oligo dt poly a cellulose step  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Custom DNA and RNA Oligos
    Description:
    To place your order click here
    Catalog Number:
    oligo
    Price:
    None
    Buy from Supplier


    Structured Review

    Millipore oligo dt poly a cellulose step
    Custom DNA and RNA Oligos
    To place your order click here
    https://www.bioz.com/result/oligo dt poly a cellulose step/product/Millipore
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    oligo dt poly a cellulose step - by Bioz Stars, 2020-04
    99/100 stars

    Images

    Related Articles

    Immunocytochemistry:

    Article Title: A Flow Cytometry-Based Screen of Nuclear Envelope Transmembrane Proteins Identifies NET4/Tmem53 as Involved in Stress-Dependent Cell Cycle Withdrawal
    Article Snippet: The cells were transfected with either 8 µg of siRNA oligo or 12 µg of esiRNA (esiRNA human TMEM53, Sigma) and plated to 10 cm dishes with several coverslips. .. At 48 or 72 h coverslips were removed and fixed for immunocytochemistry and the remaining cells on the plate were harvested by trypsinization and lysed in sample buffer for SDS-PAGE and Western blotting.

    Whole Genome Amplification:

    Article Title: Multiplexed Proteome Dynamics Profiling Reveals Mechanisms Controlling Protein Homeostasis
    Article Snippet: Cells were treated with either vehicle, JQ1-Az (10 μM), JQ1-VHL PROTAC (1 μM), JQ1-VHL PROTAC (10 μM) or IBET151-PROTAC (10 μM) for 6 h and afterward RNA fluorescence in situ hybridization (FISH) was performed according to a published procedure ( ) using a 50bp Cy3-labeled oligo dT probe (Sigma) detecting poly(A)+ RNA with following variations: 15% formamide was used instead of 50%, and THP-1 cells were immobilized on microscopy slides after fixation using Cytospin (1500 rpm, 5 min, Thermo Fisher). .. Additionally, staining with Hoechst 33258 (Sigma) and Wheat Germ Agglutinin (WGA) Alexa Fluor 647 Conjugate (Life Technologies) was performed to enable quantification of the data.

    Synthesized:

    Article Title: RecA stimulates AlkB-mediated direct repair of DNA adducts
    Article Snippet: .. In brief, 40 μg of chemically synthesized 40-mer oligo-dC (Imperial Life science) was treated with 5% (v/v) (0.59 M) MMS (Sigma, 129 925) in a final volume of 500 μl in presence of 200 mM K2 HPO4 for 14 h at room temperature. .. The methylated DNA was not purified directly by using ethanol precipitation as it resulted poor yield.

    Article Title: Genome-wide discovery of G-quadruplex forming sequences and their functional relevance in plants
    Article Snippet: .. Validation of G-quadruplex structure formation The selected DNA oligos were synthesized commercially (Sigma). ..

    Cytometry:

    Article Title: Oligo-Fucoidan prevents IL-6 and CCL2 production and cooperates with p53 to suppress ATM signaling and tumor progression
    Article Snippet: Cell cycle analysis HCT116 cells (1 × 106 ) were treated with Oligo-Fucoidan (400 μg/ml) and/or etoposide (40 μM) for 48 h. The cells were subsequently fixed with 70% ethanol at −20 °C for 1 h and incubated with 0.1% (v/v) Triton X-100 (Sigma-Aldrich), 5 μg/ml DNase-free RNase A (Sigma-Aldrich) and 10 μg/ml propidium iodide (PI) (Thermo Fisher Scientific) in PBS in the dark for 20 min at room temperature. .. PI fluorescence was analyzed by a FACSCalibur flow cytometer on the FL2 emission channel at an excitation wavelength of 488 nm.

    Construct:

    Article Title: In situ imaging and isolation of proteins using dsDNA oligonucleotides
    Article Snippet: .. For construction of functionalized dsDNA oligos recognized by LacI, two 41 bp single-stranded oligonucleotides were constructed encoding the symmetrical Lac operator 19 bp core sequence O-Sym ( ): O-Sym-1 (* gcgtgtgccagaattgtgagcgctcacaatttcttgaatct) and O-Sym-2 (* agattcaagaaattgtgagcgctcacaattctggctcacgc); where * represents a 5′ modification with either biotin, Cy3 or a disulfide group linked via a (CH2 )6 spacer (Sigma). ..

    Article Title: Species difference in ANP32A underlies influenza A virus polymerase host restriction
    Article Snippet: 48hrs later cells were transfected with polymerase and minigenome constructs and harvested after a further 20hrs, for luciferase quantification and knockdown analysis. .. Total RNA was extracted as described previously but with 100μl of cell lysate added to AVL buffer before continuing with the RNeasy mini kit (Qiagen). siRNAs for target genes were as follows:, AllStars Negative Control, huANP32A (SI02655212 FlexiTube), huANP32B (SI02655380 FlexiTube) (Qiagen), 50-92 NP (5’-AAGGAUCUUAUUUCUUCGGAG-3’), chANP32A (5’-GAGCTGGAATTCTTGAGTACA-3’) (custom RNA oligos, Sigma-Aldrich).

    Incubation:

    Article Title: Oligo-Fucoidan prevents IL-6 and CCL2 production and cooperates with p53 to suppress ATM signaling and tumor progression
    Article Snippet: .. Cell cycle analysis HCT116 cells (1 × 106 ) were treated with Oligo-Fucoidan (400 μg/ml) and/or etoposide (40 μM) for 48 h. The cells were subsequently fixed with 70% ethanol at −20 °C for 1 h and incubated with 0.1% (v/v) Triton X-100 (Sigma-Aldrich), 5 μg/ml DNase-free RNase A (Sigma-Aldrich) and 10 μg/ml propidium iodide (PI) (Thermo Fisher Scientific) in PBS in the dark for 20 min at room temperature. .. PI fluorescence was analyzed by a FACSCalibur flow cytometer on the FL2 emission channel at an excitation wavelength of 488 nm.

    Article Title: Maternal Glucose Supplementation in a Murine Model of Chorioamnionitis Alleviates Dysregulation of Autophagy in Fetal Brain
    Article Snippet: .. Brain tissues were incubated with following primary antibodies overnight at 4°C: rabbit anti–myelin basic protein (anti-MBP; Abcam) or rabbit anti-oligo 2 (Millipore, Billerica, Massachusetts). .. The next day, sections were rinsed with PBS and then incubated with donkey anti-rabbit Alexa Fluor 568 or 488 (Life Technologies, Grand Island, New York) fluorescent secondary antibody diluted in 1:500 for 3 hours at room temperature.

    Amplification:

    Article Title: Maternal Glucose Supplementation in a Murine Model of Chorioamnionitis Alleviates Dysregulation of Autophagy in Fetal Brain
    Article Snippet: Brain tissues were incubated with following primary antibodies overnight at 4°C: rabbit anti–myelin basic protein (anti-MBP; Abcam) or rabbit anti-oligo 2 (Millipore, Billerica, Massachusetts). .. For enhanced IHC staining, fetal brain sections were incubated in 1% hydrogen peroxide for 30 minutes to inactivate the endogenous peroxidase, followed by rabbit anti-LC3 incubation overnight at 4°C and then applied to tyramide signal amplification (TSA) systems (PerkinElmer, Akron, Ohio) according to the protocol of manufacture.

    Modification:

    Article Title: Hepatitis B Virus Induces Cell Proliferation via HBx-Induced microRNA-21 in Hepatocellular Carcinoma by Targeting Programmed Cell Death Protein4 (PDCD4) and Phosphatase and Tensin Homologue (PTEN)
    Article Snippet: Cell Culture and Transfection Human hepatoma cell lines HepG2, Huh7 and HepG2.2.15 were maintained in Dulbecco's modified Eagle's medium (Hi Media, India) supplemented with 10% fetal bovine serum (Invitrogen, USA) containing penicillin-streptomycin antibiotics (Invitrogen, USA) at 37°C in a humidified atmosphere with 5% CO2 . .. For transfection with pre-miRNA oligos (Sigma Aldrich, USA) or anti-miR-21, siPORT NeoFX transfection agent (Applied Biosystems, USA) was used according to the manufacturer's instructions. pSG5-HBx plasmid was used to transfect HBx gene in hepatic cells, and as a control, an empty vector was used in all the plasmid transfection experiments.

    Article Title: In situ imaging and isolation of proteins using dsDNA oligonucleotides
    Article Snippet: .. For construction of functionalized dsDNA oligos recognized by LacI, two 41 bp single-stranded oligonucleotides were constructed encoding the symmetrical Lac operator 19 bp core sequence O-Sym ( ): O-Sym-1 (* gcgtgtgccagaattgtgagcgctcacaatttcttgaatct) and O-Sym-2 (* agattcaagaaattgtgagcgctcacaattctggctcacgc); where * represents a 5′ modification with either biotin, Cy3 or a disulfide group linked via a (CH2 )6 spacer (Sigma). ..

    Article Title: RecA stimulates AlkB-mediated direct repair of DNA adducts
    Article Snippet: We modified 40-mer oligo-dC to N3-me oligo-dC by MMS treatment and used this as AlkB substrate in the repair assay. .. In brief, 40 μg of chemically synthesized 40-mer oligo-dC (Imperial Life science) was treated with 5% (v/v) (0.59 M) MMS (Sigma, 129 925) in a final volume of 500 μl in presence of 200 mM K2 HPO4 for 14 h at room temperature.

    Western Blot:

    Article Title: Hepatitis B Virus Induces Cell Proliferation via HBx-Induced microRNA-21 in Hepatocellular Carcinoma by Targeting Programmed Cell Death Protein4 (PDCD4) and Phosphatase and Tensin Homologue (PTEN)
    Article Snippet: For transfection with pre-miRNA oligos (Sigma Aldrich, USA) or anti-miR-21, siPORT NeoFX transfection agent (Applied Biosystems, USA) was used according to the manufacturer's instructions. pSG5-HBx plasmid was used to transfect HBx gene in hepatic cells, and as a control, an empty vector was used in all the plasmid transfection experiments. .. After 48 hours of transfection of HBx plasmids, the cells were collected for the Western blot experiments.

    Article Title: A Flow Cytometry-Based Screen of Nuclear Envelope Transmembrane Proteins Identifies NET4/Tmem53 as Involved in Stress-Dependent Cell Cycle Withdrawal
    Article Snippet: The cells were transfected with either 8 µg of siRNA oligo or 12 µg of esiRNA (esiRNA human TMEM53, Sigma) and plated to 10 cm dishes with several coverslips. .. At 48 or 72 h coverslips were removed and fixed for immunocytochemistry and the remaining cells on the plate were harvested by trypsinization and lysed in sample buffer for SDS-PAGE and Western blotting.

    Flow Cytometry:

    Article Title: Oligo-Fucoidan prevents IL-6 and CCL2 production and cooperates with p53 to suppress ATM signaling and tumor progression
    Article Snippet: Cell cycle analysis HCT116 cells (1 × 106 ) were treated with Oligo-Fucoidan (400 μg/ml) and/or etoposide (40 μM) for 48 h. The cells were subsequently fixed with 70% ethanol at −20 °C for 1 h and incubated with 0.1% (v/v) Triton X-100 (Sigma-Aldrich), 5 μg/ml DNase-free RNase A (Sigma-Aldrich) and 10 μg/ml propidium iodide (PI) (Thermo Fisher Scientific) in PBS in the dark for 20 min at room temperature. .. PI fluorescence was analyzed by a FACSCalibur flow cytometer on the FL2 emission channel at an excitation wavelength of 488 nm.

    Immunohistochemistry:

    Article Title: Maternal Glucose Supplementation in a Murine Model of Chorioamnionitis Alleviates Dysregulation of Autophagy in Fetal Brain
    Article Snippet: Paragraph title: Immunohistochemistry and Histology Staining ... Brain tissues were incubated with following primary antibodies overnight at 4°C: rabbit anti–myelin basic protein (anti-MBP; Abcam) or rabbit anti-oligo 2 (Millipore, Billerica, Massachusetts).

    esiRNA:

    Article Title: A Flow Cytometry-Based Screen of Nuclear Envelope Transmembrane Proteins Identifies NET4/Tmem53 as Involved in Stress-Dependent Cell Cycle Withdrawal
    Article Snippet: .. The cells were transfected with either 8 µg of siRNA oligo or 12 µg of esiRNA (esiRNA human TMEM53, Sigma) and plated to 10 cm dishes with several coverslips. .. At 48 or 72 h coverslips were removed and fixed for immunocytochemistry and the remaining cells on the plate were harvested by trypsinization and lysed in sample buffer for SDS-PAGE and Western blotting.

    Oligonucleotide Synthesis:

    Article Title: In situ imaging and isolation of proteins using dsDNA oligonucleotides
    Article Snippet: Paragraph title: Oligonucleotide synthesis and modification ... For construction of functionalized dsDNA oligos recognized by LacI, two 41 bp single-stranded oligonucleotides were constructed encoding the symmetrical Lac operator 19 bp core sequence O-Sym ( ): O-Sym-1 (* gcgtgtgccagaattgtgagcgctcacaatttcttgaatct) and O-Sym-2 (* agattcaagaaattgtgagcgctcacaattctggctcacgc); where * represents a 5′ modification with either biotin, Cy3 or a disulfide group linked via a (CH2 )6 spacer (Sigma).

    Cell Cycle Assay:

    Article Title: Oligo-Fucoidan prevents IL-6 and CCL2 production and cooperates with p53 to suppress ATM signaling and tumor progression
    Article Snippet: .. Cell cycle analysis HCT116 cells (1 × 106 ) were treated with Oligo-Fucoidan (400 μg/ml) and/or etoposide (40 μM) for 48 h. The cells were subsequently fixed with 70% ethanol at −20 °C for 1 h and incubated with 0.1% (v/v) Triton X-100 (Sigma-Aldrich), 5 μg/ml DNase-free RNase A (Sigma-Aldrich) and 10 μg/ml propidium iodide (PI) (Thermo Fisher Scientific) in PBS in the dark for 20 min at room temperature. .. PI fluorescence was analyzed by a FACSCalibur flow cytometer on the FL2 emission channel at an excitation wavelength of 488 nm.

    Cell Culture:

    Article Title: Hepatitis B Virus Induces Cell Proliferation via HBx-Induced microRNA-21 in Hepatocellular Carcinoma by Targeting Programmed Cell Death Protein4 (PDCD4) and Phosphatase and Tensin Homologue (PTEN)
    Article Snippet: Paragraph title: Cell Culture and Transfection ... For transfection with pre-miRNA oligos (Sigma Aldrich, USA) or anti-miR-21, siPORT NeoFX transfection agent (Applied Biosystems, USA) was used according to the manufacturer's instructions. pSG5-HBx plasmid was used to transfect HBx gene in hepatic cells, and as a control, an empty vector was used in all the plasmid transfection experiments.

    Article Title: A Flow Cytometry-Based Screen of Nuclear Envelope Transmembrane Proteins Identifies NET4/Tmem53 as Involved in Stress-Dependent Cell Cycle Withdrawal
    Article Snippet: Paragraph title: Cell culture and transient transfection ... The cells were transfected with either 8 µg of siRNA oligo or 12 µg of esiRNA (esiRNA human TMEM53, Sigma) and plated to 10 cm dishes with several coverslips.

    Article Title: Multiplexed Proteome Dynamics Profiling Reveals Mechanisms Controlling Protein Homeostasis
    Article Snippet: Fluorescence in situ hybridization THP-1 cells have been cultured as described above. .. Cells were treated with either vehicle, JQ1-Az (10 μM), JQ1-VHL PROTAC (1 μM), JQ1-VHL PROTAC (10 μM) or IBET151-PROTAC (10 μM) for 6 h and afterward RNA fluorescence in situ hybridization (FISH) was performed according to a published procedure ( ) using a 50bp Cy3-labeled oligo dT probe (Sigma) detecting poly(A)+ RNA with following variations: 15% formamide was used instead of 50%, and THP-1 cells were immobilized on microscopy slides after fixation using Cytospin (1500 rpm, 5 min, Thermo Fisher).

    Demethylation Assay:

    Article Title: RecA stimulates AlkB-mediated direct repair of DNA adducts
    Article Snippet: Paragraph title: Demethylation assay ... In brief, 40 μg of chemically synthesized 40-mer oligo-dC (Imperial Life science) was treated with 5% (v/v) (0.59 M) MMS (Sigma, 129 925) in a final volume of 500 μl in presence of 200 mM K2 HPO4 for 14 h at room temperature.

    Inhibition:

    Article Title: Hepatitis B Virus Induces Cell Proliferation via HBx-Induced microRNA-21 in Hepatocellular Carcinoma by Targeting Programmed Cell Death Protein4 (PDCD4) and Phosphatase and Tensin Homologue (PTEN)
    Article Snippet: For transfection with pre-miRNA oligos (Sigma Aldrich, USA) or anti-miR-21, siPORT NeoFX transfection agent (Applied Biosystems, USA) was used according to the manufacturer's instructions. pSG5-HBx plasmid was used to transfect HBx gene in hepatic cells, and as a control, an empty vector was used in all the plasmid transfection experiments. .. For inhibition of miRNA-21, anti-miR-21 oligos were transfected same as described above followed by transfection of HBx plasmid after 24 hours of anti-miR-21 transfection.

    Sequencing:

    Article Title: In situ imaging and isolation of proteins using dsDNA oligonucleotides
    Article Snippet: .. For construction of functionalized dsDNA oligos recognized by LacI, two 41 bp single-stranded oligonucleotides were constructed encoding the symmetrical Lac operator 19 bp core sequence O-Sym ( ): O-Sym-1 (* gcgtgtgccagaattgtgagcgctcacaatttcttgaatct) and O-Sym-2 (* agattcaagaaattgtgagcgctcacaattctggctcacgc); where * represents a 5′ modification with either biotin, Cy3 or a disulfide group linked via a (CH2 )6 spacer (Sigma). ..

    Binding Assay:

    Article Title: SMAD4 Regulates Cell Motility through Transcription of N-Cadherin in Human Pancreatic Ductal Epithelium
    Article Snippet: The competitive binding experiment was performed with a 25-fold amount of oligonucleotides with wild-type and mutant SBE consensus binding sites. .. The four potential SBE sequences of the promoter and mutant oligos were purchased from Sigma (Sigma-Aldrich, Woodlands, TX).

    Fluorescence:

    Article Title: Oligo-Fucoidan prevents IL-6 and CCL2 production and cooperates with p53 to suppress ATM signaling and tumor progression
    Article Snippet: Cell cycle analysis HCT116 cells (1 × 106 ) were treated with Oligo-Fucoidan (400 μg/ml) and/or etoposide (40 μM) for 48 h. The cells were subsequently fixed with 70% ethanol at −20 °C for 1 h and incubated with 0.1% (v/v) Triton X-100 (Sigma-Aldrich), 5 μg/ml DNase-free RNase A (Sigma-Aldrich) and 10 μg/ml propidium iodide (PI) (Thermo Fisher Scientific) in PBS in the dark for 20 min at room temperature. .. PI fluorescence was analyzed by a FACSCalibur flow cytometer on the FL2 emission channel at an excitation wavelength of 488 nm.

    Article Title: Multiplexed Proteome Dynamics Profiling Reveals Mechanisms Controlling Protein Homeostasis
    Article Snippet: .. Cells were treated with either vehicle, JQ1-Az (10 μM), JQ1-VHL PROTAC (1 μM), JQ1-VHL PROTAC (10 μM) or IBET151-PROTAC (10 μM) for 6 h and afterward RNA fluorescence in situ hybridization (FISH) was performed according to a published procedure ( ) using a 50bp Cy3-labeled oligo dT probe (Sigma) detecting poly(A)+ RNA with following variations: 15% formamide was used instead of 50%, and THP-1 cells were immobilized on microscopy slides after fixation using Cytospin (1500 rpm, 5 min, Thermo Fisher). .. Additionally, staining with Hoechst 33258 (Sigma) and Wheat Germ Agglutinin (WGA) Alexa Fluor 647 Conjugate (Life Technologies) was performed to enable quantification of the data.

    Methylation:

    Article Title: RecA stimulates AlkB-mediated direct repair of DNA adducts
    Article Snippet: In brief, 40 μg of chemically synthesized 40-mer oligo-dC (Imperial Life science) was treated with 5% (v/v) (0.59 M) MMS (Sigma, 129 925) in a final volume of 500 μl in presence of 200 mM K2 HPO4 for 14 h at room temperature. .. The methylated DNA was not purified directly by using ethanol precipitation as it resulted poor yield.

    Mutagenesis:

    Article Title: SMAD4 Regulates Cell Motility through Transcription of N-Cadherin in Human Pancreatic Ductal Epithelium
    Article Snippet: .. The four potential SBE sequences of the promoter and mutant oligos were purchased from Sigma (Sigma-Aldrich, Woodlands, TX). .. Chromatin immunoprecipitation (ChIP) ChIP assay was performed with a kit (EMD Millipore, Billerica, MA) as previously described .

    Isolation:

    Article Title: A Flow Cytometry-Based Screen of Nuclear Envelope Transmembrane Proteins Identifies NET4/Tmem53 as Involved in Stress-Dependent Cell Cycle Withdrawal
    Article Snippet: The cells were transfected with either 8 µg of siRNA oligo or 12 µg of esiRNA (esiRNA human TMEM53, Sigma) and plated to 10 cm dishes with several coverslips. .. Alternatively they were lysed in Trizol reagent (Sigma) for isolation of RNA.

    Luciferase:

    Article Title: Species difference in ANP32A underlies influenza A virus polymerase host restriction
    Article Snippet: 48hrs later cells were transfected with polymerase and minigenome constructs and harvested after a further 20hrs, for luciferase quantification and knockdown analysis. .. Total RNA was extracted as described previously but with 100μl of cell lysate added to AVL buffer before continuing with the RNeasy mini kit (Qiagen). siRNAs for target genes were as follows:, AllStars Negative Control, huANP32A (SI02655212 FlexiTube), huANP32B (SI02655380 FlexiTube) (Qiagen), 50-92 NP (5’-AAGGAUCUUAUUUCUUCGGAG-3’), chANP32A (5’-GAGCTGGAATTCTTGAGTACA-3’) (custom RNA oligos, Sigma-Aldrich).

    Transfection:

    Article Title: Hepatitis B Virus Induces Cell Proliferation via HBx-Induced microRNA-21 in Hepatocellular Carcinoma by Targeting Programmed Cell Death Protein4 (PDCD4) and Phosphatase and Tensin Homologue (PTEN)
    Article Snippet: .. For transfection with pre-miRNA oligos (Sigma Aldrich, USA) or anti-miR-21, siPORT NeoFX transfection agent (Applied Biosystems, USA) was used according to the manufacturer's instructions. pSG5-HBx plasmid was used to transfect HBx gene in hepatic cells, and as a control, an empty vector was used in all the plasmid transfection experiments. .. To test the efficiency of transfection, enhanced Green Fluorescent Protein-N1 (eGFP-N1) plasmid vector was used in initial experiments.

    Article Title: A Flow Cytometry-Based Screen of Nuclear Envelope Transmembrane Proteins Identifies NET4/Tmem53 as Involved in Stress-Dependent Cell Cycle Withdrawal
    Article Snippet: .. The cells were transfected with either 8 µg of siRNA oligo or 12 µg of esiRNA (esiRNA human TMEM53, Sigma) and plated to 10 cm dishes with several coverslips. .. At 48 or 72 h coverslips were removed and fixed for immunocytochemistry and the remaining cells on the plate were harvested by trypsinization and lysed in sample buffer for SDS-PAGE and Western blotting.

    Article Title: Species difference in ANP32A underlies influenza A virus polymerase host restriction
    Article Snippet: 48hrs later cells were transfected with polymerase and minigenome constructs and harvested after a further 20hrs, for luciferase quantification and knockdown analysis. .. Total RNA was extracted as described previously but with 100μl of cell lysate added to AVL buffer before continuing with the RNeasy mini kit (Qiagen). siRNAs for target genes were as follows:, AllStars Negative Control, huANP32A (SI02655212 FlexiTube), huANP32B (SI02655380 FlexiTube) (Qiagen), 50-92 NP (5’-AAGGAUCUUAUUUCUUCGGAG-3’), chANP32A (5’-GAGCTGGAATTCTTGAGTACA-3’) (custom RNA oligos, Sigma-Aldrich).

    Electrophoretic Mobility Shift Assay:

    Article Title: SMAD4 Regulates Cell Motility through Transcription of N-Cadherin in Human Pancreatic Ductal Epithelium
    Article Snippet: Paragraph title: Electrophoretic mobility shift assay ... The four potential SBE sequences of the promoter and mutant oligos were purchased from Sigma (Sigma-Aldrich, Woodlands, TX).

    Purification:

    Article Title: RecA stimulates AlkB-mediated direct repair of DNA adducts
    Article Snippet: In brief, 40 μg of chemically synthesized 40-mer oligo-dC (Imperial Life science) was treated with 5% (v/v) (0.59 M) MMS (Sigma, 129 925) in a final volume of 500 μl in presence of 200 mM K2 HPO4 for 14 h at room temperature. .. The methylated DNA was not purified directly by using ethanol precipitation as it resulted poor yield.

    Blocking Assay:

    Article Title: Genome-wide discovery of G-quadruplex forming sequences and their functional relevance in plants
    Article Snippet: Validation of G-quadruplex structure formation The selected DNA oligos were synthesized commercially (Sigma). .. Oligos in LiCl were stored at −20 °C, and oligos in KCl and NaCl were kept in the heating block (switched off) for 5–6 h till the temperature of the heating block reached to room temperature.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Underestimation of the Maximal Capacity of the Mitochondrial Electron Transport System in Oligomycin-Treated Cells
    Article Snippet: .. Chemicals and Cell Lines Most of the chemicals used, including adenosine diphosphate (ADP; A2754), bongkrekic acid (BKA; B6179), carbonyl cyanide 3-chlorophenylhydrazone (CCCP; C2759), carboxyatractyloside (CAT; C4992), carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone (FCCP; C2920), digitonin (D141), dimethyl sulfoxide (DMSO; D8418), 2,4-dinitrophenol (DNP; D198501), 4-(2-hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES; H3375), oligomycin (oligo; O4876), oligomycin A (oligo A; 75351) and sodium pyruvate (P4562) were obtained from Sigma-Aldrich (St Louis, MO, USA). .. Oligomycin (oligo*; item number 11341) was also obtained from Cayman Chemical Company (Ann Arbor, MI, USA), as was citreoviridin (citre; item number 11319).

    Mouse Assay:

    Article Title: Maternal Glucose Supplementation in a Murine Model of Chorioamnionitis Alleviates Dysregulation of Autophagy in Fetal Brain
    Article Snippet: Mice at 6 hours after surgery at E18 and PND 9 were euthanized with carbon dioxide, and neonatal brains were fixed overnight at 4°C in 4% paraformaldehyde. .. Brain tissues were incubated with following primary antibodies overnight at 4°C: rabbit anti–myelin basic protein (anti-MBP; Abcam) or rabbit anti-oligo 2 (Millipore, Billerica, Massachusetts).

    SDS Page:

    Article Title: A Flow Cytometry-Based Screen of Nuclear Envelope Transmembrane Proteins Identifies NET4/Tmem53 as Involved in Stress-Dependent Cell Cycle Withdrawal
    Article Snippet: The cells were transfected with either 8 µg of siRNA oligo or 12 µg of esiRNA (esiRNA human TMEM53, Sigma) and plated to 10 cm dishes with several coverslips. .. At 48 or 72 h coverslips were removed and fixed for immunocytochemistry and the remaining cells on the plate were harvested by trypsinization and lysed in sample buffer for SDS-PAGE and Western blotting.

    Plasmid Preparation:

    Article Title: Hepatitis B Virus Induces Cell Proliferation via HBx-Induced microRNA-21 in Hepatocellular Carcinoma by Targeting Programmed Cell Death Protein4 (PDCD4) and Phosphatase and Tensin Homologue (PTEN)
    Article Snippet: .. For transfection with pre-miRNA oligos (Sigma Aldrich, USA) or anti-miR-21, siPORT NeoFX transfection agent (Applied Biosystems, USA) was used according to the manufacturer's instructions. pSG5-HBx plasmid was used to transfect HBx gene in hepatic cells, and as a control, an empty vector was used in all the plasmid transfection experiments. .. To test the efficiency of transfection, enhanced Green Fluorescent Protein-N1 (eGFP-N1) plasmid vector was used in initial experiments.

    Microscopy:

    Article Title: Multiplexed Proteome Dynamics Profiling Reveals Mechanisms Controlling Protein Homeostasis
    Article Snippet: .. Cells were treated with either vehicle, JQ1-Az (10 μM), JQ1-VHL PROTAC (1 μM), JQ1-VHL PROTAC (10 μM) or IBET151-PROTAC (10 μM) for 6 h and afterward RNA fluorescence in situ hybridization (FISH) was performed according to a published procedure ( ) using a 50bp Cy3-labeled oligo dT probe (Sigma) detecting poly(A)+ RNA with following variations: 15% formamide was used instead of 50%, and THP-1 cells were immobilized on microscopy slides after fixation using Cytospin (1500 rpm, 5 min, Thermo Fisher). .. Additionally, staining with Hoechst 33258 (Sigma) and Wheat Germ Agglutinin (WGA) Alexa Fluor 647 Conjugate (Life Technologies) was performed to enable quantification of the data.

    Negative Control:

    Article Title: Species difference in ANP32A underlies influenza A virus polymerase host restriction
    Article Snippet: .. Total RNA was extracted as described previously but with 100μl of cell lysate added to AVL buffer before continuing with the RNeasy mini kit (Qiagen). siRNAs for target genes were as follows:, AllStars Negative Control, huANP32A (SI02655212 FlexiTube), huANP32B (SI02655380 FlexiTube) (Qiagen), 50-92 NP (5’-AAGGAUCUUAUUUCUUCGGAG-3’), chANP32A (5’-GAGCTGGAATTCTTGAGTACA-3’) (custom RNA oligos, Sigma-Aldrich). .. Quantification of chANP32A and B mRNA levels Total RNA from RH clones and DF-1 cells were extracted using an RNeasy mini kit (Qiagen), following manufacturer’s instructions.

    Ethanol Precipitation:

    Article Title: RecA stimulates AlkB-mediated direct repair of DNA adducts
    Article Snippet: In brief, 40 μg of chemically synthesized 40-mer oligo-dC (Imperial Life science) was treated with 5% (v/v) (0.59 M) MMS (Sigma, 129 925) in a final volume of 500 μl in presence of 200 mM K2 HPO4 for 14 h at room temperature. .. The methylated DNA was not purified directly by using ethanol precipitation as it resulted poor yield.

    Concentration Assay:

    Article Title: Genome-wide discovery of G-quadruplex forming sequences and their functional relevance in plants
    Article Snippet: Validation of G-quadruplex structure formation The selected DNA oligos were synthesized commercially (Sigma). .. Next day, oligos were denatured at 65 °C for 10 min. An aliquot of 100 μM stock was heated at 95 °C for 15 min, and LiCl/KCl/NaCl was added to a final concentration of 150 mM.

    Staining:

    Article Title: Maternal Glucose Supplementation in a Murine Model of Chorioamnionitis Alleviates Dysregulation of Autophagy in Fetal Brain
    Article Snippet: Paragraph title: Immunohistochemistry and Histology Staining ... Brain tissues were incubated with following primary antibodies overnight at 4°C: rabbit anti–myelin basic protein (anti-MBP; Abcam) or rabbit anti-oligo 2 (Millipore, Billerica, Massachusetts).

    Article Title: Multiplexed Proteome Dynamics Profiling Reveals Mechanisms Controlling Protein Homeostasis
    Article Snippet: Cells were treated with either vehicle, JQ1-Az (10 μM), JQ1-VHL PROTAC (1 μM), JQ1-VHL PROTAC (10 μM) or IBET151-PROTAC (10 μM) for 6 h and afterward RNA fluorescence in situ hybridization (FISH) was performed according to a published procedure ( ) using a 50bp Cy3-labeled oligo dT probe (Sigma) detecting poly(A)+ RNA with following variations: 15% formamide was used instead of 50%, and THP-1 cells were immobilized on microscopy slides after fixation using Cytospin (1500 rpm, 5 min, Thermo Fisher). .. Additionally, staining with Hoechst 33258 (Sigma) and Wheat Germ Agglutinin (WGA) Alexa Fluor 647 Conjugate (Life Technologies) was performed to enable quantification of the data.

    In Situ Hybridization:

    Article Title: Multiplexed Proteome Dynamics Profiling Reveals Mechanisms Controlling Protein Homeostasis
    Article Snippet: .. Cells were treated with either vehicle, JQ1-Az (10 μM), JQ1-VHL PROTAC (1 μM), JQ1-VHL PROTAC (10 μM) or IBET151-PROTAC (10 μM) for 6 h and afterward RNA fluorescence in situ hybridization (FISH) was performed according to a published procedure ( ) using a 50bp Cy3-labeled oligo dT probe (Sigma) detecting poly(A)+ RNA with following variations: 15% formamide was used instead of 50%, and THP-1 cells were immobilized on microscopy slides after fixation using Cytospin (1500 rpm, 5 min, Thermo Fisher). .. Additionally, staining with Hoechst 33258 (Sigma) and Wheat Germ Agglutinin (WGA) Alexa Fluor 647 Conjugate (Life Technologies) was performed to enable quantification of the data.

    Fluorescence In Situ Hybridization:

    Article Title: Multiplexed Proteome Dynamics Profiling Reveals Mechanisms Controlling Protein Homeostasis
    Article Snippet: .. Cells were treated with either vehicle, JQ1-Az (10 μM), JQ1-VHL PROTAC (1 μM), JQ1-VHL PROTAC (10 μM) or IBET151-PROTAC (10 μM) for 6 h and afterward RNA fluorescence in situ hybridization (FISH) was performed according to a published procedure ( ) using a 50bp Cy3-labeled oligo dT probe (Sigma) detecting poly(A)+ RNA with following variations: 15% formamide was used instead of 50%, and THP-1 cells were immobilized on microscopy slides after fixation using Cytospin (1500 rpm, 5 min, Thermo Fisher). .. Additionally, staining with Hoechst 33258 (Sigma) and Wheat Germ Agglutinin (WGA) Alexa Fluor 647 Conjugate (Life Technologies) was performed to enable quantification of the data.

    other:

    Article Title: High content image analysis reveals function of miR-124 upstream of Vimentin in regulating motor neuron mitochondria
    Article Snippet: Oligomycin A (Sigma, 1 µM) for 15 min, in 37 °C and analyzed 24 hrs. afterwards.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Millipore sterile phosphate buffered saline pbs vehicle
    Effects of pre-subarachnoid hemorrhage (SAH) recombinant osteopontin <t>(OPN)</t> treatment on vasospasm. A , representative India ink angiograms; B–E , vessel diameter of each cerebral artery at 24 and 72 hours post-surgery. Pre-SAH OPN treatment significantly prevents vasospasm in the bilateral internal carotid arteries ( B ), left middle cerebral artery ( C ), left anterior cerebral artery ( D ) and basilar artery ( E ) associated with the improvement of neurobehavioral scores (ANOVA). Arrow, left middle cerebral artery; arrow head, left anterior cerebral artery; double arrow, left internal carotid artery; P, O 0.02, O 0.1, rats treated with phosphate-buffered saline <t>(PBS),</t> OPN (0.02μg) or OPN (0.1μg), respectively; n=6 per group except for n=7 in PBS- and 0.1μg of OPN-treated SAH rats at 72 hours post-SAH. Data are expressed as mean±standard deviation. ANOVA, * P
    Sterile Phosphate Buffered Saline Pbs Vehicle, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sterile phosphate buffered saline pbs vehicle/product/Millipore
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    sterile phosphate buffered saline pbs vehicle - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Effects of pre-subarachnoid hemorrhage (SAH) recombinant osteopontin (OPN) treatment on vasospasm. A , representative India ink angiograms; B–E , vessel diameter of each cerebral artery at 24 and 72 hours post-surgery. Pre-SAH OPN treatment significantly prevents vasospasm in the bilateral internal carotid arteries ( B ), left middle cerebral artery ( C ), left anterior cerebral artery ( D ) and basilar artery ( E ) associated with the improvement of neurobehavioral scores (ANOVA). Arrow, left middle cerebral artery; arrow head, left anterior cerebral artery; double arrow, left internal carotid artery; P, O 0.02, O 0.1, rats treated with phosphate-buffered saline (PBS), OPN (0.02μg) or OPN (0.1μg), respectively; n=6 per group except for n=7 in PBS- and 0.1μg of OPN-treated SAH rats at 72 hours post-SAH. Data are expressed as mean±standard deviation. ANOVA, * P

    Journal: Annals of neurology

    Article Title: Recombinant Osteopontin in Cerebral Vasospasm After Subarachnoid Hemorrhage

    doi: 10.1002/ana.22102

    Figure Lengend Snippet: Effects of pre-subarachnoid hemorrhage (SAH) recombinant osteopontin (OPN) treatment on vasospasm. A , representative India ink angiograms; B–E , vessel diameter of each cerebral artery at 24 and 72 hours post-surgery. Pre-SAH OPN treatment significantly prevents vasospasm in the bilateral internal carotid arteries ( B ), left middle cerebral artery ( C ), left anterior cerebral artery ( D ) and basilar artery ( E ) associated with the improvement of neurobehavioral scores (ANOVA). Arrow, left middle cerebral artery; arrow head, left anterior cerebral artery; double arrow, left internal carotid artery; P, O 0.02, O 0.1, rats treated with phosphate-buffered saline (PBS), OPN (0.02μg) or OPN (0.1μg), respectively; n=6 per group except for n=7 in PBS- and 0.1μg of OPN-treated SAH rats at 72 hours post-SAH. Data are expressed as mean±standard deviation. ANOVA, * P

    Article Snippet: Sterile phosphate-buffered saline (PBS) vehicle (1μL) or mouse r-OPN (0.02 or 0.1μg in 1μL; EMD Chemicals, La Jolla, CA) was infused at a rate of 0.5μL/minute irrespective of the animal’s body weight at one hour pre-surgery (as a pre-treatment) or at 5 hours post-surgery (as a post-treatment).

    Techniques: Recombinant, Standard Deviation

    Representative Western blots ( A ) and effects of GRGDSP treatment on mitogen-activated protein kinase phosphatase-1 (MKP-1) levels ( B ) in cerebral arteries in subarachnoid hemorrhage (SAH) rats treated with 0.1μg of osteopontin (SAH-OPN0.1) at 24 hours post-SAH. An L-arginyl-glycyl-L-aspartate-dependent integrin receptor antagonist GRGDSP abolishes osteopontin-induced MKP-1 upregulation (unpaired t tests) irrespective of similar severity of SAH. MKP-1 levels are expressed as a ratio of β-tubulin levels for normalization and as mean±standard deviation. PBS, phosphate-buffered saline.

    Journal: Annals of neurology

    Article Title: Recombinant Osteopontin in Cerebral Vasospasm After Subarachnoid Hemorrhage

    doi: 10.1002/ana.22102

    Figure Lengend Snippet: Representative Western blots ( A ) and effects of GRGDSP treatment on mitogen-activated protein kinase phosphatase-1 (MKP-1) levels ( B ) in cerebral arteries in subarachnoid hemorrhage (SAH) rats treated with 0.1μg of osteopontin (SAH-OPN0.1) at 24 hours post-SAH. An L-arginyl-glycyl-L-aspartate-dependent integrin receptor antagonist GRGDSP abolishes osteopontin-induced MKP-1 upregulation (unpaired t tests) irrespective of similar severity of SAH. MKP-1 levels are expressed as a ratio of β-tubulin levels for normalization and as mean±standard deviation. PBS, phosphate-buffered saline.

    Article Snippet: Sterile phosphate-buffered saline (PBS) vehicle (1μL) or mouse r-OPN (0.02 or 0.1μg in 1μL; EMD Chemicals, La Jolla, CA) was infused at a rate of 0.5μL/minute irrespective of the animal’s body weight at one hour pre-surgery (as a pre-treatment) or at 5 hours post-surgery (as a post-treatment).

    Techniques: Western Blot, Standard Deviation

    Representative Western blots ( A ) and effects of pre-subarachnoid hemorrhage (SAH) recombinant osteopontin (OPN) treatment on mitogen-activated protein kinase phosphatase-1 (MKP-1; B ), phosphorylated c-Jun N-Terminal kinase (p-JNK; C ), p38 (p-p38; D ), extracellular signal-regulated kinase1/2 (p-ERK1/2; E ), caldesmon (p-caldesmon; F ) or heat shock protein 27 (p-HSP27; G ) levels in cerebral arteries at 24 hours post-SAH. Pre-SAH 0.1μg of OPN significantly induces MKP-1 while reduces phosphorylated JNK, p38, ERK1/2, caldesmon and HSP27 levels in the spastic cerebral arteries associated with the improvement of vasospasm (ANOVA). Expression levels of each protein are expressed as a ratio of β-tubulin levels for normalization and as mean±standard deviation. N=4 in phosphate-buffered saline (PBS)- or OPN (0.1μg)-treated sham-operated rats; n=6 in PBS- or OPN (0.02 or 0.1μg)-treated SAH rats.

    Journal: Annals of neurology

    Article Title: Recombinant Osteopontin in Cerebral Vasospasm After Subarachnoid Hemorrhage

    doi: 10.1002/ana.22102

    Figure Lengend Snippet: Representative Western blots ( A ) and effects of pre-subarachnoid hemorrhage (SAH) recombinant osteopontin (OPN) treatment on mitogen-activated protein kinase phosphatase-1 (MKP-1; B ), phosphorylated c-Jun N-Terminal kinase (p-JNK; C ), p38 (p-p38; D ), extracellular signal-regulated kinase1/2 (p-ERK1/2; E ), caldesmon (p-caldesmon; F ) or heat shock protein 27 (p-HSP27; G ) levels in cerebral arteries at 24 hours post-SAH. Pre-SAH 0.1μg of OPN significantly induces MKP-1 while reduces phosphorylated JNK, p38, ERK1/2, caldesmon and HSP27 levels in the spastic cerebral arteries associated with the improvement of vasospasm (ANOVA). Expression levels of each protein are expressed as a ratio of β-tubulin levels for normalization and as mean±standard deviation. N=4 in phosphate-buffered saline (PBS)- or OPN (0.1μg)-treated sham-operated rats; n=6 in PBS- or OPN (0.02 or 0.1μg)-treated SAH rats.

    Article Snippet: Sterile phosphate-buffered saline (PBS) vehicle (1μL) or mouse r-OPN (0.02 or 0.1μg in 1μL; EMD Chemicals, La Jolla, CA) was infused at a rate of 0.5μL/minute irrespective of the animal’s body weight at one hour pre-surgery (as a pre-treatment) or at 5 hours post-surgery (as a post-treatment).

    Techniques: Western Blot, Recombinant, Expressing, Standard Deviation

    Immunofluorescence for smooth muscle cells (MYH11) and mitogen-activated protein kinase phosphatase-1 (MKP-1) in the intracranial internal carotid artery at 24 hours after subarachnoid hemorrhage (SAH). Pre-SAH 0.1μg of osteopontin (OPN) induces MKP-1 in the smooth muscle layer of the post-SAH arteries, in which vasospasm is improved. Sham-PBS, Sham-operated rats treated with phosphate-buffered saline (PBS); SAH-PBS or -OPN0.1, SAH rats treated with PBS or 0.1μg of OPN.

    Journal: Annals of neurology

    Article Title: Recombinant Osteopontin in Cerebral Vasospasm After Subarachnoid Hemorrhage

    doi: 10.1002/ana.22102

    Figure Lengend Snippet: Immunofluorescence for smooth muscle cells (MYH11) and mitogen-activated protein kinase phosphatase-1 (MKP-1) in the intracranial internal carotid artery at 24 hours after subarachnoid hemorrhage (SAH). Pre-SAH 0.1μg of osteopontin (OPN) induces MKP-1 in the smooth muscle layer of the post-SAH arteries, in which vasospasm is improved. Sham-PBS, Sham-operated rats treated with phosphate-buffered saline (PBS); SAH-PBS or -OPN0.1, SAH rats treated with PBS or 0.1μg of OPN.

    Article Snippet: Sterile phosphate-buffered saline (PBS) vehicle (1μL) or mouse r-OPN (0.02 or 0.1μg in 1μL; EMD Chemicals, La Jolla, CA) was infused at a rate of 0.5μL/minute irrespective of the animal’s body weight at one hour pre-surgery (as a pre-treatment) or at 5 hours post-surgery (as a post-treatment).

    Techniques: Immunofluorescence