oligo dt primer  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher oligo dt primer
    Oligo Dt Primer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 598 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo dt primer/product/Thermo Fisher
    Average 99 stars, based on 598 article reviews
    Price from $9.99 to $1999.99
    oligo dt primer - by Bioz Stars, 2020-02
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: c-Jun N-Terminal Kinase (JNK)-Interacting Protein-1b/Islet-Brain-1 Scaffolds Alzheimer's Amyloid Precursor Protein with JNK
    Article Snippet: Mouse brain cDNA used for RT-PCR was prepared from total RNA of ICR adult mouse, isolated using an RNeasy kit (Qiagen GmbH, Hilden, Germany) and reverse transcribed using Superscript II and an Oligo-dT primer (Life Technologies Oriental, Tokyo, Japan). pEG202-NLS polylinker portion was exchanged with the corresponding Eco RI– Xba I fragment of pEG202; then hemagglutinin (HA) epitope, encoding YPYDVPDYA, was inserted between Eco RI and Xho I using linkers SM60/SM61 (pEG202-NLS-HA). .. The coding sequences of APP, APLP1, and APLP2 and their variants were PCR amplified and cloned into pEG202 and pEG202-NLS-HA using Eco RI/ Xho I. APP fragments were amplified from mouse APP695 with the following primers: APP649–695 , SM109/SM110; APP595–695 , SM108/SM110; and APP649–680 , SM109/SM123.

    Amplification:

    Article Title: Interleukin-27 inhibition of HIV-1 involves an intermediate induction of type I interferon
    Article Snippet: For real-time (RT) polymerase chain reaction (PCR) and conventional PCR, 2 μg total RNA was reverse-transcribed using oligodeoxythymidylic acid primer (Invitrogen). .. Amplification of the resulting cDNA for RT-PCR was performed with TaqMan expression assays for IL-27 p28 (Hs00377366_m1), IL-27 EBI3 (Hs00194957_m1 and Hs01057148_m1), IL-27Rα (Hs00175472_m1), IFN1α (Hs00353738_s1), IFN-β (Hs01077958_s1), APOBEC3A (Hs00377444_m1), APOBEC3B (Hs00358981_m1), APOBEC3C (Hs00819353_m1), APOBEC3F (Hs00736570_m1), APOBEC3H (Hs00419665_m1), and APOBEC3G (Hs00222415_m1; Applied Biosystems).

    Article Title: Secretory Leukocyte Protease Inhibitor (SLPI) Expression and Tumor Invasion in Oral Squamous Cell Carcinoma
    Article Snippet: .. Total RNA (2 μg) was reverse transcribed using oligodeoxythymidylic acid primer and cDNA amplified by PCR using ABI7500 Sequence Detector (Applied Biosystems, Foster City, CA). .. Amplification was performed using Taqman expression assays for SLPI (Hs00268204_m1) and GAPDH (Hs99999905_m1).

    Article Title: P. gingivalis promotes Th17 inducing pathways in chronic periodontitis
    Article Snippet: .. Total RNA (1μg) from each sample was reverse transcribed using an oligodeoxythymidylic acid primer (Invitrogen) and the resulting cDNA amplified by real-time PCR on an ABI Prism 7500 Sequence Detector (Applied Biosystems, Foster City, CA). .. Amplification was performed with TaqMan expression assays for HPRT (Assay ID: Hs99999909_m1), β-actin (Hs99999903_m1), GAPDH (Hs99999905_m1), IL-17 (Hs00174383_m1), IFNγ (Hs00989291_m1), IL-22 (Hs01574154_m1), IL-23p19 (Hs00372324_m1), IL-1β (Hs01555410_m1), IL-6 (Hs00985639_m1), IL-23 (Hs00372324_m1), IL-12p40 (Hs00233688_m1), IL-12p35 (Hs00168405_m1), from Applied Biosystems.

    Article Title: c-Jun N-Terminal Kinase (JNK)-Interacting Protein-1b/Islet-Brain-1 Scaffolds Alzheimer's Amyloid Precursor Protein with JNK
    Article Snippet: PCR inserts were amplified by deep vent DNA polymerase (New England Biolabs, Beverly, MA) or KOD DNA polymerase (Toyobo, Osaka, Japan). .. Mouse brain cDNA used for RT-PCR was prepared from total RNA of ICR adult mouse, isolated using an RNeasy kit (Qiagen GmbH, Hilden, Germany) and reverse transcribed using Superscript II and an Oligo-dT primer (Life Technologies Oriental, Tokyo, Japan). pEG202-NLS polylinker portion was exchanged with the corresponding Eco RI– Xba I fragment of pEG202; then hemagglutinin (HA) epitope, encoding YPYDVPDYA, was inserted between Eco RI and Xho I using linkers SM60/SM61 (pEG202-NLS-HA).

    Article Title: LTP3 contributes to disease susceptibility in Arabidopsis by enhancing abscisic acid ( ABA) biosynthesis
    Article Snippet: .. The full‐length LTP3 was amplified from cDNAs synthesized from 1 μg of total RNA from 4‐week‐old Col‐0 plants using oligo(dT) primer and SuperScript reverse transcriptase II (Invitrogen, Carlsbad, CA, USA). .. The sense primer (AttB1‐LTP3) used in the amplification was 5′‐CAAAAAAGCAGGCTTAATGGCTTTCGCTTTGAGGTTCTTC‐3′, and the antisense primer (AttB2‐LTP3) was 5′‐CAAGAAAGCTGGGTCCTTGATGTTGTTGCAGTTAGTGCTCAT‐3′.

    Article Title: Transcriptome of pleuropodia from locust embryos supports that these organs produce enzymes enabling the larva to hatch
    Article Snippet: Real-time RT-PCR Tissues were dissected, total RNA was isolated and DNase treated as described for sequencing and cleaned with RNA Clean & Concentrator (Zymo Research). cDNA was prepared from 0.5 μg (legs, pleuropodia) or 1 μg (cut embryos) of the RNA using oligo-dT primer (Invitrogen) and ThermoScript RT-PCR System (Invitrogen) at 55 °C (lower amount of RNA from legs and pleuropodia, compared to the amount of RNA from whole cut embryos, was used because this RNA was in a short supply and difficult to obtain since these appendages are small and had to be dissected). .. Amplification was 40 cycles of 95 °C for 10 s, 60 °C for 15 s, 72 °C for 12 s. Primers (Additional file : Table S18) were designed using Primer3PLUS [ ].

    Article Title: Polysialylated Neural Cell Adhesion Molecule-Positive CNS Precursors Generate Both Oligodendrocytes and Schwann Cells to Remyelinate the CNS after Transplantation
    Article Snippet: After spectrophotometric quantification, 500 ng–1 μg were retro-transcribed using an oligo-dT primer and the Superscript II enzyme (Life Technologies, Gaithersburg, MD). .. To ensure that the PCR signals detected were not caused by amplification of genomic DNA, control RT-PCR experiments were performed in which cDNA was synthesized without reverse transcriptase (RT).

    Article Title: All-Trans Retinoic Acid Enhances Bacterial Flagellin-Stimulated Proinflammatory Responses in Human Monocyte THP-1 Cells by Upregulating CD14
    Article Snippet: RNA concentrations were determined with a MaestroNano Microvolume spectrophotometer (Maestrogen, Las Vegas, NV, USA). cDNA synthesis was performed by reverse transcription using Hyperscript RT master mix (GeneAll, Seoul, Korea) with an Oligo (dT) primer (Invitrogen) and 2 μ g of total RNA at 42°C for 1 h. Quantitative real-time PCR was performed on the Rotor-gene system (Qiagen) using the Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen). .. PCR amplification was performed using following primer sets: TNF-α 5′-tgagcactgaaagcatgatcc-3′, 5′-ggagaagaggctgag gaaca-3′; IL-1β 5′-gggataacgaggcttatgtgc- 3′, 5′-aggtggagagctttcagttca-3′; and β -actin 5′-caccattggcaatga gcggttc-3′, 5′-aggtctttgcggatgtccacgt-3′.

    Article Title: Structural variants of IFN? preferentially promote antiviral functions
    Article Snippet: For real-time PCR, 1 μg total RNA was reverse-transcribed using oligodeoxythymidylic acid primer (Invitrogen). .. Amplification of cDNA was performed with TaqMan expression arrays for APOBEC3A (Hs00377444_m1), APOBEC3G (Hs00222415_m1), PKR-EIF2AK2 (Hs00169345_m1), TRIM22 (Hs00232319_m1), IDO (Hs00158032_m1), TNFα (Hs00174128_m1) and GAPDH (Hs99999905_m1; Applied Biosystems).

    Synthesized:

    Article Title: Interplay of MKP-1 and Nrf2 drives tumor growth and drug resistance in non-small cell lung cancer
    Article Snippet: Real-time quantitative PCR (RT-qPCR) Total RNA was prepared using TRIzol reagent (Invitrogen) and reverse transcribed using oligo-dT primer and SuperScript II reverse transcriptase (Invitrogen) as described previously [ ]. qPCR using the validated SYBR® Green or TaqMan assays were carried out on a LightCycler® 480 instrument (Roche, Germany). .. All primers and probes were synthesized by TaKaRa Biotechnology.

    Article Title: LTP3 contributes to disease susceptibility in Arabidopsis by enhancing abscisic acid ( ABA) biosynthesis
    Article Snippet: .. The full‐length LTP3 was amplified from cDNAs synthesized from 1 μg of total RNA from 4‐week‐old Col‐0 plants using oligo(dT) primer and SuperScript reverse transcriptase II (Invitrogen, Carlsbad, CA, USA). .. The sense primer (AttB1‐LTP3) used in the amplification was 5′‐CAAAAAAGCAGGCTTAATGGCTTTCGCTTTGAGGTTCTTC‐3′, and the antisense primer (AttB2‐LTP3) was 5′‐CAAGAAAGCTGGGTCCTTGATGTTGTTGCAGTTAGTGCTCAT‐3′.

    Article Title: Selective Alteration of Long-Term Potentiation-Induced Transcriptional Response in Hippocampus of Aged, Memory-Impaired Rats
    Article Snippet: .. Poly(A+ )RNA was isolated from individual samples using micro Fastrack (Invitrogen, San Diego, CA), and nonradioactive double-stranded cDNA was synthesized using an oligo dT primer with Superscript reverse transcriptase (Life Technologies, Gaithersburg, MD) according to the manufacturer’s protocol. .. Poly(A+ )RNA was isolated from individual samples using micro Fastrack (Invitrogen, San Diego, CA), and nonradioactive double-stranded cDNA was synthesized using an oligo dT primer with Superscript reverse transcriptase (Life Technologies, Gaithersburg, MD) according to the manufacturer’s protocol.

    Article Title: Polysialylated Neural Cell Adhesion Molecule-Positive CNS Precursors Generate Both Oligodendrocytes and Schwann Cells to Remyelinate the CNS after Transplantation
    Article Snippet: After spectrophotometric quantification, 500 ng–1 μg were retro-transcribed using an oligo-dT primer and the Superscript II enzyme (Life Technologies, Gaithersburg, MD). .. To ensure that the PCR signals detected were not caused by amplification of genomic DNA, control RT-PCR experiments were performed in which cDNA was synthesized without reverse transcriptase (RT).

    Neutralization:

    Article Title: Selective Alteration of Long-Term Potentiation-Induced Transcriptional Response in Hippocampus of Aged, Memory-Impaired Rats
    Article Snippet: Several identical gels were prepared and after denaturation and neutralization were transferred to nitrocellulose. .. Poly(A+ )RNA was isolated from individual samples using micro Fastrack (Invitrogen, San Diego, CA), and nonradioactive double-stranded cDNA was synthesized using an oligo dT primer with Superscript reverse transcriptase (Life Technologies, Gaithersburg, MD) according to the manufacturer’s protocol.

    Construct:

    Article Title: c-Jun N-Terminal Kinase (JNK)-Interacting Protein-1b/Islet-Brain-1 Scaffolds Alzheimer's Amyloid Precursor Protein with JNK
    Article Snippet: The sequences of all constructs were verified by dideoxy-termination using ABI310 sequencer (PE Applied Biosystems, Foster City, CA). .. Mouse brain cDNA used for RT-PCR was prepared from total RNA of ICR adult mouse, isolated using an RNeasy kit (Qiagen GmbH, Hilden, Germany) and reverse transcribed using Superscript II and an Oligo-dT primer (Life Technologies Oriental, Tokyo, Japan). pEG202-NLS polylinker portion was exchanged with the corresponding Eco RI– Xba I fragment of pEG202; then hemagglutinin (HA) epitope, encoding YPYDVPDYA, was inserted between Eco RI and Xho I using linkers SM60/SM61 (pEG202-NLS-HA).

    Article Title: LTP3 contributes to disease susceptibility in Arabidopsis by enhancing abscisic acid ( ABA) biosynthesis
    Article Snippet: The full‐length LTP3 was amplified from cDNAs synthesized from 1 μg of total RNA from 4‐week‐old Col‐0 plants using oligo(dT) primer and SuperScript reverse transcriptase II (Invitrogen, Carlsbad, CA, USA). .. The AttB1‐LTP3‐AttB2 PCR product was recombined into the pDONR207 vector (Invitrogen) via a BP reaction to produce the pENTR‐LTP3 construct.

    Real-time Polymerase Chain Reaction:

    Article Title: TORC1 and TORC2 converge to regulate the SAGA co‐activator in response to nutrient availability
    Article Snippet: Quantitative PCR analyses of cDNA were performed using RNA extracted from 50 ml of exponentially growing cells. .. 1 μg of RNA was then reverse‐transcribed (RT) at 55°C with random hexa‐nucleotide primers or an oligo‐dT primer, using the Invitrogen SuperScript III first‐strand synthesis kit (Invitrogen).

    Article Title: Interplay of MKP-1 and Nrf2 drives tumor growth and drug resistance in non-small cell lung cancer
    Article Snippet: .. Real-time quantitative PCR (RT-qPCR) Total RNA was prepared using TRIzol reagent (Invitrogen) and reverse transcribed using oligo-dT primer and SuperScript II reverse transcriptase (Invitrogen) as described previously [ ]. qPCR using the validated SYBR® Green or TaqMan assays were carried out on a LightCycler® 480 instrument (Roche, Germany). .. All primers and probes were synthesized by TaKaRa Biotechnology.

    Article Title: P. gingivalis promotes Th17 inducing pathways in chronic periodontitis
    Article Snippet: .. Total RNA (1μg) from each sample was reverse transcribed using an oligodeoxythymidylic acid primer (Invitrogen) and the resulting cDNA amplified by real-time PCR on an ABI Prism 7500 Sequence Detector (Applied Biosystems, Foster City, CA). .. Amplification was performed with TaqMan expression assays for HPRT (Assay ID: Hs99999909_m1), β-actin (Hs99999903_m1), GAPDH (Hs99999905_m1), IL-17 (Hs00174383_m1), IFNγ (Hs00989291_m1), IL-22 (Hs01574154_m1), IL-23p19 (Hs00372324_m1), IL-1β (Hs01555410_m1), IL-6 (Hs00985639_m1), IL-23 (Hs00372324_m1), IL-12p40 (Hs00233688_m1), IL-12p35 (Hs00168405_m1), from Applied Biosystems.

    Article Title: miR-125b-5p targeting TRAF6 relieves skeletal muscle atrophy induced by fasting or denervation
    Article Snippet: The RNA sample (1 µg) was used to synthesize first strand cDNA with a reverse transcription system using an oligo (dT) primer (Applied Biosystems, Carlsbad, CA, USA) and Omniscript reverse transcription kit (QIAGEN). .. Bulge-loopTM miRNA qRT-PCR Primer Sets (one RT primer and a pair of qPCR primers for each set) specific for miR-125b-5p was designed by RiboBio (Guangzhou, China).

    Article Title: Complex sex-biased antibody responses: estrogen receptors bind estrogen response elements centered within immunoglobulin heavy chain gene enhancers
    Article Snippet: RNA was isolated from day 2 cultures using a Qiagen AllPrep DNA/RNA Mini Kit (Cat #80204), and cDNA was prepared by using 8 µg RNA pre-annealed to 2 µg Oligo dT primer (Cat #S0131; Thermo Scientific) in 40 µl total volume and reverse transcribing in the following reaction: 20 µl 5× AMV Reverse Transcriptase Buffer (Cat #M515A; Promega), 10 µl dNTP 10 mM Mix (Cat #U151A; Promega), 40 µl RNA/Oligo dT Primer, 2 µl RNAsin Plus (Cat #N261A; Promega), 2µl AMV Reverse Transcriptase (Cat #M5101; Promega) and RNAse-free Water to 100 µl total volume. .. The reaction was conducted at 42°C for 1 h and then chilled on ice. qPCR was performed as described above using 5 µl of a 1:4 dilution of the cDNA.

    Article Title: Loss of γ-Secretase Function Impairs Endocytosis of Lipoprotein Particles and Membrane Cholesterol Homeostasis
    Article Snippet: For the semiquantitative PCR from MEF cells, total RNA was obtained from WT and dKO cells using Trizol (Invitrogen) followed by cDNA synthesis using oligo(dT) primer and SuperScript II reverse transcriptase (Invitrogen). .. For quantitative real-time PCR, mouse brain hemispheres were fixed in “RNA later ” overnight at −20°C.

    Article Title: All-Trans Retinoic Acid Enhances Bacterial Flagellin-Stimulated Proinflammatory Responses in Human Monocyte THP-1 Cells by Upregulating CD14
    Article Snippet: .. RNA concentrations were determined with a MaestroNano Microvolume spectrophotometer (Maestrogen, Las Vegas, NV, USA). cDNA synthesis was performed by reverse transcription using Hyperscript RT master mix (GeneAll, Seoul, Korea) with an Oligo (dT) primer (Invitrogen) and 2 μ g of total RNA at 42°C for 1 h. Quantitative real-time PCR was performed on the Rotor-gene system (Qiagen) using the Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen). .. PCR amplification was performed using following primer sets: TNF-α 5′-tgagcactgaaagcatgatcc-3′, 5′-ggagaagaggctgag gaaca-3′; IL-1β 5′-gggataacgaggcttatgtgc- 3′, 5′-aggtggagagctttcagttca-3′; and β -actin 5′-caccattggcaatga gcggttc-3′, 5′-aggtctttgcggatgtccacgt-3′.

    Article Title: Structural variants of IFN? preferentially promote antiviral functions
    Article Snippet: .. For real-time PCR, 1 μg total RNA was reverse-transcribed using oligodeoxythymidylic acid primer (Invitrogen). .. Amplification of cDNA was performed with TaqMan expression arrays for APOBEC3A (Hs00377444_m1), APOBEC3G (Hs00222415_m1), PKR-EIF2AK2 (Hs00169345_m1), TRIM22 (Hs00232319_m1), IDO (Hs00158032_m1), TNFα (Hs00174128_m1) and GAPDH (Hs99999905_m1; Applied Biosystems).

    Incubation:

    Article Title: Selective Alteration of Long-Term Potentiation-Induced Transcriptional Response in Hippocampus of Aged, Memory-Impaired Rats
    Article Snippet: Poly(A+ )RNA was isolated from individual samples using micro Fastrack (Invitrogen, San Diego, CA), and nonradioactive double-stranded cDNA was synthesized using an oligo dT primer with Superscript reverse transcriptase (Life Technologies, Gaithersburg, MD) according to the manufacturer’s protocol. .. The final reaction mix of 20 μl was incubated at 40°C for 60 min.

    Expressing:

    Article Title: Interleukin-27 inhibition of HIV-1 involves an intermediate induction of type I interferon
    Article Snippet: For real-time (RT) polymerase chain reaction (PCR) and conventional PCR, 2 μg total RNA was reverse-transcribed using oligodeoxythymidylic acid primer (Invitrogen). .. Amplification of the resulting cDNA for RT-PCR was performed with TaqMan expression assays for IL-27 p28 (Hs00377366_m1), IL-27 EBI3 (Hs00194957_m1 and Hs01057148_m1), IL-27Rα (Hs00175472_m1), IFN1α (Hs00353738_s1), IFN-β (Hs01077958_s1), APOBEC3A (Hs00377444_m1), APOBEC3B (Hs00358981_m1), APOBEC3C (Hs00819353_m1), APOBEC3F (Hs00736570_m1), APOBEC3H (Hs00419665_m1), and APOBEC3G (Hs00222415_m1; Applied Biosystems).

    Article Title: Secretory Leukocyte Protease Inhibitor (SLPI) Expression and Tumor Invasion in Oral Squamous Cell Carcinoma
    Article Snippet: Total RNA (2 μg) was reverse transcribed using oligodeoxythymidylic acid primer and cDNA amplified by PCR using ABI7500 Sequence Detector (Applied Biosystems, Foster City, CA). .. Amplification was performed using Taqman expression assays for SLPI (Hs00268204_m1) and GAPDH (Hs99999905_m1).

    Article Title: P. gingivalis promotes Th17 inducing pathways in chronic periodontitis
    Article Snippet: Total RNA (1μg) from each sample was reverse transcribed using an oligodeoxythymidylic acid primer (Invitrogen) and the resulting cDNA amplified by real-time PCR on an ABI Prism 7500 Sequence Detector (Applied Biosystems, Foster City, CA). .. Amplification was performed with TaqMan expression assays for HPRT (Assay ID: Hs99999909_m1), β-actin (Hs99999903_m1), GAPDH (Hs99999905_m1), IL-17 (Hs00174383_m1), IFNγ (Hs00989291_m1), IL-22 (Hs01574154_m1), IL-23p19 (Hs00372324_m1), IL-1β (Hs01555410_m1), IL-6 (Hs00985639_m1), IL-23 (Hs00372324_m1), IL-12p40 (Hs00233688_m1), IL-12p35 (Hs00168405_m1), from Applied Biosystems.

    Article Title: miR-125b-5p targeting TRAF6 relieves skeletal muscle atrophy induced by fasting or denervation
    Article Snippet: The RNA sample (1 µg) was used to synthesize first strand cDNA with a reverse transcription system using an oligo (dT) primer (Applied Biosystems, Carlsbad, CA, USA) and Omniscript reverse transcription kit (QIAGEN). .. Quantitative analysis of gene expression by real-time qPCR was carried out using the CFX96 (Bio-Rad) system.

    Article Title: Polysialylated Neural Cell Adhesion Molecule-Positive CNS Precursors Generate Both Oligodendrocytes and Schwann Cells to Remyelinate the CNS after Transplantation
    Article Snippet: RT-PCR analysis of P0 and P75 expression. .. After spectrophotometric quantification, 500 ng–1 μg were retro-transcribed using an oligo-dT primer and the Superscript II enzyme (Life Technologies, Gaithersburg, MD).

    Article Title: All-Trans Retinoic Acid Enhances Bacterial Flagellin-Stimulated Proinflammatory Responses in Human Monocyte THP-1 Cells by Upregulating CD14
    Article Snippet: RNA concentrations were determined with a MaestroNano Microvolume spectrophotometer (Maestrogen, Las Vegas, NV, USA). cDNA synthesis was performed by reverse transcription using Hyperscript RT master mix (GeneAll, Seoul, Korea) with an Oligo (dT) primer (Invitrogen) and 2 μ g of total RNA at 42°C for 1 h. Quantitative real-time PCR was performed on the Rotor-gene system (Qiagen) using the Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen). .. Normalization of target gene expression levels was performed using the human β -actin gene as an endogenous control.

    Article Title: Structural variants of IFN? preferentially promote antiviral functions
    Article Snippet: For real-time PCR, 1 μg total RNA was reverse-transcribed using oligodeoxythymidylic acid primer (Invitrogen). .. Amplification of cDNA was performed with TaqMan expression arrays for APOBEC3A (Hs00377444_m1), APOBEC3G (Hs00222415_m1), PKR-EIF2AK2 (Hs00169345_m1), TRIM22 (Hs00232319_m1), IDO (Hs00158032_m1), TNFα (Hs00174128_m1) and GAPDH (Hs99999905_m1; Applied Biosystems).

    Modification:

    Article Title: Polysialylated Neural Cell Adhesion Molecule-Positive CNS Precursors Generate Both Oligodendrocytes and Schwann Cells to Remyelinate the CNS after Transplantation
    Article Snippet: RNA was extracted after 5 d of culture in modified N2 with factors. .. After spectrophotometric quantification, 500 ng–1 μg were retro-transcribed using an oligo-dT primer and the Superscript II enzyme (Life Technologies, Gaithersburg, MD).

    Cell Culture:

    Article Title: Secretory Leukocyte Protease Inhibitor (SLPI) Expression and Tumor Invasion in Oral Squamous Cell Carcinoma
    Article Snippet: Total RNA (2 μg) was reverse transcribed using oligodeoxythymidylic acid primer and cDNA amplified by PCR using ABI7500 Sequence Detector (Applied Biosystems, Foster City, CA). .. HN12, Tu1386, and NHEK cells (2.0 × 105 ) were cultured overnight in the presence or absence of SLPI, and the total RNA was extracted with RNeasy mini kit (Qiagen) in parallel with normal buccal mucosa RNA.

    Polymerase Chain Reaction:

    Article Title: Interleukin-27 inhibition of HIV-1 involves an intermediate induction of type I interferon
    Article Snippet: .. For real-time (RT) polymerase chain reaction (PCR) and conventional PCR, 2 μg total RNA was reverse-transcribed using oligodeoxythymidylic acid primer (Invitrogen). .. Amplification of the resulting cDNA for RT-PCR was performed with TaqMan expression assays for IL-27 p28 (Hs00377366_m1), IL-27 EBI3 (Hs00194957_m1 and Hs01057148_m1), IL-27Rα (Hs00175472_m1), IFN1α (Hs00353738_s1), IFN-β (Hs01077958_s1), APOBEC3A (Hs00377444_m1), APOBEC3B (Hs00358981_m1), APOBEC3C (Hs00819353_m1), APOBEC3F (Hs00736570_m1), APOBEC3H (Hs00419665_m1), and APOBEC3G (Hs00222415_m1; Applied Biosystems).

    Article Title: Secretory Leukocyte Protease Inhibitor (SLPI) Expression and Tumor Invasion in Oral Squamous Cell Carcinoma
    Article Snippet: .. Total RNA (2 μg) was reverse transcribed using oligodeoxythymidylic acid primer and cDNA amplified by PCR using ABI7500 Sequence Detector (Applied Biosystems, Foster City, CA). .. Amplification was performed using Taqman expression assays for SLPI (Hs00268204_m1) and GAPDH (Hs99999905_m1).

    Article Title: c-Jun N-Terminal Kinase (JNK)-Interacting Protein-1b/Islet-Brain-1 Scaffolds Alzheimer's Amyloid Precursor Protein with JNK
    Article Snippet: PCR inserts were amplified by deep vent DNA polymerase (New England Biolabs, Beverly, MA) or KOD DNA polymerase (Toyobo, Osaka, Japan). .. Mouse brain cDNA used for RT-PCR was prepared from total RNA of ICR adult mouse, isolated using an RNeasy kit (Qiagen GmbH, Hilden, Germany) and reverse transcribed using Superscript II and an Oligo-dT primer (Life Technologies Oriental, Tokyo, Japan). pEG202-NLS polylinker portion was exchanged with the corresponding Eco RI– Xba I fragment of pEG202; then hemagglutinin (HA) epitope, encoding YPYDVPDYA, was inserted between Eco RI and Xho I using linkers SM60/SM61 (pEG202-NLS-HA).

    Article Title: LTP3 contributes to disease susceptibility in Arabidopsis by enhancing abscisic acid ( ABA) biosynthesis
    Article Snippet: The full‐length LTP3 was amplified from cDNAs synthesized from 1 μg of total RNA from 4‐week‐old Col‐0 plants using oligo(dT) primer and SuperScript reverse transcriptase II (Invitrogen, Carlsbad, CA, USA). .. The AttB1‐LTP3‐AttB2 PCR product was recombined into the pDONR207 vector (Invitrogen) via a BP reaction to produce the pENTR‐LTP3 construct.

    Article Title: Transcriptome of pleuropodia from locust embryos supports that these organs produce enzymes enabling the larva to hatch
    Article Snippet: Real-time RT-PCR Tissues were dissected, total RNA was isolated and DNase treated as described for sequencing and cleaned with RNA Clean & Concentrator (Zymo Research). cDNA was prepared from 0.5 μg (legs, pleuropodia) or 1 μg (cut embryos) of the RNA using oligo-dT primer (Invitrogen) and ThermoScript RT-PCR System (Invitrogen) at 55 °C (lower amount of RNA from legs and pleuropodia, compared to the amount of RNA from whole cut embryos, was used because this RNA was in a short supply and difficult to obtain since these appendages are small and had to be dissected). .. PCR reactions (20 μl) contained 5 μl of cDNA diluted to 40 ng/μl, 10 μl of SYBR Green PCR Master Mix (Applied Biosystems) and 5 μl of a 1:1 mix of forward and reverse primers (each 20 nM in this mix).

    Article Title: Polysialylated Neural Cell Adhesion Molecule-Positive CNS Precursors Generate Both Oligodendrocytes and Schwann Cells to Remyelinate the CNS after Transplantation
    Article Snippet: After spectrophotometric quantification, 500 ng–1 μg were retro-transcribed using an oligo-dT primer and the Superscript II enzyme (Life Technologies, Gaithersburg, MD). .. A 50 μl PCR reaction was performed using 2 μl of the reverse transcription reaction as template.

    Article Title: Loss of γ-Secretase Function Impairs Endocytosis of Lipoprotein Particles and Membrane Cholesterol Homeostasis
    Article Snippet: .. For the semiquantitative PCR from MEF cells, total RNA was obtained from WT and dKO cells using Trizol (Invitrogen) followed by cDNA synthesis using oligo(dT) primer and SuperScript II reverse transcriptase (Invitrogen). .. PCR (18 cycles) was performed for the respective cDNAs using the following primer pairs: β-actin: 5′-TGCGTGACATCAAAGAGAAG-3′ and 5′-GCTCATAGCTCTTCTCCAGG-3′; lanosterol synthase: 5′-AGGAAGCAGAGAGCCGATG-3′ and 5′-TGATCCCTCTCTCCTGAGC-3′; CYP51: 5′-CTGGACAGCACACATCCTC-3′ and 5′-CACACACCTGATGTCCTGG-3′; seladin-1: 5′-GAGACACTACTACCACCGAC-3′ and 5′-TGTCCACGTAGAGCTCTGC-3′.

    Article Title: All-Trans Retinoic Acid Enhances Bacterial Flagellin-Stimulated Proinflammatory Responses in Human Monocyte THP-1 Cells by Upregulating CD14
    Article Snippet: Paragraph title: 2.3. Quantitative Real-Time Polymerase Chain Reaction (PCR) ... RNA concentrations were determined with a MaestroNano Microvolume spectrophotometer (Maestrogen, Las Vegas, NV, USA). cDNA synthesis was performed by reverse transcription using Hyperscript RT master mix (GeneAll, Seoul, Korea) with an Oligo (dT) primer (Invitrogen) and 2 μ g of total RNA at 42°C for 1 h. Quantitative real-time PCR was performed on the Rotor-gene system (Qiagen) using the Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen).

    Article Title: Structural variants of IFN? preferentially promote antiviral functions
    Article Snippet: For real-time PCR, 1 μg total RNA was reverse-transcribed using oligodeoxythymidylic acid primer (Invitrogen). .. Data were analyzed using the 2−ddCT method and results reported as fold change or by conventional PCR with primers for TNFα 5′-TGAGCACTGAAAGCATGATCCG-3′(forward) and 5′ AGAGGGCTGATTAGAGAGAGGTCC-3′(reverse).

    Sequencing:

    Article Title: Secretory Leukocyte Protease Inhibitor (SLPI) Expression and Tumor Invasion in Oral Squamous Cell Carcinoma
    Article Snippet: .. Total RNA (2 μg) was reverse transcribed using oligodeoxythymidylic acid primer and cDNA amplified by PCR using ABI7500 Sequence Detector (Applied Biosystems, Foster City, CA). .. Amplification was performed using Taqman expression assays for SLPI (Hs00268204_m1) and GAPDH (Hs99999905_m1).

    Article Title: P. gingivalis promotes Th17 inducing pathways in chronic periodontitis
    Article Snippet: .. Total RNA (1μg) from each sample was reverse transcribed using an oligodeoxythymidylic acid primer (Invitrogen) and the resulting cDNA amplified by real-time PCR on an ABI Prism 7500 Sequence Detector (Applied Biosystems, Foster City, CA). .. Amplification was performed with TaqMan expression assays for HPRT (Assay ID: Hs99999909_m1), β-actin (Hs99999903_m1), GAPDH (Hs99999905_m1), IL-17 (Hs00174383_m1), IFNγ (Hs00989291_m1), IL-22 (Hs01574154_m1), IL-23p19 (Hs00372324_m1), IL-1β (Hs01555410_m1), IL-6 (Hs00985639_m1), IL-23 (Hs00372324_m1), IL-12p40 (Hs00233688_m1), IL-12p35 (Hs00168405_m1), from Applied Biosystems.

    Article Title: Transcriptome of pleuropodia from locust embryos supports that these organs produce enzymes enabling the larva to hatch
    Article Snippet: .. Real-time RT-PCR Tissues were dissected, total RNA was isolated and DNase treated as described for sequencing and cleaned with RNA Clean & Concentrator (Zymo Research). cDNA was prepared from 0.5 μg (legs, pleuropodia) or 1 μg (cut embryos) of the RNA using oligo-dT primer (Invitrogen) and ThermoScript RT-PCR System (Invitrogen) at 55 °C (lower amount of RNA from legs and pleuropodia, compared to the amount of RNA from whole cut embryos, was used because this RNA was in a short supply and difficult to obtain since these appendages are small and had to be dissected). .. PCR reactions (20 μl) contained 5 μl of cDNA diluted to 40 ng/μl, 10 μl of SYBR Green PCR Master Mix (Applied Biosystems) and 5 μl of a 1:1 mix of forward and reverse primers (each 20 nM in this mix).

    Fluorescence:

    Article Title: TORC1 and TORC2 converge to regulate the SAGA co‐activator in response to nutrient availability
    Article Snippet: 1 μg of RNA was then reverse‐transcribed (RT) at 55°C with random hexa‐nucleotide primers or an oligo‐dT primer, using the Invitrogen SuperScript III first‐strand synthesis kit (Invitrogen). .. Fluorescence‐based quantitative PCR was performed with SYBR Green, using Stratagene Mx3005P systems.

    Isolation:

    Article Title: Interleukin-27 inhibition of HIV-1 involves an intermediate induction of type I interferon
    Article Snippet: Paragraph title: RNA isolation and polymerase chain reaction ... For real-time (RT) polymerase chain reaction (PCR) and conventional PCR, 2 μg total RNA was reverse-transcribed using oligodeoxythymidylic acid primer (Invitrogen).

    Article Title: P. gingivalis promotes Th17 inducing pathways in chronic periodontitis
    Article Snippet: Paragraph title: RNA isolation and Real-Time PCR ... Total RNA (1μg) from each sample was reverse transcribed using an oligodeoxythymidylic acid primer (Invitrogen) and the resulting cDNA amplified by real-time PCR on an ABI Prism 7500 Sequence Detector (Applied Biosystems, Foster City, CA).

    Article Title: c-Jun N-Terminal Kinase (JNK)-Interacting Protein-1b/Islet-Brain-1 Scaffolds Alzheimer's Amyloid Precursor Protein with JNK
    Article Snippet: .. Mouse brain cDNA used for RT-PCR was prepared from total RNA of ICR adult mouse, isolated using an RNeasy kit (Qiagen GmbH, Hilden, Germany) and reverse transcribed using Superscript II and an Oligo-dT primer (Life Technologies Oriental, Tokyo, Japan). pEG202-NLS polylinker portion was exchanged with the corresponding Eco RI– Xba I fragment of pEG202; then hemagglutinin (HA) epitope, encoding YPYDVPDYA, was inserted between Eco RI and Xho I using linkers SM60/SM61 (pEG202-NLS-HA). .. The coding sequences of APP, APLP1, and APLP2 and their variants were PCR amplified and cloned into pEG202 and pEG202-NLS-HA using Eco RI/ Xho I. APP fragments were amplified from mouse APP695 with the following primers: APP649–695 , SM109/SM110; APP595–695 , SM108/SM110; and APP649–680 , SM109/SM123.

    Article Title: miR-125b-5p targeting TRAF6 relieves skeletal muscle atrophy induced by fasting or denervation
    Article Snippet: Paragraph title: RNA isolation and RT-qPCR ... The RNA sample (1 µg) was used to synthesize first strand cDNA with a reverse transcription system using an oligo (dT) primer (Applied Biosystems, Carlsbad, CA, USA) and Omniscript reverse transcription kit (QIAGEN).

    Article Title: Transcriptome of pleuropodia from locust embryos supports that these organs produce enzymes enabling the larva to hatch
    Article Snippet: .. Real-time RT-PCR Tissues were dissected, total RNA was isolated and DNase treated as described for sequencing and cleaned with RNA Clean & Concentrator (Zymo Research). cDNA was prepared from 0.5 μg (legs, pleuropodia) or 1 μg (cut embryos) of the RNA using oligo-dT primer (Invitrogen) and ThermoScript RT-PCR System (Invitrogen) at 55 °C (lower amount of RNA from legs and pleuropodia, compared to the amount of RNA from whole cut embryos, was used because this RNA was in a short supply and difficult to obtain since these appendages are small and had to be dissected). .. PCR reactions (20 μl) contained 5 μl of cDNA diluted to 40 ng/μl, 10 μl of SYBR Green PCR Master Mix (Applied Biosystems) and 5 μl of a 1:1 mix of forward and reverse primers (each 20 nM in this mix).

    Article Title: Selective Alteration of Long-Term Potentiation-Induced Transcriptional Response in Hippocampus of Aged, Memory-Impaired Rats
    Article Snippet: .. Poly(A+ )RNA was isolated from individual samples using micro Fastrack (Invitrogen, San Diego, CA), and nonradioactive double-stranded cDNA was synthesized using an oligo dT primer with Superscript reverse transcriptase (Life Technologies, Gaithersburg, MD) according to the manufacturer’s protocol. .. Poly(A+ )RNA was isolated from individual samples using micro Fastrack (Invitrogen, San Diego, CA), and nonradioactive double-stranded cDNA was synthesized using an oligo dT primer with Superscript reverse transcriptase (Life Technologies, Gaithersburg, MD) according to the manufacturer’s protocol.

    Article Title: Complex sex-biased antibody responses: estrogen receptors bind estrogen response elements centered within immunoglobulin heavy chain gene enhancers
    Article Snippet: .. RNA was isolated from day 2 cultures using a Qiagen AllPrep DNA/RNA Mini Kit (Cat #80204), and cDNA was prepared by using 8 µg RNA pre-annealed to 2 µg Oligo dT primer (Cat #S0131; Thermo Scientific) in 40 µl total volume and reverse transcribing in the following reaction: 20 µl 5× AMV Reverse Transcriptase Buffer (Cat #M515A; Promega), 10 µl dNTP 10 mM Mix (Cat #U151A; Promega), 40 µl RNA/Oligo dT Primer, 2 µl RNAsin Plus (Cat #N261A; Promega), 2µl AMV Reverse Transcriptase (Cat #M5101; Promega) and RNAse-free Water to 100 µl total volume. .. The reaction was conducted at 42°C for 1 h and then chilled on ice. qPCR was performed as described above using 5 µl of a 1:4 dilution of the cDNA.

    Article Title: Structural variants of IFN? preferentially promote antiviral functions
    Article Snippet: Paragraph title: RNA isolation and real time PCR ... For real-time PCR, 1 μg total RNA was reverse-transcribed using oligodeoxythymidylic acid primer (Invitrogen).

    Size-exclusion Chromatography:

    Article Title: Selective Alteration of Long-Term Potentiation-Induced Transcriptional Response in Hippocampus of Aged, Memory-Impaired Rats
    Article Snippet: MECS produces a tonic seizure with extension of the hindlimbs that lasts for ∼15 sec and is followed by recovery of consciousness within ∼1–2 min. .. Poly(A+ )RNA was isolated from individual samples using micro Fastrack (Invitrogen, San Diego, CA), and nonradioactive double-stranded cDNA was synthesized using an oligo dT primer with Superscript reverse transcriptase (Life Technologies, Gaithersburg, MD) according to the manufacturer’s protocol.

    Purification:

    Article Title: TORC1 and TORC2 converge to regulate the SAGA co‐activator in response to nutrient availability
    Article Snippet: Total RNA was purified using hot, acidic phenol, and contaminating DNA was removed by DNase I digestion, using the TURBO DNA‐free™ kit (Ambion). .. 1 μg of RNA was then reverse‐transcribed (RT) at 55°C with random hexa‐nucleotide primers or an oligo‐dT primer, using the Invitrogen SuperScript III first‐strand synthesis kit (Invitrogen).

    Article Title: Polysialylated Neural Cell Adhesion Molecule-Positive CNS Precursors Generate Both Oligodendrocytes and Schwann Cells to Remyelinate the CNS after Transplantation
    Article Snippet: Total RNAs were extracted from PSA-NCAM cell clusters, purified Schwann cells, or PSA-NCAM cell clusters mixed with various amounts of Schwann cells using the RNeasy mini kit from Qiagen (Hilden, Germany) following the recommendations of the manufacturer. .. After spectrophotometric quantification, 500 ng–1 μg were retro-transcribed using an oligo-dT primer and the Superscript II enzyme (Life Technologies, Gaithersburg, MD).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Interleukin-27 inhibition of HIV-1 involves an intermediate induction of type I interferon
    Article Snippet: For real-time (RT) polymerase chain reaction (PCR) and conventional PCR, 2 μg total RNA was reverse-transcribed using oligodeoxythymidylic acid primer (Invitrogen). .. Amplification of the resulting cDNA for RT-PCR was performed with TaqMan expression assays for IL-27 p28 (Hs00377366_m1), IL-27 EBI3 (Hs00194957_m1 and Hs01057148_m1), IL-27Rα (Hs00175472_m1), IFN1α (Hs00353738_s1), IFN-β (Hs01077958_s1), APOBEC3A (Hs00377444_m1), APOBEC3B (Hs00358981_m1), APOBEC3C (Hs00819353_m1), APOBEC3F (Hs00736570_m1), APOBEC3H (Hs00419665_m1), and APOBEC3G (Hs00222415_m1; Applied Biosystems).

    Article Title: c-Jun N-Terminal Kinase (JNK)-Interacting Protein-1b/Islet-Brain-1 Scaffolds Alzheimer's Amyloid Precursor Protein with JNK
    Article Snippet: .. Mouse brain cDNA used for RT-PCR was prepared from total RNA of ICR adult mouse, isolated using an RNeasy kit (Qiagen GmbH, Hilden, Germany) and reverse transcribed using Superscript II and an Oligo-dT primer (Life Technologies Oriental, Tokyo, Japan). pEG202-NLS polylinker portion was exchanged with the corresponding Eco RI– Xba I fragment of pEG202; then hemagglutinin (HA) epitope, encoding YPYDVPDYA, was inserted between Eco RI and Xho I using linkers SM60/SM61 (pEG202-NLS-HA). .. The coding sequences of APP, APLP1, and APLP2 and their variants were PCR amplified and cloned into pEG202 and pEG202-NLS-HA using Eco RI/ Xho I. APP fragments were amplified from mouse APP695 with the following primers: APP649–695 , SM109/SM110; APP595–695 , SM108/SM110; and APP649–680 , SM109/SM123.

    Article Title: Transcriptome of pleuropodia from locust embryos supports that these organs produce enzymes enabling the larva to hatch
    Article Snippet: .. Real-time RT-PCR Tissues were dissected, total RNA was isolated and DNase treated as described for sequencing and cleaned with RNA Clean & Concentrator (Zymo Research). cDNA was prepared from 0.5 μg (legs, pleuropodia) or 1 μg (cut embryos) of the RNA using oligo-dT primer (Invitrogen) and ThermoScript RT-PCR System (Invitrogen) at 55 °C (lower amount of RNA from legs and pleuropodia, compared to the amount of RNA from whole cut embryos, was used because this RNA was in a short supply and difficult to obtain since these appendages are small and had to be dissected). .. PCR reactions (20 μl) contained 5 μl of cDNA diluted to 40 ng/μl, 10 μl of SYBR Green PCR Master Mix (Applied Biosystems) and 5 μl of a 1:1 mix of forward and reverse primers (each 20 nM in this mix).

    Article Title: Polysialylated Neural Cell Adhesion Molecule-Positive CNS Precursors Generate Both Oligodendrocytes and Schwann Cells to Remyelinate the CNS after Transplantation
    Article Snippet: RT-PCR analysis of P0 and P75 expression. .. After spectrophotometric quantification, 500 ng–1 μg were retro-transcribed using an oligo-dT primer and the Superscript II enzyme (Life Technologies, Gaithersburg, MD).

    Article Title: Loss of γ-Secretase Function Impairs Endocytosis of Lipoprotein Particles and Membrane Cholesterol Homeostasis
    Article Snippet: Paragraph title: Reverse transcription (RT) PCR. ... For the semiquantitative PCR from MEF cells, total RNA was obtained from WT and dKO cells using Trizol (Invitrogen) followed by cDNA synthesis using oligo(dT) primer and SuperScript II reverse transcriptase (Invitrogen).

    Quantitative RT-PCR:

    Article Title: TORC1 and TORC2 converge to regulate the SAGA co‐activator in response to nutrient availability
    Article Snippet: Paragraph title: RT–qPCR analysis ... 1 μg of RNA was then reverse‐transcribed (RT) at 55°C with random hexa‐nucleotide primers or an oligo‐dT primer, using the Invitrogen SuperScript III first‐strand synthesis kit (Invitrogen).

    Article Title: Interplay of MKP-1 and Nrf2 drives tumor growth and drug resistance in non-small cell lung cancer
    Article Snippet: .. Real-time quantitative PCR (RT-qPCR) Total RNA was prepared using TRIzol reagent (Invitrogen) and reverse transcribed using oligo-dT primer and SuperScript II reverse transcriptase (Invitrogen) as described previously [ ]. qPCR using the validated SYBR® Green or TaqMan assays were carried out on a LightCycler® 480 instrument (Roche, Germany). .. All primers and probes were synthesized by TaKaRa Biotechnology.

    Article Title: miR-125b-5p targeting TRAF6 relieves skeletal muscle atrophy induced by fasting or denervation
    Article Snippet: Paragraph title: RNA isolation and RT-qPCR ... The RNA sample (1 µg) was used to synthesize first strand cDNA with a reverse transcription system using an oligo (dT) primer (Applied Biosystems, Carlsbad, CA, USA) and Omniscript reverse transcription kit (QIAGEN).

    Article Title: Transcriptome of pleuropodia from locust embryos supports that these organs produce enzymes enabling the larva to hatch
    Article Snippet: .. Real-time RT-PCR Tissues were dissected, total RNA was isolated and DNase treated as described for sequencing and cleaned with RNA Clean & Concentrator (Zymo Research). cDNA was prepared from 0.5 μg (legs, pleuropodia) or 1 μg (cut embryos) of the RNA using oligo-dT primer (Invitrogen) and ThermoScript RT-PCR System (Invitrogen) at 55 °C (lower amount of RNA from legs and pleuropodia, compared to the amount of RNA from whole cut embryos, was used because this RNA was in a short supply and difficult to obtain since these appendages are small and had to be dissected). .. PCR reactions (20 μl) contained 5 μl of cDNA diluted to 40 ng/μl, 10 μl of SYBR Green PCR Master Mix (Applied Biosystems) and 5 μl of a 1:1 mix of forward and reverse primers (each 20 nM in this mix).

    Plasmid Preparation:

    Article Title: c-Jun N-Terminal Kinase (JNK)-Interacting Protein-1b/Islet-Brain-1 Scaffolds Alzheimer's Amyloid Precursor Protein with JNK
    Article Snippet: Plasmid construction . .. Mouse brain cDNA used for RT-PCR was prepared from total RNA of ICR adult mouse, isolated using an RNeasy kit (Qiagen GmbH, Hilden, Germany) and reverse transcribed using Superscript II and an Oligo-dT primer (Life Technologies Oriental, Tokyo, Japan). pEG202-NLS polylinker portion was exchanged with the corresponding Eco RI– Xba I fragment of pEG202; then hemagglutinin (HA) epitope, encoding YPYDVPDYA, was inserted between Eco RI and Xho I using linkers SM60/SM61 (pEG202-NLS-HA).

    Article Title: LTP3 contributes to disease susceptibility in Arabidopsis by enhancing abscisic acid ( ABA) biosynthesis
    Article Snippet: The full‐length LTP3 was amplified from cDNAs synthesized from 1 μg of total RNA from 4‐week‐old Col‐0 plants using oligo(dT) primer and SuperScript reverse transcriptase II (Invitrogen, Carlsbad, CA, USA). .. The AttB1‐LTP3‐AttB2 PCR product was recombined into the pDONR207 vector (Invitrogen) via a BP reaction to produce the pENTR‐LTP3 construct.

    Article Title: Selective Alteration of Long-Term Potentiation-Induced Transcriptional Response in Hippocampus of Aged, Memory-Impaired Rats
    Article Snippet: Plasmids containing the indicated cDNAs were linearized with the appropriate restriction enzymes, and 1 μg of each plasmid was loaded per lane and electrophoresed in 1% agarose gels. .. Poly(A+ )RNA was isolated from individual samples using micro Fastrack (Invitrogen, San Diego, CA), and nonradioactive double-stranded cDNA was synthesized using an oligo dT primer with Superscript reverse transcriptase (Life Technologies, Gaithersburg, MD) according to the manufacturer’s protocol.

    Software:

    Article Title: TORC1 and TORC2 converge to regulate the SAGA co‐activator in response to nutrient availability
    Article Snippet: 1 μg of RNA was then reverse‐transcribed (RT) at 55°C with random hexa‐nucleotide primers or an oligo‐dT primer, using the Invitrogen SuperScript III first‐strand synthesis kit (Invitrogen). .. Relative cDNA quantities were calculated using the Stratagene MxPro software, from the slope produced by standard curves.

    Article Title: Transcriptome of pleuropodia from locust embryos supports that these organs produce enzymes enabling the larva to hatch
    Article Snippet: Real-time RT-PCR Tissues were dissected, total RNA was isolated and DNase treated as described for sequencing and cleaned with RNA Clean & Concentrator (Zymo Research). cDNA was prepared from 0.5 μg (legs, pleuropodia) or 1 μg (cut embryos) of the RNA using oligo-dT primer (Invitrogen) and ThermoScript RT-PCR System (Invitrogen) at 55 °C (lower amount of RNA from legs and pleuropodia, compared to the amount of RNA from whole cut embryos, was used because this RNA was in a short supply and difficult to obtain since these appendages are small and had to be dissected). .. Reactions were run in the LightCycler480 (Roche) and analyzed using associated software (release 1.5.0 SP1) according to comparative Ct method and normalized to the eEF1α gene.

    SYBR Green Assay:

    Article Title: TORC1 and TORC2 converge to regulate the SAGA co‐activator in response to nutrient availability
    Article Snippet: 1 μg of RNA was then reverse‐transcribed (RT) at 55°C with random hexa‐nucleotide primers or an oligo‐dT primer, using the Invitrogen SuperScript III first‐strand synthesis kit (Invitrogen). .. Fluorescence‐based quantitative PCR was performed with SYBR Green, using Stratagene Mx3005P systems.

    Article Title: Interplay of MKP-1 and Nrf2 drives tumor growth and drug resistance in non-small cell lung cancer
    Article Snippet: .. Real-time quantitative PCR (RT-qPCR) Total RNA was prepared using TRIzol reagent (Invitrogen) and reverse transcribed using oligo-dT primer and SuperScript II reverse transcriptase (Invitrogen) as described previously [ ]. qPCR using the validated SYBR® Green or TaqMan assays were carried out on a LightCycler® 480 instrument (Roche, Germany). .. All primers and probes were synthesized by TaKaRa Biotechnology.

    Article Title: miR-125b-5p targeting TRAF6 relieves skeletal muscle atrophy induced by fasting or denervation
    Article Snippet: The RNA sample (1 µg) was used to synthesize first strand cDNA with a reverse transcription system using an oligo (dT) primer (Applied Biosystems, Carlsbad, CA, USA) and Omniscript reverse transcription kit (QIAGEN). .. Each real-time PCR (10 µL) contained 1 µL of cDNA, 5 µL of SYBR Green qPCR Master mix (QIAGEN) with forward and reverse primers at a final concentration of 10 µM.

    Article Title: Transcriptome of pleuropodia from locust embryos supports that these organs produce enzymes enabling the larva to hatch
    Article Snippet: Real-time RT-PCR Tissues were dissected, total RNA was isolated and DNase treated as described for sequencing and cleaned with RNA Clean & Concentrator (Zymo Research). cDNA was prepared from 0.5 μg (legs, pleuropodia) or 1 μg (cut embryos) of the RNA using oligo-dT primer (Invitrogen) and ThermoScript RT-PCR System (Invitrogen) at 55 °C (lower amount of RNA from legs and pleuropodia, compared to the amount of RNA from whole cut embryos, was used because this RNA was in a short supply and difficult to obtain since these appendages are small and had to be dissected). .. PCR reactions (20 μl) contained 5 μl of cDNA diluted to 40 ng/μl, 10 μl of SYBR Green PCR Master Mix (Applied Biosystems) and 5 μl of a 1:1 mix of forward and reverse primers (each 20 nM in this mix).

    Article Title: All-Trans Retinoic Acid Enhances Bacterial Flagellin-Stimulated Proinflammatory Responses in Human Monocyte THP-1 Cells by Upregulating CD14
    Article Snippet: .. RNA concentrations were determined with a MaestroNano Microvolume spectrophotometer (Maestrogen, Las Vegas, NV, USA). cDNA synthesis was performed by reverse transcription using Hyperscript RT master mix (GeneAll, Seoul, Korea) with an Oligo (dT) primer (Invitrogen) and 2 μ g of total RNA at 42°C for 1 h. Quantitative real-time PCR was performed on the Rotor-gene system (Qiagen) using the Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen). .. PCR amplification was performed using following primer sets: TNF-α 5′-tgagcactgaaagcatgatcc-3′, 5′-ggagaagaggctgag gaaca-3′; IL-1β 5′-gggataacgaggcttatgtgc- 3′, 5′-aggtggagagctttcagttca-3′; and β -actin 5′-caccattggcaatga gcggttc-3′, 5′-aggtctttgcggatgtccacgt-3′.

    RNA Extraction:

    Article Title: Polysialylated Neural Cell Adhesion Molecule-Positive CNS Precursors Generate Both Oligodendrocytes and Schwann Cells to Remyelinate the CNS after Transplantation
    Article Snippet: At that time, 0, 10, 50, 100, and 1000 purified Schwann cells were added to cluster cultures, which were then grown for a further 5 d in DMEM-N2 with 10 ng/ml FGF2 before RNA extraction (see below). .. After spectrophotometric quantification, 500 ng–1 μg were retro-transcribed using an oligo-dT primer and the Superscript II enzyme (Life Technologies, Gaithersburg, MD).

    Article Title: All-Trans Retinoic Acid Enhances Bacterial Flagellin-Stimulated Proinflammatory Responses in Human Monocyte THP-1 Cells by Upregulating CD14
    Article Snippet: Quantitative Real-Time Polymerase Chain Reaction (PCR) Cells were treated with 1 μ M ATRA or DMSO for 24 h and then stimulated with flagellin from S. typhimurium for 4 h. Total RNA extraction was performed using a Qiagen RNAeasy mini kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. .. RNA concentrations were determined with a MaestroNano Microvolume spectrophotometer (Maestrogen, Las Vegas, NV, USA). cDNA synthesis was performed by reverse transcription using Hyperscript RT master mix (GeneAll, Seoul, Korea) with an Oligo (dT) primer (Invitrogen) and 2 μ g of total RNA at 42°C for 1 h. Quantitative real-time PCR was performed on the Rotor-gene system (Qiagen) using the Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen).

    Two Hybrid Screening:

    Article Title: c-Jun N-Terminal Kinase (JNK)-Interacting Protein-1b/Islet-Brain-1 Scaffolds Alzheimer's Amyloid Precursor Protein with JNK
    Article Snippet: Mouse brain cDNA used for RT-PCR was prepared from total RNA of ICR adult mouse, isolated using an RNeasy kit (Qiagen GmbH, Hilden, Germany) and reverse transcribed using Superscript II and an Oligo-dT primer (Life Technologies Oriental, Tokyo, Japan). pEG202-NLS polylinker portion was exchanged with the corresponding Eco RI– Xba I fragment of pEG202; then hemagglutinin (HA) epitope, encoding YPYDVPDYA, was inserted between Eco RI and Xho I using linkers SM60/SM61 (pEG202-NLS-HA). .. The cytoplasmic domain of APLP1 (APLP1607–653 ) was amplified with PCR from APLP1 plasmid obtained in another two-hybrid screening using SM74.

    Transgenic Assay:

    Article Title: LTP3 contributes to disease susceptibility in Arabidopsis by enhancing abscisic acid ( ABA) biosynthesis
    Article Snippet: Paragraph title: Generation of transgenic plants overexpressing LTP3 and of LTP3 ‐OX 69/ aao3 double mutants ... The full‐length LTP3 was amplified from cDNAs synthesized from 1 μg of total RNA from 4‐week‐old Col‐0 plants using oligo(dT) primer and SuperScript reverse transcriptase II (Invitrogen, Carlsbad, CA, USA).

    Spectrophotometry:

    Article Title: All-Trans Retinoic Acid Enhances Bacterial Flagellin-Stimulated Proinflammatory Responses in Human Monocyte THP-1 Cells by Upregulating CD14
    Article Snippet: .. RNA concentrations were determined with a MaestroNano Microvolume spectrophotometer (Maestrogen, Las Vegas, NV, USA). cDNA synthesis was performed by reverse transcription using Hyperscript RT master mix (GeneAll, Seoul, Korea) with an Oligo (dT) primer (Invitrogen) and 2 μ g of total RNA at 42°C for 1 h. Quantitative real-time PCR was performed on the Rotor-gene system (Qiagen) using the Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen). .. PCR amplification was performed using following primer sets: TNF-α 5′-tgagcactgaaagcatgatcc-3′, 5′-ggagaagaggctgag gaaca-3′; IL-1β 5′-gggataacgaggcttatgtgc- 3′, 5′-aggtggagagctttcagttca-3′; and β -actin 5′-caccattggcaatga gcggttc-3′, 5′-aggtctttgcggatgtccacgt-3′.

    Produced:

    Article Title: TORC1 and TORC2 converge to regulate the SAGA co‐activator in response to nutrient availability
    Article Snippet: 1 μg of RNA was then reverse‐transcribed (RT) at 55°C with random hexa‐nucleotide primers or an oligo‐dT primer, using the Invitrogen SuperScript III first‐strand synthesis kit (Invitrogen). .. Relative cDNA quantities were calculated using the Stratagene MxPro software, from the slope produced by standard curves.

    Concentration Assay:

    Article Title: miR-125b-5p targeting TRAF6 relieves skeletal muscle atrophy induced by fasting or denervation
    Article Snippet: The RNA sample (1 µg) was used to synthesize first strand cDNA with a reverse transcription system using an oligo (dT) primer (Applied Biosystems, Carlsbad, CA, USA) and Omniscript reverse transcription kit (QIAGEN). .. Each real-time PCR (10 µL) contained 1 µL of cDNA, 5 µL of SYBR Green qPCR Master mix (QIAGEN) with forward and reverse primers at a final concentration of 10 µM.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher oligos
    iFISH implementation. a Scheme of iFISH4U. Pre-designed genome-wide databases of <t>oligos</t> (left) are used as input by the iFISH4U web interface (center) to select oligos within one or more user-specified genomic regions, based on the indicated features. Features 1–3 are used while designing single probes, whereas all the four features are used to design multiple probes on the same chromosome. The black dashed boxes indicate examples of probes within the same region of interest, with the same number of oligos (vertical bars), but suboptimal size (1), homogeneity (2), or centrality (3), whereas the orange box represents the probe of choice having optimal size, homogeneity and centrality. b Cumulative distribution of the distances between consecutive oligos in the human 40-mers database. c Median standard deviation (s.d.) of the distance between consecutive oligos, inside non-overlapping genomic windows of the indicated size, in the 40-mers database and OligoMiner (OM) hg19 databases. OMB, OM ‘Balance’. OMC, OM ‘Coverage’. OMS, OM ‘Stringent’. d Percentage of non-overlapping genomic windows of the indicated size, containing at least 96 oligos, in the 40-mers database and OM hg19 databases. e Scheme of oligos in iFISH probes. Each probe consists of n oligos differing in the T sequence. f Location of the 330 iFISH probes targeting all the human autosomes and chrX. Red dots, individually tested probes (see Fig 2a, b ). g Scheme of the pipeline used to produce iFISH probes. (1) Up to 12,000 oligos, corresponding to a maximum of 125 probes each containing 96 oligos, are synthesized on an array and then pooled together. (2) The oligo-pool is dispensed into n 96-well plates, depending on the total number of probes ( p ) and colors per probe ( c ). (3) In each well, the oligos corresponding to the same probe are selectively amplified using a probe-specific <t>PCR</t> primer pair that incorporates the T7 promoter sequence (T7) and color adapter sequence (C), and (4) successfully amplified probes are purified and linearly amplified by in vitro transcription (IVT). (5) Purified IVT products are reverse transcribed (RT), (6) RNA is hydrolyzed, and finally (7) single-stranded DNA (ssDNA) is purified to obtain ready-to-use probes
    Oligos, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 130 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligos/product/Thermo Fisher
    Average 90 stars, based on 130 article reviews
    Price from $9.99 to $1999.99
    oligos - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    Image Search Results


    iFISH implementation. a Scheme of iFISH4U. Pre-designed genome-wide databases of oligos (left) are used as input by the iFISH4U web interface (center) to select oligos within one or more user-specified genomic regions, based on the indicated features. Features 1–3 are used while designing single probes, whereas all the four features are used to design multiple probes on the same chromosome. The black dashed boxes indicate examples of probes within the same region of interest, with the same number of oligos (vertical bars), but suboptimal size (1), homogeneity (2), or centrality (3), whereas the orange box represents the probe of choice having optimal size, homogeneity and centrality. b Cumulative distribution of the distances between consecutive oligos in the human 40-mers database. c Median standard deviation (s.d.) of the distance between consecutive oligos, inside non-overlapping genomic windows of the indicated size, in the 40-mers database and OligoMiner (OM) hg19 databases. OMB, OM ‘Balance’. OMC, OM ‘Coverage’. OMS, OM ‘Stringent’. d Percentage of non-overlapping genomic windows of the indicated size, containing at least 96 oligos, in the 40-mers database and OM hg19 databases. e Scheme of oligos in iFISH probes. Each probe consists of n oligos differing in the T sequence. f Location of the 330 iFISH probes targeting all the human autosomes and chrX. Red dots, individually tested probes (see Fig 2a, b ). g Scheme of the pipeline used to produce iFISH probes. (1) Up to 12,000 oligos, corresponding to a maximum of 125 probes each containing 96 oligos, are synthesized on an array and then pooled together. (2) The oligo-pool is dispensed into n 96-well plates, depending on the total number of probes ( p ) and colors per probe ( c ). (3) In each well, the oligos corresponding to the same probe are selectively amplified using a probe-specific PCR primer pair that incorporates the T7 promoter sequence (T7) and color adapter sequence (C), and (4) successfully amplified probes are purified and linearly amplified by in vitro transcription (IVT). (5) Purified IVT products are reverse transcribed (RT), (6) RNA is hydrolyzed, and finally (7) single-stranded DNA (ssDNA) is purified to obtain ready-to-use probes

    Journal: Nature Communications

    Article Title: iFISH is a publically available resource enabling versatile DNA FISH to study genome architecture

    doi: 10.1038/s41467-019-09616-w

    Figure Lengend Snippet: iFISH implementation. a Scheme of iFISH4U. Pre-designed genome-wide databases of oligos (left) are used as input by the iFISH4U web interface (center) to select oligos within one or more user-specified genomic regions, based on the indicated features. Features 1–3 are used while designing single probes, whereas all the four features are used to design multiple probes on the same chromosome. The black dashed boxes indicate examples of probes within the same region of interest, with the same number of oligos (vertical bars), but suboptimal size (1), homogeneity (2), or centrality (3), whereas the orange box represents the probe of choice having optimal size, homogeneity and centrality. b Cumulative distribution of the distances between consecutive oligos in the human 40-mers database. c Median standard deviation (s.d.) of the distance between consecutive oligos, inside non-overlapping genomic windows of the indicated size, in the 40-mers database and OligoMiner (OM) hg19 databases. OMB, OM ‘Balance’. OMC, OM ‘Coverage’. OMS, OM ‘Stringent’. d Percentage of non-overlapping genomic windows of the indicated size, containing at least 96 oligos, in the 40-mers database and OM hg19 databases. e Scheme of oligos in iFISH probes. Each probe consists of n oligos differing in the T sequence. f Location of the 330 iFISH probes targeting all the human autosomes and chrX. Red dots, individually tested probes (see Fig 2a, b ). g Scheme of the pipeline used to produce iFISH probes. (1) Up to 12,000 oligos, corresponding to a maximum of 125 probes each containing 96 oligos, are synthesized on an array and then pooled together. (2) The oligo-pool is dispensed into n 96-well plates, depending on the total number of probes ( p ) and colors per probe ( c ). (3) In each well, the oligos corresponding to the same probe are selectively amplified using a probe-specific PCR primer pair that incorporates the T7 promoter sequence (T7) and color adapter sequence (C), and (4) successfully amplified probes are purified and linearly amplified by in vitro transcription (IVT). (5) Purified IVT products are reverse transcribed (RT), (6) RNA is hydrolyzed, and finally (7) single-stranded DNA (ssDNA) is purified to obtain ready-to-use probes

    Article Snippet: We then amplified the oligos in each well by real-time PCR using the SYBR Select Master Mix (Thermo Fisher Scientific, cat. no. 4472913).

    Techniques: Genome Wide, Standard Deviation, Sequencing, Synthesized, Amplification, Polymerase Chain Reaction, Purification, In Vitro

    Processing, subcellular localization and chromatin association of STAiRs. ( A ) CAPTURE-RNA-sequencing was performed using 12 biotinylated oligonucleotides per STAiR target RNA (STAiRs 1, 2, 6, 15, 18) and 6 oligos for bacterial lacZ as a negative control. The pulldown was performed with RNA from permanently IL-6 stimulated (10 ng/ml) INA-6 cells. The RNA pulldown was implemented by streptavidin beads, following an RNA preparation, DNase digestion, library preparation (Scriptseq, Epicenter), and subsequent NGS. Identified reads were mapped to the human genome hg19. The resulting transcription patterns were visualized using Integrative Genome Viewer (IGV). The regions of oligo binding are marked with red lines below. For STAiRs 15 and 18 the annotated ncRNAs are shown in blue at the bottom. For STAiR18, 4 novel exons were identified shown in green. ( B ) Subcellular localization of STAiRs. Nuclear-cytoplasmic fractioning was performed with permanently IL-6-treated INA-6 cells. RNA was prepared, DNase-digested, reverse transcribed and relative gene expression determined by qPCR. For unspliced STAiRs 1, 2 and 6, the used primers detect primary transcripts, whereas for spliced STAiRs 15 and 18, both a pair detecting the primary (p) and spliced (s) transcript were applied. Primer pairs for STAT3 and GAPDH are intron-spanning. For detection of infrequently spliced MALAT1 a pair of exonic primers was used. Values were normalized to the corresponding cytoplasmic fraction. Means ± SD (in %) of STAiR expression per fraction are shown (n ≥ 3). ( C ) Chromatin association of STAiRs. RNA immunoprecipitation was performed with permanently IL-6-treated INA-6 cells using antibodies targeting H3K36me3, H3K4me3, and H3K27me3 as well as IgG as a negative control. RNA was prepared, DNase-digested, and reverse transcribed. RNA enrichment was analyzed by qPCR using intron-spanning primers (STAT3, GAPDH) and primers detecting the primary, unspliced ncRNA transcripts (STAiRs and HOTAIR). Samples were normalized to the IgG control. Means ± SD of STAiR enrichment per IP are shown (n ≥ 3).

    Journal: Scientific Reports

    Article Title: STAT3-induced long noncoding RNAs in multiple myeloma cells display different properties in cancer

    doi: 10.1038/s41598-017-08348-5

    Figure Lengend Snippet: Processing, subcellular localization and chromatin association of STAiRs. ( A ) CAPTURE-RNA-sequencing was performed using 12 biotinylated oligonucleotides per STAiR target RNA (STAiRs 1, 2, 6, 15, 18) and 6 oligos for bacterial lacZ as a negative control. The pulldown was performed with RNA from permanently IL-6 stimulated (10 ng/ml) INA-6 cells. The RNA pulldown was implemented by streptavidin beads, following an RNA preparation, DNase digestion, library preparation (Scriptseq, Epicenter), and subsequent NGS. Identified reads were mapped to the human genome hg19. The resulting transcription patterns were visualized using Integrative Genome Viewer (IGV). The regions of oligo binding are marked with red lines below. For STAiRs 15 and 18 the annotated ncRNAs are shown in blue at the bottom. For STAiR18, 4 novel exons were identified shown in green. ( B ) Subcellular localization of STAiRs. Nuclear-cytoplasmic fractioning was performed with permanently IL-6-treated INA-6 cells. RNA was prepared, DNase-digested, reverse transcribed and relative gene expression determined by qPCR. For unspliced STAiRs 1, 2 and 6, the used primers detect primary transcripts, whereas for spliced STAiRs 15 and 18, both a pair detecting the primary (p) and spliced (s) transcript were applied. Primer pairs for STAT3 and GAPDH are intron-spanning. For detection of infrequently spliced MALAT1 a pair of exonic primers was used. Values were normalized to the corresponding cytoplasmic fraction. Means ± SD (in %) of STAiR expression per fraction are shown (n ≥ 3). ( C ) Chromatin association of STAiRs. RNA immunoprecipitation was performed with permanently IL-6-treated INA-6 cells using antibodies targeting H3K36me3, H3K4me3, and H3K27me3 as well as IgG as a negative control. RNA was prepared, DNase-digested, and reverse transcribed. RNA enrichment was analyzed by qPCR using intron-spanning primers (STAT3, GAPDH) and primers detecting the primary, unspliced ncRNA transcripts (STAiRs and HOTAIR). Samples were normalized to the IgG control. Means ± SD of STAiR enrichment per IP are shown (n ≥ 3).

    Article Snippet: Pulldown was done by adding 100 pmol oligo mixture (12 oligos targeting each STAiR in different positions) per 1 ml cell lysate, followed by an immobilization to streptavidin T1 magnetic Dynabeads® (Thermo).

    Techniques: RNA Sequencing Assay, Negative Control, Next-Generation Sequencing, Binding Assay, Expressing, Real-time Polymerase Chain Reaction, Immunoprecipitation

    ]. Neuromag ® -complexed oligos were injected by stereotaxic surgery in the right lateral ventricle, in coordinates according to the Paxinos atlas. A magnetic plate placed underneath the head enhances transfection of magnetic particles into the neuron and glial cells. Detailed information in material and methods section (item 4.1). CPu—caudate putamen; LV—lateral ventricle.

    Journal: Molecules : A Journal of Synthetic Chemistry and Natural Product Chemistry

    Article Title: Delivery of miRNA-Targeted Oligonucleotides in the Rat Striatum by Magnetofection with Neuromag®

    doi: 10.3390/molecules23071825

    Figure Lengend Snippet: ]. Neuromag ® -complexed oligos were injected by stereotaxic surgery in the right lateral ventricle, in coordinates according to the Paxinos atlas. A magnetic plate placed underneath the head enhances transfection of magnetic particles into the neuron and glial cells. Detailed information in material and methods section (item 4.1). CPu—caudate putamen; LV—lateral ventricle.

    Article Snippet: The striatum tissue was manually dissected from euthanized animals at Day 7 post-injection of Neuromag® -complexed oligos, and frozen at −80 °C. miRNAs were isolated by mirVana™ miRNA Isolation Kit, and quantified by fluorometry (Qubit® 2.0 firmware 3.11; Thermo Fisher Scientific, Inc., Waltham, MA, USA).

    Techniques: Injection, Transfection

    Knocking down on striatal miR-134 by Neuromag-complexed AntimiR-134 oligos. The content of miR-134 in the striatum determined by real-time quantitative polymerase chain reaction (RT-qPCR), at seven days after i.c.v. injections. miR-134 results in groups injected with AntimiR-134 or the negative control Scramble first normalized with RNU6B (∆Ct), and them compared to those obtained in control animals (∆∆Ct), arbitrarily assigned as 1.0 (100% expression). Bars represent mean ± SEM regarding miRNA relative value. * P

    Journal: Molecules : A Journal of Synthetic Chemistry and Natural Product Chemistry

    Article Title: Delivery of miRNA-Targeted Oligonucleotides in the Rat Striatum by Magnetofection with Neuromag®

    doi: 10.3390/molecules23071825

    Figure Lengend Snippet: Knocking down on striatal miR-134 by Neuromag-complexed AntimiR-134 oligos. The content of miR-134 in the striatum determined by real-time quantitative polymerase chain reaction (RT-qPCR), at seven days after i.c.v. injections. miR-134 results in groups injected with AntimiR-134 or the negative control Scramble first normalized with RNU6B (∆Ct), and them compared to those obtained in control animals (∆∆Ct), arbitrarily assigned as 1.0 (100% expression). Bars represent mean ± SEM regarding miRNA relative value. * P

    Article Snippet: The striatum tissue was manually dissected from euthanized animals at Day 7 post-injection of Neuromag® -complexed oligos, and frozen at −80 °C. miRNAs were isolated by mirVana™ miRNA Isolation Kit, and quantified by fluorometry (Qubit® 2.0 firmware 3.11; Thermo Fisher Scientific, Inc., Waltham, MA, USA).

    Techniques: Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Injection, Negative Control, Expressing

    Magnetofection of striatal cells by fluorescein isothiocyanate (FITC)-labeled oligonucleotides complexed with Neuromag ® . Striatum region transfected with oligos structured in Neuromag ® for delivery into the neuron and glial cells. ( a ) Left rat striatum without intracerebroventricular (i.c.v.) injection (negative control); ( b ) NeuN-positive neuron cells transfected with green fluorescent FITC-labeled oligos; ( c ) Delineated region of ( b ) in high magnification revealing the green-labeled oligonucleotide inside neurons and glial cells (upper and bottom images, respectively). Immunostaining of NeuN and GFAP in red; FITC-labeled oligos in green; cell nucleus in blue, stained by the Hoescht 33342 reagent. Scale = 15 µm. n = 3 per group.

    Journal: Molecules : A Journal of Synthetic Chemistry and Natural Product Chemistry

    Article Title: Delivery of miRNA-Targeted Oligonucleotides in the Rat Striatum by Magnetofection with Neuromag®

    doi: 10.3390/molecules23071825

    Figure Lengend Snippet: Magnetofection of striatal cells by fluorescein isothiocyanate (FITC)-labeled oligonucleotides complexed with Neuromag ® . Striatum region transfected with oligos structured in Neuromag ® for delivery into the neuron and glial cells. ( a ) Left rat striatum without intracerebroventricular (i.c.v.) injection (negative control); ( b ) NeuN-positive neuron cells transfected with green fluorescent FITC-labeled oligos; ( c ) Delineated region of ( b ) in high magnification revealing the green-labeled oligonucleotide inside neurons and glial cells (upper and bottom images, respectively). Immunostaining of NeuN and GFAP in red; FITC-labeled oligos in green; cell nucleus in blue, stained by the Hoescht 33342 reagent. Scale = 15 µm. n = 3 per group.

    Article Snippet: The striatum tissue was manually dissected from euthanized animals at Day 7 post-injection of Neuromag® -complexed oligos, and frozen at −80 °C. miRNAs were isolated by mirVana™ miRNA Isolation Kit, and quantified by fluorometry (Qubit® 2.0 firmware 3.11; Thermo Fisher Scientific, Inc., Waltham, MA, USA).

    Techniques: Magnetofection, Labeling, Transfection, Injection, Negative Control, Immunostaining, Staining

    Overview of isothermal DNA construction on the microfluidics platform. a Overview of the basic IHDC step on the microfluidics platform. Stage I. Two oligos A and B (as shown, or alternatively two DNA fragments A and B) and a mixture of enzymes are transferred to the reactor. Stage II. Primers P1 and P2, and a mixture of enzymes, are transferred to the reactor. Stage III. A mixture of ATP and magnesium acetate, and a mixture of enzymes, are transferred to the reactor. The temperature is increased to 38 °C, and the reaction is incubated for 15 min. As a result, an elongated and amplified DNA fragment AB is produced. b Hierarchical construction tree of seven separate synthesis reactions that result in the final product (gfp as shown). c Gel electrophoresis image of all the intermediates and the final gfp construct. Lanes as labelled by: M: GeneRuler 1 kb Plus DNA Ladder (Thermo Scientific); Level 1 (quarter) fragments: 1-2, 3-4, 5-6, 7-8; Level 2 (half) fragments: 1-4 and 5-8; Level 3 (full length gfp) fragment: 1-8

    Journal: Journal of Biological Engineering

    Article Title: End-to-end automated microfluidic platform for synthetic biology: from design to functional analysis

    doi: 10.1186/s13036-016-0024-5

    Figure Lengend Snippet: Overview of isothermal DNA construction on the microfluidics platform. a Overview of the basic IHDC step on the microfluidics platform. Stage I. Two oligos A and B (as shown, or alternatively two DNA fragments A and B) and a mixture of enzymes are transferred to the reactor. Stage II. Primers P1 and P2, and a mixture of enzymes, are transferred to the reactor. Stage III. A mixture of ATP and magnesium acetate, and a mixture of enzymes, are transferred to the reactor. The temperature is increased to 38 °C, and the reaction is incubated for 15 min. As a result, an elongated and amplified DNA fragment AB is produced. b Hierarchical construction tree of seven separate synthesis reactions that result in the final product (gfp as shown). c Gel electrophoresis image of all the intermediates and the final gfp construct. Lanes as labelled by: M: GeneRuler 1 kb Plus DNA Ladder (Thermo Scientific); Level 1 (quarter) fragments: 1-2, 3-4, 5-6, 7-8; Level 2 (half) fragments: 1-4 and 5-8; Level 3 (full length gfp) fragment: 1-8

    Article Snippet: Isothermal hierarchical DNA construction (IHDC) A basic step of the IHDC on the Microfluidics platform is composed of liquid transfers of the following components to the reactor well (Fig. ): two DNA fragments from previous steps or oligos (0.2 pmol/μL) 1 μL each, two Primers (0.2 pmol/μL) 2 μL each, mixture of ATP 100 mM (Thermo Scientific) 0.3 μL with magnesium acetate (280 mM) 1.2 μL and enzymes mixture in reaction buffer (TwisDX) 15 μL.

    Techniques: Incubation, Amplification, Produced, Nucleic Acid Electrophoresis, Construct

    Isothermal hierarchical DNA construction (IHDC) coupled with Gibson DNA assembly. a Isothermal hierarchical DNA construction. At left, an example of a three-level hierarchical construction tree starting with eight oligonucleotides. At right, schematic description of the basic biochemical step of IHDC. b Gibson DNA assembly. Integration of IHDC-constructed fragments with Gibson DNA assembly

    Journal: Journal of Biological Engineering

    Article Title: End-to-end automated microfluidic platform for synthetic biology: from design to functional analysis

    doi: 10.1186/s13036-016-0024-5

    Figure Lengend Snippet: Isothermal hierarchical DNA construction (IHDC) coupled with Gibson DNA assembly. a Isothermal hierarchical DNA construction. At left, an example of a three-level hierarchical construction tree starting with eight oligonucleotides. At right, schematic description of the basic biochemical step of IHDC. b Gibson DNA assembly. Integration of IHDC-constructed fragments with Gibson DNA assembly

    Article Snippet: Isothermal hierarchical DNA construction (IHDC) A basic step of the IHDC on the Microfluidics platform is composed of liquid transfers of the following components to the reactor well (Fig. ): two DNA fragments from previous steps or oligos (0.2 pmol/μL) 1 μL each, two Primers (0.2 pmol/μL) 2 μL each, mixture of ATP 100 mM (Thermo Scientific) 0.3 μL with magnesium acetate (280 mM) 1.2 μL and enzymes mixture in reaction buffer (TwisDX) 15 μL.

    Techniques: Construct