oligo dt primer  (Promega)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Oligo dT 15 Primer
    Description:
    Primer for first strand cDNA synthesis of mRNAs
    Catalog Number:
    c1101
    Price:
    None
    Category:
    Nucleic Acid Extraction Analysis PCR RT PCR
    Buy from Supplier


    Structured Review

    Promega oligo dt primer
    USP21 modulates Hh signaling and Gli1 transcriptional activity. (A) NIH3T3 cells were treated with USP21-targeting siRNA oligonucleotides (#10, #11, #12) or a non-targeting control (NT3), serum-starved and then incubated with SAG (100 nM) for 4 h before mRNA extraction. USP21 and Gli1 mRNA levels were measured by performing quantitative reverse-transcription PCR and normalised to <t>RNA</t> levels of Pol2 ( n =3 independent experiments, mean±s.d.). x -axis labels given in bottom panel also apply to the top panel. (B) HEK293T cells were treated with USP21-targeting siRNA oligonucleotides (#5, #6) or non-targeting control <t>oligo</t> (NT3), or were treated with transfection reagent alone (Mock). 24 h before lysis, cells were transfected with Gli-responsive firefly luciferase and Renilla luciferase reporters (pGLB3B-12Gli-Luc and pRL-Renilla-TK), as well as with a Gli1 expression construct (HA–Gli1). Efficiency of the knockdown was assessed by western blotting ( n =2, bars show the range). (C) HEK293T cells were transfected with Gli-responsive firefly luciferase, Renilla luciferase reporters, HA–Gli1 and the indicated amounts of GFP, GFP–USP21 or GFP–USP21CS plasmids. Protein expression was assessed by western blotting (IB, immunoblot) for GFP. (GFP, n =5; USP21 and USP21CS, n =6; mean±s.d.; one-way ANOVA and Dunnett's test, ** P
    Primer for first strand cDNA synthesis of mRNAs
    https://www.bioz.com/result/oligo dt primer/product/Promega
    Average 99 stars, based on 317 article reviews
    Price from $9.99 to $1999.99
    oligo dt primer - by Bioz Stars, 2020-09
    99/100 stars

    Images

    1) Product Images from "The centrosomal deubiquitylase USP21 regulates Gli1 transcriptional activity and stability"

    Article Title: The centrosomal deubiquitylase USP21 regulates Gli1 transcriptional activity and stability

    Journal: Journal of Cell Science

    doi: 10.1242/jcs.188516

    USP21 modulates Hh signaling and Gli1 transcriptional activity. (A) NIH3T3 cells were treated with USP21-targeting siRNA oligonucleotides (#10, #11, #12) or a non-targeting control (NT3), serum-starved and then incubated with SAG (100 nM) for 4 h before mRNA extraction. USP21 and Gli1 mRNA levels were measured by performing quantitative reverse-transcription PCR and normalised to RNA levels of Pol2 ( n =3 independent experiments, mean±s.d.). x -axis labels given in bottom panel also apply to the top panel. (B) HEK293T cells were treated with USP21-targeting siRNA oligonucleotides (#5, #6) or non-targeting control oligo (NT3), or were treated with transfection reagent alone (Mock). 24 h before lysis, cells were transfected with Gli-responsive firefly luciferase and Renilla luciferase reporters (pGLB3B-12Gli-Luc and pRL-Renilla-TK), as well as with a Gli1 expression construct (HA–Gli1). Efficiency of the knockdown was assessed by western blotting ( n =2, bars show the range). (C) HEK293T cells were transfected with Gli-responsive firefly luciferase, Renilla luciferase reporters, HA–Gli1 and the indicated amounts of GFP, GFP–USP21 or GFP–USP21CS plasmids. Protein expression was assessed by western blotting (IB, immunoblot) for GFP. (GFP, n =5; USP21 and USP21CS, n =6; mean±s.d.; one-way ANOVA and Dunnett's test, ** P
    Figure Legend Snippet: USP21 modulates Hh signaling and Gli1 transcriptional activity. (A) NIH3T3 cells were treated with USP21-targeting siRNA oligonucleotides (#10, #11, #12) or a non-targeting control (NT3), serum-starved and then incubated with SAG (100 nM) for 4 h before mRNA extraction. USP21 and Gli1 mRNA levels were measured by performing quantitative reverse-transcription PCR and normalised to RNA levels of Pol2 ( n =3 independent experiments, mean±s.d.). x -axis labels given in bottom panel also apply to the top panel. (B) HEK293T cells were treated with USP21-targeting siRNA oligonucleotides (#5, #6) or non-targeting control oligo (NT3), or were treated with transfection reagent alone (Mock). 24 h before lysis, cells were transfected with Gli-responsive firefly luciferase and Renilla luciferase reporters (pGLB3B-12Gli-Luc and pRL-Renilla-TK), as well as with a Gli1 expression construct (HA–Gli1). Efficiency of the knockdown was assessed by western blotting ( n =2, bars show the range). (C) HEK293T cells were transfected with Gli-responsive firefly luciferase, Renilla luciferase reporters, HA–Gli1 and the indicated amounts of GFP, GFP–USP21 or GFP–USP21CS plasmids. Protein expression was assessed by western blotting (IB, immunoblot) for GFP. (GFP, n =5; USP21 and USP21CS, n =6; mean±s.d.; one-way ANOVA and Dunnett's test, ** P

    Techniques Used: Activity Assay, Incubation, Polymerase Chain Reaction, Transfection, Lysis, Luciferase, Expressing, Construct, Western Blot

    2) Product Images from "Bidirectional FcRn-dependent IgG transport in a polarized human intestinal epithelial cell line"

    Article Title: Bidirectional FcRn-dependent IgG transport in a polarized human intestinal epithelial cell line

    Journal: Journal of Clinical Investigation

    doi:

    FcRn expression in normal adult human small intestine and human intestinal epithelial cell lines. Western blots of total cellular protein (13 μg protein per lane, a ; 10 μg protein per lane, b ) isolated from the indicated source using affinity-purified rabbit antisera raised against amino acids 112–125 ( a ) or amino acids 174–188 ( b ). ( c ) RT-PCR detection of FcγRI transcripts. Total RNA (2 μg) from T84 (lanes 3 and 4), MOLT-4 (lanes 5 and 6; negative control), and U937 (lanes 1 and 2; positive control) cell lines was incubated with an oligo-dT primer with (odd-numbered lanes) or without (even-numbered lanes) avian myeloblastosis virus–RT (AMV-RT), and a nested PCR was performed with primers specific for FcγRI cDNA (top) or for β-actin (bottom).
    Figure Legend Snippet: FcRn expression in normal adult human small intestine and human intestinal epithelial cell lines. Western blots of total cellular protein (13 μg protein per lane, a ; 10 μg protein per lane, b ) isolated from the indicated source using affinity-purified rabbit antisera raised against amino acids 112–125 ( a ) or amino acids 174–188 ( b ). ( c ) RT-PCR detection of FcγRI transcripts. Total RNA (2 μg) from T84 (lanes 3 and 4), MOLT-4 (lanes 5 and 6; negative control), and U937 (lanes 1 and 2; positive control) cell lines was incubated with an oligo-dT primer with (odd-numbered lanes) or without (even-numbered lanes) avian myeloblastosis virus–RT (AMV-RT), and a nested PCR was performed with primers specific for FcγRI cDNA (top) or for β-actin (bottom).

    Techniques Used: Expressing, Western Blot, Isolation, Affinity Purification, Reverse Transcription Polymerase Chain Reaction, Negative Control, Positive Control, Incubation, Nested PCR

    3) Product Images from "Ovine herpesvirus-2 encoded microRNAs target virus genes involved in virus latency"

    Article Title: Ovine herpesvirus-2 encoded microRNAs target virus genes involved in virus latency

    Journal: The Journal of general virology

    doi: 10.1099/vir.0.059303-0

    A. Genomic location of ORF 20 and ORF 50 relative to adjacent genes. Genes are indicated by open boxes, arrow head represents direction of transcription. Dotted lines represent introns. The nucleotide positions representing the location of the predicted TATA box and poly A site for each gene are indicated. The position of primers used for PCR and cDNA priming (ORF 20) are indicated by arrows and nucleotide position. Predicted miRNA binding sequences are indicated by vertical bars in the respective UTRs. B. ORF 20 Lane 1, No RT; Lane 2, cDNA primed with 35 pm primer (250 ng); Lane 3, cDNA primed with 10 pm primer (66ng); Lane 4,: No template control; Lane 5, DNA positive control. Lane 6; Marker, Generuler 100bp C. ORF 50 Lane 1, No RT, Lane 2, cDNA primed with Oligo dT; Lane 3, cDNA primed with random primers; Lane 4, No template control; Lane 5, DNA positive control; Lane 6, Marker, Generuler 1kb D. ORF73 Lane 1, No RT, Lane 2, cDNA primed with Oligo dT; Lane 3, cDNA primed with random primers; Lane 4, No template control; Lane 5, DNA positive control; Lane 6, Marker, Generuler 100bp
    Figure Legend Snippet: A. Genomic location of ORF 20 and ORF 50 relative to adjacent genes. Genes are indicated by open boxes, arrow head represents direction of transcription. Dotted lines represent introns. The nucleotide positions representing the location of the predicted TATA box and poly A site for each gene are indicated. The position of primers used for PCR and cDNA priming (ORF 20) are indicated by arrows and nucleotide position. Predicted miRNA binding sequences are indicated by vertical bars in the respective UTRs. B. ORF 20 Lane 1, No RT; Lane 2, cDNA primed with 35 pm primer (250 ng); Lane 3, cDNA primed with 10 pm primer (66ng); Lane 4,: No template control; Lane 5, DNA positive control. Lane 6; Marker, Generuler 100bp C. ORF 50 Lane 1, No RT, Lane 2, cDNA primed with Oligo dT; Lane 3, cDNA primed with random primers; Lane 4, No template control; Lane 5, DNA positive control; Lane 6, Marker, Generuler 1kb D. ORF73 Lane 1, No RT, Lane 2, cDNA primed with Oligo dT; Lane 3, cDNA primed with random primers; Lane 4, No template control; Lane 5, DNA positive control; Lane 6, Marker, Generuler 100bp

    Techniques Used: Polymerase Chain Reaction, Binding Assay, Positive Control, Marker

    4) Product Images from "Ovine herpesvirus-2 encoded microRNAs target virus genes involved in virus latency"

    Article Title: Ovine herpesvirus-2 encoded microRNAs target virus genes involved in virus latency

    Journal: The Journal of general virology

    doi: 10.1099/vir.0.059303-0

    A. Genomic location of ORF 20 and ORF 50 relative to adjacent genes. Genes are indicated by open boxes, arrow head represents direction of transcription. Dotted lines represent introns. The nucleotide positions representing the location of the predicted TATA box and poly A site for each gene are indicated. The position of primers used for PCR and cDNA priming (ORF 20) are indicated by arrows and nucleotide position. Predicted miRNA binding sequences are indicated by vertical bars in the respective UTRs. B. ORF 20 Lane 1, No RT; Lane 2, cDNA primed with 35 pm primer (250 ng); Lane 3, cDNA primed with 10 pm primer (66ng); Lane 4,: No template control; Lane 5, DNA positive control. Lane 6; Marker, Generuler 100bp C. ORF 50 Lane 1, No RT, Lane 2, cDNA primed with Oligo dT; Lane 3, cDNA primed with random primers; Lane 4, No template control; Lane 5, DNA positive control; Lane 6, Marker, Generuler 1kb D. ORF73 Lane 1, No RT, Lane 2, cDNA primed with Oligo dT; Lane 3, cDNA primed with random primers; Lane 4, No template control; Lane 5, DNA positive control; Lane 6, Marker, Generuler 100bp
    Figure Legend Snippet: A. Genomic location of ORF 20 and ORF 50 relative to adjacent genes. Genes are indicated by open boxes, arrow head represents direction of transcription. Dotted lines represent introns. The nucleotide positions representing the location of the predicted TATA box and poly A site for each gene are indicated. The position of primers used for PCR and cDNA priming (ORF 20) are indicated by arrows and nucleotide position. Predicted miRNA binding sequences are indicated by vertical bars in the respective UTRs. B. ORF 20 Lane 1, No RT; Lane 2, cDNA primed with 35 pm primer (250 ng); Lane 3, cDNA primed with 10 pm primer (66ng); Lane 4,: No template control; Lane 5, DNA positive control. Lane 6; Marker, Generuler 100bp C. ORF 50 Lane 1, No RT, Lane 2, cDNA primed with Oligo dT; Lane 3, cDNA primed with random primers; Lane 4, No template control; Lane 5, DNA positive control; Lane 6, Marker, Generuler 1kb D. ORF73 Lane 1, No RT, Lane 2, cDNA primed with Oligo dT; Lane 3, cDNA primed with random primers; Lane 4, No template control; Lane 5, DNA positive control; Lane 6, Marker, Generuler 100bp

    Techniques Used: Polymerase Chain Reaction, Binding Assay, Positive Control, Marker

    5) Product Images from "The Conserved Intronic Cleavage and Polyadenylation Site of CstF-77 Gene Imparts Control of 3? End Processing Activity through Feedback Autoregulation and by U1 snRNP"

    Article Title: The Conserved Intronic Cleavage and Polyadenylation Site of CstF-77 Gene Imparts Control of 3? End Processing Activity through Feedback Autoregulation and by U1 snRNP

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1003613

    U1 snRNP regulates the usage of intronic pA of CstF-77 gene. ( A ) Regulation of expression of factors in U1 and U2 snRNPs in C2C12 differentiation. Expression analysis was based on a microarray dataset from the GEO database (GSE11415). Expression changes are represented by colors based on the scale shown at the bottom of the graph. ( B ) Effect of knockdown of U1-70K on the CstF-77.S/CstF-77.L ratio. Top, Immunoblot (IB) showing knockdown efficiency; bottom, CstF-77.S/CstF-77.L ratio as measured by RT-qPCR. P-value (T-test) comparing knockdown and control siRNA samples is shown. ( C ) and ( D ) As in (B), except that knockdowns of SF3B1 (C) and U2AF65 (D) are shown. ( E ) Inhibition of U1 snRNP interaction with 5′SS by U1D oligo. Sequence of the 5′ region of U1 snRNA is shown. The consensus sequence of the 5′SS of all RefSeq-supported human introns is represented by a sequence logo. U1D sequence is also shown (locked nucleic acid (LNA) residues are in uppercase and 2′-OMe RNA residues are in lowercase, see Materials and Methods for detail). ( F ) Effect of U1D on the CstF-77.S/CstF-77.L ratio. ( G ) Effect of U1D on the (isoform P)/(isoform S) ratio for pRinG-77S-1690. ( H ) The (isoform P)/(isoform S) ratios for pRinG-77S-1690 vectors with weak or medium strength 5′SS in proliferating and differentiating (1 day of differentiation) cells. See Figure 2D for 5′SS sequences. The ratio of the log 2 (P/S) value from proliferating cells to that from differentiating cells is indicated, where P represents the abundance of isoform P and S the abundance of isoform S. The difference in log 2 (P/S) value (proliferating cells vs. differentiating cells) is statistically significant ( P
    Figure Legend Snippet: U1 snRNP regulates the usage of intronic pA of CstF-77 gene. ( A ) Regulation of expression of factors in U1 and U2 snRNPs in C2C12 differentiation. Expression analysis was based on a microarray dataset from the GEO database (GSE11415). Expression changes are represented by colors based on the scale shown at the bottom of the graph. ( B ) Effect of knockdown of U1-70K on the CstF-77.S/CstF-77.L ratio. Top, Immunoblot (IB) showing knockdown efficiency; bottom, CstF-77.S/CstF-77.L ratio as measured by RT-qPCR. P-value (T-test) comparing knockdown and control siRNA samples is shown. ( C ) and ( D ) As in (B), except that knockdowns of SF3B1 (C) and U2AF65 (D) are shown. ( E ) Inhibition of U1 snRNP interaction with 5′SS by U1D oligo. Sequence of the 5′ region of U1 snRNA is shown. The consensus sequence of the 5′SS of all RefSeq-supported human introns is represented by a sequence logo. U1D sequence is also shown (locked nucleic acid (LNA) residues are in uppercase and 2′-OMe RNA residues are in lowercase, see Materials and Methods for detail). ( F ) Effect of U1D on the CstF-77.S/CstF-77.L ratio. ( G ) Effect of U1D on the (isoform P)/(isoform S) ratio for pRinG-77S-1690. ( H ) The (isoform P)/(isoform S) ratios for pRinG-77S-1690 vectors with weak or medium strength 5′SS in proliferating and differentiating (1 day of differentiation) cells. See Figure 2D for 5′SS sequences. The ratio of the log 2 (P/S) value from proliferating cells to that from differentiating cells is indicated, where P represents the abundance of isoform P and S the abundance of isoform S. The difference in log 2 (P/S) value (proliferating cells vs. differentiating cells) is statistically significant ( P

    Techniques Used: Expressing, Microarray, Quantitative RT-PCR, T-Test, Inhibition, Sequencing

    Related Articles

    RNA Extraction:

    Article Title: Skeletal muscle atrophy is attenuated in tumor-bearing mice under chemotherapy by treatment with fish oil and selenium
    Article Snippet: .. RNA extraction and RT-qPCR Total tumor RNA was extracted with a commercially available RNA mini kit (Qiagen); cDNA was synthesized using the M-MLV reverse transcriptase (Promega) and the oligo-dT15-primer (Promega). .. Real-time qPCR primers were designed using the Primer3 webware; electrophoresis was performed to verify DNA products.

    Synthesized:

    Article Title: TGN/EE SNARE protein SYP61 is ubiquitinated and required for carbon/nitrogen-nutrient responses in Arabidopsis
    Article Snippet: .. Then, the cDNA was synthesized using oligo(dT) primer (Promega) with 18S rRNA specific primer and ReverTraAce reverse transcriptase (Toyobo). qRT–PCR analysis was performed using SYBR premix Ex Taq (TaKaRa) and Mx3000P (Agilent Technologies) according to the manufacture’s protocol. ..

    Article Title: Skeletal muscle atrophy is attenuated in tumor-bearing mice under chemotherapy by treatment with fish oil and selenium
    Article Snippet: .. RNA extraction and RT-qPCR Total tumor RNA was extracted with a commercially available RNA mini kit (Qiagen); cDNA was synthesized using the M-MLV reverse transcriptase (Promega) and the oligo-dT15-primer (Promega). .. Real-time qPCR primers were designed using the Primer3 webware; electrophoresis was performed to verify DNA products.

    Isolation:

    Article Title: CONNEXIN47, CONNEXIN29 AND CONNEXIN32 CO-EXPRESSION IN OLIGODENDROCYTES AND Cx47 ASSOCIATION WITH ZONULA OCCLUDENS-1 (ZO-1) IN MOUSE BRAIN
    Article Snippet: .. Total RNA was isolated from adult mouse brain using the guanidine isothiocyanate method and reverse transcription using 500 ng oligo(dT)15 primer (Promega, Madison, WI, USA) was conducted as previously described ( ; ). .. Oligonucleotide primers, materials for amplifying mouse Cx47 coding sequence, and transfection reagents were purchased from Gibco BRL Life Technologies (Burlington, Ontario, Canada).

    Generated:

    Article Title: Three-Dimensional In Vitro Tri-Culture Platform to Investigate Effects of Crosstalk Between Mesenchymal Stem Cells, Osteoblasts, and Adipocytes
    Article Snippet: .. These blocks were homogenized in microcentrifuge tubes with pellet grinders, after which mRNA was extracted using a QIAshredder tissue homogenizer and RNeasy kit with DNase I digestion (Qiagen). cDNA was generated using SuperScript III Reverse Transcriptase (Invitrogen) with Oligo(dT)15 primers and dNTPs (Promega). .. Gene expression of each cell type was analyzed for target mesenchymal lineage genes using custom-designed primers ( ) with quantitative PCR amplification performed on a StepOnePlus™ Real-Time PCR System (Applied Biosystems) in the presence of SYBR Green/ROX master mix (Applied Biosystems).

    Quantitative RT-PCR:

    Article Title: TGN/EE SNARE protein SYP61 is ubiquitinated and required for carbon/nitrogen-nutrient responses in Arabidopsis
    Article Snippet: .. Then, the cDNA was synthesized using oligo(dT) primer (Promega) with 18S rRNA specific primer and ReverTraAce reverse transcriptase (Toyobo). qRT–PCR analysis was performed using SYBR premix Ex Taq (TaKaRa) and Mx3000P (Agilent Technologies) according to the manufacture’s protocol. ..

    Article Title: Skeletal muscle atrophy is attenuated in tumor-bearing mice under chemotherapy by treatment with fish oil and selenium
    Article Snippet: .. RNA extraction and RT-qPCR Total tumor RNA was extracted with a commercially available RNA mini kit (Qiagen); cDNA was synthesized using the M-MLV reverse transcriptase (Promega) and the oligo-dT15-primer (Promega). .. Real-time qPCR primers were designed using the Primer3 webware; electrophoresis was performed to verify DNA products.

    Real-time Polymerase Chain Reaction:

    Article Title: Selective 14-3-3γ induction quenches p-β-catenin Ser37/Bax-enhanced cell death in cerebral cortical neurons during ischemia
    Article Snippet: .. Total RNA (2 μ g) was used to perform RT by using M-MLV transcriptase (Promega, Fitchburg, WI, USA) and oligo (dT15) primer (Promega) in a total volume of 20 μ l. Conventional PCR and qPCR were performed as described previously using β -actin as the internal control. .. The primers used in PCR were Bax: 5′-CAGGATGCGTCCACCAAGAA-3′ and 5′-GCAAAGTAGAAGAGGGCAACCAC-3′ Bad: 5′-GCAGCCACCAACAGTCATCAT-3′ and 5′-CAAACTCATCGCTCATCCTTCG-3′ Bcl-2: 5′-CGCTACCGTCGTGACTTCGC-3′ and 5′-CATCCCAGCCTCCGTTATCC-3′ Bcl-xL : 5′-TGCGTGGAAAGCGTAGACAAGG-3′ and 5′-TGAAGAGTGAGCCCAGCAGAAC-3′ myeloid cell leukemia sequence-1 (MCL-1): 5′-CTCTTATTTCTTTCGGTGCCTTTG-3′ and 5′-CCAGTCCCGTTTCGTCCTTACA-3′, β -actin: 5′-CAGCCTTCCTTCTTGGGTAT-3′ and 5′-GCTCAGTAACAGTCCGCCTA-3′.

    Article Title: Mouse Spermatocytes Express CYP2E1 and Respond to Acrylamide Exposure
    Article Snippet: .. Oligo(dT)15 primer, RNasin, dNTPs, M-MLV-Reverse Transcriptase, RQ1 DNase, GoTaq Flexi, MgCl2 and GoTaq quantitative PCR master mix were obtained from Promega (Madison, WI). .. DNA repair endonucleases, formamidopyrimidine-DNA glycosylase (FPG) and 8-oxoguanine DNA glycosylase (hOGG1) were purchased from New England Biolabs Inc. (Arundel, Qld).

    Random Hexamer Labeling:

    Article Title: The CK2 Kinase Stabilizes CLOCK and Represses Its Activity in the Drosophila Circadian Oscillator
    Article Snippet: .. One µg of total RNA was reverse-transcribed in a 50 µl final reaction in presence of 0.4 µM oligodT(15) or random hexamer primers (for detection of pre-mRNA-s), 8 mM dNTP, 40 units of RNasine, and 400 units of M-MLV RTase H-minus (Promega), during 3 h at 37°C. .. Quantitative PCR was performed with a Roche LightCycler (mRNA-s) or an Applied Biosystems 7900HT Fast Real-Time PCR System (pre-mRNA-s) using the SYBR green detection protocol of the manufacturer.

    Polymerase Chain Reaction:

    Article Title: Selective 14-3-3γ induction quenches p-β-catenin Ser37/Bax-enhanced cell death in cerebral cortical neurons during ischemia
    Article Snippet: .. Total RNA (2 μ g) was used to perform RT by using M-MLV transcriptase (Promega, Fitchburg, WI, USA) and oligo (dT15) primer (Promega) in a total volume of 20 μ l. Conventional PCR and qPCR were performed as described previously using β -actin as the internal control. .. The primers used in PCR were Bax: 5′-CAGGATGCGTCCACCAAGAA-3′ and 5′-GCAAAGTAGAAGAGGGCAACCAC-3′ Bad: 5′-GCAGCCACCAACAGTCATCAT-3′ and 5′-CAAACTCATCGCTCATCCTTCG-3′ Bcl-2: 5′-CGCTACCGTCGTGACTTCGC-3′ and 5′-CATCCCAGCCTCCGTTATCC-3′ Bcl-xL : 5′-TGCGTGGAAAGCGTAGACAAGG-3′ and 5′-TGAAGAGTGAGCCCAGCAGAAC-3′ myeloid cell leukemia sequence-1 (MCL-1): 5′-CTCTTATTTCTTTCGGTGCCTTTG-3′ and 5′-CCAGTCCCGTTTCGTCCTTACA-3′, β -actin: 5′-CAGCCTTCCTTCTTGGGTAT-3′ and 5′-GCTCAGTAACAGTCCGCCTA-3′.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Promega oligo dt primer
    USP21 modulates Hh signaling and Gli1 transcriptional activity. (A) NIH3T3 cells were treated with USP21-targeting siRNA oligonucleotides (#10, #11, #12) or a non-targeting control (NT3), serum-starved and then incubated with SAG (100 nM) for 4 h before mRNA extraction. USP21 and Gli1 mRNA levels were measured by performing quantitative reverse-transcription PCR and normalised to <t>RNA</t> levels of Pol2 ( n =3 independent experiments, mean±s.d.). x -axis labels given in bottom panel also apply to the top panel. (B) HEK293T cells were treated with USP21-targeting siRNA oligonucleotides (#5, #6) or non-targeting control <t>oligo</t> (NT3), or were treated with transfection reagent alone (Mock). 24 h before lysis, cells were transfected with Gli-responsive firefly luciferase and Renilla luciferase reporters (pGLB3B-12Gli-Luc and pRL-Renilla-TK), as well as with a Gli1 expression construct (HA–Gli1). Efficiency of the knockdown was assessed by western blotting ( n =2, bars show the range). (C) HEK293T cells were transfected with Gli-responsive firefly luciferase, Renilla luciferase reporters, HA–Gli1 and the indicated amounts of GFP, GFP–USP21 or GFP–USP21CS plasmids. Protein expression was assessed by western blotting (IB, immunoblot) for GFP. (GFP, n =5; USP21 and USP21CS, n =6; mean±s.d.; one-way ANOVA and Dunnett's test, ** P
    Oligo Dt Primer, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 317 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo dt primer/product/Promega
    Average 99 stars, based on 317 article reviews
    Price from $9.99 to $1999.99
    oligo dt primer - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    91
    Promega oligo dt primed cdna
    Detection of BdCESA antisense transcripts. Tagged SS-RT-PCR was performed to detect antisense transcripts in Brachypodium . First-strand <t>cDNA</t> was prepared using either tagged, sense GSPs for either BdCESA s 1, 2, 4-9 (Antisense; NRT), <t>oligo</t> dT primers (Sense; Tag), or no primer at all (NPC). Untagged antisense GSPs and the tag2 primer were used for amplification of the Antisense, Tag, NPC, and NRT samples. For the sense amplification, untagged antisense GSPs were used with oligo dT primed cDNAs. PCR products were confirmed by DNA sequencing. See Table S1 for individual primer sequences.
    Oligo Dt Primed Cdna, supplied by Promega, used in various techniques. Bioz Stars score: 91/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo dt primed cdna/product/Promega
    Average 91 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    oligo dt primed cdna - by Bioz Stars, 2020-09
    91/100 stars
      Buy from Supplier

    Image Search Results


    USP21 modulates Hh signaling and Gli1 transcriptional activity. (A) NIH3T3 cells were treated with USP21-targeting siRNA oligonucleotides (#10, #11, #12) or a non-targeting control (NT3), serum-starved and then incubated with SAG (100 nM) for 4 h before mRNA extraction. USP21 and Gli1 mRNA levels were measured by performing quantitative reverse-transcription PCR and normalised to RNA levels of Pol2 ( n =3 independent experiments, mean±s.d.). x -axis labels given in bottom panel also apply to the top panel. (B) HEK293T cells were treated with USP21-targeting siRNA oligonucleotides (#5, #6) or non-targeting control oligo (NT3), or were treated with transfection reagent alone (Mock). 24 h before lysis, cells were transfected with Gli-responsive firefly luciferase and Renilla luciferase reporters (pGLB3B-12Gli-Luc and pRL-Renilla-TK), as well as with a Gli1 expression construct (HA–Gli1). Efficiency of the knockdown was assessed by western blotting ( n =2, bars show the range). (C) HEK293T cells were transfected with Gli-responsive firefly luciferase, Renilla luciferase reporters, HA–Gli1 and the indicated amounts of GFP, GFP–USP21 or GFP–USP21CS plasmids. Protein expression was assessed by western blotting (IB, immunoblot) for GFP. (GFP, n =5; USP21 and USP21CS, n =6; mean±s.d.; one-way ANOVA and Dunnett's test, ** P

    Journal: Journal of Cell Science

    Article Title: The centrosomal deubiquitylase USP21 regulates Gli1 transcriptional activity and stability

    doi: 10.1242/jcs.188516

    Figure Lengend Snippet: USP21 modulates Hh signaling and Gli1 transcriptional activity. (A) NIH3T3 cells were treated with USP21-targeting siRNA oligonucleotides (#10, #11, #12) or a non-targeting control (NT3), serum-starved and then incubated with SAG (100 nM) for 4 h before mRNA extraction. USP21 and Gli1 mRNA levels were measured by performing quantitative reverse-transcription PCR and normalised to RNA levels of Pol2 ( n =3 independent experiments, mean±s.d.). x -axis labels given in bottom panel also apply to the top panel. (B) HEK293T cells were treated with USP21-targeting siRNA oligonucleotides (#5, #6) or non-targeting control oligo (NT3), or were treated with transfection reagent alone (Mock). 24 h before lysis, cells were transfected with Gli-responsive firefly luciferase and Renilla luciferase reporters (pGLB3B-12Gli-Luc and pRL-Renilla-TK), as well as with a Gli1 expression construct (HA–Gli1). Efficiency of the knockdown was assessed by western blotting ( n =2, bars show the range). (C) HEK293T cells were transfected with Gli-responsive firefly luciferase, Renilla luciferase reporters, HA–Gli1 and the indicated amounts of GFP, GFP–USP21 or GFP–USP21CS plasmids. Protein expression was assessed by western blotting (IB, immunoblot) for GFP. (GFP, n =5; USP21 and USP21CS, n =6; mean±s.d.; one-way ANOVA and Dunnett's test, ** P

    Article Snippet: Quantitative reverse-transcription PCR Cells were lysed, and mRNA was extracted using the RNAeasy mini kit (Qiagen). cDNA synthesis was performed using 1 µg RNA with RevertAid H-minus M-MuLV reverse transcriptase (Fermentas) using an oligo-dT primer (Promega).

    Techniques: Activity Assay, Incubation, Polymerase Chain Reaction, Transfection, Lysis, Luciferase, Expressing, Construct, Western Blot

    FcRn expression in normal adult human small intestine and human intestinal epithelial cell lines. Western blots of total cellular protein (13 μg protein per lane, a ; 10 μg protein per lane, b ) isolated from the indicated source using affinity-purified rabbit antisera raised against amino acids 112–125 ( a ) or amino acids 174–188 ( b ). ( c ) RT-PCR detection of FcγRI transcripts. Total RNA (2 μg) from T84 (lanes 3 and 4), MOLT-4 (lanes 5 and 6; negative control), and U937 (lanes 1 and 2; positive control) cell lines was incubated with an oligo-dT primer with (odd-numbered lanes) or without (even-numbered lanes) avian myeloblastosis virus–RT (AMV-RT), and a nested PCR was performed with primers specific for FcγRI cDNA (top) or for β-actin (bottom).

    Journal: Journal of Clinical Investigation

    Article Title: Bidirectional FcRn-dependent IgG transport in a polarized human intestinal epithelial cell line

    doi:

    Figure Lengend Snippet: FcRn expression in normal adult human small intestine and human intestinal epithelial cell lines. Western blots of total cellular protein (13 μg protein per lane, a ; 10 μg protein per lane, b ) isolated from the indicated source using affinity-purified rabbit antisera raised against amino acids 112–125 ( a ) or amino acids 174–188 ( b ). ( c ) RT-PCR detection of FcγRI transcripts. Total RNA (2 μg) from T84 (lanes 3 and 4), MOLT-4 (lanes 5 and 6; negative control), and U937 (lanes 1 and 2; positive control) cell lines was incubated with an oligo-dT primer with (odd-numbered lanes) or without (even-numbered lanes) avian myeloblastosis virus–RT (AMV-RT), and a nested PCR was performed with primers specific for FcγRI cDNA (top) or for β-actin (bottom).

    Article Snippet: RNA (2 μg) was reverse-transcribed to cDNA with an oligo-dT primer (Promega Corp., Madison, Wisconsin, USA) and avian myeloblastosis virus reverse transcriptase (Promega Corp.).

    Techniques: Expressing, Western Blot, Isolation, Affinity Purification, Reverse Transcription Polymerase Chain Reaction, Negative Control, Positive Control, Incubation, Nested PCR

    A. Genomic location of ORF 20 and ORF 50 relative to adjacent genes. Genes are indicated by open boxes, arrow head represents direction of transcription. Dotted lines represent introns. The nucleotide positions representing the location of the predicted TATA box and poly A site for each gene are indicated. The position of primers used for PCR and cDNA priming (ORF 20) are indicated by arrows and nucleotide position. Predicted miRNA binding sequences are indicated by vertical bars in the respective UTRs. B. ORF 20 Lane 1, No RT; Lane 2, cDNA primed with 35 pm primer (250 ng); Lane 3, cDNA primed with 10 pm primer (66ng); Lane 4,: No template control; Lane 5, DNA positive control. Lane 6; Marker, Generuler 100bp C. ORF 50 Lane 1, No RT, Lane 2, cDNA primed with Oligo dT; Lane 3, cDNA primed with random primers; Lane 4, No template control; Lane 5, DNA positive control; Lane 6, Marker, Generuler 1kb D. ORF73 Lane 1, No RT, Lane 2, cDNA primed with Oligo dT; Lane 3, cDNA primed with random primers; Lane 4, No template control; Lane 5, DNA positive control; Lane 6, Marker, Generuler 100bp

    Journal: The Journal of general virology

    Article Title: Ovine herpesvirus-2 encoded microRNAs target virus genes involved in virus latency

    doi: 10.1099/vir.0.059303-0

    Figure Lengend Snippet: A. Genomic location of ORF 20 and ORF 50 relative to adjacent genes. Genes are indicated by open boxes, arrow head represents direction of transcription. Dotted lines represent introns. The nucleotide positions representing the location of the predicted TATA box and poly A site for each gene are indicated. The position of primers used for PCR and cDNA priming (ORF 20) are indicated by arrows and nucleotide position. Predicted miRNA binding sequences are indicated by vertical bars in the respective UTRs. B. ORF 20 Lane 1, No RT; Lane 2, cDNA primed with 35 pm primer (250 ng); Lane 3, cDNA primed with 10 pm primer (66ng); Lane 4,: No template control; Lane 5, DNA positive control. Lane 6; Marker, Generuler 100bp C. ORF 50 Lane 1, No RT, Lane 2, cDNA primed with Oligo dT; Lane 3, cDNA primed with random primers; Lane 4, No template control; Lane 5, DNA positive control; Lane 6, Marker, Generuler 1kb D. ORF73 Lane 1, No RT, Lane 2, cDNA primed with Oligo dT; Lane 3, cDNA primed with random primers; Lane 4, No template control; Lane 5, DNA positive control; Lane 6, Marker, Generuler 100bp

    Article Snippet: 1 μg of RNA was digested with RQ1 Dnase (Promega) for 30 min at 37 °C. cDNA was primed using 250ng Oligo dT primer (Promega; equivalent to 0.5 μg/μg RNA) and synthesized using AMV reverse transcriptase for 1 hr at 42 °C.

    Techniques: Polymerase Chain Reaction, Binding Assay, Positive Control, Marker

    Detection of BdCESA antisense transcripts. Tagged SS-RT-PCR was performed to detect antisense transcripts in Brachypodium . First-strand cDNA was prepared using either tagged, sense GSPs for either BdCESA s 1, 2, 4-9 (Antisense; NRT), oligo dT primers (Sense; Tag), or no primer at all (NPC). Untagged antisense GSPs and the tag2 primer were used for amplification of the Antisense, Tag, NPC, and NRT samples. For the sense amplification, untagged antisense GSPs were used with oligo dT primed cDNAs. PCR products were confirmed by DNA sequencing. See Table S1 for individual primer sequences.

    Journal: bioRxiv

    Article Title: Post-transcriptional regulation of cellulose synthase genes by small RNAs derived from CESA antisense transcripts

    doi: 10.1101/2020.04.30.070854

    Figure Lengend Snippet: Detection of BdCESA antisense transcripts. Tagged SS-RT-PCR was performed to detect antisense transcripts in Brachypodium . First-strand cDNA was prepared using either tagged, sense GSPs for either BdCESA s 1, 2, 4-9 (Antisense; NRT), oligo dT primers (Sense; Tag), or no primer at all (NPC). Untagged antisense GSPs and the tag2 primer were used for amplification of the Antisense, Tag, NPC, and NRT samples. For the sense amplification, untagged antisense GSPs were used with oligo dT primed cDNAs. PCR products were confirmed by DNA sequencing. See Table S1 for individual primer sequences.

    Article Snippet: Design of HvCESA1 RPA Probes A 400-base pair region inside the sequence of the HvCESA1 antisense was amplified by RT-PCR from an oligo dT primed cDNA using 5’TAAGCGCCCAGCTTTCAA and 5’ GATACCTCCAATGACCCAGAAC oligonucleotide primers and GoTaq Green polymerase (Promega).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Amplification, Polymerase Chain Reaction, DNA Sequencing

    A survey of the HvCESA family for antisense transcripts. (A) Schematic representation of tagged, SS-RT-PCR for antisense transcript detection. First strand cDNA synthesis uses a sense gene specific primer (GSP) that is reverse-complementary only to putative antisense transcripts. To minimize PCR artifacts, a unique tag is added to the 5’ end of the sense GSP for first strand cDNA synthesis. Tagged cDNA is amplified with an antisense GSP and the tag primer. Thus, only bona fide antisense transcripts will be amplified. (B) Tagged, SS-RT-PCR of barley third leaf RNA for the detection of HvCESA antisense transcripts. PCR was performed with antisense GSPs and tag primer for Antisense, Tag control, no-primer control (NPC), and no RT (NRT) control samples. Sense transcripts were amplified using both antisense and (untagged) sense GSPs from oligo dT primed cDNA. Identity of the tagged, antisense PCR products was confirmed by DNA sequencing. See Table S1 for individual primer sequences.

    Journal: bioRxiv

    Article Title: Post-transcriptional regulation of cellulose synthase genes by small RNAs derived from CESA antisense transcripts

    doi: 10.1101/2020.04.30.070854

    Figure Lengend Snippet: A survey of the HvCESA family for antisense transcripts. (A) Schematic representation of tagged, SS-RT-PCR for antisense transcript detection. First strand cDNA synthesis uses a sense gene specific primer (GSP) that is reverse-complementary only to putative antisense transcripts. To minimize PCR artifacts, a unique tag is added to the 5’ end of the sense GSP for first strand cDNA synthesis. Tagged cDNA is amplified with an antisense GSP and the tag primer. Thus, only bona fide antisense transcripts will be amplified. (B) Tagged, SS-RT-PCR of barley third leaf RNA for the detection of HvCESA antisense transcripts. PCR was performed with antisense GSPs and tag primer for Antisense, Tag control, no-primer control (NPC), and no RT (NRT) control samples. Sense transcripts were amplified using both antisense and (untagged) sense GSPs from oligo dT primed cDNA. Identity of the tagged, antisense PCR products was confirmed by DNA sequencing. See Table S1 for individual primer sequences.

    Article Snippet: Design of HvCESA1 RPA Probes A 400-base pair region inside the sequence of the HvCESA1 antisense was amplified by RT-PCR from an oligo dT primed cDNA using 5’TAAGCGCCCAGCTTTCAA and 5’ GATACCTCCAATGACCCAGAAC oligonucleotide primers and GoTaq Green polymerase (Promega).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Amplification, DNA Sequencing