oligo dt primer  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Name:
    Oligo dT Primer 50 µM
    Description:
    These are the same Ambion primers that are currently included in the RETROscript Kit SKU AM1710 They are provided at a stock concentration of 50 µM and are functionally tested using the RETROscript Kit
    Catalog Number:
    AM5730G
    Price:
    None
    Category:
    Oligos Primers Probes Nucleotides
    Applications:
    PCR & Real-Time PCR|RT-PCR|Reverse Transcription|Two-Step RT-PCR
    Buy from Supplier


    Structured Review

    Thermo Fisher oligo dt primer
    These are the same Ambion primers that are currently included in the RETROscript Kit SKU AM1710 They are provided at a stock concentration of 50 µM and are functionally tested using the RETROscript Kit
    https://www.bioz.com/result/oligo dt primer/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    oligo dt primer - by Bioz Stars, 2021-05
    97/100 stars

    Images

    Related Articles

    Incubation:

    Article Title: Global architecture of the nucleus in single cells by DNA seqFISH+ and multiplexed immunofluorescence
    Article Snippet: The samples were washed three times with 1× PBS and blocked at room temperature for 15 minutes with blocking solution consisted of 1× PBS, 10 mg/mL UltraPure BSA (Invitrogen AM2616), 0.3% Triton-X, 0.1% dextran sulfate (Sigma D4911) and 0.5 mg/mL sheared Salmon Sperm DNA (Invitrogen AM9680). .. Then DNA oligo-conjugated primary antibodies listed below were incubated in the blocking solution with 100-fold diluted SUPERase In RNase Inhibitor (Invitrogen AM2694) at 4°C overnight. .. The typical final concentration of DNA conjugated primary antibodies used were estimated as 1-5 ng/μL.

    Blocking Assay:

    Article Title: Global architecture of the nucleus in single cells by DNA seqFISH+ and multiplexed immunofluorescence
    Article Snippet: The samples were washed three times with 1× PBS and blocked at room temperature for 15 minutes with blocking solution consisted of 1× PBS, 10 mg/mL UltraPure BSA (Invitrogen AM2616), 0.3% Triton-X, 0.1% dextran sulfate (Sigma D4911) and 0.5 mg/mL sheared Salmon Sperm DNA (Invitrogen AM9680). .. Then DNA oligo-conjugated primary antibodies listed below were incubated in the blocking solution with 100-fold diluted SUPERase In RNase Inhibitor (Invitrogen AM2694) at 4°C overnight. .. The typical final concentration of DNA conjugated primary antibodies used were estimated as 1-5 ng/μL.

    Ligation:

    Article Title: In vivo therapeutic potential of Dicer-hunting siRNAs targeting infectious hepatitis C virus.
    Article Snippet: At 6 h post-transfection, total RNA from replicon cells was extracted using the acid guanidinium-phenol-chloroform method . .. For the RNA oligo ligation method, 5 μg of total RNA was ligated to the GeneRacer RNA adapter (Invitrogen, 5′-CGA CUG GAG CAC GAG GAC ACU GAC AUG GAC UGA AGG AGU AGA AA-3′) without any prior processing. ..

    Plasmid Preparation:

    Article Title: MicroRNA-365 Inhibits Cell Growth and Promotes Apoptosis in Melanoma by Targeting BCL2 and Cyclin D1 (CCND1)
    Article Snippet: The region of 3′UTR of the human CCND1 and BCL2 mRNA containing the miR-365 targeting site were cloned in between the XhoI(5′) and NotI(3′) sites in a psi-CHECK2 vector (Promega, USA). .. A375 cells were co-transfected with 1 μg of p3′UTR-CCND1 or p3′UTR-BCL2 or psi-CHECK2 vector and 100 nM miR-365 mimic oligos using Lipofectamine 2000 (Invitrogen, USA). .. Cells were harvested 24 hours after transfection and assayed by using a Dual Luciferase Reporter Assay (Promega, USA) according to the manufacturer’s instructions.

    Article Title: Purification, concentration and recovery of small fragments of DNA from Giardia lamblia and their use for other molecular techniques
    Article Snippet: .. Reagents Oligo TPI Fw: AGGAGCTCGGAGAGTCCAA Oligo TPI Rv: ACACGGGCTCGTAAGCAAT Oligo NADHox Fw: GCACCATATGGCTTCAACGG Oligo NADHox Rv: CAGGCCTGTCCGTGTCATTA) Oligo GlsRNA17 Fw: TGCAGCCTAATCACCGC Oligo GlsRNA 17 Rv: GTGCAGGGTCCGAGGT Phusion HighFidelity DNA polymerase (Thermo scientific) Xho I (Thermo Scientific) Nco I (Thermo Scientific) GelRed (Nucleic Acid Gel, Biotium) 1X TBE buffer (Tris-HCL/Boric Acid/EDTA) TE buffer [10 mM Tris-HCl, pH 8.0 and 1 mM (ethylenedinitrilo)tetraacetic acid (EDTA)] Sodium acetate (3 M, pH 5.2) Ethanol for molecular biology (Sigma-Aldrich) SyberGreen Master Mix kit (Applied Biosystems, CA, USA) GeneJET Plasmid Miniprep Kit (Thermo Scientific) T4 ligase (Thermo Scientific) Agarose (Invitrogen) GeneJET Plasmid Miniprep Kit (Thermo Scientific) Equipment Thermocycler MaxyGene Gradient (Axygen, USA) Thermomixer compact, Eppendorf Centrifuge (minispin Eppendorf centrifuge for 1.5 mL microcentrifuge tubes) Agarose Electrophoresis System (Thermo Scientific) Analyzer ImageJ1.50i, Wayne Rasband National Institutes of Health (USA) StepOne™ Real-Time PCR System and Fast SYBR® MultiDoc-It Digital Imaging System UVP .. Purification of small DNA fragments from agarose gels 1.

    Transfection:

    Article Title: The ePHD protein SPBP interacts with TopBP1 and together they co-operate to stimulate Ets1-mediated transcription
    Article Snippet: The luciferase values varied 1–12% between the parallels. .. Reporter gene assays involving siRNA-mediated knock down of SPBP or TopBP1 were performed as follows: HeLa cells seeded in 24-well dishes at 2 × 105 cells/well the day before transfection were transfected using Lipofectamine PLUS (Invitrogen) with reporter vectors (30 ng), expression vectors pRc-Ets68 (15 ng) and pcDNA3-HA-TopBP1 (60 ng) and 50 nM of SPBP siRNA oligos (siGENOME SMARTpool TCF20 siRNAs, Dharmacon), 50 nM of Scrambled siRNA oligos (Dharmacon) or 50 nM of TopBP1 siRNA oligos [synthesized by Ambion, sequence as described in ( )]. pCMV-β-gal (10 ng) was included to determine transfection efficiency. .. The cells were harvested 2 days post-transfection and the luciferase and β–galactosidase activities determined.

    Expressing:

    Article Title: The ePHD protein SPBP interacts with TopBP1 and together they co-operate to stimulate Ets1-mediated transcription
    Article Snippet: The luciferase values varied 1–12% between the parallels. .. Reporter gene assays involving siRNA-mediated knock down of SPBP or TopBP1 were performed as follows: HeLa cells seeded in 24-well dishes at 2 × 105 cells/well the day before transfection were transfected using Lipofectamine PLUS (Invitrogen) with reporter vectors (30 ng), expression vectors pRc-Ets68 (15 ng) and pcDNA3-HA-TopBP1 (60 ng) and 50 nM of SPBP siRNA oligos (siGENOME SMARTpool TCF20 siRNAs, Dharmacon), 50 nM of Scrambled siRNA oligos (Dharmacon) or 50 nM of TopBP1 siRNA oligos [synthesized by Ambion, sequence as described in ( )]. pCMV-β-gal (10 ng) was included to determine transfection efficiency. .. The cells were harvested 2 days post-transfection and the luciferase and β–galactosidase activities determined.

    Synthesized:

    Article Title: The ePHD protein SPBP interacts with TopBP1 and together they co-operate to stimulate Ets1-mediated transcription
    Article Snippet: The luciferase values varied 1–12% between the parallels. .. Reporter gene assays involving siRNA-mediated knock down of SPBP or TopBP1 were performed as follows: HeLa cells seeded in 24-well dishes at 2 × 105 cells/well the day before transfection were transfected using Lipofectamine PLUS (Invitrogen) with reporter vectors (30 ng), expression vectors pRc-Ets68 (15 ng) and pcDNA3-HA-TopBP1 (60 ng) and 50 nM of SPBP siRNA oligos (siGENOME SMARTpool TCF20 siRNAs, Dharmacon), 50 nM of Scrambled siRNA oligos (Dharmacon) or 50 nM of TopBP1 siRNA oligos [synthesized by Ambion, sequence as described in ( )]. pCMV-β-gal (10 ng) was included to determine transfection efficiency. .. The cells were harvested 2 days post-transfection and the luciferase and β–galactosidase activities determined.

    Sequencing:

    Article Title: The ePHD protein SPBP interacts with TopBP1 and together they co-operate to stimulate Ets1-mediated transcription
    Article Snippet: The luciferase values varied 1–12% between the parallels. .. Reporter gene assays involving siRNA-mediated knock down of SPBP or TopBP1 were performed as follows: HeLa cells seeded in 24-well dishes at 2 × 105 cells/well the day before transfection were transfected using Lipofectamine PLUS (Invitrogen) with reporter vectors (30 ng), expression vectors pRc-Ets68 (15 ng) and pcDNA3-HA-TopBP1 (60 ng) and 50 nM of SPBP siRNA oligos (siGENOME SMARTpool TCF20 siRNAs, Dharmacon), 50 nM of Scrambled siRNA oligos (Dharmacon) or 50 nM of TopBP1 siRNA oligos [synthesized by Ambion, sequence as described in ( )]. pCMV-β-gal (10 ng) was included to determine transfection efficiency. .. The cells were harvested 2 days post-transfection and the luciferase and β–galactosidase activities determined.

    Electrophoresis:

    Article Title: Purification, concentration and recovery of small fragments of DNA from Giardia lamblia and their use for other molecular techniques
    Article Snippet: .. Reagents Oligo TPI Fw: AGGAGCTCGGAGAGTCCAA Oligo TPI Rv: ACACGGGCTCGTAAGCAAT Oligo NADHox Fw: GCACCATATGGCTTCAACGG Oligo NADHox Rv: CAGGCCTGTCCGTGTCATTA) Oligo GlsRNA17 Fw: TGCAGCCTAATCACCGC Oligo GlsRNA 17 Rv: GTGCAGGGTCCGAGGT Phusion HighFidelity DNA polymerase (Thermo scientific) Xho I (Thermo Scientific) Nco I (Thermo Scientific) GelRed (Nucleic Acid Gel, Biotium) 1X TBE buffer (Tris-HCL/Boric Acid/EDTA) TE buffer [10 mM Tris-HCl, pH 8.0 and 1 mM (ethylenedinitrilo)tetraacetic acid (EDTA)] Sodium acetate (3 M, pH 5.2) Ethanol for molecular biology (Sigma-Aldrich) SyberGreen Master Mix kit (Applied Biosystems, CA, USA) GeneJET Plasmid Miniprep Kit (Thermo Scientific) T4 ligase (Thermo Scientific) Agarose (Invitrogen) GeneJET Plasmid Miniprep Kit (Thermo Scientific) Equipment Thermocycler MaxyGene Gradient (Axygen, USA) Thermomixer compact, Eppendorf Centrifuge (minispin Eppendorf centrifuge for 1.5 mL microcentrifuge tubes) Agarose Electrophoresis System (Thermo Scientific) Analyzer ImageJ1.50i, Wayne Rasband National Institutes of Health (USA) StepOne™ Real-Time PCR System and Fast SYBR® MultiDoc-It Digital Imaging System UVP .. Purification of small DNA fragments from agarose gels 1.

    Real-time Polymerase Chain Reaction:

    Article Title: Purification, concentration and recovery of small fragments of DNA from Giardia lamblia and their use for other molecular techniques
    Article Snippet: .. Reagents Oligo TPI Fw: AGGAGCTCGGAGAGTCCAA Oligo TPI Rv: ACACGGGCTCGTAAGCAAT Oligo NADHox Fw: GCACCATATGGCTTCAACGG Oligo NADHox Rv: CAGGCCTGTCCGTGTCATTA) Oligo GlsRNA17 Fw: TGCAGCCTAATCACCGC Oligo GlsRNA 17 Rv: GTGCAGGGTCCGAGGT Phusion HighFidelity DNA polymerase (Thermo scientific) Xho I (Thermo Scientific) Nco I (Thermo Scientific) GelRed (Nucleic Acid Gel, Biotium) 1X TBE buffer (Tris-HCL/Boric Acid/EDTA) TE buffer [10 mM Tris-HCl, pH 8.0 and 1 mM (ethylenedinitrilo)tetraacetic acid (EDTA)] Sodium acetate (3 M, pH 5.2) Ethanol for molecular biology (Sigma-Aldrich) SyberGreen Master Mix kit (Applied Biosystems, CA, USA) GeneJET Plasmid Miniprep Kit (Thermo Scientific) T4 ligase (Thermo Scientific) Agarose (Invitrogen) GeneJET Plasmid Miniprep Kit (Thermo Scientific) Equipment Thermocycler MaxyGene Gradient (Axygen, USA) Thermomixer compact, Eppendorf Centrifuge (minispin Eppendorf centrifuge for 1.5 mL microcentrifuge tubes) Agarose Electrophoresis System (Thermo Scientific) Analyzer ImageJ1.50i, Wayne Rasband National Institutes of Health (USA) StepOne™ Real-Time PCR System and Fast SYBR® MultiDoc-It Digital Imaging System UVP .. Purification of small DNA fragments from agarose gels 1.

    Imaging:

    Article Title: Purification, concentration and recovery of small fragments of DNA from Giardia lamblia and their use for other molecular techniques
    Article Snippet: .. Reagents Oligo TPI Fw: AGGAGCTCGGAGAGTCCAA Oligo TPI Rv: ACACGGGCTCGTAAGCAAT Oligo NADHox Fw: GCACCATATGGCTTCAACGG Oligo NADHox Rv: CAGGCCTGTCCGTGTCATTA) Oligo GlsRNA17 Fw: TGCAGCCTAATCACCGC Oligo GlsRNA 17 Rv: GTGCAGGGTCCGAGGT Phusion HighFidelity DNA polymerase (Thermo scientific) Xho I (Thermo Scientific) Nco I (Thermo Scientific) GelRed (Nucleic Acid Gel, Biotium) 1X TBE buffer (Tris-HCL/Boric Acid/EDTA) TE buffer [10 mM Tris-HCl, pH 8.0 and 1 mM (ethylenedinitrilo)tetraacetic acid (EDTA)] Sodium acetate (3 M, pH 5.2) Ethanol for molecular biology (Sigma-Aldrich) SyberGreen Master Mix kit (Applied Biosystems, CA, USA) GeneJET Plasmid Miniprep Kit (Thermo Scientific) T4 ligase (Thermo Scientific) Agarose (Invitrogen) GeneJET Plasmid Miniprep Kit (Thermo Scientific) Equipment Thermocycler MaxyGene Gradient (Axygen, USA) Thermomixer compact, Eppendorf Centrifuge (minispin Eppendorf centrifuge for 1.5 mL microcentrifuge tubes) Agarose Electrophoresis System (Thermo Scientific) Analyzer ImageJ1.50i, Wayne Rasband National Institutes of Health (USA) StepOne™ Real-Time PCR System and Fast SYBR® MultiDoc-It Digital Imaging System UVP .. Purification of small DNA fragments from agarose gels 1.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher antisense primers
    MICA and MICB gene and protein expressions in Caki-1 cells. (A) MICA (442 bp) and MICB (677 bp) transcripts were amplified by polymerase chain reaction from Caki-1 cDNA by using a single MICA/B sense primer and two MICA- or MICB -specific <t>antisense</t> primers as indicated in the Materials and Methods section. (B) The indicated tumor cell lines were stained either with a commercial APC-conjugated anti-MICB (left panel, gray areas) or with a commercial PE-conjugated anti-MICA (right panel, gray areas). The black areas show the intensity of fluorescence upon staining with APC- or PE-conjugated matching isotype mAbs. (C) The indicated tumor cell lines (1 x 10 6 ) were permeabilized and incubated with WW6B7 mAb (solid lines) or WW2G8 mAb (dashed lines) or an isotype-matched IgG1 mAbs (solid thick lines). After a 30-minute incubation in ice, cells were washed, and FITC-conjugated goat anti-mouse F(ab) 2 were added to the cell pellet. Cells were then analyzed by flow cytometry. (D) Nonpermeabilized (dashed lines) or permeabilized (solid lines) cells (1 x 10 6 ) were incubated with WW6B7 mAb and stained with a FITC-conjugated goat anti-mouse F(ab) 2 antibodies. The overlapping solid thick lines show the fluorescence given by control isotype IgG1 mAbs in nonpermeabilized or in permeabilized tumor cells.
    Antisense Primers, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/antisense primers/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    antisense primers - by Bioz Stars, 2021-05
    99/100 stars
      Buy from Supplier

    97
    Thermo Fisher rna oligos
    Ligation of 128-nt, synthetic pre-mRNA. ( A ) Strategy for making synthetic YOL047c transcript. The YOL047c gene contains a single 63-nt intron near the 5′ end of the gene. Dashed lines indicate boundaries of the splicing reporter. The 128-nt splicing reporter contains 35 nt of exon 1, the entire intron (branch point nucleotide, BP), and 30 nt of exon 2. Synthetic oligoribonucleotides (labeled A, B, C) for generating the splicing reporter contain, respectively, the 5′ splice junction, the branch point, and the 3′ splice junction. ( B ) Two-step ligation of transcript (lanes 1 , 2 ). Gel-purified AB product (lane 1 , “AB”) was ligated with oligo C and splint S2, yielding full-length ABC product (lane 2 , “ABC”). One-step ligation of transcript (lanes 3 , 4 ). All three <t>RNA</t> <t>oligonucleotides</t> and both splints were incubated in a single reaction. Reactions were treated with DNAse I after ligation, so no splints are visible.
    Rna Oligos, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna oligos/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    rna oligos - by Bioz Stars, 2021-05
    97/100 stars
      Buy from Supplier

    Image Search Results


    MICA and MICB gene and protein expressions in Caki-1 cells. (A) MICA (442 bp) and MICB (677 bp) transcripts were amplified by polymerase chain reaction from Caki-1 cDNA by using a single MICA/B sense primer and two MICA- or MICB -specific antisense primers as indicated in the Materials and Methods section. (B) The indicated tumor cell lines were stained either with a commercial APC-conjugated anti-MICB (left panel, gray areas) or with a commercial PE-conjugated anti-MICA (right panel, gray areas). The black areas show the intensity of fluorescence upon staining with APC- or PE-conjugated matching isotype mAbs. (C) The indicated tumor cell lines (1 x 10 6 ) were permeabilized and incubated with WW6B7 mAb (solid lines) or WW2G8 mAb (dashed lines) or an isotype-matched IgG1 mAbs (solid thick lines). After a 30-minute incubation in ice, cells were washed, and FITC-conjugated goat anti-mouse F(ab) 2 were added to the cell pellet. Cells were then analyzed by flow cytometry. (D) Nonpermeabilized (dashed lines) or permeabilized (solid lines) cells (1 x 10 6 ) were incubated with WW6B7 mAb and stained with a FITC-conjugated goat anti-mouse F(ab) 2 antibodies. The overlapping solid thick lines show the fluorescence given by control isotype IgG1 mAbs in nonpermeabilized or in permeabilized tumor cells.

    Journal: Neoplasia (New York, N.Y.)

    Article Title: Defective Infiltration of Natural Killer Cells in MICA/B-Positive Renal Cell Carcinoma Involves ?2-Integrin-Mediated Interaction 1

    doi:

    Figure Lengend Snippet: MICA and MICB gene and protein expressions in Caki-1 cells. (A) MICA (442 bp) and MICB (677 bp) transcripts were amplified by polymerase chain reaction from Caki-1 cDNA by using a single MICA/B sense primer and two MICA- or MICB -specific antisense primers as indicated in the Materials and Methods section. (B) The indicated tumor cell lines were stained either with a commercial APC-conjugated anti-MICB (left panel, gray areas) or with a commercial PE-conjugated anti-MICA (right panel, gray areas). The black areas show the intensity of fluorescence upon staining with APC- or PE-conjugated matching isotype mAbs. (C) The indicated tumor cell lines (1 x 10 6 ) were permeabilized and incubated with WW6B7 mAb (solid lines) or WW2G8 mAb (dashed lines) or an isotype-matched IgG1 mAbs (solid thick lines). After a 30-minute incubation in ice, cells were washed, and FITC-conjugated goat anti-mouse F(ab) 2 were added to the cell pellet. Cells were then analyzed by flow cytometry. (D) Nonpermeabilized (dashed lines) or permeabilized (solid lines) cells (1 x 10 6 ) were incubated with WW6B7 mAb and stained with a FITC-conjugated goat anti-mouse F(ab) 2 antibodies. The overlapping solid thick lines show the fluorescence given by control isotype IgG1 mAbs in nonpermeabilized or in permeabilized tumor cells.

    Article Snippet: Complementary DNA (cDNA) first strand was produced using a SuperScript First-Strand Synthesis System using oligo(dt)12–18 antisense primers (Invitrogen, Lucerne, Switzerland).

    Techniques: Amplification, Polymerase Chain Reaction, Staining, Fluorescence, Incubation, Flow Cytometry, Cytometry

    Ligation of 128-nt, synthetic pre-mRNA. ( A ) Strategy for making synthetic YOL047c transcript. The YOL047c gene contains a single 63-nt intron near the 5′ end of the gene. Dashed lines indicate boundaries of the splicing reporter. The 128-nt splicing reporter contains 35 nt of exon 1, the entire intron (branch point nucleotide, BP), and 30 nt of exon 2. Synthetic oligoribonucleotides (labeled A, B, C) for generating the splicing reporter contain, respectively, the 5′ splice junction, the branch point, and the 3′ splice junction. ( B ) Two-step ligation of transcript (lanes 1 , 2 ). Gel-purified AB product (lane 1 , “AB”) was ligated with oligo C and splint S2, yielding full-length ABC product (lane 2 , “ABC”). One-step ligation of transcript (lanes 3 , 4 ). All three RNA oligonucleotides and both splints were incubated in a single reaction. Reactions were treated with DNAse I after ligation, so no splints are visible.

    Journal: RNA

    Article Title: An RNA ligase-mediated method for the efficient creation of large, synthetic RNAs

    doi: 10.1261/rna.93506

    Figure Lengend Snippet: Ligation of 128-nt, synthetic pre-mRNA. ( A ) Strategy for making synthetic YOL047c transcript. The YOL047c gene contains a single 63-nt intron near the 5′ end of the gene. Dashed lines indicate boundaries of the splicing reporter. The 128-nt splicing reporter contains 35 nt of exon 1, the entire intron (branch point nucleotide, BP), and 30 nt of exon 2. Synthetic oligoribonucleotides (labeled A, B, C) for generating the splicing reporter contain, respectively, the 5′ splice junction, the branch point, and the 3′ splice junction. ( B ) Two-step ligation of transcript (lanes 1 , 2 ). Gel-purified AB product (lane 1 , “AB”) was ligated with oligo C and splint S2, yielding full-length ABC product (lane 2 , “ABC”). One-step ligation of transcript (lanes 3 , 4 ). All three RNA oligonucleotides and both splints were incubated in a single reaction. Reactions were treated with DNAse I after ligation, so no splints are visible.

    Article Snippet: Samples in which the splint and one of the RNA oligos were too close in size to resolve on a gel were then treated with 1 U DNAse I (Ambion) for 15 min at 37°C, as indicated in the figure legends.

    Techniques: Ligation, Labeling, Purification, Incubation

    Applications of small DNA fragments purified from G . lamblia . A) Fragments corresponding to NADHox (98 bp), TPI (65 bp) genes and snoRNA GlsR17 (62 bp) (lines, 1, 2 and 3, respectively), were separated on 2.5% agarose gels. B) The three DNA fragments mentioned in (A) were recovered, diluted in 10 μL and then re-amplified again by PCR with a primer pair; for NADHox (Fw: GCACCATATGGCTTCAACGG and Rv: CAGGCCTGTCCGTGTCATTA); TPI (Fw: AGGAGCTCGGAGAGTCCAA and Rv: ACACGGGCTCGTAAGCAAT) and GlsRNA17 (Fw: TGCAGCCTAATCACCGC and GTGCAGGGTCCGAGGT). M: Molecular weight marker (10 bp DNA Ladder, Thermo Scientific). C) Blunt-end ligation of DNA fragments purified using the modified freeze-squeeze method and digestion of the fragments cloned into vector pJET1.2 with restriction enzymes with Xho I and Nde I D) Sequences obtained from the three fragments cloned into vector pJET1.2. Sequences analyses were carried out in the Unidad de síntesis y secuenciación del Instituto de Biotecnología, UNAM (Cuernavaca, México).

    Journal: MethodsX

    Article Title: Purification, concentration and recovery of small fragments of DNA from Giardia lamblia and their use for other molecular techniques

    doi: 10.1016/j.mex.2017.08.005

    Figure Lengend Snippet: Applications of small DNA fragments purified from G . lamblia . A) Fragments corresponding to NADHox (98 bp), TPI (65 bp) genes and snoRNA GlsR17 (62 bp) (lines, 1, 2 and 3, respectively), were separated on 2.5% agarose gels. B) The three DNA fragments mentioned in (A) were recovered, diluted in 10 μL and then re-amplified again by PCR with a primer pair; for NADHox (Fw: GCACCATATGGCTTCAACGG and Rv: CAGGCCTGTCCGTGTCATTA); TPI (Fw: AGGAGCTCGGAGAGTCCAA and Rv: ACACGGGCTCGTAAGCAAT) and GlsRNA17 (Fw: TGCAGCCTAATCACCGC and GTGCAGGGTCCGAGGT). M: Molecular weight marker (10 bp DNA Ladder, Thermo Scientific). C) Blunt-end ligation of DNA fragments purified using the modified freeze-squeeze method and digestion of the fragments cloned into vector pJET1.2 with restriction enzymes with Xho I and Nde I D) Sequences obtained from the three fragments cloned into vector pJET1.2. Sequences analyses were carried out in the Unidad de síntesis y secuenciación del Instituto de Biotecnología, UNAM (Cuernavaca, México).

    Article Snippet: Reagents Oligo TPI Fw: AGGAGCTCGGAGAGTCCAA Oligo TPI Rv: ACACGGGCTCGTAAGCAAT Oligo NADHox Fw: GCACCATATGGCTTCAACGG Oligo NADHox Rv: CAGGCCTGTCCGTGTCATTA) Oligo GlsRNA17 Fw: TGCAGCCTAATCACCGC Oligo GlsRNA 17 Rv: GTGCAGGGTCCGAGGT Phusion HighFidelity DNA polymerase (Thermo scientific) Xho I (Thermo Scientific) Nco I (Thermo Scientific) GelRed (Nucleic Acid Gel, Biotium) 1X TBE buffer (Tris-HCL/Boric Acid/EDTA) TE buffer [10 mM Tris-HCl, pH 8.0 and 1 mM (ethylenedinitrilo)tetraacetic acid (EDTA)] Sodium acetate (3 M, pH 5.2) Ethanol for molecular biology (Sigma-Aldrich) SyberGreen Master Mix kit (Applied Biosystems, CA, USA) GeneJET Plasmid Miniprep Kit (Thermo Scientific) T4 ligase (Thermo Scientific) Agarose (Invitrogen) GeneJET Plasmid Miniprep Kit (Thermo Scientific) Equipment Thermocycler MaxyGene Gradient (Axygen, USA) Thermomixer compact, Eppendorf Centrifuge (minispin Eppendorf centrifuge for 1.5 mL microcentrifuge tubes) Agarose Electrophoresis System (Thermo Scientific) Analyzer ImageJ1.50i, Wayne Rasband National Institutes of Health (USA) StepOne™ Real-Time PCR System and Fast SYBR® MultiDoc-It Digital Imaging System UVP

    Techniques: Purification, Amplification, Polymerase Chain Reaction, Molecular Weight, Marker, Ligation, Modification, Clone Assay, Plasmid Preparation

    Generation and efficacy of dicer-hunting siRNAs (dh-siRNAs). (a) Complicated secondary structure of the 5′-UTR in the HCV genome 50 and representation of the potent siRNA sequences we identified (si50-10, si197-1, and si197-6). (b, c) 5′-RACE strategy for identifying the RNAi cleavage sites of the target HCV genome using the RNA oligo ligation method (b) and the C-tailing at the 3′-end of RNA method (c). (d–f) Representation of the cleavage sites by siRNA and the number of clones in the sequences of HCV RNA genome that were used as templates. Cleavage site of the HCV RNA genome by siE (d), d-siD5-50 (e), and d-siD5-197 (f) was identified using the two RACE methods (2b and 2C). (g, h) Evaluation of silencing efficacy of dh-siRNAs. The HCV-replicon cells with reporter genes were transfected with the dh-si50 series (si50-6, 7, 10, 11, 13, and 15) (g) or the dh-si197 series (si197-1, 3, 4, 5, and 6) derived from d-si197 (h). Luciferase activity was measured after 48 hr. Data are presented as mean ± s.d. ( n = 5) of values normalized to those obtained with mock-transfected cells. (i) Comparison of IC50 for inhibition of HCV replication by siRNAs that were derived from dh-siRNA or predicted by siRNA web design tools. Based on the HCR6 (genotype 1b) sequence, commercial software (siBlock-iT, siDirect) predicted several siRNA sequences ( Supplementary table 1 ). IC50 values represent the mean for independent determinations ( n = 5) using HCV replicon cells harboring subgenomic HCR6 sequences.

    Journal: Scientific Reports

    Article Title: In vivo therapeutic potential of Dicer-hunting siRNAs targeting infectious hepatitis C virus.

    doi: 10.1038/srep04750

    Figure Lengend Snippet: Generation and efficacy of dicer-hunting siRNAs (dh-siRNAs). (a) Complicated secondary structure of the 5′-UTR in the HCV genome 50 and representation of the potent siRNA sequences we identified (si50-10, si197-1, and si197-6). (b, c) 5′-RACE strategy for identifying the RNAi cleavage sites of the target HCV genome using the RNA oligo ligation method (b) and the C-tailing at the 3′-end of RNA method (c). (d–f) Representation of the cleavage sites by siRNA and the number of clones in the sequences of HCV RNA genome that were used as templates. Cleavage site of the HCV RNA genome by siE (d), d-siD5-50 (e), and d-siD5-197 (f) was identified using the two RACE methods (2b and 2C). (g, h) Evaluation of silencing efficacy of dh-siRNAs. The HCV-replicon cells with reporter genes were transfected with the dh-si50 series (si50-6, 7, 10, 11, 13, and 15) (g) or the dh-si197 series (si197-1, 3, 4, 5, and 6) derived from d-si197 (h). Luciferase activity was measured after 48 hr. Data are presented as mean ± s.d. ( n = 5) of values normalized to those obtained with mock-transfected cells. (i) Comparison of IC50 for inhibition of HCV replication by siRNAs that were derived from dh-siRNA or predicted by siRNA web design tools. Based on the HCR6 (genotype 1b) sequence, commercial software (siBlock-iT, siDirect) predicted several siRNA sequences ( Supplementary table 1 ). IC50 values represent the mean for independent determinations ( n = 5) using HCV replicon cells harboring subgenomic HCR6 sequences.

    Article Snippet: For the RNA oligo ligation method, 5 μg of total RNA was ligated to the GeneRacer RNA adapter (Invitrogen, 5′-CGA CUG GAG CAC GAG GAC ACU GAC AUG GAC UGA AGG AGU AGA AA-3′) without any prior processing.

    Techniques: Ligation, Clone Assay, Transfection, Derivative Assay, Luciferase, Activity Assay, Inhibition, Sequencing, Software