nickel nitrilotriacetic acid ni nta agarose matrix  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    Ni NTA Agarose
    Description:
    For purification of His tagged proteins by gravity flow chromatography Kit contents Qiagen Ni NTA Agarose 25mL 45 to 165m Bead Up to 50mg mL Binding Capacity Cell Lysate Start Material Nickel charged Resin 2 8psi max Pressure Manual Automated Processing Large Scale Sepharose CL 6B Matrix 100g to 100mg Yield 6xHis tag Affinity Chromatography Purification High Binding Affinity and High Capacity Precharged Ready to use Matrices For Purification of His tagged Proteins by Gravity flow Chromatography Benefits One step purification from crude lysate to 95 pure protein High binding affinity and high capacity Choice of purification under native or denaturing conditions Precharged ready to use matrices for any scale of purification Automated purification and assay protocol
    Catalog Number:
    30210
    Price:
    305
    Category:
    Ni NTA Agarose
    Buy from Supplier


    Structured Review

    Qiagen nickel nitrilotriacetic acid ni nta agarose matrix
    Ni NTA Agarose
    For purification of His tagged proteins by gravity flow chromatography Kit contents Qiagen Ni NTA Agarose 25mL 45 to 165m Bead Up to 50mg mL Binding Capacity Cell Lysate Start Material Nickel charged Resin 2 8psi max Pressure Manual Automated Processing Large Scale Sepharose CL 6B Matrix 100g to 100mg Yield 6xHis tag Affinity Chromatography Purification High Binding Affinity and High Capacity Precharged Ready to use Matrices For Purification of His tagged Proteins by Gravity flow Chromatography Benefits One step purification from crude lysate to 95 pure protein High binding affinity and high capacity Choice of purification under native or denaturing conditions Precharged ready to use matrices for any scale of purification Automated purification and assay protocol
    https://www.bioz.com/result/nickel nitrilotriacetic acid ni nta agarose matrix/product/Qiagen
    Average 90 stars, based on 299 article reviews
    Price from $9.99 to $1999.99
    nickel nitrilotriacetic acid ni nta agarose matrix - by Bioz Stars, 2020-01
    90/100 stars

    Images

    1) Product Images from "DDB2 is a Novel Regulator of Wnt-Signaling in Colon Cancer"

    Article Title: DDB2 is a Novel Regulator of Wnt-Signaling in Colon Cancer

    Journal: Cancer research

    doi: 10.1158/0008-5472.CAN-17-1570

    DDB2 is required for RNF43-mediated FZD5 ubiquitination and regulation of the Wnt target genes in colon cancer cells (A) DDB2 deficiency leads to inhibition of FZD5 ubiquitination. HT-29 cells were transfected with V5–FZD5, His-ubiquitin and siRNA-Control or siRNA-DDB2, as indicated. His-Ubiquitinated proteins were collected by nickel-nitrilotriacetic acid–agarose beads and the presence of ubiquitinated V5-FZD5 is detected by V5 antibody. (B) Lack of DDB2 bound region in Rnf43 gene results in inhibition of FZD5 ubiquitination. HT-29 Parental, Short Del and Long Del cells were transfected with V5–FZD5 and His-ubiquitin. And the assay was performed as described above. IP, Immunopull-down; IB: Immunoblotting; Ub, ubiquitin. Arrows indicate mature, glycosylated V5-conjugated FZD5. (C) HT-29 cells transiently expressing siControl or siDDB2 were treated with vehicle or human recombinant Wnt3A protein (300ng/ml, 24hrs). Relative mRNA levels of DDB2, Rnf43 , Axin2 and c-Myc were analyzed using qRT-PCR (Normalized by 18S rRNA). N=3. All error bars indicate SD. (D) Lack of DDB2 binding region in Rnf43 gene increases the expression of Wnt/β-catenin pathway target genes upon Wnt3a treatment. HT-29 Parental cells, Short Del cells and Long Del cells were treated with vehicle or human recombinant Wnt3A protein (300ng/ml, 24hrs). Relative mRNA levels of DDB2, Rnf43 , Axin2 and c-Myc were analyzed using qRT-PCR (Normalized by 18S rRNA). N=3. All error bars indicate SD. *: P
    Figure Legend Snippet: DDB2 is required for RNF43-mediated FZD5 ubiquitination and regulation of the Wnt target genes in colon cancer cells (A) DDB2 deficiency leads to inhibition of FZD5 ubiquitination. HT-29 cells were transfected with V5–FZD5, His-ubiquitin and siRNA-Control or siRNA-DDB2, as indicated. His-Ubiquitinated proteins were collected by nickel-nitrilotriacetic acid–agarose beads and the presence of ubiquitinated V5-FZD5 is detected by V5 antibody. (B) Lack of DDB2 bound region in Rnf43 gene results in inhibition of FZD5 ubiquitination. HT-29 Parental, Short Del and Long Del cells were transfected with V5–FZD5 and His-ubiquitin. And the assay was performed as described above. IP, Immunopull-down; IB: Immunoblotting; Ub, ubiquitin. Arrows indicate mature, glycosylated V5-conjugated FZD5. (C) HT-29 cells transiently expressing siControl or siDDB2 were treated with vehicle or human recombinant Wnt3A protein (300ng/ml, 24hrs). Relative mRNA levels of DDB2, Rnf43 , Axin2 and c-Myc were analyzed using qRT-PCR (Normalized by 18S rRNA). N=3. All error bars indicate SD. (D) Lack of DDB2 binding region in Rnf43 gene increases the expression of Wnt/β-catenin pathway target genes upon Wnt3a treatment. HT-29 Parental cells, Short Del cells and Long Del cells were treated with vehicle or human recombinant Wnt3A protein (300ng/ml, 24hrs). Relative mRNA levels of DDB2, Rnf43 , Axin2 and c-Myc were analyzed using qRT-PCR (Normalized by 18S rRNA). N=3. All error bars indicate SD. *: P

    Techniques Used: Inhibition, Transfection, Expressing, Recombinant, Quantitative RT-PCR, Binding Assay

    2) Product Images from "A G protein–coupled receptor and the intracellular synthase of its agonist functionally cooperate"

    Article Title: A G protein–coupled receptor and the intracellular synthase of its agonist functionally cooperate

    Journal: The Journal of Cell Biology

    doi: 10.1083/jcb.201304015

    L-PGDS interacts with Hsp90. (A) HEK293 cells were transiently transfected with pcDNA3, L-PGDS–Myc, Hsp90-HA, or Hsp90ΔMEEVD-HA mutant constructs. Immunoprecipitation (IP) of L-PGDS was performed using a Myc-specific monoclonal antibody, and immunoblotting (IB) was performed using peroxidase-conjugated anti-Myc or anti-HA antibodies. (B) Immunoprecipitation was performed in HeLa cells using Hsp90-specific monoclonal or mouse isotypic control IgG antibodies, and immunoblotting was performed using Hsp90-specific polyclonal or L-PGDS–specific polyclonal antibodies. (C) His pull-down assays were performed using purified His-Hsp90 bound to Ni 2+ -agarose beads incubated with purified GST–L-PGDS. The binding of L-PGDS to Hsp90 was detected by immunoblotting using an L-PGDS–specific polyclonal antibody, and the His-Hsp90 present in the binding reaction were detected using an Hsp90-specific polyclonal antibody. (D) Illustration of the funnel-shaped β barrel structure of L-PGDS (available in the Protein Data Bank under accession no. 2E4J ). On the outside of the funnel near the bottom, a surface was identified that had basic residues (Arg42, Lys66, Arg151, Lys156, and Lys160) surrounding a sunken hydrophobic site (Trp43, Tyr44, Ala46, and Gly47) under a C-terminal loop. (E) HEK293 cells were transiently transfected with pcDNA3, L-PGDS–HA, or its W43A/G47A-HA mutant construct. Immunoprecipitation of L-PGDS was performed using a HA-specific monoclonal antibody, and immunoblotting was performed using a peroxidase-conjugated anti-HA antibody. Endogenous Hsp90 was detected using an Hsp90-specific polyclonal antibody. Blots shown are representative of three independent experiments. NTA, nitrilotriacetic acid.
    Figure Legend Snippet: L-PGDS interacts with Hsp90. (A) HEK293 cells were transiently transfected with pcDNA3, L-PGDS–Myc, Hsp90-HA, or Hsp90ΔMEEVD-HA mutant constructs. Immunoprecipitation (IP) of L-PGDS was performed using a Myc-specific monoclonal antibody, and immunoblotting (IB) was performed using peroxidase-conjugated anti-Myc or anti-HA antibodies. (B) Immunoprecipitation was performed in HeLa cells using Hsp90-specific monoclonal or mouse isotypic control IgG antibodies, and immunoblotting was performed using Hsp90-specific polyclonal or L-PGDS–specific polyclonal antibodies. (C) His pull-down assays were performed using purified His-Hsp90 bound to Ni 2+ -agarose beads incubated with purified GST–L-PGDS. The binding of L-PGDS to Hsp90 was detected by immunoblotting using an L-PGDS–specific polyclonal antibody, and the His-Hsp90 present in the binding reaction were detected using an Hsp90-specific polyclonal antibody. (D) Illustration of the funnel-shaped β barrel structure of L-PGDS (available in the Protein Data Bank under accession no. 2E4J ). On the outside of the funnel near the bottom, a surface was identified that had basic residues (Arg42, Lys66, Arg151, Lys156, and Lys160) surrounding a sunken hydrophobic site (Trp43, Tyr44, Ala46, and Gly47) under a C-terminal loop. (E) HEK293 cells were transiently transfected with pcDNA3, L-PGDS–HA, or its W43A/G47A-HA mutant construct. Immunoprecipitation of L-PGDS was performed using a HA-specific monoclonal antibody, and immunoblotting was performed using a peroxidase-conjugated anti-HA antibody. Endogenous Hsp90 was detected using an Hsp90-specific polyclonal antibody. Blots shown are representative of three independent experiments. NTA, nitrilotriacetic acid.

    Techniques Used: Transfection, Mutagenesis, Construct, Immunoprecipitation, Purification, Incubation, Binding Assay

    3) Product Images from "Monitoring and kinetic analysis of the molecular interactions by which a repressor protein, PhaR, binds to target DNAs and poly[(R)-3-hydroxybutyrate]"

    Article Title: Monitoring and kinetic analysis of the molecular interactions by which a repressor protein, PhaR, binds to target DNAs and poly[(R)-3-hydroxybutyrate]

    Journal: AMB Express

    doi: 10.1186/2191-0855-3-6

    Purification profiles of recombinant PhaR. Soluble proteins were subjected to electrophoresis in an SDS (4-15%) polyacrylamide gradient gel and stained with CBB. Lane 1, molecular mass standard proteins; lane 2, soluble protein fraction of E. coli BL21 (DE3) harboring pET100/D-TOPO-PhaR Re .; lane 3, PhaR purified by nickel-nitrilotriacetic acid agarose (5 μg).
    Figure Legend Snippet: Purification profiles of recombinant PhaR. Soluble proteins were subjected to electrophoresis in an SDS (4-15%) polyacrylamide gradient gel and stained with CBB. Lane 1, molecular mass standard proteins; lane 2, soluble protein fraction of E. coli BL21 (DE3) harboring pET100/D-TOPO-PhaR Re .; lane 3, PhaR purified by nickel-nitrilotriacetic acid agarose (5 μg).

    Techniques Used: Purification, Recombinant, Electrophoresis, Staining

    4) Product Images from "SUMOylation of human septins is critical for septin filament bundling and cytokinesis"

    Article Title: SUMOylation of human septins is critical for septin filament bundling and cytokinesis

    Journal: The Journal of Cell Biology

    doi: 10.1083/jcb.201703096

    SUMOylation of human septins. (a) HeLa cells were cotransfected with WT His 6 -SUMO1, 2, or nonconjugatable (ΔGG) mutants and HA-tagged septins. Cell lysates were then subjected to denaturing His pull-down, and the presence of SUMOylated septins was assayed by immunoblot analysis using anti-HA antibodies (asterisks represent nonspecific binding of un-SUMOylated septins to nickel–nitrilotriacetic acid beads). Input fractions are shown as controls. (b) Immunoblot analysis, using anti-SEPT7 antibodies, of His pull-down proteins from HeLa cells transfected with WT or nonconjugatable (ΔGG) His 6 -SUMO1. Input fractions are shown as control. (c) Immunoblot analysis of His pull-down proteins from synchronized HeLa cells transfected with WT His 6 -SUMO1. Anti-RanGAP1 antibodies were used to monitor pull-down of SUMOylated proteins. Antiphosphorylated histone H3 antibodies (phos-H3) were used to control cell cycle synchronization.
    Figure Legend Snippet: SUMOylation of human septins. (a) HeLa cells were cotransfected with WT His 6 -SUMO1, 2, or nonconjugatable (ΔGG) mutants and HA-tagged septins. Cell lysates were then subjected to denaturing His pull-down, and the presence of SUMOylated septins was assayed by immunoblot analysis using anti-HA antibodies (asterisks represent nonspecific binding of un-SUMOylated septins to nickel–nitrilotriacetic acid beads). Input fractions are shown as controls. (b) Immunoblot analysis, using anti-SEPT7 antibodies, of His pull-down proteins from HeLa cells transfected with WT or nonconjugatable (ΔGG) His 6 -SUMO1. Input fractions are shown as control. (c) Immunoblot analysis of His pull-down proteins from synchronized HeLa cells transfected with WT His 6 -SUMO1. Anti-RanGAP1 antibodies were used to monitor pull-down of SUMOylated proteins. Antiphosphorylated histone H3 antibodies (phos-H3) were used to control cell cycle synchronization.

    Techniques Used: Binding Assay, Transfection

    5) Product Images from "Methicillin-resistant Staphylococcus aureus (MRSA) Pyruvate Kinase as a Target for Bis-indole Alkaloids with Antibacterial Activities *"

    Article Title: Methicillin-resistant Staphylococcus aureus (MRSA) Pyruvate Kinase as a Target for Bis-indole Alkaloids with Antibacterial Activities *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M111.289033

    SDS-PAGE of purified MRSA PK and human PK isoforms. 5-μg aliquots of MRSA PK, human M1, M2, R, and L PK proteins purified to homogeneity through the nickel-nitrilotriacetic acid chromatography step as described under “Experimental Procedures”
    Figure Legend Snippet: SDS-PAGE of purified MRSA PK and human PK isoforms. 5-μg aliquots of MRSA PK, human M1, M2, R, and L PK proteins purified to homogeneity through the nickel-nitrilotriacetic acid chromatography step as described under “Experimental Procedures”

    Techniques Used: SDS Page, Purification, Chromatography

    6) Product Images from "Epstein-Barr virus-induced gene 3 (EBI3) can mediate IL-6 trans-signaling"

    Article Title: Epstein-Barr virus-induced gene 3 (EBI3) can mediate IL-6 trans-signaling

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M116.762021

    EBI3 forms a secreted complex with IL-6. A , HEK-239 Flp-In TM cells were transfected with expression vectors coding for mEBI3-T2A-IL-6 (clone nos. 1 and 2), mIL-27T2A, and mIL-6. Proteins were immunoprecipitated ( IP ) from cellular supernatants using anti-mEBI3 mAb and anti-rat IgG-agarose resin. Signals for mEBI3 (35 kDa) and mIL-6 (25 kDa) were revealed by successive incubation with anti-mEBI3 and biotinylated anti-mIL-6 Abs followed by anti-rat IgG-HRP and streptavidin-HRP, respectively. Signals at 50 and 25 kDa represent background because of the detection of the Ig heavy and light chains eluted from rat IgG-agarose by the secondary antibody used for EBI3 detection. B , His-biotin-tagged recombinant mouse or human EBI3 and unconjugated mouse or human IL-6 were subjected to IMAC. Nickel-nitrilotriacetic acid (Ni-NTA) resin incubated without the addition of EBI3 and IL-6 was used as negative control (resin lanes). EBI3 (100 ng) and IL-6 (20 ng) were used as positive detection controls. Signals were revealed with either streptavidin-HRP or anti-IL-6 followed by HRP-conjugated anti-IgG. WB , Western blotting.
    Figure Legend Snippet: EBI3 forms a secreted complex with IL-6. A , HEK-239 Flp-In TM cells were transfected with expression vectors coding for mEBI3-T2A-IL-6 (clone nos. 1 and 2), mIL-27T2A, and mIL-6. Proteins were immunoprecipitated ( IP ) from cellular supernatants using anti-mEBI3 mAb and anti-rat IgG-agarose resin. Signals for mEBI3 (35 kDa) and mIL-6 (25 kDa) were revealed by successive incubation with anti-mEBI3 and biotinylated anti-mIL-6 Abs followed by anti-rat IgG-HRP and streptavidin-HRP, respectively. Signals at 50 and 25 kDa represent background because of the detection of the Ig heavy and light chains eluted from rat IgG-agarose by the secondary antibody used for EBI3 detection. B , His-biotin-tagged recombinant mouse or human EBI3 and unconjugated mouse or human IL-6 were subjected to IMAC. Nickel-nitrilotriacetic acid (Ni-NTA) resin incubated without the addition of EBI3 and IL-6 was used as negative control (resin lanes). EBI3 (100 ng) and IL-6 (20 ng) were used as positive detection controls. Signals were revealed with either streptavidin-HRP or anti-IL-6 followed by HRP-conjugated anti-IgG. WB , Western blotting.

    Techniques Used: Transfection, Expressing, Immunoprecipitation, Incubation, Recombinant, Negative Control, Western Blot

    7) Product Images from "The Rev1 interacting region (RIR) motif in the scaffold protein XRCC1 mediates a low-affinity interaction with polynucleotide kinase/phosphatase (PNKP) during DNA single-strand break repair"

    Article Title: The Rev1 interacting region (RIR) motif in the scaffold protein XRCC1 mediates a low-affinity interaction with polynucleotide kinase/phosphatase (PNKP) during DNA single-strand break repair

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M117.806638

    The RIR motif mediates the phosphorylation-independent interaction with PNKP. A , phosphorylation-independent interaction of PNKP with full-length and truncated XRCC1. Acrylodan-labeled PNKP was excited at 380 nm, the relative fluorescence intensities were monitored at 485 nm (the data for XRCC1-His is provided in the inset ) as a function of full-length XRCC1-His (■) or truncated His-XRCC1 161–406 (●). The concentrations of PNKP-AC used were 20 and 80 n m with full-length XRCC1, and truncated His-XRCC1 161–406 , respectively. A representative plot of the fraction of PNKP-AC bound versus XRCC1 concentration is shown. The K d values reported represents the mean ± S.E. ( n = 3). B , mutation of the phenylalanine motif prevents phosphorylation-independent interaction of XRCC1 with PNKP, in vitro . PNKP-AC (80 n m ) was excited at 380 nm, and the emission fluorescence was measured between 400 and 550 nm. Note that the emission peak was ∼490 nm and was quenched only by wild-type XRCC1 and not by His-XRCC1 FFF mutant. Data are based on three experiments using varied concentrations of the triple mutant. The scans shown represent data for a 1:1 molar ratio for PNKP to wild-type XRCC1 and a 1:6 molar ratio of PNKP to XRCC1 FFF . C , cell extract from EM9 cells transiently transfected with pcD2E-PNKP and either empty pcD2E vector ( EM9-V ) or a pCD2E expression construct encoding full-length XRCC1-His ( EM9-XH ), XRCC1-His FFF ( EM9-XH FFF ), XRCC1-His S518A/T519A/T523A ( EM9-XH S518A/T519A/T523A ), or XRCC1-His FFF/S518A/T519A/T523A ( EM9-XH FFF/518 ) was incubated with nickel-nitrilotriacetic acid-agarose and histidine-tagged protein complexes recovered as described under “Experimental procedures.” Aliquots of the column input and eluate were fractionated by SDS-PAGE and immunoblotted with anti-XRCC1 and anti-PNKP antibody. The gel on the right is an overexposure of the PNKP blot in the eluate sample.
    Figure Legend Snippet: The RIR motif mediates the phosphorylation-independent interaction with PNKP. A , phosphorylation-independent interaction of PNKP with full-length and truncated XRCC1. Acrylodan-labeled PNKP was excited at 380 nm, the relative fluorescence intensities were monitored at 485 nm (the data for XRCC1-His is provided in the inset ) as a function of full-length XRCC1-His (■) or truncated His-XRCC1 161–406 (●). The concentrations of PNKP-AC used were 20 and 80 n m with full-length XRCC1, and truncated His-XRCC1 161–406 , respectively. A representative plot of the fraction of PNKP-AC bound versus XRCC1 concentration is shown. The K d values reported represents the mean ± S.E. ( n = 3). B , mutation of the phenylalanine motif prevents phosphorylation-independent interaction of XRCC1 with PNKP, in vitro . PNKP-AC (80 n m ) was excited at 380 nm, and the emission fluorescence was measured between 400 and 550 nm. Note that the emission peak was ∼490 nm and was quenched only by wild-type XRCC1 and not by His-XRCC1 FFF mutant. Data are based on three experiments using varied concentrations of the triple mutant. The scans shown represent data for a 1:1 molar ratio for PNKP to wild-type XRCC1 and a 1:6 molar ratio of PNKP to XRCC1 FFF . C , cell extract from EM9 cells transiently transfected with pcD2E-PNKP and either empty pcD2E vector ( EM9-V ) or a pCD2E expression construct encoding full-length XRCC1-His ( EM9-XH ), XRCC1-His FFF ( EM9-XH FFF ), XRCC1-His S518A/T519A/T523A ( EM9-XH S518A/T519A/T523A ), or XRCC1-His FFF/S518A/T519A/T523A ( EM9-XH FFF/518 ) was incubated with nickel-nitrilotriacetic acid-agarose and histidine-tagged protein complexes recovered as described under “Experimental procedures.” Aliquots of the column input and eluate were fractionated by SDS-PAGE and immunoblotted with anti-XRCC1 and anti-PNKP antibody. The gel on the right is an overexposure of the PNKP blot in the eluate sample.

    Techniques Used: Labeling, Fluorescence, Concentration Assay, Mutagenesis, In Vitro, Field Flow Fractionation, Transfection, Plasmid Preparation, Expressing, Construct, Incubation, SDS Page

    8) Product Images from "Phosphorylation of lipid metabolic enzymes by yeast protein kinase C requires phosphatidylserine and diacylglycerol"

    Article Title: Phosphorylation of lipid metabolic enzymes by yeast protein kinase C requires phosphatidylserine and diacylglycerol

    Journal: Journal of Lipid Research

    doi: 10.1194/jlr.M075036

    Nem1 and Spo7 are phosphorylated by Pkc1 on serine residues. A: SDS-PAGE (12% gel) of Nem1-ΔTM and His 6 -tagged Spo7-ΔTM expressed in E. coli (lane 1), purified by affinity chromatography with nickel-nitrilotriacetic acid-agarose (lane 2), and further purified by ion-exchange chromatography with Q-Sepharose (lane 3). The stoichiometry of Nem1-ΔTM to Spo7-ΔTM in the preparation was 1.5:1 (mol/mol). B: The complex of Nem1-ΔTM (80 μg/ml) and His 6 -tagged Spo7-ΔTM (30 μg/ml) was incubated for 20 min with 70 ng Pkc1 in the presence of 50 μM [γ- 32 P]ATP, 10 mM MgCl 2 , 0.5 mM PS, 0.15 mM DAG, and 1.7 mM CaCl 2 . Pkc1 or the complex of Nem1-ΔTM and Spo7-ΔTM was omitted from the reaction where indicated. Following the incubation, the reaction mixtures were resolved by SDS-PAGE (12% gel) and the gel was dried and subjected to phosphorimaging analysis. The positions of phosphorylated Nem1-ΔTM and Spo7-ΔTM are indicated. C, D: 32 P-labeled Nem1-ΔTM and Spo7-ΔTM in the polyacrylamide gel were transferred to a polyvinylidene difluoride membrane and then treated with HCl or L-1-tosylamido-2-phenylethyl chloromethyl ketone-treated trypsin. Phosphoamino acids in the acid hydrolysate were separated on cellulose TLC plates by two-dimensional electrophoresis (C), whereas phosphopeptides in the tryptic digest were separated by electrophoresis (from left to right) in the first dimension and by chromatography (from bottom to top) in the second dimension (D). Phosphoamino acids and phosphopeptides resolved on the TLC plates were subjected to phosphorimaging analysis. The positions of the standard phosphoamino acids, phosphoserine (p-Ser), phosphothreonine (p-Thr), and phosphotyrosine (p-Tyr) are indicated by dashed line circles. The data shown are representative of three experiments.
    Figure Legend Snippet: Nem1 and Spo7 are phosphorylated by Pkc1 on serine residues. A: SDS-PAGE (12% gel) of Nem1-ΔTM and His 6 -tagged Spo7-ΔTM expressed in E. coli (lane 1), purified by affinity chromatography with nickel-nitrilotriacetic acid-agarose (lane 2), and further purified by ion-exchange chromatography with Q-Sepharose (lane 3). The stoichiometry of Nem1-ΔTM to Spo7-ΔTM in the preparation was 1.5:1 (mol/mol). B: The complex of Nem1-ΔTM (80 μg/ml) and His 6 -tagged Spo7-ΔTM (30 μg/ml) was incubated for 20 min with 70 ng Pkc1 in the presence of 50 μM [γ- 32 P]ATP, 10 mM MgCl 2 , 0.5 mM PS, 0.15 mM DAG, and 1.7 mM CaCl 2 . Pkc1 or the complex of Nem1-ΔTM and Spo7-ΔTM was omitted from the reaction where indicated. Following the incubation, the reaction mixtures were resolved by SDS-PAGE (12% gel) and the gel was dried and subjected to phosphorimaging analysis. The positions of phosphorylated Nem1-ΔTM and Spo7-ΔTM are indicated. C, D: 32 P-labeled Nem1-ΔTM and Spo7-ΔTM in the polyacrylamide gel were transferred to a polyvinylidene difluoride membrane and then treated with HCl or L-1-tosylamido-2-phenylethyl chloromethyl ketone-treated trypsin. Phosphoamino acids in the acid hydrolysate were separated on cellulose TLC plates by two-dimensional electrophoresis (C), whereas phosphopeptides in the tryptic digest were separated by electrophoresis (from left to right) in the first dimension and by chromatography (from bottom to top) in the second dimension (D). Phosphoamino acids and phosphopeptides resolved on the TLC plates were subjected to phosphorimaging analysis. The positions of the standard phosphoamino acids, phosphoserine (p-Ser), phosphothreonine (p-Thr), and phosphotyrosine (p-Tyr) are indicated by dashed line circles. The data shown are representative of three experiments.

    Techniques Used: SDS Page, Purification, Affinity Chromatography, Ion Exchange Chromatography, Incubation, Labeling, Thin Layer Chromatography, Electrophoresis, Chromatography

    9) Product Images from "Regulation of GPCR expression through an interaction with CCT7, a subunit of the CCT/TRiC complex"

    Article Title: Regulation of GPCR expression through an interaction with CCT7, a subunit of the CCT/TRiC complex

    Journal: Molecular Biology of the Cell

    doi: 10.1091/mbc.E16-04-0224

    Identification of the CCT7-binding domains on TPβ and β 2 AR. (A) His pull-down assays were carried out using purified hexahistidine (His) 6 -CCT7-MYC bound to nickel–nitrilotriacetic acid–agarose beads incubated with purified GST or GST fused to the TP C-termini (GST-TPβ-CT and GST-TPα-CT) and intracellular loops (GST-TPβ-ICL). (B) His pull-down assays were carried out using purified (His) 6 -CCT7-MYC bound to nickel–nitrilotriacetic acid–agarose beads incubated with purified GST or GST fused to the β 2 AR C-terminus (GST-β 2 AR-CT) and intracellular loops (GST-β 2 AR-ICL). The binding of GST-fusion proteins in A and B was detected by immunoblotting with a GST-specific HRP-conjugated antibody, and the (His) 6 -CCT7-MYC present in the binding reactions was detected with a MYC-specific HRP-conjugated antibody. Blots shown are representative of at least five independent experiments.
    Figure Legend Snippet: Identification of the CCT7-binding domains on TPβ and β 2 AR. (A) His pull-down assays were carried out using purified hexahistidine (His) 6 -CCT7-MYC bound to nickel–nitrilotriacetic acid–agarose beads incubated with purified GST or GST fused to the TP C-termini (GST-TPβ-CT and GST-TPα-CT) and intracellular loops (GST-TPβ-ICL). (B) His pull-down assays were carried out using purified (His) 6 -CCT7-MYC bound to nickel–nitrilotriacetic acid–agarose beads incubated with purified GST or GST fused to the β 2 AR C-terminus (GST-β 2 AR-CT) and intracellular loops (GST-β 2 AR-ICL). The binding of GST-fusion proteins in A and B was detected by immunoblotting with a GST-specific HRP-conjugated antibody, and the (His) 6 -CCT7-MYC present in the binding reactions was detected with a MYC-specific HRP-conjugated antibody. Blots shown are representative of at least five independent experiments.

    Techniques Used: Binding Assay, Purification, Incubation

    10) Product Images from "An Intrinsically Disordered APLF Links Ku, DNA-PKcs, and XRCC4-DNA Ligase IV in an Extended Flexible Non-homologous End Joining Complex *"

    Article Title: An Intrinsically Disordered APLF Links Ku, DNA-PKcs, and XRCC4-DNA Ligase IV in an Extended Flexible Non-homologous End Joining Complex *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M116.751867

    APLF interacts with the Ku·DNA-PKcs·DNA complex. A, His-APLF was immobilized on nitrilotriacetic acid beads and incubated with HeLa whole cell extracts. Beads were washed either in the absence (−) or presence (+) of ethidium bromide (EtBr, 50 μg/ml), then boiled in SDS sample buffer, loaded onto SDS-PAGE gels, and immunoblotted with antibodies to His (for His-APLF), DNA-PKcs, and Ku80 as indicated. B, GST ( lane 2 ) or GST-APLF ( lanes 3–6 ) were immobilized on glutathione-Sepharose 4B beads and incubated with whole cell extracts from HeLa cells that had been either unirradiated (−) or irradiated (10 gray IR) and allowed to recover for 1 h. Beads were washed either in the absence (−) or presence (+) of EtBr (50 μg/ml), then boiled in SDS sample buffer, loaded onto SDS-PAGE gels, and immunoblotted with antibodies to GST (for GST-APLF), DNA-PKcs, and Ku80 as indicated. The lower panel represents a longer exposure of the Ku80 blot to show a signal in the input lanes. Lane 1 contained 50 μg of extract from unirradiated cells as a positive control. C, HeLa cells were transiently transfected with FLAG-tagged APLF ( lanes 3 and 4 ) or empty vector ( lane 2 ), then extracts were immunoprecipitated with anti-FLAG antibody, run on SDS-PAGE, and immunoblotted with antibodies to FLAG (for FLAG-APLF), DNA-PKcs and Ku as indicated. Where indicated, ethidium bromide (50 μg/ml) was added to immunoprecipitation wash buffers. Note: a duplicated sample lane has been removed between lanes 2 and 3 . All blots were from the same exposure of the same gels. D, purified DNA-PKcs and/or Ku were incubated with GST-APLF immobilized on glutathione-Sepharose 4B beads in either the absence (−) or presence (+) of CT-DNA (10 μg/ml). Samples were run on SDS-PAGE and immunoblotted with antibodies to GST (for GST-APLF), DNA-PKcs and Ku as indicated. E, purified DNA-PKcs and Ku were incubated with GST-APLF ( lanes 3–8 ) or GST ( lane 2 ) immobilized on glutathione-Sepharose 4B beads in the presence of different lengths of DNA (10 μg/ml) and then immunoblotted with antibodies as indicated. In lanes 2 and 4 , proteins were incubated in the presence of 10 μg/ml of CT-DNA, lane 5 contained 40 base ssDNA; lane 6 , 40-bp dsDNA; lane 7 , 100 base ssDNA; and lane 8 , 100-bp dsDNA. Lane 1 contained 100 ng each DNA-PKcs and Ku. Lane 3 contained no DNA. F, purified DNA-PKcs and Ku were incubated with either GST alone ( lanes 2 and 3 ), GST-APLF ( lanes 4 and 5 ), or GST-APLF residues 1–120 ( lanes 6 and 7 ), 110–360 ( lanes 8 and 9 ), or 360–511 ( lanes 9 and 10 ) that had been bound to glutathione-Sepharose 4B beads either in the absence (−) or presence (+) of CT-DNA (80 μg/ml). Samples were washed, run on SDS-PAGE, and immunoblotted. Lane 1 contains 100 ng each DNA-PKcs and Ku. The upper panel is a Ponceau Red-stained membrane, whereas the lower panels show immunoblots for DNA-PKcs and Ku80, respectively. Positions of molecular mass markers (in kDa) are shown on the left-hand side on the Ponceau-stained blot. G, GST alone, GST-APLF, or GST-APLF with mutations of R182E/K183E/R184E or W189G were bound to glutathione-Sepharose 4B beads and incubated with purified DNA-PKcs and Ku in the absence (−) or presence (+) of CT-DNA as above then immunoblotted with antibodies to GST (for GST-APLF), DNA-PKcs, and Ku80 as indicated.
    Figure Legend Snippet: APLF interacts with the Ku·DNA-PKcs·DNA complex. A, His-APLF was immobilized on nitrilotriacetic acid beads and incubated with HeLa whole cell extracts. Beads were washed either in the absence (−) or presence (+) of ethidium bromide (EtBr, 50 μg/ml), then boiled in SDS sample buffer, loaded onto SDS-PAGE gels, and immunoblotted with antibodies to His (for His-APLF), DNA-PKcs, and Ku80 as indicated. B, GST ( lane 2 ) or GST-APLF ( lanes 3–6 ) were immobilized on glutathione-Sepharose 4B beads and incubated with whole cell extracts from HeLa cells that had been either unirradiated (−) or irradiated (10 gray IR) and allowed to recover for 1 h. Beads were washed either in the absence (−) or presence (+) of EtBr (50 μg/ml), then boiled in SDS sample buffer, loaded onto SDS-PAGE gels, and immunoblotted with antibodies to GST (for GST-APLF), DNA-PKcs, and Ku80 as indicated. The lower panel represents a longer exposure of the Ku80 blot to show a signal in the input lanes. Lane 1 contained 50 μg of extract from unirradiated cells as a positive control. C, HeLa cells were transiently transfected with FLAG-tagged APLF ( lanes 3 and 4 ) or empty vector ( lane 2 ), then extracts were immunoprecipitated with anti-FLAG antibody, run on SDS-PAGE, and immunoblotted with antibodies to FLAG (for FLAG-APLF), DNA-PKcs and Ku as indicated. Where indicated, ethidium bromide (50 μg/ml) was added to immunoprecipitation wash buffers. Note: a duplicated sample lane has been removed between lanes 2 and 3 . All blots were from the same exposure of the same gels. D, purified DNA-PKcs and/or Ku were incubated with GST-APLF immobilized on glutathione-Sepharose 4B beads in either the absence (−) or presence (+) of CT-DNA (10 μg/ml). Samples were run on SDS-PAGE and immunoblotted with antibodies to GST (for GST-APLF), DNA-PKcs and Ku as indicated. E, purified DNA-PKcs and Ku were incubated with GST-APLF ( lanes 3–8 ) or GST ( lane 2 ) immobilized on glutathione-Sepharose 4B beads in the presence of different lengths of DNA (10 μg/ml) and then immunoblotted with antibodies as indicated. In lanes 2 and 4 , proteins were incubated in the presence of 10 μg/ml of CT-DNA, lane 5 contained 40 base ssDNA; lane 6 , 40-bp dsDNA; lane 7 , 100 base ssDNA; and lane 8 , 100-bp dsDNA. Lane 1 contained 100 ng each DNA-PKcs and Ku. Lane 3 contained no DNA. F, purified DNA-PKcs and Ku were incubated with either GST alone ( lanes 2 and 3 ), GST-APLF ( lanes 4 and 5 ), or GST-APLF residues 1–120 ( lanes 6 and 7 ), 110–360 ( lanes 8 and 9 ), or 360–511 ( lanes 9 and 10 ) that had been bound to glutathione-Sepharose 4B beads either in the absence (−) or presence (+) of CT-DNA (80 μg/ml). Samples were washed, run on SDS-PAGE, and immunoblotted. Lane 1 contains 100 ng each DNA-PKcs and Ku. The upper panel is a Ponceau Red-stained membrane, whereas the lower panels show immunoblots for DNA-PKcs and Ku80, respectively. Positions of molecular mass markers (in kDa) are shown on the left-hand side on the Ponceau-stained blot. G, GST alone, GST-APLF, or GST-APLF with mutations of R182E/K183E/R184E or W189G were bound to glutathione-Sepharose 4B beads and incubated with purified DNA-PKcs and Ku in the absence (−) or presence (+) of CT-DNA as above then immunoblotted with antibodies to GST (for GST-APLF), DNA-PKcs, and Ku80 as indicated.

    Techniques Used: Incubation, SDS Page, Irradiation, Positive Control, Transfection, Plasmid Preparation, Immunoprecipitation, Purification, Staining, Western Blot

    11) Product Images from "Small Heat Shock Protein Hsp17.8 Functions as an AKR2A Cofactor in the Targeting of Chloroplast Outer Membrane Proteins in Arabidopsis 1Small Heat Shock Protein Hsp17.8 Functions as an AKR2A Cofactor in the Targeting of Chloroplast Outer Membrane Proteins in Arabidopsis 1 [W]Small Heat Shock Protein Hsp17.8 Functions as an AKR2A Cofactor in the Targeting of Chloroplast Outer Membrane Proteins in Arabidopsis 1 [W] [OA]"

    Article Title: Small Heat Shock Protein Hsp17.8 Functions as an AKR2A Cofactor in the Targeting of Chloroplast Outer Membrane Proteins in Arabidopsis 1Small Heat Shock Protein Hsp17.8 Functions as an AKR2A Cofactor in the Targeting of Chloroplast Outer Membrane Proteins in Arabidopsis 1 [W]Small Heat Shock Protein Hsp17.8 Functions as an AKR2A Cofactor in the Targeting of Chloroplast Outer Membrane Proteins in Arabidopsis 1 [W] [OA]

    Journal: Plant Physiology

    doi: 10.1104/pp.111.178681

    Hsp17.8 increases the amount of AKR2A proteins bound to chloroplasts. A and B, The effect of Hsp17.8 on the AKR2A binding to chloroplasts. A, His-tagged AKR2A or Hsp17.8 recombinant proteins were expressed in E. coli and purified using a nickel-nitrilotriacetic
    Figure Legend Snippet: Hsp17.8 increases the amount of AKR2A proteins bound to chloroplasts. A and B, The effect of Hsp17.8 on the AKR2A binding to chloroplasts. A, His-tagged AKR2A or Hsp17.8 recombinant proteins were expressed in E. coli and purified using a nickel-nitrilotriacetic

    Techniques Used: Binding Assay, Recombinant, Purification

    12) Product Images from "Assembly of the Yeast Exoribonuclease Rrp6 with Its Associated Cofactor Rrp47 Occurs in the Nucleus and Is Critical for the Controlled Expression of Rrp47 *"

    Article Title: Assembly of the Yeast Exoribonuclease Rrp6 with Its Associated Cofactor Rrp47 Occurs in the Nucleus and Is Critical for the Controlled Expression of Rrp47 *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M112.445759

    Rrp47 forms a stoichiometric heterodimer with the Rrp6 NT domain. A , Purification of the recombinant Rrp47·Rrp6 NT complex. Aliquots of the cell extract ( CXT ; lane 1 ), nickel-nitrilotriacetic acid ( Ni-NTA ) flow-through ( FT ; lane 2 ), and eluate ( E ; lane 3 ) fractions, the eluate upon GST-Sepharose affinity chromatography ( GST eluate ; lane 4), and the peak fraction after gel filtration ( GF peak ; lane 5 ) were resolved by SDS-PAGE, and proteins were visualized by staining with colloidal Coomassie Blue. A densitometric scan of the peak fraction in lane 5 is shown on the right. B , Western analyses of the purified Rrp47·Rrp6 NT complex. Images are shown after probing a blot of the GF peak fraction ( A , lane 5 ) for His-Rrp47 and after reprobing for GST-Rrp6 NT . C , glutaraldehyde cross-linking analysis of the Rrp47·Rrp6 NT complex. Reactants were resolved by SDS-PAGE and analyzed by Western blotting using the penta-His antibody. Lane 1 , non-treated sample. Lane 2 , prequenched sample. Lanes 3–5 , samples cross-linked for the times indicated. The positions of molecular mass markers (sizes in kDa) are shown for each panel .
    Figure Legend Snippet: Rrp47 forms a stoichiometric heterodimer with the Rrp6 NT domain. A , Purification of the recombinant Rrp47·Rrp6 NT complex. Aliquots of the cell extract ( CXT ; lane 1 ), nickel-nitrilotriacetic acid ( Ni-NTA ) flow-through ( FT ; lane 2 ), and eluate ( E ; lane 3 ) fractions, the eluate upon GST-Sepharose affinity chromatography ( GST eluate ; lane 4), and the peak fraction after gel filtration ( GF peak ; lane 5 ) were resolved by SDS-PAGE, and proteins were visualized by staining with colloidal Coomassie Blue. A densitometric scan of the peak fraction in lane 5 is shown on the right. B , Western analyses of the purified Rrp47·Rrp6 NT complex. Images are shown after probing a blot of the GF peak fraction ( A , lane 5 ) for His-Rrp47 and after reprobing for GST-Rrp6 NT . C , glutaraldehyde cross-linking analysis of the Rrp47·Rrp6 NT complex. Reactants were resolved by SDS-PAGE and analyzed by Western blotting using the penta-His antibody. Lane 1 , non-treated sample. Lane 2 , prequenched sample. Lanes 3–5 , samples cross-linked for the times indicated. The positions of molecular mass markers (sizes in kDa) are shown for each panel .

    Techniques Used: Purification, Recombinant, Flow Cytometry, Affinity Chromatography, Filtration, SDS Page, Staining, Western Blot

    13) Product Images from "Components of the Rv0081-Rv0088 Locus, Which Encodes a Predicted Formate Hydrogenlyase Complex, Are Coregulated by Rv0081, MprA, and DosR in Mycobacterium tuberculosis ▿ ▿ †"

    Article Title: Components of the Rv0081-Rv0088 Locus, Which Encodes a Predicted Formate Hydrogenlyase Complex, Are Coregulated by Rv0081, MprA, and DosR in Mycobacterium tuberculosis ▿ ▿ †

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.05562-11

    Autogenous regulation of the Rv0081 promoter by Rv0081. (A) Genomic organization of the Rv0079-Rv0089 locus. Numbers below genes indicate the intergenic distance. (B) Rv0081 promoter- lacZ reporter assays were conducted in wild-type M. smegmatis carrying vector only (white bars) or vector expressing hsp60-Rv0081 (black bars). Cultures were grown with shaking or were grown statically, and β-galactosidase activity was quantified. Data are presented in Miller units. (C) His-Rv0081 was overproduced and purified using nickel nitrilotriacetic acid-agarose column chromatography. Enriched His-Rv0081 is depicted with an arrow. M, marker; L, lysate; FT, flowthrough; B, binding buffer; W, wash buffer; E, eluate; DE, dialyzed eluate. (D) Binding by His-Rv0081 was assessed using electrophoretic mobility shift assays to regions upstream of Rv0081 , Rv0079 , Rv0082 , or hycD . Reaction mixtures contained 1.0 ng radiolabeled probe alone (lane 1) or probe with 10 ng (lane 2), 40 ng (lane 3), or 80 ng (lane 4) of His-Rv0081. (E) Binding by Rv0081 to its own upstream region is sequence specific. Radiolabeled probe (1.0 ng) from the Rv0081 upstream region was incubated alone (lane 1) or in the presence of 100 ng of His-Rv0081 (lanes 2 to 6). Reaction mixtures also contained 150-fold and 300-fold excess cold DNA from the Rv0081 upstream region (lanes 3 and 4) or nonspecific cold DNA from the hycD upstream region (lanes 5 and 6). B, bound; F, free.
    Figure Legend Snippet: Autogenous regulation of the Rv0081 promoter by Rv0081. (A) Genomic organization of the Rv0079-Rv0089 locus. Numbers below genes indicate the intergenic distance. (B) Rv0081 promoter- lacZ reporter assays were conducted in wild-type M. smegmatis carrying vector only (white bars) or vector expressing hsp60-Rv0081 (black bars). Cultures were grown with shaking or were grown statically, and β-galactosidase activity was quantified. Data are presented in Miller units. (C) His-Rv0081 was overproduced and purified using nickel nitrilotriacetic acid-agarose column chromatography. Enriched His-Rv0081 is depicted with an arrow. M, marker; L, lysate; FT, flowthrough; B, binding buffer; W, wash buffer; E, eluate; DE, dialyzed eluate. (D) Binding by His-Rv0081 was assessed using electrophoretic mobility shift assays to regions upstream of Rv0081 , Rv0079 , Rv0082 , or hycD . Reaction mixtures contained 1.0 ng radiolabeled probe alone (lane 1) or probe with 10 ng (lane 2), 40 ng (lane 3), or 80 ng (lane 4) of His-Rv0081. (E) Binding by Rv0081 to its own upstream region is sequence specific. Radiolabeled probe (1.0 ng) from the Rv0081 upstream region was incubated alone (lane 1) or in the presence of 100 ng of His-Rv0081 (lanes 2 to 6). Reaction mixtures also contained 150-fold and 300-fold excess cold DNA from the Rv0081 upstream region (lanes 3 and 4) or nonspecific cold DNA from the hycD upstream region (lanes 5 and 6). B, bound; F, free.

    Techniques Used: Plasmid Preparation, Expressing, Activity Assay, Purification, Column Chromatography, Marker, Binding Assay, Electrophoretic Mobility Shift Assay, Sequencing, Incubation

    14) Product Images from "Characterization of FdmV as an Amide Synthetase for Fredericamycin A Biosynthesis in Streptomyces griseus ATCC 43944"

    Article Title: Characterization of FdmV as an Amide Synthetase for Fredericamycin A Biosynthesis in Streptomyces griseus ATCC 43944

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M110.147744

    Purification of recombinant C-His 6 -tagged FdmV from SB4030 as monitored by SDS-PAGE. Lane M , Benchmark TM protein ladder (Invitrogen); lane 1 , total soluble proteins; lane 2 , partially purified FdmV after nickel-nitrilotriacetic acid affinity chromatography; lane 3, purified FdmV after HiTrap TM HP anion-exchange chromatography.
    Figure Legend Snippet: Purification of recombinant C-His 6 -tagged FdmV from SB4030 as monitored by SDS-PAGE. Lane M , Benchmark TM protein ladder (Invitrogen); lane 1 , total soluble proteins; lane 2 , partially purified FdmV after nickel-nitrilotriacetic acid affinity chromatography; lane 3, purified FdmV after HiTrap TM HP anion-exchange chromatography.

    Techniques Used: Purification, Recombinant, SDS Page, Affinity Chromatography, Chromatography

    15) Product Images from "The CUL7/F-box and WD Repeat Domain Containing 8 (CUL7/Fbxw8) Ubiquitin Ligase Promotes Degradation of Hematopoietic Progenitor Kinase 1 *"

    Article Title: The CUL7/F-box and WD Repeat Domain Containing 8 (CUL7/Fbxw8) Ubiquitin Ligase Promotes Degradation of Hematopoietic Progenitor Kinase 1 *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M113.520106

    Cotransfection of Fbxw8 results in the polyubiquitination of HPK1 protein mainly through K48 of ubiquitin. A , wild-type HPK1 and HA-Ub were cotransfected with either Myc-Fbxw8 or Flag-Fbxw7. Thirty-six hours after transfection, cells were harvested for immunoprecipitation with anti-HPK1 antibody followed by Western blotting as indicated. The inputs for the immunoprecipitation are shown at the bottom. B , Flag-HPK1 and Myc-Fbxw8 were cotransfected with wild-type His.Myc-Ub, His.Myc-Ub K48R, or His.Myc-Ub K63R into 293T cells. Nickel-nitrilotriacetic acid agarose beads were used to pull down the ubiquitinated HPK1 protein.
    Figure Legend Snippet: Cotransfection of Fbxw8 results in the polyubiquitination of HPK1 protein mainly through K48 of ubiquitin. A , wild-type HPK1 and HA-Ub were cotransfected with either Myc-Fbxw8 or Flag-Fbxw7. Thirty-six hours after transfection, cells were harvested for immunoprecipitation with anti-HPK1 antibody followed by Western blotting as indicated. The inputs for the immunoprecipitation are shown at the bottom. B , Flag-HPK1 and Myc-Fbxw8 were cotransfected with wild-type His.Myc-Ub, His.Myc-Ub K48R, or His.Myc-Ub K63R into 293T cells. Nickel-nitrilotriacetic acid agarose beads were used to pull down the ubiquitinated HPK1 protein.

    Techniques Used: Cotransfection, Transfection, Immunoprecipitation, Western Blot

    16) Product Images from "Iridoid-specific Glucosyltransferase from Gardenia jasminoides *"

    Article Title: Iridoid-specific Glucosyltransferase from Gardenia jasminoides *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M111.242586

    Analysis of the glucosyltransferase activity of recombinant UGT85A24 expressed in E. coli . A , results from SDS-PAGE analysis of the crude protein from E. coli JM109 harboring pQE-30-GjUGT2 ( left lane: C ) and the recombinant enzyme (UGT85A24) purified using a nickel-nitrilotriacetic acid resin column ( right: P ). B , time course changes in genipin glucosylation by incubation with recombinant UGT85A24.
    Figure Legend Snippet: Analysis of the glucosyltransferase activity of recombinant UGT85A24 expressed in E. coli . A , results from SDS-PAGE analysis of the crude protein from E. coli JM109 harboring pQE-30-GjUGT2 ( left lane: C ) and the recombinant enzyme (UGT85A24) purified using a nickel-nitrilotriacetic acid resin column ( right: P ). B , time course changes in genipin glucosylation by incubation with recombinant UGT85A24.

    Techniques Used: Activity Assay, Recombinant, SDS Page, Purification, Incubation

    17) Product Images from "High Mobility Group Nucleosomal Binding Domain 2 (HMGN2) SUMOylation by the SUMO E3 Ligase PIAS1 Decreases the Binding Affinity to Nucleosome Core Particles *"

    Article Title: High Mobility Group Nucleosomal Binding Domain 2 (HMGN2) SUMOylation by the SUMO E3 Ligase PIAS1 Decreases the Binding Affinity to Nucleosome Core Particles *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M114.555425

    SUMOylation of HMGN2 reduces its binding affinity to NCP. A, E. coli were co-transformed with pRset-HMGN2 and pT-E1E2S1 plasmids, and SUMOylated HMGN2 protein was purified using nickel-nitrilotriacetic acid-agarose beads and loaded in 12% SDS-PAGE for Coomassie Blue staining and Western blotting with anti-HMGN2 antibody. The mono- or di-SUMOylated form of HMGN2 (fraction number around 19–22) was collected and re-purified from non-SUMOylated HMGN2 using CM-Sepharose column chromatography, and then immunoblotted ( IB ) with anti-SUMO1 antibody. B and C, mobility shift assay of binding affinity of wild-type and SUMOylated HMGN2 to purified NCPs was tested two times at various molar ratios of HMGN2 protein to NCPs. The band intensities (*) of test #1 were measured as a representative, and the ratio of HMGN2 to SUMO1-HMGN2 at each molar ratio to NCPs was drawn. Arrow , HMGN2 and NCP complexes. D and E, mobility shift assay of binding of wild-type and SUMOylated HMGN2 to nuclear deproteined DNA was measured, and the ratio of HMGN2 to SUMO1-HMGN2 at each molar ratio to nuclear DNA binding was drawn. Arrow , HMGN2 and DNA complex.
    Figure Legend Snippet: SUMOylation of HMGN2 reduces its binding affinity to NCP. A, E. coli were co-transformed with pRset-HMGN2 and pT-E1E2S1 plasmids, and SUMOylated HMGN2 protein was purified using nickel-nitrilotriacetic acid-agarose beads and loaded in 12% SDS-PAGE for Coomassie Blue staining and Western blotting with anti-HMGN2 antibody. The mono- or di-SUMOylated form of HMGN2 (fraction number around 19–22) was collected and re-purified from non-SUMOylated HMGN2 using CM-Sepharose column chromatography, and then immunoblotted ( IB ) with anti-SUMO1 antibody. B and C, mobility shift assay of binding affinity of wild-type and SUMOylated HMGN2 to purified NCPs was tested two times at various molar ratios of HMGN2 protein to NCPs. The band intensities (*) of test #1 were measured as a representative, and the ratio of HMGN2 to SUMO1-HMGN2 at each molar ratio to NCPs was drawn. Arrow , HMGN2 and NCP complexes. D and E, mobility shift assay of binding of wild-type and SUMOylated HMGN2 to nuclear deproteined DNA was measured, and the ratio of HMGN2 to SUMO1-HMGN2 at each molar ratio to nuclear DNA binding was drawn. Arrow , HMGN2 and DNA complex.

    Techniques Used: Binding Assay, Transformation Assay, Purification, SDS Page, Staining, Western Blot, Column Chromatography, Mobility Shift

    18) Product Images from "cGMP-dependent protein kinase and the regulation of vascular smooth muscle cell gene expression: possible involvement of Elk-1 sumoylation"

    Article Title: cGMP-dependent protein kinase and the regulation of vascular smooth muscle cell gene expression: possible involvement of Elk-1 sumoylation

    Journal: American Journal of Physiology - Heart and Circulatory Physiology

    doi: 10.1152/ajpheart.00677.2010

    PKG-I increases Elk-1 sumoylation in vivo. His-Flag-Elk-1 (E) and hemagglutinin (HA) -SUMO-1 (S) expression vectors were transfected into control COS-7 cells (COS/C) or stably PKG-1α expressing COS-7 cells (COS/Iα). After 2 days, cells were lysed in 1 ml of 6 M guanethidine HCl, 0.1 M NaH 2 PO 4 , 0.01 M Tris·HCl (pH 8.0), and 0.3 M NaCl plus 20 mM imidazole, 20 mM β-mercaptoethanol, 15 mM N -ethylmaleimide (NEM), 5 nM calyculin A, and 1× proteinase cocktail. The lysates were mixed with 30 μl of Ni 2+ -nitrilotriacetic acid (Ni-NTA) agarose beads prewashed with lysis buffer and incubated overnight at 4°C. The beads were washed twice with lysis buffer and the following wash buffers: 8 M urea, 0.1 M NaH 2 PO 4 , 0.01 M Tris·HCl (pH 8.0, pH 6.3, and pH 5.9). All wash buffers contain 20 mM imidazole and 20 mM β-mercaptoethanol. After the final wash, the beads were eluted with 8 M urea, 0.1 M NaH 2 PO 4 , and 0.01 M Tris·HCl (pH 4.5) containing 200 mM imidazole and 720 mM β-mercaptoethanol. The eluates and total extracts were subjected to SDS-PAGE and immunoblotting with indicated antibodies.
    Figure Legend Snippet: PKG-I increases Elk-1 sumoylation in vivo. His-Flag-Elk-1 (E) and hemagglutinin (HA) -SUMO-1 (S) expression vectors were transfected into control COS-7 cells (COS/C) or stably PKG-1α expressing COS-7 cells (COS/Iα). After 2 days, cells were lysed in 1 ml of 6 M guanethidine HCl, 0.1 M NaH 2 PO 4 , 0.01 M Tris·HCl (pH 8.0), and 0.3 M NaCl plus 20 mM imidazole, 20 mM β-mercaptoethanol, 15 mM N -ethylmaleimide (NEM), 5 nM calyculin A, and 1× proteinase cocktail. The lysates were mixed with 30 μl of Ni 2+ -nitrilotriacetic acid (Ni-NTA) agarose beads prewashed with lysis buffer and incubated overnight at 4°C. The beads were washed twice with lysis buffer and the following wash buffers: 8 M urea, 0.1 M NaH 2 PO 4 , 0.01 M Tris·HCl (pH 8.0, pH 6.3, and pH 5.9). All wash buffers contain 20 mM imidazole and 20 mM β-mercaptoethanol. After the final wash, the beads were eluted with 8 M urea, 0.1 M NaH 2 PO 4 , and 0.01 M Tris·HCl (pH 4.5) containing 200 mM imidazole and 720 mM β-mercaptoethanol. The eluates and total extracts were subjected to SDS-PAGE and immunoblotting with indicated antibodies.

    Techniques Used: In Vivo, Expressing, Transfection, Stable Transfection, Lysis, Incubation, SDS Page

    19) Product Images from "Phosphatidic Acid Binds to Cytosolic Glyceraldehyde-3-phosphate Dehydrogenase and Promotes Its Cleavage in Arabidopsis *"

    Article Title: Phosphatidic Acid Binds to Cytosolic Glyceraldehyde-3-phosphate Dehydrogenase and Promotes Its Cleavage in Arabidopsis *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M112.427229

    SPR quantitative analysis of PA-GAPC interaction. His-tagged proteins (0.2 μ m ) were first immobilized on the nitrilotriacetic acid chip followed by injection of liposomes containing PC only or PC plus PA. The representative sensorgrams show RU
    Figure Legend Snippet: SPR quantitative analysis of PA-GAPC interaction. His-tagged proteins (0.2 μ m ) were first immobilized on the nitrilotriacetic acid chip followed by injection of liposomes containing PC only or PC plus PA. The representative sensorgrams show RU

    Techniques Used: SPR Assay, Chromatin Immunoprecipitation, Injection

    20) Product Images from "The Chloroplastic GrpE Homolog of Chlamydomonas"

    Article Title: The Chloroplastic GrpE Homolog of Chlamydomonas

    Journal: The Plant Cell

    doi: 10.1105/tpc.010202

    Complementation of the E. coli grpE Deletion Strain OD212 with CGE1 and Analysis of CGE1–DnaK Interactions. (A) Temperature-sensitive E. coli strain OD212 carrying a deletion of its grpE gene was transformed with a plasmid vector for the expression of CGE1 (CGE1-1 and CGE1-2) or the same vector expressing an unrelated gene (control). Dilutions of transformant cultures were spotted onto Luria-Bertani plates and incubated overnight at 25, 37, or 43°C. (B) Comparison of the expression of CGE1 in the OD212 transformants described in (A) with Chlamydomonas (Chlamy) CGE1 by protein gel blot analysis and detection with CGE1 antiserum (α-CGE1). Each lane contained 15 μg of total soluble protein. (C) Expression of hexahistidine-tagged versions of CGE1 and an unrelated 30-kD protein (control) from plasmid vectors was induced in E. coli strain M15 by isopropylthio-β-galactoside. Cells were lysed under native conditions (crude lysate; lanes 1 and 2) and incubated with nickel–nitrilotriacetic acid agarose (Ni-NTA). After washing, proteins bound to Ni-NTA were eluted by incubation with 250 mM imidazole (lanes 3 and 4). In a parallel experiment, Ni-NTA beads binding CGE1 were first incubated for 10 min at 24°C with a buffer containing 20 mM 3-( N -morpholino)-propanesulfonic acid (Mops)-KOH, pH 7.4, 80 mM KCl, 5 mM MgCl 2 , and either 5 mM ATP or no nucleotide (mock) (lanes 5 and 6). The proteins that had remained on the resin then were eluted with 250 mM imidazole (lanes 7 and 8). Eluted proteins were precipitated with trichloroacetic acid, separated on an SDS–10% polyacrylamide gel, and visualized by Coomassie blue staining (top) or transferred to nitrocellulose and immunodetected with an antiserum (α) against DnaK using enhanced chemiluminescence (bottom).
    Figure Legend Snippet: Complementation of the E. coli grpE Deletion Strain OD212 with CGE1 and Analysis of CGE1–DnaK Interactions. (A) Temperature-sensitive E. coli strain OD212 carrying a deletion of its grpE gene was transformed with a plasmid vector for the expression of CGE1 (CGE1-1 and CGE1-2) or the same vector expressing an unrelated gene (control). Dilutions of transformant cultures were spotted onto Luria-Bertani plates and incubated overnight at 25, 37, or 43°C. (B) Comparison of the expression of CGE1 in the OD212 transformants described in (A) with Chlamydomonas (Chlamy) CGE1 by protein gel blot analysis and detection with CGE1 antiserum (α-CGE1). Each lane contained 15 μg of total soluble protein. (C) Expression of hexahistidine-tagged versions of CGE1 and an unrelated 30-kD protein (control) from plasmid vectors was induced in E. coli strain M15 by isopropylthio-β-galactoside. Cells were lysed under native conditions (crude lysate; lanes 1 and 2) and incubated with nickel–nitrilotriacetic acid agarose (Ni-NTA). After washing, proteins bound to Ni-NTA were eluted by incubation with 250 mM imidazole (lanes 3 and 4). In a parallel experiment, Ni-NTA beads binding CGE1 were first incubated for 10 min at 24°C with a buffer containing 20 mM 3-( N -morpholino)-propanesulfonic acid (Mops)-KOH, pH 7.4, 80 mM KCl, 5 mM MgCl 2 , and either 5 mM ATP or no nucleotide (mock) (lanes 5 and 6). The proteins that had remained on the resin then were eluted with 250 mM imidazole (lanes 7 and 8). Eluted proteins were precipitated with trichloroacetic acid, separated on an SDS–10% polyacrylamide gel, and visualized by Coomassie blue staining (top) or transferred to nitrocellulose and immunodetected with an antiserum (α) against DnaK using enhanced chemiluminescence (bottom).

    Techniques Used: Transformation Assay, Plasmid Preparation, Expressing, Incubation, Western Blot, Binding Assay, Staining

    21) Product Images from "Characterization of the Bacillus subtilis ywtD Gene, Whose Product Is Involved in ?-Polyglutamic Acid Degradation"

    Article Title: Characterization of the Bacillus subtilis ywtD Gene, Whose Product Is Involved in ?-Polyglutamic Acid Degradation

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.185.7.2379-2382.2003

    SDS-PAGE of YwtD produced in E. coli ). The gel was stained with Coomassie brilliant blue R-250. Lane 1, marker proteins; lane 2, cell extracts without IPTG induction; lane 3, cell extracts with 0.5 mM IPTG induction; lane 4, purified YwtD after nickel-nitrilotriacetic acid column chromatography.
    Figure Legend Snippet: SDS-PAGE of YwtD produced in E. coli ). The gel was stained with Coomassie brilliant blue R-250. Lane 1, marker proteins; lane 2, cell extracts without IPTG induction; lane 3, cell extracts with 0.5 mM IPTG induction; lane 4, purified YwtD after nickel-nitrilotriacetic acid column chromatography.

    Techniques Used: SDS Page, Produced, Staining, Marker, Purification, Column Chromatography

    22) Product Images from "Abscisic Acid-Induced Transcription Is Mediated by Phosphorylation of an Abscisic Acid Response Element Binding Factor, TRAB1"

    Article Title: Abscisic Acid-Induced Transcription Is Mediated by Phosphorylation of an Abscisic Acid Response Element Binding Factor, TRAB1

    Journal: The Plant Cell

    doi: 10.1105/tpc.005272

    Mobility Shift of TRAB1 on SDS-PAGE Caused by ABA-Induced Phosphorylation. (A) Nuclear extracts of rice suspension-cultured cells (Oc cells) treated with ABA for the indicated times (0 indicates untreated cells) were analyzed by immunoblotting with anti-TRAB1 antibody. The arrow and asterisks indicate TRAB1-specific and nonspecific bands, respectively. Although the expression of the nonspecific bands was affected by ABA, the nature of these polypeptides is unknown. (B) TRAB1-dHA/His expressed in transgenic cells treated without (−) or with (+) ABA for 30 min was recovered with nickel–nitrilotriacetic acid agarose resin, incubated without (−) or with (+) CIAP, and analyzed by immunoblotting with anti-HA antibody. The signals seen at the top of the +CIAP lanes are parts of bulky CIAP bands that reacted nonspecifically with the anti-HA antibody.
    Figure Legend Snippet: Mobility Shift of TRAB1 on SDS-PAGE Caused by ABA-Induced Phosphorylation. (A) Nuclear extracts of rice suspension-cultured cells (Oc cells) treated with ABA for the indicated times (0 indicates untreated cells) were analyzed by immunoblotting with anti-TRAB1 antibody. The arrow and asterisks indicate TRAB1-specific and nonspecific bands, respectively. Although the expression of the nonspecific bands was affected by ABA, the nature of these polypeptides is unknown. (B) TRAB1-dHA/His expressed in transgenic cells treated without (−) or with (+) ABA for 30 min was recovered with nickel–nitrilotriacetic acid agarose resin, incubated without (−) or with (+) CIAP, and analyzed by immunoblotting with anti-HA antibody. The signals seen at the top of the +CIAP lanes are parts of bulky CIAP bands that reacted nonspecifically with the anti-HA antibody.

    Techniques Used: Mobility Shift, SDS Page, Cell Culture, Expressing, Transgenic Assay, Incubation

    23) Product Images from "Adenosine Kinase Is Inactivated by Geminivirus AL2 and L2 Proteins"

    Article Title: Adenosine Kinase Is Inactivated by Geminivirus AL2 and L2 Proteins

    Journal: The Plant Cell

    doi: 10.1105/tpc.015180

    ADK Expression and in Vitro Activity. His-tagged ADK, the indicated ADK deletion derivatives, and CAT were expressed in E. coli BL21 cells and partially purified using nickel–nitrilotriacetic acid agarose resin. (A) Coomassie blue–stained polyacrylamide gel showing the partially purified proteins. ADK protein concentrations were estimated by comparing band intensities with BSA standards. (B) Immunoblot of the same gel probed with anti-His tag antibody (anti-his tag). (C) Demonstration of in vitro ADK activity. Reactions contained the substrates adenosine and ATP with 10 to 70 ng of ADK. Products were resolved by thin layer chromatography. An autoradiograph is shown. Control ATP, ADP, AMP, and adenosine (spotted individually at right) were visualized with UV light.
    Figure Legend Snippet: ADK Expression and in Vitro Activity. His-tagged ADK, the indicated ADK deletion derivatives, and CAT were expressed in E. coli BL21 cells and partially purified using nickel–nitrilotriacetic acid agarose resin. (A) Coomassie blue–stained polyacrylamide gel showing the partially purified proteins. ADK protein concentrations were estimated by comparing band intensities with BSA standards. (B) Immunoblot of the same gel probed with anti-His tag antibody (anti-his tag). (C) Demonstration of in vitro ADK activity. Reactions contained the substrates adenosine and ATP with 10 to 70 ng of ADK. Products were resolved by thin layer chromatography. An autoradiograph is shown. Control ATP, ADP, AMP, and adenosine (spotted individually at right) were visualized with UV light.

    Techniques Used: Expressing, In Vitro, Activity Assay, Purification, Staining, Thin Layer Chromatography, Autoradiography

    24) Product Images from "Oligomeric Structure and Functional Characterization of Caenorhabditis elegans Innexin-6 Gap Junction Protein *"

    Article Title: Oligomeric Structure and Functional Characterization of Caenorhabditis elegans Innexin-6 Gap Junction Protein *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M112.428383

    SDS-PAGE and Western blots of INX-6-His channels. The Coomassie Brilliant Blue-stained gel ( lanes 1 and 2 ) and corresponding Western blots probed with anti-His antibody ( lanes 3 and 4 ) are shown. Isolated membranes ( lanes 1 and 3 ) and eluate from nickel-nitrilotriacetic
    Figure Legend Snippet: SDS-PAGE and Western blots of INX-6-His channels. The Coomassie Brilliant Blue-stained gel ( lanes 1 and 2 ) and corresponding Western blots probed with anti-His antibody ( lanes 3 and 4 ) are shown. Isolated membranes ( lanes 1 and 3 ) and eluate from nickel-nitrilotriacetic

    Techniques Used: SDS Page, Western Blot, Staining, Isolation

    25) Product Images from "Abscisic Acid-Induced Transcription Is Mediated by Phosphorylation of an Abscisic Acid Response Element Binding Factor, TRAB1"

    Article Title: Abscisic Acid-Induced Transcription Is Mediated by Phosphorylation of an Abscisic Acid Response Element Binding Factor, TRAB1

    Journal: The Plant Cell

    doi: 10.1105/tpc.005272

    Mobility Shift of TRAB1 on SDS-PAGE Caused by ABA-Induced Phosphorylation. (A) Nuclear extracts of rice suspension-cultured cells (Oc cells) treated with ABA for the indicated times (0 indicates untreated cells) were analyzed by immunoblotting with anti-TRAB1 antibody. The arrow and asterisks indicate TRAB1-specific and nonspecific bands, respectively. Although the expression of the nonspecific bands was affected by ABA, the nature of these polypeptides is unknown. (B) TRAB1-dHA/His expressed in transgenic cells treated without (−) or with (+) ABA for 30 min was recovered with nickel–nitrilotriacetic acid agarose resin, incubated without (−) or with (+) CIAP, and analyzed by immunoblotting with anti-HA antibody. The signals seen at the top of the +CIAP lanes are parts of bulky CIAP bands that reacted nonspecifically with the anti-HA antibody.
    Figure Legend Snippet: Mobility Shift of TRAB1 on SDS-PAGE Caused by ABA-Induced Phosphorylation. (A) Nuclear extracts of rice suspension-cultured cells (Oc cells) treated with ABA for the indicated times (0 indicates untreated cells) were analyzed by immunoblotting with anti-TRAB1 antibody. The arrow and asterisks indicate TRAB1-specific and nonspecific bands, respectively. Although the expression of the nonspecific bands was affected by ABA, the nature of these polypeptides is unknown. (B) TRAB1-dHA/His expressed in transgenic cells treated without (−) or with (+) ABA for 30 min was recovered with nickel–nitrilotriacetic acid agarose resin, incubated without (−) or with (+) CIAP, and analyzed by immunoblotting with anti-HA antibody. The signals seen at the top of the +CIAP lanes are parts of bulky CIAP bands that reacted nonspecifically with the anti-HA antibody.

    Techniques Used: Mobility Shift, SDS Page, Cell Culture, Expressing, Transgenic Assay, Incubation

    26) Product Images from "FANCI Binds Branched DNA and Is Monoubiquitinated by UBE2T-FANCL *"

    Article Title: FANCI Binds Branched DNA and Is Monoubiquitinated by UBE2T-FANCL *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.C109.038075

    FANCI purification and demonstration of its DNA binding activity. A , FANCI purification scheme. Nickel-NTA , nickel-nitrilotriacetic acid. B , Coomassie Blue-stained gel of FANCI and the FANCI K523R mutant. M , molecular mass markers. C , FANCI was tested for binding to pairs of DNA substrates. The percentage of the DNA probes shifted by FANCI is quantified and shown in the right panels. D , H3 was tested in competition with dsDNA H3/H4 (H3 annealed to its complement H4) for FANCI binding. The right panel shows the quantification of the results. In C and D , 0.3 pmol of each DNA substrate was used. Note that treatment of nucleoprotein complexes with SDS and proteinase K ( SDS + PK ) released the DNA substrates. Error bars indicate S.E.
    Figure Legend Snippet: FANCI purification and demonstration of its DNA binding activity. A , FANCI purification scheme. Nickel-NTA , nickel-nitrilotriacetic acid. B , Coomassie Blue-stained gel of FANCI and the FANCI K523R mutant. M , molecular mass markers. C , FANCI was tested for binding to pairs of DNA substrates. The percentage of the DNA probes shifted by FANCI is quantified and shown in the right panels. D , H3 was tested in competition with dsDNA H3/H4 (H3 annealed to its complement H4) for FANCI binding. The right panel shows the quantification of the results. In C and D , 0.3 pmol of each DNA substrate was used. Note that treatment of nucleoprotein complexes with SDS and proteinase K ( SDS + PK ) released the DNA substrates. Error bars indicate S.E.

    Techniques Used: Purification, Binding Assay, Activity Assay, Staining, Mutagenesis

    27) Product Images from "A Cysteine-Rich Extracellular Protein, LAT52, Interacts with the Extracellular Domain of the Pollen Receptor Kinase LePRK2 W⃞"

    Article Title: A Cysteine-Rich Extracellular Protein, LAT52, Interacts with the Extracellular Domain of the Pollen Receptor Kinase LePRK2 W⃞

    Journal: The Plant Cell

    doi: 10.1105/tpc.003103

    The Extracellular Domain of LePRK2 Is Sufficient for Interaction with LAT52. (A) Expression and purification of the extracellular domain of LePRK2 fused with a His tag (His-ECD2). His-ECD2 protein was expressed and purified by nickel–nitrilotriacetic acid agarose and separated by SDS-PAGE. Gels were stained with Coomassie blue (CB stained) or immunoblotted (IB) with anti-His or anti-LePRK2 antibody. His-ECD2 was used in the subsequent semi-in vivo coimmunoprecipitation assays. (B) Subcellular location of LAT52 and LePRK2. Immunoblots of soluble (S 100 ) or membrane-associated (P 100 ) fractions of mature pollen extracts are shown. The S 100 fraction was used in the subsequent semi-in vivo coimmunoprecipitation assays. (C) Coimmunoprecipitation of LAT52 with either endogenous LePRK2 from mature pollen (MP) extracts (IP LePRK2) or exogenous ECD2 protein (IP His). Lanes 1 and 2, mature pollen extracts (S 10 or S 100 ) were immunoprecipitated with anti-LePRK2 antibody. Lanes 3 and 5, mature pollen extracts (S 10 or S 100 ) were immunoprecipitated with anti-His antibody. Lanes 4, 6, and 9, mature pollen extracts (S 10 or S 100 ) were incubated with 5 μg of purified His-ECD2 protein and immunoprecipitated with anti-His antibody. Immunoprecipitated proteins were subjected to immunoblot analysis with anti-LAT52 antibody. Lane 7, mature pollen extract (S 100 ) as a control. Lane 8, molecular mass marker (MW).
    Figure Legend Snippet: The Extracellular Domain of LePRK2 Is Sufficient for Interaction with LAT52. (A) Expression and purification of the extracellular domain of LePRK2 fused with a His tag (His-ECD2). His-ECD2 protein was expressed and purified by nickel–nitrilotriacetic acid agarose and separated by SDS-PAGE. Gels were stained with Coomassie blue (CB stained) or immunoblotted (IB) with anti-His or anti-LePRK2 antibody. His-ECD2 was used in the subsequent semi-in vivo coimmunoprecipitation assays. (B) Subcellular location of LAT52 and LePRK2. Immunoblots of soluble (S 100 ) or membrane-associated (P 100 ) fractions of mature pollen extracts are shown. The S 100 fraction was used in the subsequent semi-in vivo coimmunoprecipitation assays. (C) Coimmunoprecipitation of LAT52 with either endogenous LePRK2 from mature pollen (MP) extracts (IP LePRK2) or exogenous ECD2 protein (IP His). Lanes 1 and 2, mature pollen extracts (S 10 or S 100 ) were immunoprecipitated with anti-LePRK2 antibody. Lanes 3 and 5, mature pollen extracts (S 10 or S 100 ) were immunoprecipitated with anti-His antibody. Lanes 4, 6, and 9, mature pollen extracts (S 10 or S 100 ) were incubated with 5 μg of purified His-ECD2 protein and immunoprecipitated with anti-His antibody. Immunoprecipitated proteins were subjected to immunoblot analysis with anti-LAT52 antibody. Lane 7, mature pollen extract (S 100 ) as a control. Lane 8, molecular mass marker (MW).

    Techniques Used: Expressing, Purification, SDS Page, Staining, In Vivo, Western Blot, Immunoprecipitation, Incubation, Marker

    Related Articles

    Conditioned Place Preference:

    Article Title: Cell-Penetrating Function of the Poly(ADP-Ribose) (PAR)-Binding Motif Derived from the PAR-Dependent E3 Ubiquitin Ligase Iduna
    Article Snippet: The gene encoding CPP-EGFP was cloned in pRSET-B plasmids, which were then used to transform E. coli BL21 (DE3) pLysS. .. 6His-tagged proteins were incubated with Ni-NTA agarose (Qiagen, Hilden, Germany) for 1 h on the rocker.

    Clone Assay:

    Article Title: Cell-Penetrating Function of the Poly(ADP-Ribose) (PAR)-Binding Motif Derived from the PAR-Dependent E3 Ubiquitin Ligase Iduna
    Article Snippet: The gene encoding CPP-EGFP was cloned in pRSET-B plasmids, which were then used to transform E. coli BL21 (DE3) pLysS. .. 6His-tagged proteins were incubated with Ni-NTA agarose (Qiagen, Hilden, Germany) for 1 h on the rocker.

    Article Title: Arabidopsis PROTEASOME REGULATOR1 is required for auxin-mediated suppression of proteasome activity and regulates auxin signalling
    Article Snippet: The amplified fragment was cloned into the pET-28a(+) vector (Novagen) to generate PTRE1–6 × His-tag construct. .. The cells were lysed by sonication in lysis buffer (50 mM NaH2 PO4 , 300 mM NaCl and 10 mM imidazole, pH 8.0) and PTRE1-His protein was purified using Ni-NTA Agarose (Qiagen) under native conditions.

    Article Title: Flagella-mediated secretion of a novel Vibrio cholerae cytotoxin affecting both vertebrate and invertebrate hosts
    Article Snippet: Paragraph title: Cloning, overexpression, and purification of MakA ... The supernatant was loaded onto a column packed with Ni-NTA agarose (Qiagen).

    Centrifugation:

    Article Title: Nitric Oxide Impairs Normoxic Degradation of HIF-1? by Inhibition of Prolyl Hydroxylases
    Article Snippet: .. Protein of the supernatant, 500 μg, was mixed with 100 μl Ni-NTA-agarose (1:1 resuspended in lysis buffer A) and incubated, while rolling, at room temperature for 1 h. Afterward, beads were pelleted by centrifuging at 1000 × g for 5 min, washed three times with 200 μl lysis buffer A, resuspended in 50 μl 2× sample buffer (125 mM Tris/HCl, 2% SDS, 10% glycerin, 1 mM dithiothreitol (DTT), 0.002% bromophenol blue, pH 6.9) and heated at 95°C for 10 min. Beads were removed by centrifugation. .. Proteins were electrophoretically separated on 7.5% SDS-gels, followed by Western analysis using HIF-1α antibodies.

    Article Title: Cell-Penetrating Function of the Poly(ADP-Ribose) (PAR)-Binding Motif Derived from the PAR-Dependent E3 Ubiquitin Ligase Iduna
    Article Snippet: The suspended pellets were sonicated to disrupt the bacterial membrane, and the soluble fraction was harvested by centrifugation and filtered with a 0.45 µm filter (Sartorious, Gottingen, Germany). .. 6His-tagged proteins were incubated with Ni-NTA agarose (Qiagen, Hilden, Germany) for 1 h on the rocker.

    Amplification:

    Article Title: Arabidopsis PROTEASOME REGULATOR1 is required for auxin-mediated suppression of proteasome activity and regulates auxin signalling
    Article Snippet: The amplified fragment was cloned into the pET-28a(+) vector (Novagen) to generate PTRE1–6 × His-tag construct. .. The cells were lysed by sonication in lysis buffer (50 mM NaH2 PO4 , 300 mM NaCl and 10 mM imidazole, pH 8.0) and PTRE1-His protein was purified using Ni-NTA Agarose (Qiagen) under native conditions.

    Article Title: MAE4, an eLtaS monoclonal antibody, blocks Staphylococcus aureus virulence
    Article Snippet: eLtaS protein expression and purification The eltaS gene was amplified by PCR from the genomic DNA of S. aureus 8325-4 using the primer sequences (forward-EcoRI ) ccggaattctctgaagatgacttaacaaa and (reverse-XhoI ) ccgctcgagttattttttagagtttgctt. .. The fusion protein was purified by Ni-NTA agarose (Qiagen).

    Binding Assay:

    Article Title: Photoexcited CRYPTOCHROME1 Interacts with Dephosphorylated BES1 to Regulate Brassinosteroid Signaling and Photomorphogenesis in Arabidopsis
    Article Snippet: EMSA was performed with 100 ng of His-BES1, His-TF, His-TF-CCT1, or His-TF-CNT1, which was expressed in E. coli , concentrated, and purified with Ni-NTA Agarose (Qiagen) and Amicon Ultra centrifugal filter units (Ultra-4; MWCO:10 kD) (Merck Millipore; catalog no. UFC801024). .. The binding reaction was performed in 20 μL binding buffer [10× binding buffer, 100 mM MgCl2 , 1 µg/μL poly (dI·dC), and 1% Nonidet P-40] with 200 fmol probe and 100 ng His-BES1 protein according to the manufacturer’s instructions (Thermo Scientific) ( ).

    Transduction:

    Article Title: Loss of BAP1 function leads to EZH2-dependent transformation
    Article Snippet: Ubiquitin assays HEK293T cells were seeded in a 10-cm dish and 24 hours later were transduced with 4 μg of a Myc-His-Ubi expression construct and control, 1 μg L3MBTL2 and/or 1–10 μg BAP1-GFP overexpression constructs. .. His-Ubi proteins were purified by incubation by 20 μL of Ni-NTA agarose (Qiagen) for 4 hours at room temperature.

    BIA-KA:

    Article Title: MAE4, an eLtaS monoclonal antibody, blocks Staphylococcus aureus virulence
    Article Snippet: The fusion protein was purified by Ni-NTA agarose (Qiagen). .. Protein concentrations were determined by use of the bicinchoninic acid (BCA) protein assay, and proteins were stored at −70 °C until use.

    Construct:

    Article Title: Arabidopsis PROTEASOME REGULATOR1 is required for auxin-mediated suppression of proteasome activity and regulates auxin signalling
    Article Snippet: After confirmation by sequencing, the construct was transformed into Escherichia coli Rosetta cells, and expression of the fusion protein was induced by adding isopropyl-β-D -thiogalactoside (final concentration 1 mM) at 37 °C. .. The cells were lysed by sonication in lysis buffer (50 mM NaH2 PO4 , 300 mM NaCl and 10 mM imidazole, pH 8.0) and PTRE1-His protein was purified using Ni-NTA Agarose (Qiagen) under native conditions.

    Article Title: Loss of BAP1 function leads to EZH2-dependent transformation
    Article Snippet: Ubiquitin assays HEK293T cells were seeded in a 10-cm dish and 24 hours later were transduced with 4 μg of a Myc-His-Ubi expression construct and control, 1 μg L3MBTL2 and/or 1–10 μg BAP1-GFP overexpression constructs. .. His-Ubi proteins were purified by incubation by 20 μL of Ni-NTA agarose (Qiagen) for 4 hours at room temperature.

    Article Title: Extracellular Superoxide Dismutase Attenuates Renal Oxidative Stress Through the Activation of Adenosine Monophosphate-Activated Protein Kinase in Diabetic Nephropathy
    Article Snippet: .. In brief, 293 cells were transient transfected with SOD3 construct for 48 h. The supernatant was collected and purified using a column containing Ni-NTA agarose (Qiagen, Valencia, CA), followed by dialysis. .. The purified SOD3 activity was measured with an SOD assay kit (Dojindo, Sunnyvale, CA).

    Article Title: Flagella-mediated secretion of a novel Vibrio cholerae cytotoxin affecting both vertebrate and invertebrate hosts
    Article Snippet: The construct was expressed in E. coli BL21(DE3) in LB broth supplemented with 50 μg/mL kanamycin. .. The supernatant was loaded onto a column packed with Ni-NTA agarose (Qiagen).

    Enzyme-linked Immunosorbent Assay:

    Article Title: Arabidopsis PROTEASOME REGULATOR1 is required for auxin-mediated suppression of proteasome activity and regulates auxin signalling
    Article Snippet: The cells were lysed by sonication in lysis buffer (50 mM NaH2 PO4 , 300 mM NaCl and 10 mM imidazole, pH 8.0) and PTRE1-His protein was purified using Ni-NTA Agarose (Qiagen) under native conditions. .. For PTRE1 antibody generation, the purified PTRE1-His (pET-28a-PTRE1) protein was used to immunize rabbits more than three times, and the serum-antibody titre was detected by enzyme-linked immunosorbent assay.

    Incubation:

    Article Title: Cyclic GMP-dependent Stimulation of Serotonin Transport Does Not Involve Direct Transporter Phosphorylation by cGMP-dependent Protein Kinase *
    Article Snippet: Ni-NTA agarose was from Qiagen. .. Briefly, 1 μg of myelin basic protein was incubated with purified p38 MAPK (1–100 ng) in 10 m m HEPES buffer, pH 7.4, containing 0.5 μCi [γ-33 P]ATP, 50 μ m ATP, 5 m m MgCl2 , 0.2 m m EDTA, and 1 m m DTT.

    Article Title: Photoexcited CRYPTOCHROME1 Interacts with Dephosphorylated BES1 to Regulate Brassinosteroid Signaling and Photomorphogenesis in Arabidopsis
    Article Snippet: EMSA was performed with 100 ng of His-BES1, His-TF, His-TF-CCT1, or His-TF-CNT1, which was expressed in E. coli , concentrated, and purified with Ni-NTA Agarose (Qiagen) and Amicon Ultra centrifugal filter units (Ultra-4; MWCO:10 kD) (Merck Millipore; catalog no. UFC801024). .. After 20 min incubation at room temperature, the reactions were resolved by 6% native polyacrylamide gel electrophoresis at 4°C, and the DNA-protein complexes were transferred to a nylon membrane (GE Healthcare).

    Article Title: Nitric Oxide Impairs Normoxic Degradation of HIF-1? by Inhibition of Prolyl Hydroxylases
    Article Snippet: .. Protein of the supernatant, 500 μg, was mixed with 100 μl Ni-NTA-agarose (1:1 resuspended in lysis buffer A) and incubated, while rolling, at room temperature for 1 h. Afterward, beads were pelleted by centrifuging at 1000 × g for 5 min, washed three times with 200 μl lysis buffer A, resuspended in 50 μl 2× sample buffer (125 mM Tris/HCl, 2% SDS, 10% glycerin, 1 mM dithiothreitol (DTT), 0.002% bromophenol blue, pH 6.9) and heated at 95°C for 10 min. Beads were removed by centrifugation. .. Proteins were electrophoretically separated on 7.5% SDS-gels, followed by Western analysis using HIF-1α antibodies.

    Article Title: E2-EPF UCP regulates stability and functions of missense mutant pVHL via ubiquitin mediated proteolysis
    Article Snippet: Subsequently, the membrane was incubated with secondary antibody in PBST containing 0.5 % skim milk for 1 h at RT, and the proteins were visualized using a chemiluminescence kit (Intron). .. The cell lysate was prepared in NET gel buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.1 % NP-40, 1 mM EDTA, pH 8.0) supplemented complete proteinase inhibitor cocktail (Roche), and GST-tagged and His-tagged proteins were pulled-down with the glutathione sepharose beads (GE healthcare) and Ni-NTA agarose (Qiagen).

    Article Title: Cell-Penetrating Function of the Poly(ADP-Ribose) (PAR)-Binding Motif Derived from the PAR-Dependent E3 Ubiquitin Ligase Iduna
    Article Snippet: .. 6His-tagged proteins were incubated with Ni-NTA agarose (Qiagen, Hilden, Germany) for 1 h on the rocker. .. The proteins were applied into Poly-prep column (Bio-Rad, Hercules, CA, USA) and washed with native condition wash buffer (50 mM NaH2 PO4 , 300 mM NaCl, 50 mM Imidazole, pH 8.0) and eluted with native condition elution buffer (50 mM NaH2 PO4 , 300 mM NaCl, 250 mM Imidazole, pH 8.0).

    Article Title: A novel EF-hand protein, CRACR2A, is a cytosolic Ca2+ sensor that stabilizes CRAC channels in T cells
    Article Snippet: .. After sonication and clearing, the supernatant was incubated with Ni-NTA agarose (Qiagen). ..

    Article Title: Loss of BAP1 function leads to EZH2-dependent transformation
    Article Snippet: .. His-Ubi proteins were purified by incubation by 20 μL of Ni-NTA agarose (Qiagen) for 4 hours at room temperature. ..

    Article Title: Flagella-mediated secretion of a novel Vibrio cholerae cytotoxin affecting both vertebrate and invertebrate hosts
    Article Snippet: The supernatant was loaded onto a column packed with Ni-NTA agarose (Qiagen). .. The buffer of the eluate was exchanged by dialysis to lysis buffer and incubated with 1% (w/w) TEV protease overnight.

    Activity Assay:

    Article Title: Cyclic GMP-dependent Stimulation of Serotonin Transport Does Not Involve Direct Transporter Phosphorylation by cGMP-dependent Protein Kinase *
    Article Snippet: Ni-NTA agarose was from Qiagen. .. Kinase activity of the purified p38 MAPK was evaluated by in vitro 33 P labeling of myelin basic protein.

    Article Title: Extracellular Superoxide Dismutase Attenuates Renal Oxidative Stress Through the Activation of Adenosine Monophosphate-Activated Protein Kinase in Diabetic Nephropathy
    Article Snippet: In brief, 293 cells were transient transfected with SOD3 construct for 48 h. The supernatant was collected and purified using a column containing Ni-NTA agarose (Qiagen, Valencia, CA), followed by dialysis. .. The purified SOD3 activity was measured with an SOD assay kit (Dojindo, Sunnyvale, CA).

    Expressing:

    Article Title: Clathrin Coat Disassembly Illuminates the Mechanisms of Hsp70 Force Generation
    Article Snippet: .. CLCA1 was co-expressed with His-tagged CHC as expression of CLCA1 alone led to its degradation, and purified by Ni-NTA agarose as described above. .. Co-purified proteins were incubated at 95°C for 5min to precipitate CHC, which was removed by centrifugation.

    Article Title: Arabidopsis PROTEASOME REGULATOR1 is required for auxin-mediated suppression of proteasome activity and regulates auxin signalling
    Article Snippet: Paragraph title: Recombinant expression of PTRE1 and antibody generation ... The cells were lysed by sonication in lysis buffer (50 mM NaH2 PO4 , 300 mM NaCl and 10 mM imidazole, pH 8.0) and PTRE1-His protein was purified using Ni-NTA Agarose (Qiagen) under native conditions.

    Article Title: A novel EF-hand protein, CRACR2A, is a cytosolic Ca2+ sensor that stabilizes CRAC channels in T cells
    Article Snippet: GST fusion protein expressing transformants were grown in liquid cultures and induced with isopropyl-1-thio-β-D-galactopyranoside (IPTG, 0.2 mM) at 18°C overnight. .. After sonication and clearing, the supernatant was incubated with Ni-NTA agarose (Qiagen).

    Article Title: Loss of BAP1 function leads to EZH2-dependent transformation
    Article Snippet: Ubiquitin assays HEK293T cells were seeded in a 10-cm dish and 24 hours later were transduced with 4 μg of a Myc-His-Ubi expression construct and control, 1 μg L3MBTL2 and/or 1–10 μg BAP1-GFP overexpression constructs. .. His-Ubi proteins were purified by incubation by 20 μL of Ni-NTA agarose (Qiagen) for 4 hours at room temperature.

    Article Title: MAE4, an eLtaS monoclonal antibody, blocks Staphylococcus aureus virulence
    Article Snippet: Paragraph title: eLtaS protein expression and purification ... The fusion protein was purified by Ni-NTA agarose (Qiagen).

    Article Title: Generation of a recombinant Aggregatibacter actinomycetemcomitans RTX toxin in Escherichia coli
    Article Snippet: Overnight Express™ Autoinduction System 1 (Novagen) was found to produce higher levels of the toxin expression than 1 mM IPTG and was therefore used in these studies. .. The toxins purified from the cell lysates on Ni-NTA agarose (Qiagen) typically yield ~20 mg/L per liter of culture.

    Bradford Assay:

    Article Title: Cell-Penetrating Function of the Poly(ADP-Ribose) (PAR)-Binding Motif Derived from the PAR-Dependent E3 Ubiquitin Ligase Iduna
    Article Snippet: 6His-tagged proteins were incubated with Ni-NTA agarose (Qiagen, Hilden, Germany) for 1 h on the rocker. .. Eluted proteins were desalted using a PD-10 Sephadex G-25 column (GE Healthcare, Little Chalfont, UK) and quantified with Bradford assay (Bio-Rad) [ ].

    Transformation Assay:

    Article Title: Arabidopsis PROTEASOME REGULATOR1 is required for auxin-mediated suppression of proteasome activity and regulates auxin signalling
    Article Snippet: After confirmation by sequencing, the construct was transformed into Escherichia coli Rosetta cells, and expression of the fusion protein was induced by adding isopropyl-β-D -thiogalactoside (final concentration 1 mM) at 37 °C. .. The cells were lysed by sonication in lysis buffer (50 mM NaH2 PO4 , 300 mM NaCl and 10 mM imidazole, pH 8.0) and PTRE1-His protein was purified using Ni-NTA Agarose (Qiagen) under native conditions.

    Over Expression:

    Article Title: Loss of BAP1 function leads to EZH2-dependent transformation
    Article Snippet: Ubiquitin assays HEK293T cells were seeded in a 10-cm dish and 24 hours later were transduced with 4 μg of a Myc-His-Ubi expression construct and control, 1 μg L3MBTL2 and/or 1–10 μg BAP1-GFP overexpression constructs. .. His-Ubi proteins were purified by incubation by 20 μL of Ni-NTA agarose (Qiagen) for 4 hours at room temperature.

    Article Title: Flagella-mediated secretion of a novel Vibrio cholerae cytotoxin affecting both vertebrate and invertebrate hosts
    Article Snippet: Paragraph title: Cloning, overexpression, and purification of MakA ... The supernatant was loaded onto a column packed with Ni-NTA agarose (Qiagen).

    Transfection:

    Article Title: Loss of BAP1 function leads to EZH2-dependent transformation
    Article Snippet: Forty-eight hours after the transfection, cells were lysed in a Guanidine HCl based lysis buffer: 6 M guanidine, 0.1 M NaH2 PO4, 10 mM Tris, pH 8.0, and 10 mM BME. .. His-Ubi proteins were purified by incubation by 20 μL of Ni-NTA agarose (Qiagen) for 4 hours at room temperature.

    Article Title: Extracellular Superoxide Dismutase Attenuates Renal Oxidative Stress Through the Activation of Adenosine Monophosphate-Activated Protein Kinase in Diabetic Nephropathy
    Article Snippet: .. In brief, 293 cells were transient transfected with SOD3 construct for 48 h. The supernatant was collected and purified using a column containing Ni-NTA agarose (Qiagen, Valencia, CA), followed by dialysis. .. The purified SOD3 activity was measured with an SOD assay kit (Dojindo, Sunnyvale, CA).

    Protease Inhibitor:

    Article Title: E2-EPF UCP regulates stability and functions of missense mutant pVHL via ubiquitin mediated proteolysis
    Article Snippet: Immunoblot analysis and pull down assay Cells were lysed on ice using RIPA buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.5 mM EDTA, 1 % NP40, 0.1 % SDS, 1 mM PMSF, 1X protease inhibitor) and were separated by 12 % SDS-PAGE. .. The cell lysate was prepared in NET gel buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.1 % NP-40, 1 mM EDTA, pH 8.0) supplemented complete proteinase inhibitor cocktail (Roche), and GST-tagged and His-tagged proteins were pulled-down with the glutathione sepharose beads (GE healthcare) and Ni-NTA agarose (Qiagen).

    Sequencing:

    Article Title: Arabidopsis PROTEASOME REGULATOR1 is required for auxin-mediated suppression of proteasome activity and regulates auxin signalling
    Article Snippet: After confirmation by sequencing, the construct was transformed into Escherichia coli Rosetta cells, and expression of the fusion protein was induced by adding isopropyl-β-D -thiogalactoside (final concentration 1 mM) at 37 °C. .. The cells were lysed by sonication in lysis buffer (50 mM NaH2 PO4 , 300 mM NaCl and 10 mM imidazole, pH 8.0) and PTRE1-His protein was purified using Ni-NTA Agarose (Qiagen) under native conditions.

    Article Title: Flagella-mediated secretion of a novel Vibrio cholerae cytotoxin affecting both vertebrate and invertebrate hosts
    Article Snippet: After cleavage with TEV protease the final protein had the sequence GAMG followed by MakA residues 2–369. .. The supernatant was loaded onto a column packed with Ni-NTA agarose (Qiagen).

    Sonication:

    Article Title: Cell-Penetrating Function of the Poly(ADP-Ribose) (PAR)-Binding Motif Derived from the PAR-Dependent E3 Ubiquitin Ligase Iduna
    Article Snippet: The suspended pellets were sonicated to disrupt the bacterial membrane, and the soluble fraction was harvested by centrifugation and filtered with a 0.45 µm filter (Sartorious, Gottingen, Germany). .. 6His-tagged proteins were incubated with Ni-NTA agarose (Qiagen, Hilden, Germany) for 1 h on the rocker.

    Article Title: Arabidopsis PROTEASOME REGULATOR1 is required for auxin-mediated suppression of proteasome activity and regulates auxin signalling
    Article Snippet: .. The cells were lysed by sonication in lysis buffer (50 mM NaH2 PO4 , 300 mM NaCl and 10 mM imidazole, pH 8.0) and PTRE1-His protein was purified using Ni-NTA Agarose (Qiagen) under native conditions. .. His-tag antibody (cat-M089, 1: 5,000, MBL) was used to confirm the expression of recombinant PTRE1 in E. coli .

    Article Title: A novel EF-hand protein, CRACR2A, is a cytosolic Ca2+ sensor that stabilizes CRAC channels in T cells
    Article Snippet: .. After sonication and clearing, the supernatant was incubated with Ni-NTA agarose (Qiagen). ..

    Article Title: Flagella-mediated secretion of a novel Vibrio cholerae cytotoxin affecting both vertebrate and invertebrate hosts
    Article Snippet: The cell pellet was resuspended in 50 mM Tris-HCl pH 7.6, 0.3 M NaCl and 10 mM imidazole (lysis buffer) supplemented with 1% triton-X100 and sonicated on ice. .. The supernatant was loaded onto a column packed with Ni-NTA agarose (Qiagen).

    Injection:

    Article Title: Extracellular Superoxide Dismutase Attenuates Renal Oxidative Stress Through the Activation of Adenosine Monophosphate-Activated Protein Kinase in Diabetic Nephropathy
    Article Snippet: In brief, 293 cells were transient transfected with SOD3 construct for 48 h. The supernatant was collected and purified using a column containing Ni-NTA agarose (Qiagen, Valencia, CA), followed by dialysis. .. For injection into the mice or treatment in vitro , SOD3 was filtered to eliminate endotoxin.

    Recombinant:

    Article Title: Cell-Penetrating Function of the Poly(ADP-Ribose) (PAR)-Binding Motif Derived from the PAR-Dependent E3 Ubiquitin Ligase Iduna
    Article Snippet: Paragraph title: 4.1. Recombinant Protein Purification ... 6His-tagged proteins were incubated with Ni-NTA agarose (Qiagen, Hilden, Germany) for 1 h on the rocker.

    Article Title: Arabidopsis PROTEASOME REGULATOR1 is required for auxin-mediated suppression of proteasome activity and regulates auxin signalling
    Article Snippet: Paragraph title: Recombinant expression of PTRE1 and antibody generation ... The cells were lysed by sonication in lysis buffer (50 mM NaH2 PO4 , 300 mM NaCl and 10 mM imidazole, pH 8.0) and PTRE1-His protein was purified using Ni-NTA Agarose (Qiagen) under native conditions.

    Article Title: A novel EF-hand protein, CRACR2A, is a cytosolic Ca2+ sensor that stabilizes CRAC channels in T cells
    Article Snippet: Paragraph title: Purification of recombinant proteins from insect cells and E. coli ... After sonication and clearing, the supernatant was incubated with Ni-NTA agarose (Qiagen).

    Article Title: Generation of a recombinant Aggregatibacter actinomycetemcomitans RTX toxin in Escherichia coli
    Article Snippet: Paragraph title: Purification of recombinant toxins ... The toxins purified from the cell lysates on Ni-NTA agarose (Qiagen) typically yield ~20 mg/L per liter of culture.

    Article Title: Extracellular Superoxide Dismutase Attenuates Renal Oxidative Stress Through the Activation of Adenosine Monophosphate-Activated Protein Kinase in Diabetic Nephropathy
    Article Snippet: Paragraph title: Preparation of recombinant EC-SOD ... In brief, 293 cells were transient transfected with SOD3 construct for 48 h. The supernatant was collected and purified using a column containing Ni-NTA agarose (Qiagen, Valencia, CA), followed by dialysis.

    DNA Extraction:

    Article Title: Differential Recognition of Vibrio parahaemolyticus OmpU by Toll-Like Receptors in Monocytes and Macrophages for the Induction of Proinflammatory Responses
    Article Snippet: Plasmid and DNA isolation kits were obtained from Qiagen. .. Ni-NTA agarose was obtained from Qiagen.

    Pull Down Assay:

    Article Title: E2-EPF UCP regulates stability and functions of missense mutant pVHL via ubiquitin mediated proteolysis
    Article Snippet: Paragraph title: Immunoblot analysis and pull down assay ... The cell lysate was prepared in NET gel buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.1 % NP-40, 1 mM EDTA, pH 8.0) supplemented complete proteinase inhibitor cocktail (Roche), and GST-tagged and His-tagged proteins were pulled-down with the glutathione sepharose beads (GE healthcare) and Ni-NTA agarose (Qiagen).

    Mutagenesis:

    Article Title: Flagella-mediated secretion of a novel Vibrio cholerae cytotoxin affecting both vertebrate and invertebrate hosts
    Article Snippet: Since the introduction of an NcoI site in the 5´primer causes a mutation it was designed so that the initial MakA residue, Met, was mutated to Gly keeping the sequence from the second residue intact. .. The supernatant was loaded onto a column packed with Ni-NTA agarose (Qiagen).

    Isolation:

    Article Title: Arabidopsis PROTEASOME REGULATOR1 is required for auxin-mediated suppression of proteasome activity and regulates auxin signalling
    Article Snippet: The cells were lysed by sonication in lysis buffer (50 mM NaH2 PO4 , 300 mM NaCl and 10 mM imidazole, pH 8.0) and PTRE1-His protein was purified using Ni-NTA Agarose (Qiagen) under native conditions. .. The antiserum was collected and isolated to obtain PTRE1 antibody (Abmart).

    Flow Cytometry:

    Article Title: Flagella-mediated secretion of a novel Vibrio cholerae cytotoxin affecting both vertebrate and invertebrate hosts
    Article Snippet: The supernatant was loaded onto a column packed with Ni-NTA agarose (Qiagen). .. The cleaved protein was purified on the Ni-NTA agarose column again and the flow through and wash fractions were concentrated by an Amicon Ultra centrifugal filter device (Millipore).

    Labeling:

    Article Title: Cyclic GMP-dependent Stimulation of Serotonin Transport Does Not Involve Direct Transporter Phosphorylation by cGMP-dependent Protein Kinase *
    Article Snippet: Ni-NTA agarose was from Qiagen. .. Kinase activity of the purified p38 MAPK was evaluated by in vitro 33 P labeling of myelin basic protein.

    Article Title: Photoexcited CRYPTOCHROME1 Interacts with Dephosphorylated BES1 to Regulate Brassinosteroid Signaling and Photomorphogenesis in Arabidopsis
    Article Snippet: EMSA was performed with 100 ng of His-BES1, His-TF, His-TF-CCT1, or His-TF-CNT1, which was expressed in E. coli , concentrated, and purified with Ni-NTA Agarose (Qiagen) and Amicon Ultra centrifugal filter units (Ultra-4; MWCO:10 kD) (Merck Millipore; catalog no. UFC801024). .. Biotin-labeled probes were obtained by synthesizing, annealing, and labeling the probes with biotin, followed by annealing.

    Purification:

    Article Title: Cyclic GMP-dependent Stimulation of Serotonin Transport Does Not Involve Direct Transporter Phosphorylation by cGMP-dependent Protein Kinase *
    Article Snippet: N 6 -benzyl-ADP, N 6 -benzyl-ATP, and purified His-tagged nucleoside diphosphate kinase, prepared as described ( , ), were generous gifts from Dr. A. J. Koleske (Yale University). .. Ni-NTA agarose was from Qiagen.

    Article Title: Photoexcited CRYPTOCHROME1 Interacts with Dephosphorylated BES1 to Regulate Brassinosteroid Signaling and Photomorphogenesis in Arabidopsis
    Article Snippet: .. EMSA was performed with 100 ng of His-BES1, His-TF, His-TF-CCT1, or His-TF-CNT1, which was expressed in E. coli , concentrated, and purified with Ni-NTA Agarose (Qiagen) and Amicon Ultra centrifugal filter units (Ultra-4; MWCO:10 kD) (Merck Millipore; catalog no. UFC801024). .. Biotin-labeled probes were obtained by synthesizing, annealing, and labeling the probes with biotin, followed by annealing.

    Article Title: Clathrin Coat Disassembly Illuminates the Mechanisms of Hsp70 Force Generation
    Article Snippet: .. CLCA1 was co-expressed with His-tagged CHC as expression of CLCA1 alone led to its degradation, and purified by Ni-NTA agarose as described above. .. Co-purified proteins were incubated at 95°C for 5min to precipitate CHC, which was removed by centrifugation.

    Article Title: Arabidopsis PROTEASOME REGULATOR1 is required for auxin-mediated suppression of proteasome activity and regulates auxin signalling
    Article Snippet: .. The cells were lysed by sonication in lysis buffer (50 mM NaH2 PO4 , 300 mM NaCl and 10 mM imidazole, pH 8.0) and PTRE1-His protein was purified using Ni-NTA Agarose (Qiagen) under native conditions. .. His-tag antibody (cat-M089, 1: 5,000, MBL) was used to confirm the expression of recombinant PTRE1 in E. coli .

    Article Title: A novel EF-hand protein, CRACR2A, is a cytosolic Ca2+ sensor that stabilizes CRAC channels in T cells
    Article Snippet: Paragraph title: Purification of recombinant proteins from insect cells and E. coli ... After sonication and clearing, the supernatant was incubated with Ni-NTA agarose (Qiagen).

    Article Title: Loss of BAP1 function leads to EZH2-dependent transformation
    Article Snippet: .. His-Ubi proteins were purified by incubation by 20 μL of Ni-NTA agarose (Qiagen) for 4 hours at room temperature. ..

    Article Title: MAE4, an eLtaS monoclonal antibody, blocks Staphylococcus aureus virulence
    Article Snippet: .. The fusion protein was purified by Ni-NTA agarose (Qiagen). .. Purified eLtaS protein was passed through the pierce high-capacity endotoxin removal resin to remove residual E. coli endotoxins (Thermo Scientific).

    Article Title: Generation of a recombinant Aggregatibacter actinomycetemcomitans RTX toxin in Escherichia coli
    Article Snippet: .. The toxins purified from the cell lysates on Ni-NTA agarose (Qiagen) typically yield ~20 mg/L per liter of culture. .. The toxin was bound to the column at 5 mM imidazole concentration and eluted with 500 mM imidazole. shows batch purification on LtxAREC on Ni-NTA column.

    Article Title: Extracellular Superoxide Dismutase Attenuates Renal Oxidative Stress Through the Activation of Adenosine Monophosphate-Activated Protein Kinase in Diabetic Nephropathy
    Article Snippet: .. In brief, 293 cells were transient transfected with SOD3 construct for 48 h. The supernatant was collected and purified using a column containing Ni-NTA agarose (Qiagen, Valencia, CA), followed by dialysis. .. The purified SOD3 activity was measured with an SOD assay kit (Dojindo, Sunnyvale, CA).

    Article Title: Flagella-mediated secretion of a novel Vibrio cholerae cytotoxin affecting both vertebrate and invertebrate hosts
    Article Snippet: Paragraph title: Cloning, overexpression, and purification of MakA ... The supernatant was loaded onto a column packed with Ni-NTA agarose (Qiagen).

    Protein Purification:

    Article Title: Cell-Penetrating Function of the Poly(ADP-Ribose) (PAR)-Binding Motif Derived from the PAR-Dependent E3 Ubiquitin Ligase Iduna
    Article Snippet: Paragraph title: 4.1. Recombinant Protein Purification ... 6His-tagged proteins were incubated with Ni-NTA agarose (Qiagen, Hilden, Germany) for 1 h on the rocker.

    Polymerase Chain Reaction:

    Article Title: MAE4, an eLtaS monoclonal antibody, blocks Staphylococcus aureus virulence
    Article Snippet: The PCR fragment was subcloned into the expression vector pET-28(a) and expressed in Escherichia coli (BL21) as an N-terminal his-tag fusion protein. .. The fusion protein was purified by Ni-NTA agarose (Qiagen).

    Polyacrylamide Gel Electrophoresis:

    Article Title: Photoexcited CRYPTOCHROME1 Interacts with Dephosphorylated BES1 to Regulate Brassinosteroid Signaling and Photomorphogenesis in Arabidopsis
    Article Snippet: EMSA was performed with 100 ng of His-BES1, His-TF, His-TF-CCT1, or His-TF-CNT1, which was expressed in E. coli , concentrated, and purified with Ni-NTA Agarose (Qiagen) and Amicon Ultra centrifugal filter units (Ultra-4; MWCO:10 kD) (Merck Millipore; catalog no. UFC801024). .. After 20 min incubation at room temperature, the reactions were resolved by 6% native polyacrylamide gel electrophoresis at 4°C, and the DNA-protein complexes were transferred to a nylon membrane (GE Healthcare).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Arabidopsis PROTEASOME REGULATOR1 is required for auxin-mediated suppression of proteasome activity and regulates auxin signalling
    Article Snippet: The cells were lysed by sonication in lysis buffer (50 mM NaH2 PO4 , 300 mM NaCl and 10 mM imidazole, pH 8.0) and PTRE1-His protein was purified using Ni-NTA Agarose (Qiagen) under native conditions. .. His-tag antibody (cat-M089, 1: 5,000, MBL) was used to confirm the expression of recombinant PTRE1 in E. coli .

    Mouse Assay:

    Article Title: Extracellular Superoxide Dismutase Attenuates Renal Oxidative Stress Through the Activation of Adenosine Monophosphate-Activated Protein Kinase in Diabetic Nephropathy
    Article Snippet: In brief, 293 cells were transient transfected with SOD3 construct for 48 h. The supernatant was collected and purified using a column containing Ni-NTA agarose (Qiagen, Valencia, CA), followed by dialysis. .. For injection into the mice or treatment in vitro , SOD3 was filtered to eliminate endotoxin.

    SDS Page:

    Article Title: E2-EPF UCP regulates stability and functions of missense mutant pVHL via ubiquitin mediated proteolysis
    Article Snippet: Immunoblot analysis and pull down assay Cells were lysed on ice using RIPA buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.5 mM EDTA, 1 % NP40, 0.1 % SDS, 1 mM PMSF, 1X protease inhibitor) and were separated by 12 % SDS-PAGE. .. The cell lysate was prepared in NET gel buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.1 % NP-40, 1 mM EDTA, pH 8.0) supplemented complete proteinase inhibitor cocktail (Roche), and GST-tagged and His-tagged proteins were pulled-down with the glutathione sepharose beads (GE healthcare) and Ni-NTA agarose (Qiagen).

    Plasmid Preparation:

    Article Title: Differential Recognition of Vibrio parahaemolyticus OmpU by Toll-Like Receptors in Monocytes and Macrophages for the Induction of Proinflammatory Responses
    Article Snippet: Plasmid and DNA isolation kits were obtained from Qiagen. .. Ni-NTA agarose was obtained from Qiagen.

    Article Title: Arabidopsis PROTEASOME REGULATOR1 is required for auxin-mediated suppression of proteasome activity and regulates auxin signalling
    Article Snippet: The amplified fragment was cloned into the pET-28a(+) vector (Novagen) to generate PTRE1–6 × His-tag construct. .. The cells were lysed by sonication in lysis buffer (50 mM NaH2 PO4 , 300 mM NaCl and 10 mM imidazole, pH 8.0) and PTRE1-His protein was purified using Ni-NTA Agarose (Qiagen) under native conditions.

    Article Title: MAE4, an eLtaS monoclonal antibody, blocks Staphylococcus aureus virulence
    Article Snippet: The PCR fragment was subcloned into the expression vector pET-28(a) and expressed in Escherichia coli (BL21) as an N-terminal his-tag fusion protein. .. The fusion protein was purified by Ni-NTA agarose (Qiagen).

    Positron Emission Tomography:

    Article Title: Arabidopsis PROTEASOME REGULATOR1 is required for auxin-mediated suppression of proteasome activity and regulates auxin signalling
    Article Snippet: The amplified fragment was cloned into the pET-28a(+) vector (Novagen) to generate PTRE1–6 × His-tag construct. .. The cells were lysed by sonication in lysis buffer (50 mM NaH2 PO4 , 300 mM NaCl and 10 mM imidazole, pH 8.0) and PTRE1-His protein was purified using Ni-NTA Agarose (Qiagen) under native conditions.

    Article Title: MAE4, an eLtaS monoclonal antibody, blocks Staphylococcus aureus virulence
    Article Snippet: The PCR fragment was subcloned into the expression vector pET-28(a) and expressed in Escherichia coli (BL21) as an N-terminal his-tag fusion protein. .. The fusion protein was purified by Ni-NTA agarose (Qiagen).

    In Vitro:

    Article Title: Cyclic GMP-dependent Stimulation of Serotonin Transport Does Not Involve Direct Transporter Phosphorylation by cGMP-dependent Protein Kinase *
    Article Snippet: Ni-NTA agarose was from Qiagen. .. Kinase activity of the purified p38 MAPK was evaluated by in vitro 33 P labeling of myelin basic protein.

    Article Title: Extracellular Superoxide Dismutase Attenuates Renal Oxidative Stress Through the Activation of Adenosine Monophosphate-Activated Protein Kinase in Diabetic Nephropathy
    Article Snippet: In brief, 293 cells were transient transfected with SOD3 construct for 48 h. The supernatant was collected and purified using a column containing Ni-NTA agarose (Qiagen, Valencia, CA), followed by dialysis. .. For injection into the mice or treatment in vitro , SOD3 was filtered to eliminate endotoxin.

    Produced:

    Article Title: Generation of a recombinant Aggregatibacter actinomycetemcomitans RTX toxin in Escherichia coli
    Article Snippet: The LtxAREC and proLtxA proteins were produced as double–His6 tag proteins in E. coli BL21(λDE3) cells. .. The toxins purified from the cell lysates on Ni-NTA agarose (Qiagen) typically yield ~20 mg/L per liter of culture.

    Concentration Assay:

    Article Title: Arabidopsis PROTEASOME REGULATOR1 is required for auxin-mediated suppression of proteasome activity and regulates auxin signalling
    Article Snippet: After confirmation by sequencing, the construct was transformed into Escherichia coli Rosetta cells, and expression of the fusion protein was induced by adding isopropyl-β-D -thiogalactoside (final concentration 1 mM) at 37 °C. .. The cells were lysed by sonication in lysis buffer (50 mM NaH2 PO4 , 300 mM NaCl and 10 mM imidazole, pH 8.0) and PTRE1-His protein was purified using Ni-NTA Agarose (Qiagen) under native conditions.

    Article Title: Generation of a recombinant Aggregatibacter actinomycetemcomitans RTX toxin in Escherichia coli
    Article Snippet: The toxins purified from the cell lysates on Ni-NTA agarose (Qiagen) typically yield ~20 mg/L per liter of culture. .. The toxin was bound to the column at 5 mM imidazole concentration and eluted with 500 mM imidazole. shows batch purification on LtxAREC on Ni-NTA column.

    Lysis:

    Article Title: Nitric Oxide Impairs Normoxic Degradation of HIF-1? by Inhibition of Prolyl Hydroxylases
    Article Snippet: .. Protein of the supernatant, 500 μg, was mixed with 100 μl Ni-NTA-agarose (1:1 resuspended in lysis buffer A) and incubated, while rolling, at room temperature for 1 h. Afterward, beads were pelleted by centrifuging at 1000 × g for 5 min, washed three times with 200 μl lysis buffer A, resuspended in 50 μl 2× sample buffer (125 mM Tris/HCl, 2% SDS, 10% glycerin, 1 mM dithiothreitol (DTT), 0.002% bromophenol blue, pH 6.9) and heated at 95°C for 10 min. Beads were removed by centrifugation. .. Proteins were electrophoretically separated on 7.5% SDS-gels, followed by Western analysis using HIF-1α antibodies.

    Article Title: Cell-Penetrating Function of the Poly(ADP-Ribose) (PAR)-Binding Motif Derived from the PAR-Dependent E3 Ubiquitin Ligase Iduna
    Article Snippet: After induction, the culture was centrifuged, and the pellet was suspended in native condition lysis buffer (50 mM NaH2 PO4 , 300 mM NaCl, 20 mM Imidazole, pH 8.0). .. 6His-tagged proteins were incubated with Ni-NTA agarose (Qiagen, Hilden, Germany) for 1 h on the rocker.

    Article Title: Arabidopsis PROTEASOME REGULATOR1 is required for auxin-mediated suppression of proteasome activity and regulates auxin signalling
    Article Snippet: .. The cells were lysed by sonication in lysis buffer (50 mM NaH2 PO4 , 300 mM NaCl and 10 mM imidazole, pH 8.0) and PTRE1-His protein was purified using Ni-NTA Agarose (Qiagen) under native conditions. .. His-tag antibody (cat-M089, 1: 5,000, MBL) was used to confirm the expression of recombinant PTRE1 in E. coli .

    Article Title: A novel EF-hand protein, CRACR2A, is a cytosolic Ca2+ sensor that stabilizes CRAC channels in T cells
    Article Snippet: For 6× His-tagged proteins, cells were harvested and resuspended in lysis buffer (50 mM NaH2 PO4 , 500 mM NaCl, 10% glycerol, 0.5% Triton X-100, and 10 mM Imidazole, pH 8.0). .. After sonication and clearing, the supernatant was incubated with Ni-NTA agarose (Qiagen).

    Article Title: Loss of BAP1 function leads to EZH2-dependent transformation
    Article Snippet: Forty-eight hours after the transfection, cells were lysed in a Guanidine HCl based lysis buffer: 6 M guanidine, 0.1 M NaH2 PO4, 10 mM Tris, pH 8.0, and 10 mM BME. .. His-Ubi proteins were purified by incubation by 20 μL of Ni-NTA agarose (Qiagen) for 4 hours at room temperature.

    Article Title: Cyclic GMP-dependent Stimulation of Serotonin Transport Does Not Involve Direct Transporter Phosphorylation by cGMP-dependent Protein Kinase *
    Article Snippet: .. The supernatant fraction was collected, and His10 -tagged PKG Iα was captured by incubating with 250 μl of Ni-NTA-agarose (50% suspension in lysis buffer) with gentle agitation at 4 °C overnight. ..

    Article Title: Flagella-mediated secretion of a novel Vibrio cholerae cytotoxin affecting both vertebrate and invertebrate hosts
    Article Snippet: The cell pellet was resuspended in 50 mM Tris-HCl pH 7.6, 0.3 M NaCl and 10 mM imidazole (lysis buffer) supplemented with 1% triton-X100 and sonicated on ice. .. The supernatant was loaded onto a column packed with Ni-NTA agarose (Qiagen).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Qiagen ni nta agarose
    Ni Nta Agarose, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 485 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ni nta agarose/product/Qiagen
    Average 90 stars, based on 485 article reviews
    Price from $9.99 to $1999.99
    ni nta agarose - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results