nuclease free water nfw  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    Nuclease Free Water
    Description:
    For use in any molecular biology application Kit contents Qiagen Nuclease free Water 10 x 50mL Highly Pure Prepared in a Proprietary Process which Yields DNase RNase and Nuclease free Deionized Water without the use of Chemical Additives Ideal for use in any Molecular Biology Application Includes Nuclease free Water Prepared without the use of Diethylpyrocarbonate DEPC
    Catalog Number:
    129114
    Price:
    123
    Category:
    Nuclease Free Water
    Buy from Supplier


    Structured Review

    Qiagen nuclease free water nfw
    Nuclease Free Water
    For use in any molecular biology application Kit contents Qiagen Nuclease free Water 10 x 50mL Highly Pure Prepared in a Proprietary Process which Yields DNase RNase and Nuclease free Deionized Water without the use of Chemical Additives Ideal for use in any Molecular Biology Application Includes Nuclease free Water Prepared without the use of Diethylpyrocarbonate DEPC
    https://www.bioz.com/result/nuclease free water nfw/product/Qiagen
    Average 95 stars, based on 120 article reviews
    Price from $9.99 to $1999.99
    nuclease free water nfw - by Bioz Stars, 2020-02
    95/100 stars

    Images

    1) Product Images from "The development of two field‐ready reverse transcription loop‐mediated isothermal amplification assays for the rapid detection of Seneca Valley virus 1. The development of two field‐ready reverse transcription loop‐mediated isothermal amplification assays for the rapid detection of Seneca Valley virus 1"

    Article Title: The development of two field‐ready reverse transcription loop‐mediated isothermal amplification assays for the rapid detection of Seneca Valley virus 1. The development of two field‐ready reverse transcription loop‐mediated isothermal amplification assays for the rapid detection of Seneca Valley virus 1

    Journal: Transboundary and Emerging Diseases

    doi: 10.1111/tbed.13051

    Comparison of ‘wet’ and lyophilized reagents using direct detection by RT ‐ LAMP with primer set 1 (a) and primer set 2 (b). Black bars represent ‘wet’ reagents and grey bars represent lyophilized reagents. Neat: SVV ‐1 sample NC ‐88‐23626 diluted 1/100 in negative pig epithelium tissue suspension to simulate a natural original suspension sample. This ‘neat’ sample was then diluted frac12;, ¼, 1/8, 1/10, 1/16 and 1/20 in nuclease‐free water ( NFW ) and compared to extracted RNA from the ‘neat’ sample as a positive control
    Figure Legend Snippet: Comparison of ‘wet’ and lyophilized reagents using direct detection by RT ‐ LAMP with primer set 1 (a) and primer set 2 (b). Black bars represent ‘wet’ reagents and grey bars represent lyophilized reagents. Neat: SVV ‐1 sample NC ‐88‐23626 diluted 1/100 in negative pig epithelium tissue suspension to simulate a natural original suspension sample. This ‘neat’ sample was then diluted frac12;, ¼, 1/8, 1/10, 1/16 and 1/20 in nuclease‐free water ( NFW ) and compared to extracted RNA from the ‘neat’ sample as a positive control

    Techniques Used: Positive Control

    2) Product Images from "Preparing DNA Libraries for Multiplexed Paired-End Deep Sequencing for Illumina GA Sequencers"

    Article Title: Preparing DNA Libraries for Multiplexed Paired-End Deep Sequencing for Illumina GA Sequencers

    Journal: Current protocols in microbiology

    doi: 10.1002/9780471729259.mc01e04s20

    Fragmented DNA smearing patterns after ligation of adapters (Ligation Mix) and after PCR (PCR Mix). Note increase in smear intensity as well as a shift up in the size range of the smear.
    Figure Legend Snippet: Fragmented DNA smearing patterns after ligation of adapters (Ligation Mix) and after PCR (PCR Mix). Note increase in smear intensity as well as a shift up in the size range of the smear.

    Techniques Used: Ligation, Polymerase Chain Reaction

    Overview of DNA library preparation for deep sequencing. The purified genomic DNA is processed and modified as described in the basic protocols. The adapter-modified DNA fragments (library) are then enriched through PCR. Note the relative positions and characteristics (Inset) of the InPE1.0, InPE2.0 and the Index primers used during PCR. For multiplexed paired-end PCR, the same InPE1.0 and InPE2.0 primers are used, however, up to 12 different Index primers can be added to the enrichment reactions individually. Sequencing is performed in one direction through sequencing by synthesis , and then in the alternate direction as described in the background information. The complementary sequences are shaded darker.
    Figure Legend Snippet: Overview of DNA library preparation for deep sequencing. The purified genomic DNA is processed and modified as described in the basic protocols. The adapter-modified DNA fragments (library) are then enriched through PCR. Note the relative positions and characteristics (Inset) of the InPE1.0, InPE2.0 and the Index primers used during PCR. For multiplexed paired-end PCR, the same InPE1.0 and InPE2.0 primers are used, however, up to 12 different Index primers can be added to the enrichment reactions individually. Sequencing is performed in one direction through sequencing by synthesis , and then in the alternate direction as described in the background information. The complementary sequences are shaded darker.

    Techniques Used: Sequencing, Purification, Modification, Polymerase Chain Reaction

    Related Articles

    Centrifugation:

    Article Title: Interleukin-17A Promotes Aortic Endothelial Cell Activation via Transcriptionally and Post-translationally Activating p38 Mitogen-activated Protein Kinase (MAPK) Pathway *
    Article Snippet: .. After centrifugation, the RNA pellet was washed twice with 75% ethyl alcohol in nuclease-free water (Qiagen, Valencia, CA). ..

    Amplification:

    Article Title: Identification of a Human Papillomavirus–Associated Oncogenic miRNA Panel in Human Oropharyngeal Squamous Cell Carcinoma Validated by Bioinformatics Analysis of The Cancer Genome Atlas
    Article Snippet: The LNATM primer sets for miR-9, four candidate reference genes, and two positive control primer sets were obtained from Exiqon A/S. cDNA from the reverse transcription reactions were diluted 100× with nuclease-free water combined 1:1 with 2× PCR master mix (Exiqon A/S) and 0.05 ng of total RNA per reaction. .. Real-time PCR amplification and melting curve analysis was performed using an ABI StepOnePlus system (Applied Biosystems, Foster City, CA) in a standard (2-hour) run according to the following cycles: polymerase activation/denaturation at 95°C for 10 minutes, amplification for 40 cycles at 95°C for 10 seconds, followed by 60°C for 1 minute at a ramp rate of 1.6 degrees centigrade per second, and melting curve analysis as specified by the StepOnePlus system.

    Article Title: Impact of Bactrocera oleae on the fungal microbiota of ripe olive drupes
    Article Snippet: DNA extracts were amplified using the universal fungal primers ITS3_KYO2 ( GATGAAGAACGYAGYRAA ) [ ] and ITS4 ( TCCTCCGCTTATTGATATGC ) [ ], modified by adding the adapters needed for Illumina MiSeq sequencing. .. PCR reactions were conducted in a total volume of 25 μl, consisting of 1 μl of DNA (50 μg) or nuclease-free water (QIAGEN, Valencia, CA, USA) as negative control, 12.5 μl of KAPA HiFi HotStart ReadyMix (Kapa Biosystems, Wilmington, MA, USA) and 1.5 μl of each primer (10 μM).

    Article Title: The biogeochemical vertical structure renders a meromictic volcanic lake a trap for geogenic CO2 (Lake Averno, Italy)
    Article Snippet: Sequencing libraries were prepared from the purified amplicon libraries using a second PCR. .. The sequencing libraries were purified using Agencourt Ampure XP Bead (Beckman Coulter, USA) following the vendor recommended protocol, using a sample:bead ratio of 5:4, and the DNA was eluted in 20 μL of nuclease free water (Qiagen, Germany).

    Article Title: Comparative Detection and Quantification of Arcobacter butzleri in Stools from Diarrheic and Nondiarrheic People in Southwestern Alberta, Canada
    Article Snippet: .. Amplification reaction mixtures consisted of 2.0 μl of 10× PCR buffer containing 15 mM MgCl2 (Qiagen Inc.), 2.0 μl of UltraPure bovine serum albumin (BSA; 1.0 mg ml−1 ; Ambion, Life Technologies Inc., Burlington, ON, Canada), 0.4 μl of deoxynucleoside triphosphate (dNTP) mix (10 mM; Bio Basic Canada Inc., Markham, ON, Canada), 0.1 μl of HotStarTaq Plus DNA polymerase (5.0 U μl−1 ; Qiagen Inc.), 1.0 μl of ddAbutzF (10 μM; Integrated DNA Technologies, Coralville, IA), 1.0 μl of ddAbutzR (10 μM; Integrated DNA Technologies), 2.0 μl of DNA template, and 11.5 μl of nuclease-free water (Qiagen Inc.). ..

    Article Title: Comparative Detection and Quantification of Arcobacter butzleri in Stools from Diarrheic and Nondiarrheic People in Southwestern Alberta, Canada
    Article Snippet: .. The presence and quantities of the IAC were confirmed by real-time PCR amplification on a Stratagene Mx3005P quantitative PCR (qPCR) system (Agilent Technologies, Santa Clara, CA) using the following reagents: 10 μl of 2× Quantitect SYBR green (Qiagen Inc.), 2.0 μl of UltraPure BSA (1.0 mg ml−1 ; Ambion), 1.0 μl of primer IAC-f (10 μM; Integrated DNA Technologies), 1.0 μl of primer IAC-r (10 μM; Integrated DNA Technologies), 2.0 μl of DNA template, and 4.0 μl of nuclease-free water (Qiagen Inc.). ..

    Article Title: Apple endophytic microbiota of different rootstock/scion combinations suggests a genotype-specific influence
    Article Snippet: Nuclease-free water (QIAGEN, Valencia, CA, USA) replaced template DNA in negative controls. .. All amplicons and amplification mixtures including negative controls were sequenced on a MiSeq platform using V2 chemistry (Illumina, San Diego, CA, USA).

    Article Title: Magnetic Hyperthermia in Y79 Retinoblastoma and ARPE-19 Retinal Epithelial Cells: Tumor Selective Apoptotic Activity of Iron Oxide Nanoparticle
    Article Snippet: .. A solution of 25 μl made of the amplified cDNA diluted with nuclease-free water and RT2 SYBR Green qPCR Mastermix (catalog number 330502; Qiagen) was added to each well of the RT2 Profiler PCR Array Human Apoptosis (catalog number PAHS-012Z; Qiagen) plate. .. Real-time PCR was performed on a CFX96 PCR system (Bio-Rad Laboratories, Hercules, CA) by using SYBR green detection.

    Positive Control:

    Article Title: Identification of a Human Papillomavirus–Associated Oncogenic miRNA Panel in Human Oropharyngeal Squamous Cell Carcinoma Validated by Bioinformatics Analysis of The Cancer Genome Atlas
    Article Snippet: .. The LNATM primer sets for miR-9, four candidate reference genes, and two positive control primer sets were obtained from Exiqon A/S. cDNA from the reverse transcription reactions were diluted 100× with nuclease-free water combined 1:1 with 2× PCR master mix (Exiqon A/S) and 0.05 ng of total RNA per reaction. .. Real-time PCR amplification and melting curve analysis was performed using an ABI StepOnePlus system (Applied Biosystems, Foster City, CA) in a standard (2-hour) run according to the following cycles: polymerase activation/denaturation at 95°C for 10 minutes, amplification for 40 cycles at 95°C for 10 seconds, followed by 60°C for 1 minute at a ramp rate of 1.6 degrees centigrade per second, and melting curve analysis as specified by the StepOnePlus system.

    Synthesized:

    Article Title: Discovery of siRNA Lipid Nanoparticles to Transfect Suspension Leukemia Cells and Provide In Vivo Delivery Capability
    Article Snippet: Dlin-KC2-DMA: 2-(2,2-di((9Z,12Z)-octadeca-9,12-dienyl)-1,3-dioxolan-4-yl)-N,N-dimethylethanamine; DLin-KC2-ClMDMA: N-(chloromethyl)-2-(2,2-di((9Z,12Z)-octadeca-9,12-dienyl)-1,3-dioxolan-4-yl)-N,N-dimethylethanamonium chloride; DLin-KC2-TMA: 2-(2,2-di((9Z,12Z)-octadeca-9,12-dienyl)-1,3-dioxolan-4-yl)-N,N,N-trimethylethanamonium iodide; DLin-KC2-DMEA: 2-(2,2-di((9Z,12Z)-octadeca-9,12-dienyl)-1,3-dioxolan-4-yl)-N-ethyl-N,N-dimethylethanamonium iodide; PEG-c-DOMG: R-3-[(ω-methoxy-poly(ethyleneglycol)2000 )carbamoyl]-1,2-dimyristyloxy-propyl-3-amine, were synthesized in Roche Chemistry Department. .. In a separate vial (borosilicate, Schott Fiolax Clear) with magnetic stirring bar, the siRNA portion was diluted to an appropriate concentration using either nuclease-free water (Qiagen, Valencia, CA), citrate buffer (20 mmol/l, pH 4.0), or 5% Dextrose.

    Article Title: Comparative Detection and Quantification of Arcobacter butzleri in Stools from Diarrheic and Nondiarrheic People in Southwestern Alberta, Canada
    Article Snippet: The IAC targets a 268-bp sequence in a putative carbohydrate kinase (PfkB family; GenBank accession number ) using the primers IAC-f (3′-GGTATGCTAGCCCCGCTTAGGGT-5′) and IAC-r (3′-TGCTCCAGAAAAGATGTCCAGCGG-5′ and was synthesized by Integrated DNA Technologies. .. The presence and quantities of the IAC were confirmed by real-time PCR amplification on a Stratagene Mx3005P quantitative PCR (qPCR) system (Agilent Technologies, Santa Clara, CA) using the following reagents: 10 μl of 2× Quantitect SYBR green (Qiagen Inc.), 2.0 μl of UltraPure BSA (1.0 mg ml−1 ; Ambion), 1.0 μl of primer IAC-f (10 μM; Integrated DNA Technologies), 1.0 μl of primer IAC-r (10 μM; Integrated DNA Technologies), 2.0 μl of DNA template, and 4.0 μl of nuclease-free water (Qiagen Inc.).

    Article Title: Magnetic Hyperthermia in Y79 Retinoblastoma and ARPE-19 Retinal Epithelial Cells: Tumor Selective Apoptotic Activity of Iron Oxide Nanoparticle
    Article Snippet: A total of 25 ng of complementary DNA (cDNA) was then synthesized and preamplified using the RT2 PreAMP cDNA Synthesis kit (catalog number 330451; Qiagen) following the manufacturer's instructions. .. A solution of 25 μl made of the amplified cDNA diluted with nuclease-free water and RT2 SYBR Green qPCR Mastermix (catalog number 330502; Qiagen) was added to each well of the RT2 Profiler PCR Array Human Apoptosis (catalog number PAHS-012Z; Qiagen) plate.

    Quantitative RT-PCR:

    Article Title: Fluorescence activated cell sorting followed by small RNA sequencing reveals stable microRNA expression during cell cycle progression
    Article Snippet: .. RNA isolation, messenger RNA profiling and validation by qRT-PCR Total RNA was isolated using miRNeasy Mini Kit (Qiagen), according to the manufacturer’s instructions and was eluted in 50 uL nuclease-free water (Qiagen). .. RNA concentration and integrity was determined by the Agilent Bioanalyzer 2100 system (Agilent Technologies, Additional file : Figure S1, Additional file : Table S1).

    SYBR Green Assay:

    Article Title: Comparative Detection and Quantification of Arcobacter butzleri in Stools from Diarrheic and Nondiarrheic People in Southwestern Alberta, Canada
    Article Snippet: .. The presence and quantities of the IAC were confirmed by real-time PCR amplification on a Stratagene Mx3005P quantitative PCR (qPCR) system (Agilent Technologies, Santa Clara, CA) using the following reagents: 10 μl of 2× Quantitect SYBR green (Qiagen Inc.), 2.0 μl of UltraPure BSA (1.0 mg ml−1 ; Ambion), 1.0 μl of primer IAC-f (10 μM; Integrated DNA Technologies), 1.0 μl of primer IAC-r (10 μM; Integrated DNA Technologies), 2.0 μl of DNA template, and 4.0 μl of nuclease-free water (Qiagen Inc.). ..

    Article Title: Magnetic Hyperthermia in Y79 Retinoblastoma and ARPE-19 Retinal Epithelial Cells: Tumor Selective Apoptotic Activity of Iron Oxide Nanoparticle
    Article Snippet: .. A solution of 25 μl made of the amplified cDNA diluted with nuclease-free water and RT2 SYBR Green qPCR Mastermix (catalog number 330502; Qiagen) was added to each well of the RT2 Profiler PCR Array Human Apoptosis (catalog number PAHS-012Z; Qiagen) plate. .. Real-time PCR was performed on a CFX96 PCR system (Bio-Rad Laboratories, Hercules, CA) by using SYBR green detection.

    Incubation:

    Article Title: TALE factors use two distinct functional modes to control an essential zebrafish gene expression program
    Article Snippet: Chromatin fragments were eluted by the addition of 50 μl of freshly made elution buffer (10 mM Tris-HCl pH8.0, 1 mM EDTA, 2% SDS) and incubation at 25°C for 15 min followed by an incubation at 65°C for another 15 min. Then, DNA fragments were reverse cross-linked by adding 2.5 μl of 5M NaCl and incubating at 65°C O/N. .. Finally, DNA fragments were recovered in 10 μl nuclease free water using a PCR purification mini-elute kit (Qiagen).

    Article Title: The absence of N-acetylglucosamine in wall teichoic acids of Listeria monocytogenes modifies biofilm architecture and tolerance to rinsing and cleaning procedures
    Article Snippet: The cell fraction was incubated for 5 min at room temperature in the dark, then subjected to light exposure at 80% during 10 min in Eppendorf tube using a PhAST Blue lamp (GenIUL, Barcelone, Espagne). .. For relative quantification of extracted DNA, the hlyA gene which encodes a pore-forming toxin listeriolysin O was used as a genetic target. qPCR was performed in a total volume of 25 μl containing 2.5 μl extracted genomic DNA, 12.5 μl of SYBR® Premix Ex Taq™ (Perfect Real Time), 1μM of forward primer NovF ( 5′- TGC AAG TCC TAA GAC GCC A-3′ ) (Eurobio, Les Ulis, France) [ ], 1 μM of reverse primer NovR ( 5′- CAC TGC ATC TCC GTG GTA TAC TAA -3′ ) (Eurobio) [ ] and 9 μl of nuclease free water (Qiagen, Hilden, Germany).

    Article Title: Comparative Detection and Quantification of Arcobacter butzleri in Stools from Diarrheic and Nondiarrheic People in Southwestern Alberta, Canada
    Article Snippet: To enumerate A. butzleri cells by culture, 1.0 g of the seeded feces was suspended in 9.0 ml of CB and diluted in a 10-fold dilution series, and 100 μl of each dilution was spread on CBA in duplicate, cultures were incubated in a microaerobic atmosphere (i.e., 5% O2 , 3% H2 , 10% CO2 , and 82% N2 ) at 37°C, and colonies were enumerated at the dilution yielding 30 to 300 CFU after 48 and 96 h. The experiment was conducted two times on separate occasions. .. The presence and quantities of the IAC were confirmed by real-time PCR amplification on a Stratagene Mx3005P quantitative PCR (qPCR) system (Agilent Technologies, Santa Clara, CA) using the following reagents: 10 μl of 2× Quantitect SYBR green (Qiagen Inc.), 2.0 μl of UltraPure BSA (1.0 mg ml−1 ; Ambion), 1.0 μl of primer IAC-f (10 μM; Integrated DNA Technologies), 1.0 μl of primer IAC-r (10 μM; Integrated DNA Technologies), 2.0 μl of DNA template, and 4.0 μl of nuclease-free water (Qiagen Inc.).

    Article Title: Interleukin-17A Promotes Aortic Endothelial Cell Activation via Transcriptionally and Post-translationally Activating p38 Mitogen-activated Protein Kinase (MAPK) Pathway *
    Article Snippet: Lysed cells were incubated for 5 min at room temperature for complete dissociation of nucleoprotein complex. .. After centrifugation, the RNA pellet was washed twice with 75% ethyl alcohol in nuclease-free water (Qiagen, Valencia, CA).

    Article Title: Apple endophytic microbiota of different rootstock/scion combinations suggests a genotype-specific influence
    Article Snippet: The reactions were incubated in a T100 thermal cycler (Bio-Rad) for 3 min at 98 °C followed by 30 cycles of 30 s at 95 °C, 30 s at 50 °C, and 30 s at 72 °C. .. Nuclease-free water (QIAGEN, Valencia, CA, USA) replaced template DNA in negative controls.

    Article Title: Magnetic Hyperthermia in Y79 Retinoblastoma and ARPE-19 Retinal Epithelial Cells: Tumor Selective Apoptotic Activity of Iron Oxide Nanoparticle
    Article Snippet: The cells were further incubated for 24 hours after magnetic induction. .. A solution of 25 μl made of the amplified cDNA diluted with nuclease-free water and RT2 SYBR Green qPCR Mastermix (catalog number 330502; Qiagen) was added to each well of the RT2 Profiler PCR Array Human Apoptosis (catalog number PAHS-012Z; Qiagen) plate.

    Modification:

    Article Title: Impact of Bactrocera oleae on the fungal microbiota of ripe olive drupes
    Article Snippet: DNA extracts were amplified using the universal fungal primers ITS3_KYO2 ( GATGAAGAACGYAGYRAA ) [ ] and ITS4 ( TCCTCCGCTTATTGATATGC ) [ ], modified by adding the adapters needed for Illumina MiSeq sequencing. .. PCR reactions were conducted in a total volume of 25 μl, consisting of 1 μl of DNA (50 μg) or nuclease-free water (QIAGEN, Valencia, CA, USA) as negative control, 12.5 μl of KAPA HiFi HotStart ReadyMix (Kapa Biosystems, Wilmington, MA, USA) and 1.5 μl of each primer (10 μM).

    Western Blot:

    Article Title: Identification of a Human Papillomavirus–Associated Oncogenic miRNA Panel in Human Oropharyngeal Squamous Cell Carcinoma Validated by Bioinformatics Analysis of The Cancer Genome Atlas
    Article Snippet: For Western blot analysis, 20 μg of protein from cell lysates was electrophoresed on SDS-PAGE and electroblotted to polyvinylidene difluoride membranes. .. The LNATM primer sets for miR-9, four candidate reference genes, and two positive control primer sets were obtained from Exiqon A/S. cDNA from the reverse transcription reactions were diluted 100× with nuclease-free water combined 1:1 with 2× PCR master mix (Exiqon A/S) and 0.05 ng of total RNA per reaction.

    Concentration Assay:

    Article Title: The absence of N-acetylglucosamine in wall teichoic acids of Listeria monocytogenes modifies biofilm architecture and tolerance to rinsing and cleaning procedures
    Article Snippet: The DNA concentration was measured with a DS-11 Spectrophotometer from Denovix (Wilmington, NC, USA). .. For relative quantification of extracted DNA, the hlyA gene which encodes a pore-forming toxin listeriolysin O was used as a genetic target. qPCR was performed in a total volume of 25 μl containing 2.5 μl extracted genomic DNA, 12.5 μl of SYBR® Premix Ex Taq™ (Perfect Real Time), 1μM of forward primer NovF ( 5′- TGC AAG TCC TAA GAC GCC A-3′ ) (Eurobio, Les Ulis, France) [ ], 1 μM of reverse primer NovR ( 5′- CAC TGC ATC TCC GTG GTA TAC TAA -3′ ) (Eurobio) [ ] and 9 μl of nuclease free water (Qiagen, Hilden, Germany).

    Article Title: The biogeochemical vertical structure renders a meromictic volcanic lake a trap for geogenic CO2 (Lake Averno, Italy)
    Article Snippet: DNA concentration was measured using Quant-iT DNA Assay Kit, high sensitivity (Thermo Fisher Scientific, USA). .. The sequencing libraries were purified using Agencourt Ampure XP Bead (Beckman Coulter, USA) following the vendor recommended protocol, using a sample:bead ratio of 5:4, and the DNA was eluted in 20 μL of nuclease free water (Qiagen, Germany).

    Article Title: Discovery of siRNA Lipid Nanoparticles to Transfect Suspension Leukemia Cells and Provide In Vivo Delivery Capability
    Article Snippet: .. In a separate vial (borosilicate, Schott Fiolax Clear) with magnetic stirring bar, the siRNA portion was diluted to an appropriate concentration using either nuclease-free water (Qiagen, Valencia, CA), citrate buffer (20 mmol/l, pH 4.0), or 5% Dextrose. .. The lipid-ethanol solution was then added with rapid stirring to the aqueous siRNA-containing solution resulting in a final ethanol concentration of 10–50%.

    Article Title: Interleukin-17A Promotes Aortic Endothelial Cell Activation via Transcriptionally and Post-translationally Activating p38 Mitogen-activated Protein Kinase (MAPK) Pathway *
    Article Snippet: After centrifugation, the RNA pellet was washed twice with 75% ethyl alcohol in nuclease-free water (Qiagen, Valencia, CA). .. RNA quality and concentration were determined by the NanoDrop 2000 (Thermo Scientific, Wilmington, DE).

    Article Title: Fluorescence activated cell sorting followed by small RNA sequencing reveals stable microRNA expression during cell cycle progression
    Article Snippet: RNA isolation, messenger RNA profiling and validation by qRT-PCR Total RNA was isolated using miRNeasy Mini Kit (Qiagen), according to the manufacturer’s instructions and was eluted in 50 uL nuclease-free water (Qiagen). .. RNA concentration and integrity was determined by the Agilent Bioanalyzer 2100 system (Agilent Technologies, Additional file : Figure S1, Additional file : Table S1).

    Polymerase Chain Reaction:

    Article Title: Identification of a Human Papillomavirus–Associated Oncogenic miRNA Panel in Human Oropharyngeal Squamous Cell Carcinoma Validated by Bioinformatics Analysis of The Cancer Genome Atlas
    Article Snippet: .. The LNATM primer sets for miR-9, four candidate reference genes, and two positive control primer sets were obtained from Exiqon A/S. cDNA from the reverse transcription reactions were diluted 100× with nuclease-free water combined 1:1 with 2× PCR master mix (Exiqon A/S) and 0.05 ng of total RNA per reaction. .. Real-time PCR amplification and melting curve analysis was performed using an ABI StepOnePlus system (Applied Biosystems, Foster City, CA) in a standard (2-hour) run according to the following cycles: polymerase activation/denaturation at 95°C for 10 minutes, amplification for 40 cycles at 95°C for 10 seconds, followed by 60°C for 1 minute at a ramp rate of 1.6 degrees centigrade per second, and melting curve analysis as specified by the StepOnePlus system.

    Article Title: TALE factors use two distinct functional modes to control an essential zebrafish gene expression program
    Article Snippet: .. Finally, DNA fragments were recovered in 10 μl nuclease free water using a PCR purification mini-elute kit (Qiagen). .. ChIP DNA fragments and their corresponding input were quantified on a Qubit with the dsDNA HS assay kit (ThermoFisher Scientific).

    Article Title: Impact of Bactrocera oleae on the fungal microbiota of ripe olive drupes
    Article Snippet: .. PCR reactions were conducted in a total volume of 25 μl, consisting of 1 μl of DNA (50 μg) or nuclease-free water (QIAGEN, Valencia, CA, USA) as negative control, 12.5 μl of KAPA HiFi HotStart ReadyMix (Kapa Biosystems, Wilmington, MA, USA) and 1.5 μl of each primer (10 μM). .. Amplification was performed in an Eppendorf Vapo Protect Mastercycler pro S (Eppendorf, Germany) as follows: 3 min at 98°C followed by 30 cycles of 30 s at 95°C, 30 s at 50°C and 30 s at 72°C.

    Article Title: The biogeochemical vertical structure renders a meromictic volcanic lake a trap for geogenic CO2 (Lake Averno, Italy)
    Article Snippet: Sequencing libraries were prepared from the purified amplicon libraries using a second PCR. .. The sequencing libraries were purified using Agencourt Ampure XP Bead (Beckman Coulter, USA) following the vendor recommended protocol, using a sample:bead ratio of 5:4, and the DNA was eluted in 20 μL of nuclease free water (Qiagen, Germany).

    Article Title: Comparative Detection and Quantification of Arcobacter butzleri in Stools from Diarrheic and Nondiarrheic People in Southwestern Alberta, Canada
    Article Snippet: .. Amplification reaction mixtures consisted of 2.0 μl of 10× PCR buffer containing 15 mM MgCl2 (Qiagen Inc.), 2.0 μl of UltraPure bovine serum albumin (BSA; 1.0 mg ml−1 ; Ambion, Life Technologies Inc., Burlington, ON, Canada), 0.4 μl of deoxynucleoside triphosphate (dNTP) mix (10 mM; Bio Basic Canada Inc., Markham, ON, Canada), 0.1 μl of HotStarTaq Plus DNA polymerase (5.0 U μl−1 ; Qiagen Inc.), 1.0 μl of ddAbutzF (10 μM; Integrated DNA Technologies, Coralville, IA), 1.0 μl of ddAbutzR (10 μM; Integrated DNA Technologies), 2.0 μl of DNA template, and 11.5 μl of nuclease-free water (Qiagen Inc.). ..

    Article Title: Apple endophytic microbiota of different rootstock/scion combinations suggests a genotype-specific influence
    Article Snippet: PCR reactions were conducted in a total volume of 25 μL containing 12.5 μL of KAPA HiFi HotStart ReadyMix (Kapa Biosystems, Wilmington, MA, USA), 1.0 μL of each primer (10 μM), 2.5 μL of DNA template, and 8.0 μL nuclease-free water. .. Nuclease-free water (QIAGEN, Valencia, CA, USA) replaced template DNA in negative controls.

    Article Title: Magnetic Hyperthermia in Y79 Retinoblastoma and ARPE-19 Retinal Epithelial Cells: Tumor Selective Apoptotic Activity of Iron Oxide Nanoparticle
    Article Snippet: .. A solution of 25 μl made of the amplified cDNA diluted with nuclease-free water and RT2 SYBR Green qPCR Mastermix (catalog number 330502; Qiagen) was added to each well of the RT2 Profiler PCR Array Human Apoptosis (catalog number PAHS-012Z; Qiagen) plate. .. Real-time PCR was performed on a CFX96 PCR system (Bio-Rad Laboratories, Hercules, CA) by using SYBR green detection.

    Sequencing:

    Article Title: Impact of Bactrocera oleae on the fungal microbiota of ripe olive drupes
    Article Snippet: Paragraph title: Library preparation and sequencing ... PCR reactions were conducted in a total volume of 25 μl, consisting of 1 μl of DNA (50 μg) or nuclease-free water (QIAGEN, Valencia, CA, USA) as negative control, 12.5 μl of KAPA HiFi HotStart ReadyMix (Kapa Biosystems, Wilmington, MA, USA) and 1.5 μl of each primer (10 μM).

    Article Title: The biogeochemical vertical structure renders a meromictic volcanic lake a trap for geogenic CO2 (Lake Averno, Italy)
    Article Snippet: .. The sequencing libraries were purified using Agencourt Ampure XP Bead (Beckman Coulter, USA) following the vendor recommended protocol, using a sample:bead ratio of 5:4, and the DNA was eluted in 20 μL of nuclease free water (Qiagen, Germany). .. DNA concentration was measured using Quant-iT DNA Assay Kit, high sensitivity (Thermo Fisher Scientific, USA).

    Article Title: Comparative Detection and Quantification of Arcobacter butzleri in Stools from Diarrheic and Nondiarrheic People in Southwestern Alberta, Canada
    Article Snippet: The IAC targets a 268-bp sequence in a putative carbohydrate kinase (PfkB family; GenBank accession number ) using the primers IAC-f (3′-GGTATGCTAGCCCCGCTTAGGGT-5′) and IAC-r (3′-TGCTCCAGAAAAGATGTCCAGCGG-5′ and was synthesized by Integrated DNA Technologies. .. The presence and quantities of the IAC were confirmed by real-time PCR amplification on a Stratagene Mx3005P quantitative PCR (qPCR) system (Agilent Technologies, Santa Clara, CA) using the following reagents: 10 μl of 2× Quantitect SYBR green (Qiagen Inc.), 2.0 μl of UltraPure BSA (1.0 mg ml−1 ; Ambion), 1.0 μl of primer IAC-f (10 μM; Integrated DNA Technologies), 1.0 μl of primer IAC-r (10 μM; Integrated DNA Technologies), 2.0 μl of DNA template, and 4.0 μl of nuclease-free water (Qiagen Inc.).

    Injection:

    Article Title: Discovery of siRNA Lipid Nanoparticles to Transfect Suspension Leukemia Cells and Provide In Vivo Delivery Capability
    Article Snippet: In a separate vial (borosilicate, Schott Fiolax Clear) with magnetic stirring bar, the siRNA portion was diluted to an appropriate concentration using either nuclease-free water (Qiagen, Valencia, CA), citrate buffer (20 mmol/l, pH 4.0), or 5% Dextrose. .. The injection rate of the lipid-ethanol solution is controlled by a syringe pump (Harvard Apparatus).

    Crocin Bleaching Assay:

    Article Title: Comparative Detection and Quantification of Arcobacter butzleri in Stools from Diarrheic and Nondiarrheic People in Southwestern Alberta, Canada
    Article Snippet: To enumerate A. butzleri cells by culture, 1.0 g of the seeded feces was suspended in 9.0 ml of CB and diluted in a 10-fold dilution series, and 100 μl of each dilution was spread on CBA in duplicate, cultures were incubated in a microaerobic atmosphere (i.e., 5% O2 , 3% H2 , 10% CO2 , and 82% N2 ) at 37°C, and colonies were enumerated at the dilution yielding 30 to 300 CFU after 48 and 96 h. The experiment was conducted two times on separate occasions. .. The presence and quantities of the IAC were confirmed by real-time PCR amplification on a Stratagene Mx3005P quantitative PCR (qPCR) system (Agilent Technologies, Santa Clara, CA) using the following reagents: 10 μl of 2× Quantitect SYBR green (Qiagen Inc.), 2.0 μl of UltraPure BSA (1.0 mg ml−1 ; Ambion), 1.0 μl of primer IAC-f (10 μM; Integrated DNA Technologies), 1.0 μl of primer IAC-r (10 μM; Integrated DNA Technologies), 2.0 μl of DNA template, and 4.0 μl of nuclease-free water (Qiagen Inc.).

    ChIP-sequencing:

    Article Title: TALE factors use two distinct functional modes to control an essential zebrafish gene expression program
    Article Snippet: Paragraph title: ChIP-seq ... Finally, DNA fragments were recovered in 10 μl nuclease free water using a PCR purification mini-elute kit (Qiagen).

    Nucleic Acid Electrophoresis:

    Article Title: The biogeochemical vertical structure renders a meromictic volcanic lake a trap for geogenic CO2 (Lake Averno, Italy)
    Article Snippet: The sequencing libraries were purified using Agencourt Ampure XP Bead (Beckman Coulter, USA) following the vendor recommended protocol, using a sample:bead ratio of 5:4, and the DNA was eluted in 20 μL of nuclease free water (Qiagen, Germany). .. Gel electrophoresis using Tapestation 2200 and D1000 High Sensitivity screentapes (Agilent, USA) was used to check the product size and purity of randomly picked sequencing libraries.

    Isolation:

    Article Title: Identification of a Human Papillomavirus–Associated Oncogenic miRNA Panel in Human Oropharyngeal Squamous Cell Carcinoma Validated by Bioinformatics Analysis of The Cancer Genome Atlas
    Article Snippet: To assess levels of miR-9 in cell lines, RNA was extracted in technical triplicates using the miRCURY RNA isolation kit (Exiqon A/S) according to the manufacturer's instructions, polyadenylated, and reverse transcribed into cDNA in a single reaction with the Universal cDNA synthesis kit II (Exiqon A/S). .. The LNATM primer sets for miR-9, four candidate reference genes, and two positive control primer sets were obtained from Exiqon A/S. cDNA from the reverse transcription reactions were diluted 100× with nuclease-free water combined 1:1 with 2× PCR master mix (Exiqon A/S) and 0.05 ng of total RNA per reaction.

    Article Title: Comparative Detection and Quantification of Arcobacter butzleri in Stools from Diarrheic and Nondiarrheic People in Southwestern Alberta, Canada
    Article Snippet: As an internal amplification control (IAC), 2 μl of DNA (1 × 106 copies μl−1 ) from a synthesized gene designed using the genome of Pyrococcus yayanosii ( ) was added to the feces subsamples prior to extraction; this bacterium is an obligate piezophilic hyperthermophilic archaeon isolated from deep-sea hydrothermal sites ( ). .. The presence and quantities of the IAC were confirmed by real-time PCR amplification on a Stratagene Mx3005P quantitative PCR (qPCR) system (Agilent Technologies, Santa Clara, CA) using the following reagents: 10 μl of 2× Quantitect SYBR green (Qiagen Inc.), 2.0 μl of UltraPure BSA (1.0 mg ml−1 ; Ambion), 1.0 μl of primer IAC-f (10 μM; Integrated DNA Technologies), 1.0 μl of primer IAC-r (10 μM; Integrated DNA Technologies), 2.0 μl of DNA template, and 4.0 μl of nuclease-free water (Qiagen Inc.).

    Article Title: Interleukin-17A Promotes Aortic Endothelial Cell Activation via Transcriptionally and Post-translationally Activating p38 Mitogen-activated Protein Kinase (MAPK) Pathway *
    Article Snippet: Total RNA was isolated as we described previously ( ) from HAECs with TRIzol® reagent (Invitrogen). .. After centrifugation, the RNA pellet was washed twice with 75% ethyl alcohol in nuclease-free water (Qiagen, Valencia, CA).

    Article Title: Fluorescence activated cell sorting followed by small RNA sequencing reveals stable microRNA expression during cell cycle progression
    Article Snippet: .. RNA isolation, messenger RNA profiling and validation by qRT-PCR Total RNA was isolated using miRNeasy Mini Kit (Qiagen), according to the manufacturer’s instructions and was eluted in 50 uL nuclease-free water (Qiagen). .. RNA concentration and integrity was determined by the Agilent Bioanalyzer 2100 system (Agilent Technologies, Additional file : Figure S1, Additional file : Table S1).

    Article Title: Genome-Wide Gene Expression Changes in the Normal-Appearing Airway during the Evolution of Smoking-Associated Lung Adenocarcinoma
    Article Snippet: Paragraph title: Total RNA isolation from mouse airway brushings ... Purified RNA samples were then cleaned and resuspended in nuclease-free water using the RNeasy MinElute Cleanup Kit from Qiagen according to the manufacturer’s protocol.

    Negative Control:

    Article Title: Impact of Bactrocera oleae on the fungal microbiota of ripe olive drupes
    Article Snippet: .. PCR reactions were conducted in a total volume of 25 μl, consisting of 1 μl of DNA (50 μg) or nuclease-free water (QIAGEN, Valencia, CA, USA) as negative control, 12.5 μl of KAPA HiFi HotStart ReadyMix (Kapa Biosystems, Wilmington, MA, USA) and 1.5 μl of each primer (10 μM). .. Amplification was performed in an Eppendorf Vapo Protect Mastercycler pro S (Eppendorf, Germany) as follows: 3 min at 98°C followed by 30 cycles of 30 s at 95°C, 30 s at 50°C and 30 s at 72°C.

    Labeling:

    Article Title: Changes in Mycobacterium tuberculosis-Specific Immunity With Influenza co-infection at Time of TB Diagnosis
    Article Snippet: To detect 16 S RNA, a master mix containing 12.5 μl Quantitect Master Mix, 6.65 μl of nuclease free water, 0.25 μl reverse transcriptase, 0.3 μl of 16 S-ROX (Rox-AGGACCACGGGATGCATGTCTTGT-BHQ2) (all supplied by Qiagen, Netherlands) per reaction was prepared. .. A master mix containing 12.5 μl Quantitect Master Mix, 5.05 μl of nuclease free water, 0.25 μl reverse transcriptase, 1.2 μl 50 nM MgCl2+ (Qiagen, The Netherlands) and 1 μl VIC labeled 560 Control Mix (Bioline, UK) per reaction was prepared to detect the IC.

    Purification:

    Article Title: TALE factors use two distinct functional modes to control an essential zebrafish gene expression program
    Article Snippet: .. Finally, DNA fragments were recovered in 10 μl nuclease free water using a PCR purification mini-elute kit (Qiagen). .. ChIP DNA fragments and their corresponding input were quantified on a Qubit with the dsDNA HS assay kit (ThermoFisher Scientific).

    Article Title: Impact of Bactrocera oleae on the fungal microbiota of ripe olive drupes
    Article Snippet: PCR reactions were conducted in a total volume of 25 μl, consisting of 1 μl of DNA (50 μg) or nuclease-free water (QIAGEN, Valencia, CA, USA) as negative control, 12.5 μl of KAPA HiFi HotStart ReadyMix (Kapa Biosystems, Wilmington, MA, USA) and 1.5 μl of each primer (10 μM). .. PCR products were purified using the Agencourt Ampure XP kit (BECKMAN COULTER-Beverly, Massachusetts), multiplexed using the Nextera XT indexing kit (Illumina, Inc., San Diego, CA), and purified again with the Agencourt Ampure XP kit.

    Article Title: The absence of N-acetylglucosamine in wall teichoic acids of Listeria monocytogenes modifies biofilm architecture and tolerance to rinsing and cleaning procedures
    Article Snippet: For qPCR assay, the cell fractions were centrifuged (5 000 x g, 10 min) and DNA was extracted with the DNeasy® Blood & Tissue kit (Qiagen, Hilden, Germany) according to the specifications provided by the supplier (protocol “Purification of Total DNA from Animal Tissues”, using ATL lysis buffer). .. For relative quantification of extracted DNA, the hlyA gene which encodes a pore-forming toxin listeriolysin O was used as a genetic target. qPCR was performed in a total volume of 25 μl containing 2.5 μl extracted genomic DNA, 12.5 μl of SYBR® Premix Ex Taq™ (Perfect Real Time), 1μM of forward primer NovF ( 5′- TGC AAG TCC TAA GAC GCC A-3′ ) (Eurobio, Les Ulis, France) [ ], 1 μM of reverse primer NovR ( 5′- CAC TGC ATC TCC GTG GTA TAC TAA -3′ ) (Eurobio) [ ] and 9 μl of nuclease free water (Qiagen, Hilden, Germany).

    Article Title: The biogeochemical vertical structure renders a meromictic volcanic lake a trap for geogenic CO2 (Lake Averno, Italy)
    Article Snippet: .. The sequencing libraries were purified using Agencourt Ampure XP Bead (Beckman Coulter, USA) following the vendor recommended protocol, using a sample:bead ratio of 5:4, and the DNA was eluted in 20 μL of nuclease free water (Qiagen, Germany). .. DNA concentration was measured using Quant-iT DNA Assay Kit, high sensitivity (Thermo Fisher Scientific, USA).

    Article Title: Genome-Wide Gene Expression Changes in the Normal-Appearing Airway during the Evolution of Smoking-Associated Lung Adenocarcinoma
    Article Snippet: .. Purified RNA samples were then cleaned and resuspended in nuclease-free water using the RNeasy MinElute Cleanup Kit from Qiagen according to the manufacturer’s protocol. .. RNA quantity was measured using the NanoDrop 1000.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Changes in Mycobacterium tuberculosis-Specific Immunity With Influenza co-infection at Time of TB Diagnosis
    Article Snippet: Levels of 16 S RNA and internal control (IC) were quantified using reverse transcription polymerase chain reaction (RT-PCR). .. To detect 16 S RNA, a master mix containing 12.5 μl Quantitect Master Mix, 6.65 μl of nuclease free water, 0.25 μl reverse transcriptase, 0.3 μl of 16 S-ROX (Rox-AGGACCACGGGATGCATGTCTTGT-BHQ2) (all supplied by Qiagen, Netherlands) per reaction was prepared.

    IA:

    Article Title: Comparative Detection and Quantification of Arcobacter butzleri in Stools from Diarrheic and Nondiarrheic People in Southwestern Alberta, Canada
    Article Snippet: .. Amplification reaction mixtures consisted of 2.0 μl of 10× PCR buffer containing 15 mM MgCl2 (Qiagen Inc.), 2.0 μl of UltraPure bovine serum albumin (BSA; 1.0 mg ml−1 ; Ambion, Life Technologies Inc., Burlington, ON, Canada), 0.4 μl of deoxynucleoside triphosphate (dNTP) mix (10 mM; Bio Basic Canada Inc., Markham, ON, Canada), 0.1 μl of HotStarTaq Plus DNA polymerase (5.0 U μl−1 ; Qiagen Inc.), 1.0 μl of ddAbutzF (10 μM; Integrated DNA Technologies, Coralville, IA), 1.0 μl of ddAbutzR (10 μM; Integrated DNA Technologies), 2.0 μl of DNA template, and 11.5 μl of nuclease-free water (Qiagen Inc.). ..

    Chromatin Immunoprecipitation:

    Article Title: TALE factors use two distinct functional modes to control an essential zebrafish gene expression program
    Article Snippet: Finally, DNA fragments were recovered in 10 μl nuclease free water using a PCR purification mini-elute kit (Qiagen). .. ChIP DNA fragments and their corresponding input were quantified on a Qubit with the dsDNA HS assay kit (ThermoFisher Scientific).

    SDS Page:

    Article Title: Identification of a Human Papillomavirus–Associated Oncogenic miRNA Panel in Human Oropharyngeal Squamous Cell Carcinoma Validated by Bioinformatics Analysis of The Cancer Genome Atlas
    Article Snippet: For Western blot analysis, 20 μg of protein from cell lysates was electrophoresed on SDS-PAGE and electroblotted to polyvinylidene difluoride membranes. .. The LNATM primer sets for miR-9, four candidate reference genes, and two positive control primer sets were obtained from Exiqon A/S. cDNA from the reverse transcription reactions were diluted 100× with nuclease-free water combined 1:1 with 2× PCR master mix (Exiqon A/S) and 0.05 ng of total RNA per reaction.

    Software:

    Article Title: The absence of N-acetylglucosamine in wall teichoic acids of Listeria monocytogenes modifies biofilm architecture and tolerance to rinsing and cleaning procedures
    Article Snippet: For relative quantification of extracted DNA, the hlyA gene which encodes a pore-forming toxin listeriolysin O was used as a genetic target. qPCR was performed in a total volume of 25 μl containing 2.5 μl extracted genomic DNA, 12.5 μl of SYBR® Premix Ex Taq™ (Perfect Real Time), 1μM of forward primer NovF ( 5′- TGC AAG TCC TAA GAC GCC A-3′ ) (Eurobio, Les Ulis, France) [ ], 1 μM of reverse primer NovR ( 5′- CAC TGC ATC TCC GTG GTA TAC TAA -3′ ) (Eurobio) [ ] and 9 μl of nuclease free water (Qiagen, Hilden, Germany). .. Cycle threshold (Cq) values were automatically calculated by the SmartCycler software using the second derivative method.

    Real-time Polymerase Chain Reaction:

    Article Title: Identification of a Human Papillomavirus–Associated Oncogenic miRNA Panel in Human Oropharyngeal Squamous Cell Carcinoma Validated by Bioinformatics Analysis of The Cancer Genome Atlas
    Article Snippet: The LNATM primer sets for miR-9, four candidate reference genes, and two positive control primer sets were obtained from Exiqon A/S. cDNA from the reverse transcription reactions were diluted 100× with nuclease-free water combined 1:1 with 2× PCR master mix (Exiqon A/S) and 0.05 ng of total RNA per reaction. .. Real-time PCR amplification and melting curve analysis was performed using an ABI StepOnePlus system (Applied Biosystems, Foster City, CA) in a standard (2-hour) run according to the following cycles: polymerase activation/denaturation at 95°C for 10 minutes, amplification for 40 cycles at 95°C for 10 seconds, followed by 60°C for 1 minute at a ramp rate of 1.6 degrees centigrade per second, and melting curve analysis as specified by the StepOnePlus system.

    Article Title: The absence of N-acetylglucosamine in wall teichoic acids of Listeria monocytogenes modifies biofilm architecture and tolerance to rinsing and cleaning procedures
    Article Snippet: .. For relative quantification of extracted DNA, the hlyA gene which encodes a pore-forming toxin listeriolysin O was used as a genetic target. qPCR was performed in a total volume of 25 μl containing 2.5 μl extracted genomic DNA, 12.5 μl of SYBR® Premix Ex Taq™ (Perfect Real Time), 1μM of forward primer NovF ( 5′- TGC AAG TCC TAA GAC GCC A-3′ ) (Eurobio, Les Ulis, France) [ ], 1 μM of reverse primer NovR ( 5′- CAC TGC ATC TCC GTG GTA TAC TAA -3′ ) (Eurobio) [ ] and 9 μl of nuclease free water (Qiagen, Hilden, Germany). .. The cycling parameters were: 30 s at 95°C followed by 40 cycles of 15 s at 95°C and 30 s at 57°C and 30 s at 72°C. qPCR and data analysis were performed with a Smart- Cycler II® system (Cepheid, Sunnyvale, USA).

    Article Title: Comparative Detection and Quantification of Arcobacter butzleri in Stools from Diarrheic and Nondiarrheic People in Southwestern Alberta, Canada
    Article Snippet: .. The presence and quantities of the IAC were confirmed by real-time PCR amplification on a Stratagene Mx3005P quantitative PCR (qPCR) system (Agilent Technologies, Santa Clara, CA) using the following reagents: 10 μl of 2× Quantitect SYBR green (Qiagen Inc.), 2.0 μl of UltraPure BSA (1.0 mg ml−1 ; Ambion), 1.0 μl of primer IAC-f (10 μM; Integrated DNA Technologies), 1.0 μl of primer IAC-r (10 μM; Integrated DNA Technologies), 2.0 μl of DNA template, and 4.0 μl of nuclease-free water (Qiagen Inc.). ..

    Article Title: Interleukin-17A Promotes Aortic Endothelial Cell Activation via Transcriptionally and Post-translationally Activating p38 Mitogen-activated Protein Kinase (MAPK) Pathway *
    Article Snippet: Paragraph title: RNA Extraction and Real Time PCR ... After centrifugation, the RNA pellet was washed twice with 75% ethyl alcohol in nuclease-free water (Qiagen, Valencia, CA).

    Article Title: Changes in Mycobacterium tuberculosis-Specific Immunity With Influenza co-infection at Time of TB Diagnosis
    Article Snippet: Paragraph title: Quantitative PCR ... To detect 16 S RNA, a master mix containing 12.5 μl Quantitect Master Mix, 6.65 μl of nuclease free water, 0.25 μl reverse transcriptase, 0.3 μl of 16 S-ROX (Rox-AGGACCACGGGATGCATGTCTTGT-BHQ2) (all supplied by Qiagen, Netherlands) per reaction was prepared.

    Article Title: Real-Time PCR Methodology for Selective Detection of Viable Escherichia coli O157:H7 Cells by Targeting Z3276 as a Genetic Marker
    Article Snippet: Paragraph title: Real-time PCR. ... Five microliters of template DNA (100 pg) was used, and nuclease-free water (Qiagen Sciences, MD) was added to reach a reaction mixture volume of 50 μl.

    Article Title: Magnetic Hyperthermia in Y79 Retinoblastoma and ARPE-19 Retinal Epithelial Cells: Tumor Selective Apoptotic Activity of Iron Oxide Nanoparticle
    Article Snippet: .. A solution of 25 μl made of the amplified cDNA diluted with nuclease-free water and RT2 SYBR Green qPCR Mastermix (catalog number 330502; Qiagen) was added to each well of the RT2 Profiler PCR Array Human Apoptosis (catalog number PAHS-012Z; Qiagen) plate. .. Real-time PCR was performed on a CFX96 PCR system (Bio-Rad Laboratories, Hercules, CA) by using SYBR green detection.

    RNA Extraction:

    Article Title: Interleukin-17A Promotes Aortic Endothelial Cell Activation via Transcriptionally and Post-translationally Activating p38 Mitogen-activated Protein Kinase (MAPK) Pathway *
    Article Snippet: Paragraph title: RNA Extraction and Real Time PCR ... After centrifugation, the RNA pellet was washed twice with 75% ethyl alcohol in nuclease-free water (Qiagen, Valencia, CA).

    Sample Prep:

    Article Title: TALE factors use two distinct functional modes to control an essential zebrafish gene expression program
    Article Snippet: Finally, DNA fragments were recovered in 10 μl nuclease free water using a PCR purification mini-elute kit (Qiagen). .. 10 ng of DNA was used for library preparation using the Tru-seq ChIP Sample Preparation Guide (Illumina Inc).

    Electrophoresis:

    Article Title: Comparative Detection and Quantification of Arcobacter butzleri in Stools from Diarrheic and Nondiarrheic People in Southwestern Alberta, Canada
    Article Snippet: Amplification reaction mixtures consisted of 2.0 μl of 10× PCR buffer containing 15 mM MgCl2 (Qiagen Inc.), 2.0 μl of UltraPure bovine serum albumin (BSA; 1.0 mg ml−1 ; Ambion, Life Technologies Inc., Burlington, ON, Canada), 0.4 μl of deoxynucleoside triphosphate (dNTP) mix (10 mM; Bio Basic Canada Inc., Markham, ON, Canada), 0.1 μl of HotStarTaq Plus DNA polymerase (5.0 U μl−1 ; Qiagen Inc.), 1.0 μl of ddAbutzF (10 μM; Integrated DNA Technologies, Coralville, IA), 1.0 μl of ddAbutzR (10 μM; Integrated DNA Technologies), 2.0 μl of DNA template, and 11.5 μl of nuclease-free water (Qiagen Inc.). .. Amplicons were visualized on a QIAxcel capillary electrophoresis machine (Qiagen Inc.) using the AM320 separation and resolution method, with 15- to 3,000-bp alignment markers and 100- to 2,500-bp size markers.

    Next-Generation Sequencing:

    Article Title: The biogeochemical vertical structure renders a meromictic volcanic lake a trap for geogenic CO2 (Lake Averno, Italy)
    Article Snippet: Paragraph title: Bacterial diversity by next generation sequencing ... The sequencing libraries were purified using Agencourt Ampure XP Bead (Beckman Coulter, USA) following the vendor recommended protocol, using a sample:bead ratio of 5:4, and the DNA was eluted in 20 μL of nuclease free water (Qiagen, Germany).

    Spectrophotometry:

    Article Title: The absence of N-acetylglucosamine in wall teichoic acids of Listeria monocytogenes modifies biofilm architecture and tolerance to rinsing and cleaning procedures
    Article Snippet: The DNA concentration was measured with a DS-11 Spectrophotometer from Denovix (Wilmington, NC, USA). .. For relative quantification of extracted DNA, the hlyA gene which encodes a pore-forming toxin listeriolysin O was used as a genetic target. qPCR was performed in a total volume of 25 μl containing 2.5 μl extracted genomic DNA, 12.5 μl of SYBR® Premix Ex Taq™ (Perfect Real Time), 1μM of forward primer NovF ( 5′- TGC AAG TCC TAA GAC GCC A-3′ ) (Eurobio, Les Ulis, France) [ ], 1 μM of reverse primer NovR ( 5′- CAC TGC ATC TCC GTG GTA TAC TAA -3′ ) (Eurobio) [ ] and 9 μl of nuclease free water (Qiagen, Hilden, Germany).

    Activation Assay:

    Article Title: Identification of a Human Papillomavirus–Associated Oncogenic miRNA Panel in Human Oropharyngeal Squamous Cell Carcinoma Validated by Bioinformatics Analysis of The Cancer Genome Atlas
    Article Snippet: The LNATM primer sets for miR-9, four candidate reference genes, and two positive control primer sets were obtained from Exiqon A/S. cDNA from the reverse transcription reactions were diluted 100× with nuclease-free water combined 1:1 with 2× PCR master mix (Exiqon A/S) and 0.05 ng of total RNA per reaction. .. Real-time PCR amplification and melting curve analysis was performed using an ABI StepOnePlus system (Applied Biosystems, Foster City, CA) in a standard (2-hour) run according to the following cycles: polymerase activation/denaturation at 95°C for 10 minutes, amplification for 40 cycles at 95°C for 10 seconds, followed by 60°C for 1 minute at a ramp rate of 1.6 degrees centigrade per second, and melting curve analysis as specified by the StepOnePlus system.

    Article Title: Real-Time PCR Methodology for Selective Detection of Viable Escherichia coli O157:H7 Cells by Targeting Z3276 as a Genetic Marker
    Article Snippet: Five microliters of template DNA (100 pg) was used, and nuclease-free water (Qiagen Sciences, MD) was added to reach a reaction mixture volume of 50 μl. .. The real-time PCR conditions were first optimized and were set as follows: activation of TaqMan probe at 95°C for 10 min, followed by 40 cycles of denaturation at 95°C for 10 s and annealing/extension at 60°C for 1 min.

    DNA Purification:

    Article Title: Apple endophytic microbiota of different rootstock/scion combinations suggests a genotype-specific influence
    Article Snippet: Total DNA was extracted from the ground xylem tissues using a Wizard Genomic DNA Purification Kit according to the manufacturer’s protocol (Promega, Madison, WI, USA). .. Nuclease-free water (QIAGEN, Valencia, CA, USA) replaced template DNA in negative controls.

    Lysis:

    Article Title: The absence of N-acetylglucosamine in wall teichoic acids of Listeria monocytogenes modifies biofilm architecture and tolerance to rinsing and cleaning procedures
    Article Snippet: For qPCR assay, the cell fractions were centrifuged (5 000 x g, 10 min) and DNA was extracted with the DNeasy® Blood & Tissue kit (Qiagen, Hilden, Germany) according to the specifications provided by the supplier (protocol “Purification of Total DNA from Animal Tissues”, using ATL lysis buffer). .. For relative quantification of extracted DNA, the hlyA gene which encodes a pore-forming toxin listeriolysin O was used as a genetic target. qPCR was performed in a total volume of 25 μl containing 2.5 μl extracted genomic DNA, 12.5 μl of SYBR® Premix Ex Taq™ (Perfect Real Time), 1μM of forward primer NovF ( 5′- TGC AAG TCC TAA GAC GCC A-3′ ) (Eurobio, Les Ulis, France) [ ], 1 μM of reverse primer NovR ( 5′- CAC TGC ATC TCC GTG GTA TAC TAA -3′ ) (Eurobio) [ ] and 9 μl of nuclease free water (Qiagen, Hilden, Germany).

    Article Title: Genome-Wide Gene Expression Changes in the Normal-Appearing Airway during the Evolution of Smoking-Associated Lung Adenocarcinoma
    Article Snippet: Tubes containing brushes in lysis buffer were vortexed gently to dissociate harvested epithelia and brushes were then removed. .. Purified RNA samples were then cleaned and resuspended in nuclease-free water using the RNeasy MinElute Cleanup Kit from Qiagen according to the manufacturer’s protocol.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Qiagen nuclease free water nfw
    Comparison of ‘wet’ and lyophilized reagents using direct detection by RT ‐ LAMP with primer set 1 (a) and primer set 2 (b). Black bars represent ‘wet’ reagents and grey bars represent lyophilized reagents. Neat: SVV ‐1 sample NC ‐88‐23626 diluted 1/100 in negative pig epithelium tissue suspension to simulate a natural original suspension sample. This ‘neat’ sample was then diluted frac12;, ¼, 1/8, 1/10, 1/16 and 1/20 in nuclease‐free water ( <t>NFW</t> ) and compared to extracted <t>RNA</t> from the ‘neat’ sample as a positive control
    Nuclease Free Water Nfw, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nuclease free water nfw/product/Qiagen
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    nuclease free water nfw - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    78
    Qiagen sterile double distilled water nuclease free pcr thermal cycler
    Fragmented <t>DNA</t> smearing patterns after ligation of adapters (Ligation Mix) and after <t>PCR</t> (PCR Mix). Note increase in smear intensity as well as a shift up in the size range of the smear.
    Sterile Double Distilled Water Nuclease Free Pcr Thermal Cycler, supplied by Qiagen, used in various techniques. Bioz Stars score: 78/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sterile double distilled water nuclease free pcr thermal cycler/product/Qiagen
    Average 78 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    sterile double distilled water nuclease free pcr thermal cycler - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    95
    Qiagen rnase free water
    Interaction of VP30 and VP35 is <t>RNA</t> dependent. (A) Co-IP analysis of FLAG-tagged VP30_wt with HA-tagged VP35 after <t>RNase</t> treatment. HEK-293 cells expressing VP30 FLAG and/or VP35 HA were lysed 48 h posttransfection. An aliquot was taken from cell lysates as control for protein expression levels (input). Two additional aliquots from each extract sample were processed in parallel by adding an RNase A/T1 mix to the first aliquot (+ RNase), but not to the second (− RNase), followed by precip itation of protein complexes for 2 h at 4°C using mouse anti-HA agarose (Sigma-Aldrich). Western blot analysis was performed using a mouse anti-FLAG M2 biotinylated antibody and Alexa Fluor 680-conjugated streptavidin (shown in red). HA-tagged VP35 was stained by rabbit anti-HA and IRDye 800-conjugated goat anti-rabbit (shown in green). Detection of proteins was obtained with the LiCor Odyssey Imaging System. The quantification of Western blot signals for VP30 coprecipitated by VP35 after or without RNase treatment (bar diagram on the right) was based on five independent experiments. VP30 FLAG amounts coimmunoprecipitated without RNase were set to 100%. *, P ≤ 0.05; **, P ≤ 0.01; ***, P ≤ 0.001. (B) Co-IP analysis of FLAG-tagged VP35 with HA-tagged VP35 after or without RNase treatment. The procedure was identical to that described for panel A, except that anti-FLAG agarose (Sigma-Aldrich) was used for the co-IP, a mouse anti-HA biotinylated antibody and Alexa Fluor 680-conjugated streptavidin (shown in red) were used for Western blot detection of VP35 HA , and a rabbit anti-FLAG and IRDye 800-conjugated goat anti-rabbit (shown in green) antibodies were used for detection of VP35 FLAG . The quantification of Western blot signals for VP35 FLAG coprecipitated with VP35 HA after or without RNase treatment (bar diagram on the right) was based on five independent experiments. (C) Interaction of VP30 with VP35 is dependent on both proteins' ability to bind to RNA. Co-IP analysis of VP30 or VP35 with corresponding mutants that lack RNA binding activity. For VP35, we used a mutant (VP35mut HA ) lacking dsRNA binding activity owing to mutations R305A, K309A, and R312A. VP30_5LA FLAG was used as a negative RNA binding mutant to evaluate its interaction with VP35. Co-IP of protein complexes was performed as described for panel B. Single expression of the proteins used as control is shown in lanes 1 to 4. Lane 5, coexpression of VP30 FLAG with VP35 HA ; lane 6, coexpression of VP30 FLAG with VP35mut HA ; lane 7, coexpression of VP30_5LA FLAG with VP35 HA . Western blot signals of VP30 FLAG precipitated by VP35 HA versus VP35mut HA were quantified based on three independent experiments (upper bar diagram on the right); Western blot signals of VP30 FLAG or VP30_5LA FLAG precipitated by VP35 HA were quantified based on four independent experiments (lower bar diagram on the right). Amounts of precipitated wild-type proteins were set to 100%. *, P ≤ 0.05; **, P ≤ 0.01; ***, P ≤ 0.001. Mock lanes, untransfected cells.
    Rnase Free Water, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 221 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnase free water/product/Qiagen
    Average 95 stars, based on 221 article reviews
    Price from $9.99 to $1999.99
    rnase free water - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results


    Comparison of ‘wet’ and lyophilized reagents using direct detection by RT ‐ LAMP with primer set 1 (a) and primer set 2 (b). Black bars represent ‘wet’ reagents and grey bars represent lyophilized reagents. Neat: SVV ‐1 sample NC ‐88‐23626 diluted 1/100 in negative pig epithelium tissue suspension to simulate a natural original suspension sample. This ‘neat’ sample was then diluted frac12;, ¼, 1/8, 1/10, 1/16 and 1/20 in nuclease‐free water ( NFW ) and compared to extracted RNA from the ‘neat’ sample as a positive control

    Journal: Transboundary and Emerging Diseases

    Article Title: The development of two field‐ready reverse transcription loop‐mediated isothermal amplification assays for the rapid detection of Seneca Valley virus 1. The development of two field‐ready reverse transcription loop‐mediated isothermal amplification assays for the rapid detection of Seneca Valley virus 1

    doi: 10.1111/tbed.13051

    Figure Lengend Snippet: Comparison of ‘wet’ and lyophilized reagents using direct detection by RT ‐ LAMP with primer set 1 (a) and primer set 2 (b). Black bars represent ‘wet’ reagents and grey bars represent lyophilized reagents. Neat: SVV ‐1 sample NC ‐88‐23626 diluted 1/100 in negative pig epithelium tissue suspension to simulate a natural original suspension sample. This ‘neat’ sample was then diluted frac12;, ¼, 1/8, 1/10, 1/16 and 1/20 in nuclease‐free water ( NFW ) and compared to extracted RNA from the ‘neat’ sample as a positive control

    Article Snippet: To determine the analytical sensitivity, a tenfold dilution series (10−1 –10−9 ) was made of RNA extracted from SVV‐1 isolates NC‐88‐23626 and LA‐97‐1278 (Table ) diluted in nuclease‐free water (NFW) containing carrier RNA (1 μg/μl, Qiagen).

    Techniques: Positive Control

    Fragmented DNA smearing patterns after ligation of adapters (Ligation Mix) and after PCR (PCR Mix). Note increase in smear intensity as well as a shift up in the size range of the smear.

    Journal: Current protocols in microbiology

    Article Title: Preparing DNA Libraries for Multiplexed Paired-End Deep Sequencing for Illumina GA Sequencers

    doi: 10.1002/9780471729259.mc01e04s20

    Figure Lengend Snippet: Fragmented DNA smearing patterns after ligation of adapters (Ligation Mix) and after PCR (PCR Mix). Note increase in smear intensity as well as a shift up in the size range of the smear.

    Article Snippet: Adapter-ligated DNA sample PCR Primer InPE1.0 (Illumina Cat. #PE400-1001) PCR Primer InPE2.0 (Illumina Cat. #PE400-1001) PCR Index primer (Illumina Cat. #PE400-1001) 5x HF Phusion buffer (NEB Cat. #F-540S) 10 mM dNTP (NEB Cat. #N0447S) Phusion DNA polymerase (NEB Cat. #F-540S) 6X gel loading dye with Gel Green (see recipe) 100 bp Marker (NEB Cat. #N3231S) 1X TBE (see recipe) 5% TBE DNA acrylamide gel (BioRad Cat. #161-1109) Sterile double-distilled water (nuclease-free) PCR thermal cycler to hold 200 μl PCR tubes with heated lid DNA acrylamide gel electrophoresis set-up QIAquick PCR Purification kit (Qiagen Cat. #28104) NanoDrop spectrophotometer (NanoDrop Model #ND100) Prepare the following reaction mix on ice in a new 200 μl PCR tube, making sure that the Phusion DNA polymerase is the last component to be added to the mix: The PCR Index Primer used should be different for each strain DNA library constructed (e.g. strain 1 – Index Primer 1; strain 2 – Index Primer 2; strain 3 – Index Primer 3; etc) Amplify using the following PCR protocol: 30 sec at 98°C 18 cycles of: 10 sec at 98 °C 30 sec at 65 °C 30 sec at 72 °C 5 min at 72 °C Hold at 4 °C until ready to proceed with next step.

    Techniques: Ligation, Polymerase Chain Reaction

    Overview of DNA library preparation for deep sequencing. The purified genomic DNA is processed and modified as described in the basic protocols. The adapter-modified DNA fragments (library) are then enriched through PCR. Note the relative positions and characteristics (Inset) of the InPE1.0, InPE2.0 and the Index primers used during PCR. For multiplexed paired-end PCR, the same InPE1.0 and InPE2.0 primers are used, however, up to 12 different Index primers can be added to the enrichment reactions individually. Sequencing is performed in one direction through sequencing by synthesis , and then in the alternate direction as described in the background information. The complementary sequences are shaded darker.

    Journal: Current protocols in microbiology

    Article Title: Preparing DNA Libraries for Multiplexed Paired-End Deep Sequencing for Illumina GA Sequencers

    doi: 10.1002/9780471729259.mc01e04s20

    Figure Lengend Snippet: Overview of DNA library preparation for deep sequencing. The purified genomic DNA is processed and modified as described in the basic protocols. The adapter-modified DNA fragments (library) are then enriched through PCR. Note the relative positions and characteristics (Inset) of the InPE1.0, InPE2.0 and the Index primers used during PCR. For multiplexed paired-end PCR, the same InPE1.0 and InPE2.0 primers are used, however, up to 12 different Index primers can be added to the enrichment reactions individually. Sequencing is performed in one direction through sequencing by synthesis , and then in the alternate direction as described in the background information. The complementary sequences are shaded darker.

    Article Snippet: Adapter-ligated DNA sample PCR Primer InPE1.0 (Illumina Cat. #PE400-1001) PCR Primer InPE2.0 (Illumina Cat. #PE400-1001) PCR Index primer (Illumina Cat. #PE400-1001) 5x HF Phusion buffer (NEB Cat. #F-540S) 10 mM dNTP (NEB Cat. #N0447S) Phusion DNA polymerase (NEB Cat. #F-540S) 6X gel loading dye with Gel Green (see recipe) 100 bp Marker (NEB Cat. #N3231S) 1X TBE (see recipe) 5% TBE DNA acrylamide gel (BioRad Cat. #161-1109) Sterile double-distilled water (nuclease-free) PCR thermal cycler to hold 200 μl PCR tubes with heated lid DNA acrylamide gel electrophoresis set-up QIAquick PCR Purification kit (Qiagen Cat. #28104) NanoDrop spectrophotometer (NanoDrop Model #ND100) Prepare the following reaction mix on ice in a new 200 μl PCR tube, making sure that the Phusion DNA polymerase is the last component to be added to the mix: The PCR Index Primer used should be different for each strain DNA library constructed (e.g. strain 1 – Index Primer 1; strain 2 – Index Primer 2; strain 3 – Index Primer 3; etc) Amplify using the following PCR protocol: 30 sec at 98°C 18 cycles of: 10 sec at 98 °C 30 sec at 65 °C 30 sec at 72 °C 5 min at 72 °C Hold at 4 °C until ready to proceed with next step.

    Techniques: Sequencing, Purification, Modification, Polymerase Chain Reaction

    Interaction of VP30 and VP35 is RNA dependent. (A) Co-IP analysis of FLAG-tagged VP30_wt with HA-tagged VP35 after RNase treatment. HEK-293 cells expressing VP30 FLAG and/or VP35 HA were lysed 48 h posttransfection. An aliquot was taken from cell lysates as control for protein expression levels (input). Two additional aliquots from each extract sample were processed in parallel by adding an RNase A/T1 mix to the first aliquot (+ RNase), but not to the second (− RNase), followed by precip itation of protein complexes for 2 h at 4°C using mouse anti-HA agarose (Sigma-Aldrich). Western blot analysis was performed using a mouse anti-FLAG M2 biotinylated antibody and Alexa Fluor 680-conjugated streptavidin (shown in red). HA-tagged VP35 was stained by rabbit anti-HA and IRDye 800-conjugated goat anti-rabbit (shown in green). Detection of proteins was obtained with the LiCor Odyssey Imaging System. The quantification of Western blot signals for VP30 coprecipitated by VP35 after or without RNase treatment (bar diagram on the right) was based on five independent experiments. VP30 FLAG amounts coimmunoprecipitated without RNase were set to 100%. *, P ≤ 0.05; **, P ≤ 0.01; ***, P ≤ 0.001. (B) Co-IP analysis of FLAG-tagged VP35 with HA-tagged VP35 after or without RNase treatment. The procedure was identical to that described for panel A, except that anti-FLAG agarose (Sigma-Aldrich) was used for the co-IP, a mouse anti-HA biotinylated antibody and Alexa Fluor 680-conjugated streptavidin (shown in red) were used for Western blot detection of VP35 HA , and a rabbit anti-FLAG and IRDye 800-conjugated goat anti-rabbit (shown in green) antibodies were used for detection of VP35 FLAG . The quantification of Western blot signals for VP35 FLAG coprecipitated with VP35 HA after or without RNase treatment (bar diagram on the right) was based on five independent experiments. (C) Interaction of VP30 with VP35 is dependent on both proteins' ability to bind to RNA. Co-IP analysis of VP30 or VP35 with corresponding mutants that lack RNA binding activity. For VP35, we used a mutant (VP35mut HA ) lacking dsRNA binding activity owing to mutations R305A, K309A, and R312A. VP30_5LA FLAG was used as a negative RNA binding mutant to evaluate its interaction with VP35. Co-IP of protein complexes was performed as described for panel B. Single expression of the proteins used as control is shown in lanes 1 to 4. Lane 5, coexpression of VP30 FLAG with VP35 HA ; lane 6, coexpression of VP30 FLAG with VP35mut HA ; lane 7, coexpression of VP30_5LA FLAG with VP35 HA . Western blot signals of VP30 FLAG precipitated by VP35 HA versus VP35mut HA were quantified based on three independent experiments (upper bar diagram on the right); Western blot signals of VP30 FLAG or VP30_5LA FLAG precipitated by VP35 HA were quantified based on four independent experiments (lower bar diagram on the right). Amounts of precipitated wild-type proteins were set to 100%. *, P ≤ 0.05; **, P ≤ 0.01; ***, P ≤ 0.001. Mock lanes, untransfected cells.

    Journal: Journal of Virology

    Article Title: RNA Binding of Ebola Virus VP30 Is Essential for Activating Viral Transcription

    doi: 10.1128/JVI.00271-16

    Figure Lengend Snippet: Interaction of VP30 and VP35 is RNA dependent. (A) Co-IP analysis of FLAG-tagged VP30_wt with HA-tagged VP35 after RNase treatment. HEK-293 cells expressing VP30 FLAG and/or VP35 HA were lysed 48 h posttransfection. An aliquot was taken from cell lysates as control for protein expression levels (input). Two additional aliquots from each extract sample were processed in parallel by adding an RNase A/T1 mix to the first aliquot (+ RNase), but not to the second (− RNase), followed by precip itation of protein complexes for 2 h at 4°C using mouse anti-HA agarose (Sigma-Aldrich). Western blot analysis was performed using a mouse anti-FLAG M2 biotinylated antibody and Alexa Fluor 680-conjugated streptavidin (shown in red). HA-tagged VP35 was stained by rabbit anti-HA and IRDye 800-conjugated goat anti-rabbit (shown in green). Detection of proteins was obtained with the LiCor Odyssey Imaging System. The quantification of Western blot signals for VP30 coprecipitated by VP35 after or without RNase treatment (bar diagram on the right) was based on five independent experiments. VP30 FLAG amounts coimmunoprecipitated without RNase were set to 100%. *, P ≤ 0.05; **, P ≤ 0.01; ***, P ≤ 0.001. (B) Co-IP analysis of FLAG-tagged VP35 with HA-tagged VP35 after or without RNase treatment. The procedure was identical to that described for panel A, except that anti-FLAG agarose (Sigma-Aldrich) was used for the co-IP, a mouse anti-HA biotinylated antibody and Alexa Fluor 680-conjugated streptavidin (shown in red) were used for Western blot detection of VP35 HA , and a rabbit anti-FLAG and IRDye 800-conjugated goat anti-rabbit (shown in green) antibodies were used for detection of VP35 FLAG . The quantification of Western blot signals for VP35 FLAG coprecipitated with VP35 HA after or without RNase treatment (bar diagram on the right) was based on five independent experiments. (C) Interaction of VP30 with VP35 is dependent on both proteins' ability to bind to RNA. Co-IP analysis of VP30 or VP35 with corresponding mutants that lack RNA binding activity. For VP35, we used a mutant (VP35mut HA ) lacking dsRNA binding activity owing to mutations R305A, K309A, and R312A. VP30_5LA FLAG was used as a negative RNA binding mutant to evaluate its interaction with VP35. Co-IP of protein complexes was performed as described for panel B. Single expression of the proteins used as control is shown in lanes 1 to 4. Lane 5, coexpression of VP30 FLAG with VP35 HA ; lane 6, coexpression of VP30 FLAG with VP35mut HA ; lane 7, coexpression of VP30_5LA FLAG with VP35 HA . Western blot signals of VP30 FLAG precipitated by VP35 HA versus VP35mut HA were quantified based on three independent experiments (upper bar diagram on the right); Western blot signals of VP30 FLAG or VP30_5LA FLAG precipitated by VP35 HA were quantified based on four independent experiments (lower bar diagram on the right). Amounts of precipitated wild-type proteins were set to 100%. *, P ≤ 0.05; **, P ≤ 0.01; ***, P ≤ 0.001. Mock lanes, untransfected cells.

    Article Snippet: The RNA was eluted in 50 μl RNase-free water, and 10 μl was used for reverse transcription (RT) of either negative-strand RNA (vRNA) or positive-strand cRNA/mRNA using the Omniscript RT kit (Qiagen) in the presence of 10 U RiboLock RNase inhibitor (Thermo Fisher Scientific Fermentas) according to the manufacturer's instructions.

    Techniques: Co-Immunoprecipitation Assay, Expressing, Western Blot, Staining, Imaging, RNA Binding Assay, Activity Assay, Mutagenesis, Binding Assay

    R‐loops promote ( GAA ) 10 ‐dependent epigenetic instability of BU ‐1 DRIP‐qPCR analysis reveals accumulation of R‐loops across the BU‐1 locus in primpol cells. The DRIP signal was calculated as enrichment over RNase H‐treated samples and was normalised to −0.5 kb amplicon. The mean and SD for three biological replicates is presented. An unpaired t ‐test was used to compare differences between matched amplicons in primpol BU‐1A (GAA)10 and the other cell lines indicated. **** P ≤ 0.0001, ns = not significant. DNA:RNA hybrids in primpol BU‐1A (GAA)10 :Gg RNase H1 (see also Appendix Fig S5 ) and primpol BU‐1A (GAA)10 :hPrimPol. An unpaired t ‐test on three biological replicates was used to compare differences to primpol BU‐1A (GAA)10 for each matched amplicon. The bar represents the mean, and whiskers represent the SD. *** P ≤ 0.001, ** P ≤ 0.01, ns = not significant. Overexpression of chicken RNase H1 prevents (GAA) 10 ‐induced BU‐1A epigenetic instability in primpol cells. Fluctuation analysis was performed on three primpol BU‐1A (GAA)10 clones. One‐way ANOVA was used to calculate the significance of differences in BU‐1 instability between primpol BU‐1A ΔG4 and other cell lines. **** P ≤ 0.0001, ns = not significant. Diagram of the RNase H1 hybrid binding domain (HBD)–mCherry fusion and flow cytometry expression profiles of the construct in four clones. Western blots of the same four clones are shown in Appendix Fig S6 . R‐loop stabilisation induces epigenetic instability of BU‐1 . Bu‐1a fluctuation analysis of wild‐type cells expressing HBD‐mCherry. The scatter plots pool results from at least two different clones with matched HBD expression. Mean ± SD reported. **** P ≤ 0.0001, *** P ≤ 0.001, ns = not significant; one‐way ANOVA.

    Journal: The EMBO Journal

    Article Title: R‐loop formation during S phase is restricted by PrimPol‐mediated repriming

    doi: 10.15252/embj.201899793

    Figure Lengend Snippet: R‐loops promote ( GAA ) 10 ‐dependent epigenetic instability of BU ‐1 DRIP‐qPCR analysis reveals accumulation of R‐loops across the BU‐1 locus in primpol cells. The DRIP signal was calculated as enrichment over RNase H‐treated samples and was normalised to −0.5 kb amplicon. The mean and SD for three biological replicates is presented. An unpaired t ‐test was used to compare differences between matched amplicons in primpol BU‐1A (GAA)10 and the other cell lines indicated. **** P ≤ 0.0001, ns = not significant. DNA:RNA hybrids in primpol BU‐1A (GAA)10 :Gg RNase H1 (see also Appendix Fig S5 ) and primpol BU‐1A (GAA)10 :hPrimPol. An unpaired t ‐test on three biological replicates was used to compare differences to primpol BU‐1A (GAA)10 for each matched amplicon. The bar represents the mean, and whiskers represent the SD. *** P ≤ 0.001, ** P ≤ 0.01, ns = not significant. Overexpression of chicken RNase H1 prevents (GAA) 10 ‐induced BU‐1A epigenetic instability in primpol cells. Fluctuation analysis was performed on three primpol BU‐1A (GAA)10 clones. One‐way ANOVA was used to calculate the significance of differences in BU‐1 instability between primpol BU‐1A ΔG4 and other cell lines. **** P ≤ 0.0001, ns = not significant. Diagram of the RNase H1 hybrid binding domain (HBD)–mCherry fusion and flow cytometry expression profiles of the construct in four clones. Western blots of the same four clones are shown in Appendix Fig S6 . R‐loop stabilisation induces epigenetic instability of BU‐1 . Bu‐1a fluctuation analysis of wild‐type cells expressing HBD‐mCherry. The scatter plots pool results from at least two different clones with matched HBD expression. Mean ± SD reported. **** P ≤ 0.0001, *** P ≤ 0.001, ns = not significant; one‐way ANOVA.

    Article Snippet: Eluted RNA was precipitated with glycogen, 0.3 M NaCl and isopropanol overnight at −20°C, followed by high‐speed centrifugation and 70% ethanol wash. RNA was resuspended in RNase‐free water, converted to cDNA using QuantiTect RT kit (QIAGEN) and analysed with qPCR as previously described.

    Techniques: Real-time Polymerase Chain Reaction, Amplification, Over Expression, Binding Assay, Flow Cytometry, Cytometry, Expressing, Construct, Clone Assay, Western Blot

    PrimPol suppresses R‐loop formation in association with DNA secondary structure‐forming sequences in BOBSC iPS cells Representative normalised RNA DIP‐seq data in the SKI locus. Wild type in blue; primpol in red. The locations of H‐DNA and G4 motifs are shown below the gene map. The corresponding RNase H‐treated samples are dashed. Since so little material was recovered following RNase H treatment, all samples were pooled prior to library generation. Metagene analysis of RNA‐DIP peak distribution in wild‐type and primpol BOBSC cells compared with the distribution of the indicated features in the genome. RNA DIP‐seq peak heights in wild‐type and primpol BOBSC cells normalised to a DT40 spike‐in. n (wild type) = 32,740; n ( primpol ) = 33,721. Correlation of normalised RNA DIP‐seq peak heights in the overlapping peaks between wild type and primpol . Blue line = 1:1 correlation; red line = linear regression through data. Correlation between H‐DNA‐forming sequences and all genes (white bar), and genes with DRIP peaks in wild‐type (blue) and primpol cells (red). Correlation between G4 motifs ([G 3‐5 N 1‐7 ] 4 ) and all genes (white bar), and genes with DRIP peaks in wild‐type (blue) and primpol cells (red). Normalised RNA DIP‐seq peak heights in the genes identified as associating with H‐DNA. Normalised RNA DIP‐seq peak heights in the genes identified as associating with G4 motifs ([G 3‐5 N 1‐7 ] 4 ). Data information: P ‐values calculated with Mann–Whitney U ‐test. In violin plots, bar = median; box = interquartile range (IQR); whiskers = upper and lower inner fences (1 st /3 rd quartile + 1.5*IQR).

    Journal: The EMBO Journal

    Article Title: R‐loop formation during S phase is restricted by PrimPol‐mediated repriming

    doi: 10.15252/embj.201899793

    Figure Lengend Snippet: PrimPol suppresses R‐loop formation in association with DNA secondary structure‐forming sequences in BOBSC iPS cells Representative normalised RNA DIP‐seq data in the SKI locus. Wild type in blue; primpol in red. The locations of H‐DNA and G4 motifs are shown below the gene map. The corresponding RNase H‐treated samples are dashed. Since so little material was recovered following RNase H treatment, all samples were pooled prior to library generation. Metagene analysis of RNA‐DIP peak distribution in wild‐type and primpol BOBSC cells compared with the distribution of the indicated features in the genome. RNA DIP‐seq peak heights in wild‐type and primpol BOBSC cells normalised to a DT40 spike‐in. n (wild type) = 32,740; n ( primpol ) = 33,721. Correlation of normalised RNA DIP‐seq peak heights in the overlapping peaks between wild type and primpol . Blue line = 1:1 correlation; red line = linear regression through data. Correlation between H‐DNA‐forming sequences and all genes (white bar), and genes with DRIP peaks in wild‐type (blue) and primpol cells (red). Correlation between G4 motifs ([G 3‐5 N 1‐7 ] 4 ) and all genes (white bar), and genes with DRIP peaks in wild‐type (blue) and primpol cells (red). Normalised RNA DIP‐seq peak heights in the genes identified as associating with H‐DNA. Normalised RNA DIP‐seq peak heights in the genes identified as associating with G4 motifs ([G 3‐5 N 1‐7 ] 4 ). Data information: P ‐values calculated with Mann–Whitney U ‐test. In violin plots, bar = median; box = interquartile range (IQR); whiskers = upper and lower inner fences (1 st /3 rd quartile + 1.5*IQR).

    Article Snippet: Eluted RNA was precipitated with glycogen, 0.3 M NaCl and isopropanol overnight at −20°C, followed by high‐speed centrifugation and 70% ethanol wash. RNA was resuspended in RNase‐free water, converted to cDNA using QuantiTect RT kit (QIAGEN) and analysed with qPCR as previously described.

    Techniques: DNA Immunoprecipitation Sequencing, MANN-WHITNEY

    Loss of PrimPol leads to unscheduled S phase R‐loop formation Expression of geminin‐tagged chicken RNase H1‐YFP. Phases of the cell cycle were determined by staining DNA content in live cells by Hoechst 33342 ( X ‐axis). RNase H1‐YFP with or without the geminin degron protein is detected on the Y ‐axis. The RNase H1‐YFP‐geminin degron is degraded in G1. In contrast, RNase H1‐YFP levels remain stable irrespective of the phase of the cell cycle. 2n and 4n indicate the chromosome number before and after DNA replication. Bu‐1a fluctuation analysis of two independently derived primpol BU‐1A (GAA)10 :Gg RNase H1‐YFP‐geminin degron clones. Since the expression of the RNase H1‐YFP‐geminin degron construct is not stable (unlike the RNase H1‐YFP construct without the degron), Bu‐1a expression was assessed separately in the YFP +ve and YFP −ve cells within each clone. Statistical differences calculated the Kruskal–Wallis test. For all panels, at least 36 individual clones were analysed; mean ± SD reported. **** P ≤ 0.0001, *** P ≤ 0.001, ns = not significant. DRIP‐qPCR for R‐loops around the engineered +3.5 (GAA) 10 repeat in BU‐1 in different phases of the cell cycle. The location of the qPCR amplicons is indicated in the map at the top of the panel. The BU‐1 DRIP signal was normalised to −0.5 kb amplicon in G1‐arrested cells ( t = 0 h). See Fig EV4 for representative cell cycle synchronisation profiles. Black: wild type; red: primpol . Error bars = SD. **** P ≤ 0.0001, *** P ≤ 0.001, ** P ≤ 0.01, * P ≤ 0.05. Workflow for the S9.6‐independent detection of newly synthesised R‐loops. See Materials and Methods for details. Validation of analysis of nascent DNA:RNA hybrid formation in BU‐1 locus. Enrichment of 4‐SU‐labelled RNA moiety of DNA:RNA hybrids was calculated relative to input in three independent asynchronous wild‐type (black) or primpol (red) cells, with or without exogenous RNase H treatment. Error bars = SD. ** P ≤ 0.01, * P ≤ 0.05, ns = not significant; unpaired t ‐test. Synchronisation and 4‐SU pulse labelling scheme to identify nascently formed DNA:RNA hybrids. Newly synthesised R‐loops in BU‐1 during S phase in wild type (black) and primpol (red). Error bars represent 1 SD of three biological repeats of the experiment. *** P ≤ 0.001, * P ≤ 0.05; unpaired t ‐test.

    Journal: The EMBO Journal

    Article Title: R‐loop formation during S phase is restricted by PrimPol‐mediated repriming

    doi: 10.15252/embj.201899793

    Figure Lengend Snippet: Loss of PrimPol leads to unscheduled S phase R‐loop formation Expression of geminin‐tagged chicken RNase H1‐YFP. Phases of the cell cycle were determined by staining DNA content in live cells by Hoechst 33342 ( X ‐axis). RNase H1‐YFP with or without the geminin degron protein is detected on the Y ‐axis. The RNase H1‐YFP‐geminin degron is degraded in G1. In contrast, RNase H1‐YFP levels remain stable irrespective of the phase of the cell cycle. 2n and 4n indicate the chromosome number before and after DNA replication. Bu‐1a fluctuation analysis of two independently derived primpol BU‐1A (GAA)10 :Gg RNase H1‐YFP‐geminin degron clones. Since the expression of the RNase H1‐YFP‐geminin degron construct is not stable (unlike the RNase H1‐YFP construct without the degron), Bu‐1a expression was assessed separately in the YFP +ve and YFP −ve cells within each clone. Statistical differences calculated the Kruskal–Wallis test. For all panels, at least 36 individual clones were analysed; mean ± SD reported. **** P ≤ 0.0001, *** P ≤ 0.001, ns = not significant. DRIP‐qPCR for R‐loops around the engineered +3.5 (GAA) 10 repeat in BU‐1 in different phases of the cell cycle. The location of the qPCR amplicons is indicated in the map at the top of the panel. The BU‐1 DRIP signal was normalised to −0.5 kb amplicon in G1‐arrested cells ( t = 0 h). See Fig EV4 for representative cell cycle synchronisation profiles. Black: wild type; red: primpol . Error bars = SD. **** P ≤ 0.0001, *** P ≤ 0.001, ** P ≤ 0.01, * P ≤ 0.05. Workflow for the S9.6‐independent detection of newly synthesised R‐loops. See Materials and Methods for details. Validation of analysis of nascent DNA:RNA hybrid formation in BU‐1 locus. Enrichment of 4‐SU‐labelled RNA moiety of DNA:RNA hybrids was calculated relative to input in three independent asynchronous wild‐type (black) or primpol (red) cells, with or without exogenous RNase H treatment. Error bars = SD. ** P ≤ 0.01, * P ≤ 0.05, ns = not significant; unpaired t ‐test. Synchronisation and 4‐SU pulse labelling scheme to identify nascently formed DNA:RNA hybrids. Newly synthesised R‐loops in BU‐1 during S phase in wild type (black) and primpol (red). Error bars represent 1 SD of three biological repeats of the experiment. *** P ≤ 0.001, * P ≤ 0.05; unpaired t ‐test.

    Article Snippet: Eluted RNA was precipitated with glycogen, 0.3 M NaCl and isopropanol overnight at −20°C, followed by high‐speed centrifugation and 70% ethanol wash. RNA was resuspended in RNase‐free water, converted to cDNA using QuantiTect RT kit (QIAGEN) and analysed with qPCR as previously described.

    Techniques: Expressing, Staining, Derivative Assay, Clone Assay, Construct, Real-time Polymerase Chain Reaction, Amplification