oligo dt 18 primer  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Name:
    Oligo dT 18 Primer
    Description:
    Thermo Scientific Oligo dT 18 Primer is a synthetic single stranded 18 mer oligonucleotide with 5 and 3 hydroxyl ends The primer is supplied as a ready to use 20X concentrated aqueous solution Applications• cDNA Synthesis• RT qPCR• RT PCRRelated ProductsAnchored Oligo dTRandom Hexamer PrimerOligo dT 18 Primer
    Catalog Number:
    SO131
    Price:
    None
    Category:
    Oligos Primers Probes Nucleotides
    Applications:
    Cloning|One-Step qRT-PCR|PCR & Real-Time PCR|RT-PCR|Real Time PCR (qPCR)|Reverse Transcription|Two-Step RT-PCR|cDNA Libraries & Library Construction
    Buy from Supplier


    Structured Review

    Thermo Fisher oligo dt 18 primer
    Thermo Scientific Oligo dT 18 Primer is a synthetic single stranded 18 mer oligonucleotide with 5 and 3 hydroxyl ends The primer is supplied as a ready to use 20X concentrated aqueous solution Applications• cDNA Synthesis• RT qPCR• RT PCRRelated ProductsAnchored Oligo dTRandom Hexamer PrimerOligo dT 18 Primer
    https://www.bioz.com/result/oligo dt 18 primer/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    oligo dt 18 primer - by Bioz Stars, 2021-05
    97/100 stars

    Images

    Related Articles

    Synthesized:

    Article Title: The expression of Wnt-1 inducible signaling pathway protein-2 in astrocytoma: Correlation between pathological grade and clinical outcome
    Article Snippet: RT-PCR Total RNA was isolated from human brain tumors and normal tissue using Trizol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA). .. The first strand of cDNA was synthesized from 1 μg of total RNA by using an Oligo (dT) 18 primer and M-MuLV RT (Thermo Fisher Scientific, Waltham, MA, USA). .. The PCR was performed under the following conditions: 95°C for 5 min, 30 cycles of 95°C for 30 sec, 56°C for 30 sec, 72°C for 30 sec and a final extension step at 72°C for 10 min, using the Taq DNA polymerase kit (Takara Biotechnology Co., Ltd., Dalian, China).

    Article Title: Phloem-Triggered Virus-Induced Gene Silencing Using a Recombinant Polerovirus
    Article Snippet: Endogenous mRNA and Viral RNA Analysis by Real-Time RT-PCR Expression of CHLI1 (AT4G18480) and RTM1 (AT1G05760) and accumulation of TuYV RNA were analyzed by real-time RT-PCR. .. To measure CHLI1 expression, total RNA was extracted 19 dpi from 100 mg of frozen ground tissue from pools of two plants (two to five pools were analyzed/virus) following the TRI Reagent® Protocol with one additional phenol and two chloroform steps before ethanol/sodium acetate precipitation. cDNA was synthesized using a mix of oligo(dT)18 , Tu-4942-Rev and CHLI1-340Rev primers (listed in Supplementary Table ), 2 μg of total RNA and SuperScript® III Reverse Transcriptase (Invitrogen). ..

    Amplification:

    Article Title: High Inter-Individual Diversity of Point Mutations, Insertions, and Deletions in Human Influenza Virus Nucleoprotein-Specific Memory B Cells
    Article Snippet: The variable region fragment was subsequently replaced by a non-Ig sequence of 2817 basepairs. .. Amplification and gene cloning RNA from the frozen single cells was reverse transcribed at 50°C for 60 min in a 20 μl reaction mixture containing 1 μl oligo dT18 primer (10 mM), 1 μl dNTP-Mix (10 mM each nucleotide), 1 μl 0.1 M DTT, 0.5 μl RnaseOUT (Life Technologies, Inc.), and 100 U Superscript III (Life Technologies, Inc.). .. The reaction was inactivated at 70°C for 15 min. IGH transcripts were amplified using 2.5 μl cDNA.

    Article Title: Fluid and Electrolyte Homeostasis: Tricellular tight junction-associated angulins in the gill epithelium of rainbow trout
    Article Snippet: Briefly, total RNA was isolated from discrete organs (for lsr and ildr2 expression profiles) or cultured gill epithelia using TRIzol reagent (Invitrogen Canada) according to the manufacturer’s instructions. .. Total RNA was quantified using a Multiskan Spectrum UV/Vis microplate spectrophotometer (Thermo Fisher Scientific, Nepean, ON, Canada); thereafter, 2 μg of total RNA were treated with DNase I (amplification grade; Invitrogen Canada) and used for cDNA synthesis with SuperScript III reverse transcriptase and oligo(dT)-(12–18) primers (Invitrogen Canada). .. Primers used to determine transcript abundance were as follows: tric [GenBank accession no. ; GTCACATCCCCAAACCAGTC (forward) and GTCCAGCTCGTCAAACTTCC (reverse); predicted amplicon size 170 bp], lsr [GenBank accession no. ; ACCCCCAGCCACCCTAC (forward) and GGAACTCACCTCGCTCA (reverse); predicted amplicon size 347 bp], and ildr2 [GenBank accession no. ; CGGAAGACACTATCAGGAGACT (forward) and CAGGTTTGTGGGCAGCAG (reverse); predicted amplicon size 182 bp].

    Clone Assay:

    Article Title: High Inter-Individual Diversity of Point Mutations, Insertions, and Deletions in Human Influenza Virus Nucleoprotein-Specific Memory B Cells
    Article Snippet: The variable region fragment was subsequently replaced by a non-Ig sequence of 2817 basepairs. .. Amplification and gene cloning RNA from the frozen single cells was reverse transcribed at 50°C for 60 min in a 20 μl reaction mixture containing 1 μl oligo dT18 primer (10 mM), 1 μl dNTP-Mix (10 mM each nucleotide), 1 μl 0.1 M DTT, 0.5 μl RnaseOUT (Life Technologies, Inc.), and 100 U Superscript III (Life Technologies, Inc.). .. The reaction was inactivated at 70°C for 15 min. IGH transcripts were amplified using 2.5 μl cDNA.

    Generated:

    Article Title: Effect of Introducing Chitinase Gene on the Resistance of Tuber Mustard against White Mold
    Article Snippet: Total RNA was extracted from the leaf tissues of four 75-day-old lines including TMB4, TMB7, TMB12, and TMB18 and control plants using Trizol according to the producer’s manual (Sangon Biotech, Shanghai, China). .. First strand cDNA was generated using the oligo(dT)18 primer by using the ‘‘first strand cDNA synthesis kit’’ (Thermo Fisher Scientific, Waltham, MA, USA), which contained M-MuLV reverse transcriptase. .. PCR amplification was conducted using the first strand cDNA as template and chit42 specific primers under the same conditions described by .

    Expressing:

    Article Title: Phloem-Triggered Virus-Induced Gene Silencing Using a Recombinant Polerovirus
    Article Snippet: Endogenous mRNA and Viral RNA Analysis by Real-Time RT-PCR Expression of CHLI1 (AT4G18480) and RTM1 (AT1G05760) and accumulation of TuYV RNA were analyzed by real-time RT-PCR. .. To measure CHLI1 expression, total RNA was extracted 19 dpi from 100 mg of frozen ground tissue from pools of two plants (two to five pools were analyzed/virus) following the TRI Reagent® Protocol with one additional phenol and two chloroform steps before ethanol/sodium acetate precipitation. cDNA was synthesized using a mix of oligo(dT)18 , Tu-4942-Rev and CHLI1-340Rev primers (listed in Supplementary Table ), 2 μg of total RNA and SuperScript® III Reverse Transcriptase (Invitrogen). ..

    Spectrophotometry:

    Article Title: Fluid and Electrolyte Homeostasis: Tricellular tight junction-associated angulins in the gill epithelium of rainbow trout
    Article Snippet: Briefly, total RNA was isolated from discrete organs (for lsr and ildr2 expression profiles) or cultured gill epithelia using TRIzol reagent (Invitrogen Canada) according to the manufacturer’s instructions. .. Total RNA was quantified using a Multiskan Spectrum UV/Vis microplate spectrophotometer (Thermo Fisher Scientific, Nepean, ON, Canada); thereafter, 2 μg of total RNA were treated with DNase I (amplification grade; Invitrogen Canada) and used for cDNA synthesis with SuperScript III reverse transcriptase and oligo(dT)-(12–18) primers (Invitrogen Canada). .. Primers used to determine transcript abundance were as follows: tric [GenBank accession no. ; GTCACATCCCCAAACCAGTC (forward) and GTCCAGCTCGTCAAACTTCC (reverse); predicted amplicon size 170 bp], lsr [GenBank accession no. ; ACCCCCAGCCACCCTAC (forward) and GGAACTCACCTCGCTCA (reverse); predicted amplicon size 347 bp], and ildr2 [GenBank accession no. ; CGGAAGACACTATCAGGAGACT (forward) and CAGGTTTGTGGGCAGCAG (reverse); predicted amplicon size 182 bp].

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher antisense primers
    MICA and MICB gene and protein expressions in Caki-1 cells. (A) MICA (442 bp) and MICB (677 bp) transcripts were amplified by polymerase chain reaction from Caki-1 cDNA by using a single MICA/B sense primer and two MICA- or MICB -specific <t>antisense</t> primers as indicated in the Materials and Methods section. (B) The indicated tumor cell lines were stained either with a commercial APC-conjugated anti-MICB (left panel, gray areas) or with a commercial PE-conjugated anti-MICA (right panel, gray areas). The black areas show the intensity of fluorescence upon staining with APC- or PE-conjugated matching isotype mAbs. (C) The indicated tumor cell lines (1 x 10 6 ) were permeabilized and incubated with WW6B7 mAb (solid lines) or WW2G8 mAb (dashed lines) or an isotype-matched IgG1 mAbs (solid thick lines). After a 30-minute incubation in ice, cells were washed, and FITC-conjugated goat anti-mouse F(ab) 2 were added to the cell pellet. Cells were then analyzed by flow cytometry. (D) Nonpermeabilized (dashed lines) or permeabilized (solid lines) cells (1 x 10 6 ) were incubated with WW6B7 mAb and stained with a FITC-conjugated goat anti-mouse F(ab) 2 antibodies. The overlapping solid thick lines show the fluorescence given by control isotype IgG1 mAbs in nonpermeabilized or in permeabilized tumor cells.
    Antisense Primers, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/antisense primers/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    antisense primers - by Bioz Stars, 2021-05
    99/100 stars
      Buy from Supplier

    97
    Thermo Fisher poros oligo r3
    MICA and MICB gene and protein expressions in Caki-1 cells. (A) MICA (442 bp) and MICB (677 bp) transcripts were amplified by polymerase chain reaction from Caki-1 cDNA by using a single MICA/B sense primer and two MICA- or MICB -specific <t>antisense</t> primers as indicated in the Materials and Methods section. (B) The indicated tumor cell lines were stained either with a commercial APC-conjugated anti-MICB (left panel, gray areas) or with a commercial PE-conjugated anti-MICA (right panel, gray areas). The black areas show the intensity of fluorescence upon staining with APC- or PE-conjugated matching isotype mAbs. (C) The indicated tumor cell lines (1 x 10 6 ) were permeabilized and incubated with WW6B7 mAb (solid lines) or WW2G8 mAb (dashed lines) or an isotype-matched IgG1 mAbs (solid thick lines). After a 30-minute incubation in ice, cells were washed, and FITC-conjugated goat anti-mouse F(ab) 2 were added to the cell pellet. Cells were then analyzed by flow cytometry. (D) Nonpermeabilized (dashed lines) or permeabilized (solid lines) cells (1 x 10 6 ) were incubated with WW6B7 mAb and stained with a FITC-conjugated goat anti-mouse F(ab) 2 antibodies. The overlapping solid thick lines show the fluorescence given by control isotype IgG1 mAbs in nonpermeabilized or in permeabilized tumor cells.
    Poros Oligo R3, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/poros oligo r3/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    poros oligo r3 - by Bioz Stars, 2021-05
    97/100 stars
      Buy from Supplier

    Image Search Results


    MICA and MICB gene and protein expressions in Caki-1 cells. (A) MICA (442 bp) and MICB (677 bp) transcripts were amplified by polymerase chain reaction from Caki-1 cDNA by using a single MICA/B sense primer and two MICA- or MICB -specific antisense primers as indicated in the Materials and Methods section. (B) The indicated tumor cell lines were stained either with a commercial APC-conjugated anti-MICB (left panel, gray areas) or with a commercial PE-conjugated anti-MICA (right panel, gray areas). The black areas show the intensity of fluorescence upon staining with APC- or PE-conjugated matching isotype mAbs. (C) The indicated tumor cell lines (1 x 10 6 ) were permeabilized and incubated with WW6B7 mAb (solid lines) or WW2G8 mAb (dashed lines) or an isotype-matched IgG1 mAbs (solid thick lines). After a 30-minute incubation in ice, cells were washed, and FITC-conjugated goat anti-mouse F(ab) 2 were added to the cell pellet. Cells were then analyzed by flow cytometry. (D) Nonpermeabilized (dashed lines) or permeabilized (solid lines) cells (1 x 10 6 ) were incubated with WW6B7 mAb and stained with a FITC-conjugated goat anti-mouse F(ab) 2 antibodies. The overlapping solid thick lines show the fluorescence given by control isotype IgG1 mAbs in nonpermeabilized or in permeabilized tumor cells.

    Journal: Neoplasia (New York, N.Y.)

    Article Title: Defective Infiltration of Natural Killer Cells in MICA/B-Positive Renal Cell Carcinoma Involves ?2-Integrin-Mediated Interaction 1

    doi:

    Figure Lengend Snippet: MICA and MICB gene and protein expressions in Caki-1 cells. (A) MICA (442 bp) and MICB (677 bp) transcripts were amplified by polymerase chain reaction from Caki-1 cDNA by using a single MICA/B sense primer and two MICA- or MICB -specific antisense primers as indicated in the Materials and Methods section. (B) The indicated tumor cell lines were stained either with a commercial APC-conjugated anti-MICB (left panel, gray areas) or with a commercial PE-conjugated anti-MICA (right panel, gray areas). The black areas show the intensity of fluorescence upon staining with APC- or PE-conjugated matching isotype mAbs. (C) The indicated tumor cell lines (1 x 10 6 ) were permeabilized and incubated with WW6B7 mAb (solid lines) or WW2G8 mAb (dashed lines) or an isotype-matched IgG1 mAbs (solid thick lines). After a 30-minute incubation in ice, cells were washed, and FITC-conjugated goat anti-mouse F(ab) 2 were added to the cell pellet. Cells were then analyzed by flow cytometry. (D) Nonpermeabilized (dashed lines) or permeabilized (solid lines) cells (1 x 10 6 ) were incubated with WW6B7 mAb and stained with a FITC-conjugated goat anti-mouse F(ab) 2 antibodies. The overlapping solid thick lines show the fluorescence given by control isotype IgG1 mAbs in nonpermeabilized or in permeabilized tumor cells.

    Article Snippet: Complementary DNA (cDNA) first strand was produced using a SuperScript First-Strand Synthesis System using oligo(dt)12–18 antisense primers (Invitrogen, Lucerne, Switzerland).

    Techniques: Amplification, Polymerase Chain Reaction, Staining, Fluorescence, Incubation, Flow Cytometry, Cytometry

    mRNA levels of selected immune and signaling molecules in seminal vesicles and coelomocytes after the stimulation with representative TLR ligands. Coelomocytes and seminal vesicles from earthworms were incubated for 6 h with various TLR ligands: profilin, poly I:C, lipoteichoic acid (LTA), zymosan, flagellin, LPS, ODN. The mRNA levels of (A) mcc Ea TLR, (B) Ea TLR, (C) EMAP, (D) LBP/BPI, (E) Fet/Lys, (F) NF-κB, and (G) Myd88 molecules were assessed. The values represent fold changes relative to non-treated controls (here settled as a value 1, dashed line). Values are the means of three experiments (±SD) performed in triplicate. The significance was evaluated by two-way ANOVA with Bonferroni posttest in the GraphPad Prism software ( * P

    Journal: Frontiers in Immunology

    Article Title: Developmental and Immune Role of a Novel Multiple Cysteine Cluster TLR From Eisenia andrei Earthworms

    doi: 10.3389/fimmu.2019.01277

    Figure Lengend Snippet: mRNA levels of selected immune and signaling molecules in seminal vesicles and coelomocytes after the stimulation with representative TLR ligands. Coelomocytes and seminal vesicles from earthworms were incubated for 6 h with various TLR ligands: profilin, poly I:C, lipoteichoic acid (LTA), zymosan, flagellin, LPS, ODN. The mRNA levels of (A) mcc Ea TLR, (B) Ea TLR, (C) EMAP, (D) LBP/BPI, (E) Fet/Lys, (F) NF-κB, and (G) Myd88 molecules were assessed. The values represent fold changes relative to non-treated controls (here settled as a value 1, dashed line). Values are the means of three experiments (±SD) performed in triplicate. The significance was evaluated by two-way ANOVA with Bonferroni posttest in the GraphPad Prism software ( * P

    Article Snippet: RNA Isolation, cDNA Synthesis, qPCR, Preparation of PlasmidsTotal RNA was isolated from coelomocytes, from various tissues or from whole body tissues of the individual earthworms, using TRIZOL reagent (Life Technologies) according to the manufacturer's protocol.

    Techniques: Incubation, Software