ni nta agarose  (Qiagen)

Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Ni NTA Agarose
    For purification of His tagged proteins by gravity flow chromatography Kit contents Qiagen Ni NTA Agarose 25mL 45 to 165m Bead Up to 50mg mL Binding Capacity Cell Lysate Start Material Nickel charged Resin 2 8psi max Pressure Manual Automated Processing Large Scale Sepharose CL 6B Matrix 100g to 100mg Yield 6xHis tag Affinity Chromatography Purification High Binding Affinity and High Capacity Precharged Ready to use Matrices For Purification of His tagged Proteins by Gravity flow Chromatography Benefits One step purification from crude lysate to 95 pure protein High binding affinity and high capacity Choice of purification under native or denaturing conditions Precharged ready to use matrices for any scale of purification Automated purification and assay protocol
    Catalog Number:
    Ni NTA Agarose
    Buy from Supplier

    Structured Review

    Qiagen ni nta agarose
    Ni NTA Agarose
    For purification of His tagged proteins by gravity flow chromatography Kit contents Qiagen Ni NTA Agarose 25mL 45 to 165m Bead Up to 50mg mL Binding Capacity Cell Lysate Start Material Nickel charged Resin 2 8psi max Pressure Manual Automated Processing Large Scale Sepharose CL 6B Matrix 100g to 100mg Yield 6xHis tag Affinity Chromatography Purification High Binding Affinity and High Capacity Precharged Ready to use Matrices For Purification of His tagged Proteins by Gravity flow Chromatography Benefits One step purification from crude lysate to 95 pure protein High binding affinity and high capacity Choice of purification under native or denaturing conditions Precharged ready to use matrices for any scale of purification Automated purification and assay protocol nta agarose/product/Qiagen
    Average 90 stars, based on 546 article reviews
    Price from $9.99 to $1999.99
    ni nta agarose - by Bioz Stars, 2020-01
    90/100 stars


    1) Product Images from "Cell fate determination by ubiquitin-dependent regulation of translation"

    Article Title: Cell fate determination by ubiquitin-dependent regulation of translation

    Journal: Nature

    doi: 10.1038/nature14978

    CUL3 KBTBD8 monoubiquitylates TCOF1 and NOLC1 a. High-confidence interactors of wt- or mutant KBTBD8. Left: normalized TSCs per interactor of wt-KBTBD8 (sum of 3 biological replicates/condition). Right: heatmap depicting binding relative to wt-KBTBD8. b. Verification of KBTBD8 interactions in 293T cells by αFLAG-immunoprecipitation and Western. c. Immunoprecipitation of KBTBD8 from hESCs (full scans in Supplementary Fig. 1 ). d. Ubiquitylated HA TCOF1 detected after denaturing Ni-NTA purification in 293T cells reconstituted with KBTBD8 variants e. Monoubiquitylation of HA NOLC1 by CUL3 KBTBD8 in 293T cells. f. Monoubiquitylation of endogenous TCOF1 and NOLC1 in 293T cells reconstituted with KBTBD8 variants and HIS ubiquitin L73P .
    Figure Legend Snippet: CUL3 KBTBD8 monoubiquitylates TCOF1 and NOLC1 a. High-confidence interactors of wt- or mutant KBTBD8. Left: normalized TSCs per interactor of wt-KBTBD8 (sum of 3 biological replicates/condition). Right: heatmap depicting binding relative to wt-KBTBD8. b. Verification of KBTBD8 interactions in 293T cells by αFLAG-immunoprecipitation and Western. c. Immunoprecipitation of KBTBD8 from hESCs (full scans in Supplementary Fig. 1 ). d. Ubiquitylated HA TCOF1 detected after denaturing Ni-NTA purification in 293T cells reconstituted with KBTBD8 variants e. Monoubiquitylation of HA NOLC1 by CUL3 KBTBD8 in 293T cells. f. Monoubiquitylation of endogenous TCOF1 and NOLC1 in 293T cells reconstituted with KBTBD8 variants and HIS ubiquitin L73P .

    Techniques Used: Mutagenesis, Binding Assay, Immunoprecipitation, Western Blot, Purification

    2) Product Images from "Identification of DPY19L3 as the C-mannosyltransferase of R-spondin1 in human cells"

    Article Title: Identification of DPY19L3 as the C-mannosyltransferase of R-spondin1 in human cells

    Journal: Molecular Biology of the Cell

    doi: 10.1091/mbc.E15-06-0373

    DPY19L3 is the C -mannosyltransferase of Rspo1 at W 156 . (A, B) Identification of C -mannosyltransferase of Rspo1. Human DPY19L1-L4– or empty vector (mock)–expressing Drosophila S2 cells were transiently transfected with pMT-Rspo1-MH, and protein expression was induced by 200 μM CuSO 4 for 72 h. Rspo1-MH protein was purified by tandem affinity chromatography, heparin–Sepharose, and Ni-NTA agarose. The samples were digested with trypsin and Asp-N, and the resulting peptides were analyzed by LC-MS/MS. Monomannosylated peptide was observed only when the protein was produced in DPY19L3-expressing S2 cells (A). Unmannosylated and monomannosylated peptides derived from DPY19L3-expressing S2 cells were further analyzed by LC-MS/MS. Indicated y ions were detected, and signals resulting from the characteristic cross-ring cleavages were observed at the y 7 and y 8 ions in monomannosylated peptide (B). # W, C -mannosyltryptophan; *C, propionamide cysteine. (C) Effect of C -mannosylation of Rspo1 at W 156 on Wnt signaling–enhancing activity. Recombinant Rspo1 proteins produced by mock- or DPY19L3-transfected S2 cells were purified, and the amounts of proteins were equalized by Western blot (inset). 293T cells were transfected with TOPFlash or FOPFlash in the presence of 10% Wnt3a-conditioned medium and treated with equal amounts of purified Rspo1 proteins. After 24 h, luciferase activities were measured and normalized to Renilla luciferase. C -mannosylated Rspo1 at W 156 (produced by DPY19L3-expressing S2 cells) had increased activity compared with non– C -mannosylated Rspo1 (produced by mock-transfected S2 cells). Data shown are means ± SD. * p
    Figure Legend Snippet: DPY19L3 is the C -mannosyltransferase of Rspo1 at W 156 . (A, B) Identification of C -mannosyltransferase of Rspo1. Human DPY19L1-L4– or empty vector (mock)–expressing Drosophila S2 cells were transiently transfected with pMT-Rspo1-MH, and protein expression was induced by 200 μM CuSO 4 for 72 h. Rspo1-MH protein was purified by tandem affinity chromatography, heparin–Sepharose, and Ni-NTA agarose. The samples were digested with trypsin and Asp-N, and the resulting peptides were analyzed by LC-MS/MS. Monomannosylated peptide was observed only when the protein was produced in DPY19L3-expressing S2 cells (A). Unmannosylated and monomannosylated peptides derived from DPY19L3-expressing S2 cells were further analyzed by LC-MS/MS. Indicated y ions were detected, and signals resulting from the characteristic cross-ring cleavages were observed at the y 7 and y 8 ions in monomannosylated peptide (B). # W, C -mannosyltryptophan; *C, propionamide cysteine. (C) Effect of C -mannosylation of Rspo1 at W 156 on Wnt signaling–enhancing activity. Recombinant Rspo1 proteins produced by mock- or DPY19L3-transfected S2 cells were purified, and the amounts of proteins were equalized by Western blot (inset). 293T cells were transfected with TOPFlash or FOPFlash in the presence of 10% Wnt3a-conditioned medium and treated with equal amounts of purified Rspo1 proteins. After 24 h, luciferase activities were measured and normalized to Renilla luciferase. C -mannosylated Rspo1 at W 156 (produced by DPY19L3-expressing S2 cells) had increased activity compared with non– C -mannosylated Rspo1 (produced by mock-transfected S2 cells). Data shown are means ± SD. * p

    Techniques Used: Plasmid Preparation, Expressing, Transfection, Purification, Affinity Chromatography, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, Produced, Derivative Assay, Activity Assay, Recombinant, Western Blot, Luciferase

    DPY19L3 is the C -mannosyltransferase of Rspo1 at W 156 in human cells. (A) Expression of DPY19 members in HT1080-Rspo1-MH cells. Total RNA was isolated from HT1080-Rspo1-MH cells, and semiquantitative (top) and quantitative (bottom) RT-PCR were performed. Absolute copy number of mRNA transcript/10 ng of total RNA was calculated by quantitative RT-PCR. DPY19L2 expression was lower than the others. (B) Knockdown of DPY19L1, DPY19L3, and DPY19L4. Total RNA was isolated from each cell line, and quantitative RT-PCR was performed. Significant knockdown efficiency was observed for each siRNA against its target gene. (C) DPY19L3 is the C -mannosyltransferase of Rspo1 at W 156 in human cells. HT1080-Rspo1-MH cells were treated with the indicated siRNAs, and conditioned media were collected. Recombinant Rspo1 was purified with Ni-NTA agarose, and the samples were digested with trypsin and Asp-N. The resulting peptides were analyzed by MALDI-TOF MS. siDPY19L3 changed the ratio of two peptides compared with siCtrl: the signal intensity from the dimannosylated peptide at W 153 and W 156 ( m/z = 1919.0) declined, although that of the monomannosylated peptide at W 153 ( m/z = 1756.9) increased. # W, C -mannosyltryptophan; *C, propionamide cysteine. The ratio monomannosylated/dimannosylated Rspo1 was calculated from each peak area.
    Figure Legend Snippet: DPY19L3 is the C -mannosyltransferase of Rspo1 at W 156 in human cells. (A) Expression of DPY19 members in HT1080-Rspo1-MH cells. Total RNA was isolated from HT1080-Rspo1-MH cells, and semiquantitative (top) and quantitative (bottom) RT-PCR were performed. Absolute copy number of mRNA transcript/10 ng of total RNA was calculated by quantitative RT-PCR. DPY19L2 expression was lower than the others. (B) Knockdown of DPY19L1, DPY19L3, and DPY19L4. Total RNA was isolated from each cell line, and quantitative RT-PCR was performed. Significant knockdown efficiency was observed for each siRNA against its target gene. (C) DPY19L3 is the C -mannosyltransferase of Rspo1 at W 156 in human cells. HT1080-Rspo1-MH cells were treated with the indicated siRNAs, and conditioned media were collected. Recombinant Rspo1 was purified with Ni-NTA agarose, and the samples were digested with trypsin and Asp-N. The resulting peptides were analyzed by MALDI-TOF MS. siDPY19L3 changed the ratio of two peptides compared with siCtrl: the signal intensity from the dimannosylated peptide at W 153 and W 156 ( m/z = 1919.0) declined, although that of the monomannosylated peptide at W 153 ( m/z = 1756.9) increased. # W, C -mannosyltryptophan; *C, propionamide cysteine. The ratio monomannosylated/dimannosylated Rspo1 was calculated from each peak area.

    Techniques Used: Expressing, Isolation, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Recombinant, Purification, Mass Spectrometry

    Identification of C -mannosylation sites in Rspo1. (A) Separation of recombinant Rspo1 from the conditioned medium of HT1080-Rspo1-MH cells. Secreted Rspo1-MH was purified with Ni-NTA agarose, and samples were electrophoresed on an SDS–polyacrylamide gel. The gel was visualized with CBB staining. (B–E) Identification of C -mannosylation sites in Rspo1. Samples were digested with trypsin and Asp-N, and the resulting peptides were analyzed by LC-MS/MS. The signal was observed in the chromatogram at m/z = 786.33 (B) and 705.31 (D). The ions at 9.97 min ( m/z = 786.33) and 10.70 min ( m/z =705.31) were further analyzed by LC-MS/MS, respectively (C, E). Indicated y ions were detected, and both W 153 and W 156 (C) or only W 153 (E) of Rspo1 was C -mannosylated. C -mannosylation sites are underlined. *C, propionamide cysteine.
    Figure Legend Snippet: Identification of C -mannosylation sites in Rspo1. (A) Separation of recombinant Rspo1 from the conditioned medium of HT1080-Rspo1-MH cells. Secreted Rspo1-MH was purified with Ni-NTA agarose, and samples were electrophoresed on an SDS–polyacrylamide gel. The gel was visualized with CBB staining. (B–E) Identification of C -mannosylation sites in Rspo1. Samples were digested with trypsin and Asp-N, and the resulting peptides were analyzed by LC-MS/MS. The signal was observed in the chromatogram at m/z = 786.33 (B) and 705.31 (D). The ions at 9.97 min ( m/z = 786.33) and 10.70 min ( m/z =705.31) were further analyzed by LC-MS/MS, respectively (C, E). Indicated y ions were detected, and both W 153 and W 156 (C) or only W 153 (E) of Rspo1 was C -mannosylated. C -mannosylation sites are underlined. *C, propionamide cysteine.

    Techniques Used: Recombinant, Purification, Staining, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry

    3) Product Images from "Puromycin-Sensitive Aminopeptidase: An Antiviral Prodrug Activating Enzyme"

    Article Title: Puromycin-Sensitive Aminopeptidase: An Antiviral Prodrug Activating Enzyme

    Journal: Antiviral research

    doi: 10.1016/j.antiviral.2009.12.003

    Purified recombinant APP-S. Recombinant human APP-S was expressed in BL21-RIPL cells and purified using a Ni-NTA affinity column. APP-S was eluted via cleavage by thrombin between the His-tag and the recombinant APP-S. Following quantification of total
    Figure Legend Snippet: Purified recombinant APP-S. Recombinant human APP-S was expressed in BL21-RIPL cells and purified using a Ni-NTA affinity column. APP-S was eluted via cleavage by thrombin between the His-tag and the recombinant APP-S. Following quantification of total

    Techniques Used: Purification, Recombinant, Affinity Column

    4) Product Images from "Identification of DPY19L3 as the C-mannosyltransferase of R-spondin1 in human cells"

    Article Title: Identification of DPY19L3 as the C-mannosyltransferase of R-spondin1 in human cells

    Journal: Molecular Biology of the Cell

    doi: 10.1091/mbc.E15-06-0373

    DPY19L3 is the C -mannosyltransferase of Rspo1 at W 156 . (A, B) Identification of C -mannosyltransferase of Rspo1. Human DPY19L1-L4– or empty vector (mock)–expressing Drosophila S2 cells were transiently transfected with pMT-Rspo1-MH, and protein expression was induced by 200 μM CuSO 4 for 72 h. Rspo1-MH protein was purified by tandem affinity chromatography, heparin–Sepharose, and Ni-NTA agarose. The samples were digested with trypsin and Asp-N, and the resulting peptides were analyzed by LC-MS/MS. Monomannosylated peptide was observed only when the protein was produced in DPY19L3-expressing S2 cells (A). Unmannosylated and monomannosylated peptides derived from DPY19L3-expressing S2 cells were further analyzed by LC-MS/MS. Indicated y ions were detected, and signals resulting from the characteristic cross-ring cleavages were observed at the y 7 and y 8 ions in monomannosylated peptide (B). # W, C -mannosyltryptophan; *C, propionamide cysteine. (C) Effect of C -mannosylation of Rspo1 at W 156 on Wnt signaling–enhancing activity. Recombinant Rspo1 proteins produced by mock- or DPY19L3-transfected S2 cells were purified, and the amounts of proteins were equalized by Western blot (inset). 293T cells were transfected with TOPFlash or FOPFlash in the presence of 10% Wnt3a-conditioned medium and treated with equal amounts of purified Rspo1 proteins. After 24 h, luciferase activities were measured and normalized to Renilla luciferase. C -mannosylated Rspo1 at W 156 (produced by DPY19L3-expressing S2 cells) had increased activity compared with non– C -mannosylated Rspo1 (produced by mock-transfected S2 cells). Data shown are means ± SD. * p
    Figure Legend Snippet: DPY19L3 is the C -mannosyltransferase of Rspo1 at W 156 . (A, B) Identification of C -mannosyltransferase of Rspo1. Human DPY19L1-L4– or empty vector (mock)–expressing Drosophila S2 cells were transiently transfected with pMT-Rspo1-MH, and protein expression was induced by 200 μM CuSO 4 for 72 h. Rspo1-MH protein was purified by tandem affinity chromatography, heparin–Sepharose, and Ni-NTA agarose. The samples were digested with trypsin and Asp-N, and the resulting peptides were analyzed by LC-MS/MS. Monomannosylated peptide was observed only when the protein was produced in DPY19L3-expressing S2 cells (A). Unmannosylated and monomannosylated peptides derived from DPY19L3-expressing S2 cells were further analyzed by LC-MS/MS. Indicated y ions were detected, and signals resulting from the characteristic cross-ring cleavages were observed at the y 7 and y 8 ions in monomannosylated peptide (B). # W, C -mannosyltryptophan; *C, propionamide cysteine. (C) Effect of C -mannosylation of Rspo1 at W 156 on Wnt signaling–enhancing activity. Recombinant Rspo1 proteins produced by mock- or DPY19L3-transfected S2 cells were purified, and the amounts of proteins were equalized by Western blot (inset). 293T cells were transfected with TOPFlash or FOPFlash in the presence of 10% Wnt3a-conditioned medium and treated with equal amounts of purified Rspo1 proteins. After 24 h, luciferase activities were measured and normalized to Renilla luciferase. C -mannosylated Rspo1 at W 156 (produced by DPY19L3-expressing S2 cells) had increased activity compared with non– C -mannosylated Rspo1 (produced by mock-transfected S2 cells). Data shown are means ± SD. * p

    Techniques Used: Plasmid Preparation, Expressing, Transfection, Purification, Affinity Chromatography, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, Produced, Derivative Assay, Activity Assay, Recombinant, Western Blot, Luciferase

    DPY19L3 is the C -mannosyltransferase of Rspo1 at W 156 in human cells. (A) Expression of DPY19 members in HT1080-Rspo1-MH cells. Total RNA was isolated from HT1080-Rspo1-MH cells, and semiquantitative (top) and quantitative (bottom) RT-PCR were performed. Absolute copy number of mRNA transcript/10 ng of total RNA was calculated by quantitative RT-PCR. DPY19L2 expression was lower than the others. (B) Knockdown of DPY19L1, DPY19L3, and DPY19L4. Total RNA was isolated from each cell line, and quantitative RT-PCR was performed. Significant knockdown efficiency was observed for each siRNA against its target gene. (C) DPY19L3 is the C -mannosyltransferase of Rspo1 at W 156 in human cells. HT1080-Rspo1-MH cells were treated with the indicated siRNAs, and conditioned media were collected. Recombinant Rspo1 was purified with Ni-NTA agarose, and the samples were digested with trypsin and Asp-N. The resulting peptides were analyzed by MALDI-TOF MS. siDPY19L3 changed the ratio of two peptides compared with siCtrl: the signal intensity from the dimannosylated peptide at W 153 and W 156 ( m/z = 1919.0) declined, although that of the monomannosylated peptide at W 153 ( m/z = 1756.9) increased. # W, C -mannosyltryptophan; *C, propionamide cysteine. The ratio monomannosylated/dimannosylated Rspo1 was calculated from each peak area.
    Figure Legend Snippet: DPY19L3 is the C -mannosyltransferase of Rspo1 at W 156 in human cells. (A) Expression of DPY19 members in HT1080-Rspo1-MH cells. Total RNA was isolated from HT1080-Rspo1-MH cells, and semiquantitative (top) and quantitative (bottom) RT-PCR were performed. Absolute copy number of mRNA transcript/10 ng of total RNA was calculated by quantitative RT-PCR. DPY19L2 expression was lower than the others. (B) Knockdown of DPY19L1, DPY19L3, and DPY19L4. Total RNA was isolated from each cell line, and quantitative RT-PCR was performed. Significant knockdown efficiency was observed for each siRNA against its target gene. (C) DPY19L3 is the C -mannosyltransferase of Rspo1 at W 156 in human cells. HT1080-Rspo1-MH cells were treated with the indicated siRNAs, and conditioned media were collected. Recombinant Rspo1 was purified with Ni-NTA agarose, and the samples were digested with trypsin and Asp-N. The resulting peptides were analyzed by MALDI-TOF MS. siDPY19L3 changed the ratio of two peptides compared with siCtrl: the signal intensity from the dimannosylated peptide at W 153 and W 156 ( m/z = 1919.0) declined, although that of the monomannosylated peptide at W 153 ( m/z = 1756.9) increased. # W, C -mannosyltryptophan; *C, propionamide cysteine. The ratio monomannosylated/dimannosylated Rspo1 was calculated from each peak area.

    Techniques Used: Expressing, Isolation, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Recombinant, Purification, Mass Spectrometry

    Identification of C -mannosylation sites in Rspo1. (A) Separation of recombinant Rspo1 from the conditioned medium of HT1080-Rspo1-MH cells. Secreted Rspo1-MH was purified with Ni-NTA agarose, and samples were electrophoresed on an SDS–polyacrylamide gel. The gel was visualized with CBB staining. (B–E) Identification of C -mannosylation sites in Rspo1. Samples were digested with trypsin and Asp-N, and the resulting peptides were analyzed by LC-MS/MS. The signal was observed in the chromatogram at m/z = 786.33 (B) and 705.31 (D). The ions at 9.97 min ( m/z = 786.33) and 10.70 min ( m/z =705.31) were further analyzed by LC-MS/MS, respectively (C, E). Indicated y ions were detected, and both W 153 and W 156 (C) or only W 153 (E) of Rspo1 was C -mannosylated. C -mannosylation sites are underlined. *C, propionamide cysteine.
    Figure Legend Snippet: Identification of C -mannosylation sites in Rspo1. (A) Separation of recombinant Rspo1 from the conditioned medium of HT1080-Rspo1-MH cells. Secreted Rspo1-MH was purified with Ni-NTA agarose, and samples were electrophoresed on an SDS–polyacrylamide gel. The gel was visualized with CBB staining. (B–E) Identification of C -mannosylation sites in Rspo1. Samples were digested with trypsin and Asp-N, and the resulting peptides were analyzed by LC-MS/MS. The signal was observed in the chromatogram at m/z = 786.33 (B) and 705.31 (D). The ions at 9.97 min ( m/z = 786.33) and 10.70 min ( m/z =705.31) were further analyzed by LC-MS/MS, respectively (C, E). Indicated y ions were detected, and both W 153 and W 156 (C) or only W 153 (E) of Rspo1 was C -mannosylated. C -mannosylation sites are underlined. *C, propionamide cysteine.

    Techniques Used: Recombinant, Purification, Staining, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry

    5) Product Images from "Puromycin-Sensitive Aminopeptidase: An Antiviral Prodrug Activating Enzyme"

    Article Title: Puromycin-Sensitive Aminopeptidase: An Antiviral Prodrug Activating Enzyme

    Journal: Antiviral research

    doi: 10.1016/j.antiviral.2009.12.003

    Purified recombinant APP-S. Recombinant human APP-S was expressed in BL21-RIPL cells and purified using a Ni-NTA affinity column. APP-S was eluted via cleavage by thrombin between the His-tag and the recombinant APP-S. Following quantification of total
    Figure Legend Snippet: Purified recombinant APP-S. Recombinant human APP-S was expressed in BL21-RIPL cells and purified using a Ni-NTA affinity column. APP-S was eluted via cleavage by thrombin between the His-tag and the recombinant APP-S. Following quantification of total

    Techniques Used: Purification, Recombinant, Affinity Column

    Related Articles

    Conditioned Place Preference:

    Article Title: Cell-Penetrating Function of the Poly(ADP-Ribose) (PAR)-Binding Motif Derived from the PAR-Dependent E3 Ubiquitin Ligase Iduna
    Article Snippet: The gene encoding CPP-EGFP was cloned in pRSET-B plasmids, which were then used to transform E. coli BL21 (DE3) pLysS. .. 6His-tagged proteins were incubated with Ni-NTA agarose (Qiagen, Hilden, Germany) for 1 h on the rocker.

    Clone Assay:

    Article Title: Cell-Penetrating Function of the Poly(ADP-Ribose) (PAR)-Binding Motif Derived from the PAR-Dependent E3 Ubiquitin Ligase Iduna
    Article Snippet: The gene encoding CPP-EGFP was cloned in pRSET-B plasmids, which were then used to transform E. coli BL21 (DE3) pLysS. .. 6His-tagged proteins were incubated with Ni-NTA agarose (Qiagen, Hilden, Germany) for 1 h on the rocker.

    Article Title: Arabidopsis PROTEASOME REGULATOR1 is required for auxin-mediated suppression of proteasome activity and regulates auxin signalling
    Article Snippet: The amplified fragment was cloned into the pET-28a(+) vector (Novagen) to generate PTRE1–6 × His-tag construct. .. The cells were lysed by sonication in lysis buffer (50 mM NaH2 PO4 , 300 mM NaCl and 10 mM imidazole, pH 8.0) and PTRE1-His protein was purified using Ni-NTA Agarose (Qiagen) under native conditions.

    Article Title: Flagella-mediated secretion of a novel Vibrio cholerae cytotoxin affecting both vertebrate and invertebrate hosts
    Article Snippet: Paragraph title: Cloning, overexpression, and purification of MakA ... The supernatant was loaded onto a column packed with Ni-NTA agarose (Qiagen).


    Article Title: Nitric Oxide Impairs Normoxic Degradation of HIF-1? by Inhibition of Prolyl Hydroxylases
    Article Snippet: .. Protein of the supernatant, 500 μg, was mixed with 100 μl Ni-NTA-agarose (1:1 resuspended in lysis buffer A) and incubated, while rolling, at room temperature for 1 h. Afterward, beads were pelleted by centrifuging at 1000 × g for 5 min, washed three times with 200 μl lysis buffer A, resuspended in 50 μl 2× sample buffer (125 mM Tris/HCl, 2% SDS, 10% glycerin, 1 mM dithiothreitol (DTT), 0.002% bromophenol blue, pH 6.9) and heated at 95°C for 10 min. Beads were removed by centrifugation. .. Proteins were electrophoretically separated on 7.5% SDS-gels, followed by Western analysis using HIF-1α antibodies.

    Article Title: Cell-Penetrating Function of the Poly(ADP-Ribose) (PAR)-Binding Motif Derived from the PAR-Dependent E3 Ubiquitin Ligase Iduna
    Article Snippet: The suspended pellets were sonicated to disrupt the bacterial membrane, and the soluble fraction was harvested by centrifugation and filtered with a 0.45 µm filter (Sartorious, Gottingen, Germany). .. 6His-tagged proteins were incubated with Ni-NTA agarose (Qiagen, Hilden, Germany) for 1 h on the rocker.


    Article Title: Arabidopsis PROTEASOME REGULATOR1 is required for auxin-mediated suppression of proteasome activity and regulates auxin signalling
    Article Snippet: The amplified fragment was cloned into the pET-28a(+) vector (Novagen) to generate PTRE1–6 × His-tag construct. .. The cells were lysed by sonication in lysis buffer (50 mM NaH2 PO4 , 300 mM NaCl and 10 mM imidazole, pH 8.0) and PTRE1-His protein was purified using Ni-NTA Agarose (Qiagen) under native conditions.

    Article Title: MAE4, an eLtaS monoclonal antibody, blocks Staphylococcus aureus virulence
    Article Snippet: eLtaS protein expression and purification The eltaS gene was amplified by PCR from the genomic DNA of S. aureus 8325-4 using the primer sequences (forward-EcoRI ) ccggaattctctgaagatgacttaacaaa and (reverse-XhoI ) ccgctcgagttattttttagagtttgctt. .. The fusion protein was purified by Ni-NTA agarose (Qiagen).

    Binding Assay:

    Article Title: Photoexcited CRYPTOCHROME1 Interacts with Dephosphorylated BES1 to Regulate Brassinosteroid Signaling and Photomorphogenesis in Arabidopsis
    Article Snippet: EMSA was performed with 100 ng of His-BES1, His-TF, His-TF-CCT1, or His-TF-CNT1, which was expressed in E. coli , concentrated, and purified with Ni-NTA Agarose (Qiagen) and Amicon Ultra centrifugal filter units (Ultra-4; MWCO:10 kD) (Merck Millipore; catalog no. UFC801024). .. The binding reaction was performed in 20 μL binding buffer [10× binding buffer, 100 mM MgCl2 , 1 µg/μL poly (dI·dC), and 1% Nonidet P-40] with 200 fmol probe and 100 ng His-BES1 protein according to the manufacturer’s instructions (Thermo Scientific) ( ).


    Article Title: Loss of BAP1 function leads to EZH2-dependent transformation
    Article Snippet: Ubiquitin assays HEK293T cells were seeded in a 10-cm dish and 24 hours later were transduced with 4 μg of a Myc-His-Ubi expression construct and control, 1 μg L3MBTL2 and/or 1–10 μg BAP1-GFP overexpression constructs. .. His-Ubi proteins were purified by incubation by 20 μL of Ni-NTA agarose (Qiagen) for 4 hours at room temperature.


    Article Title: MAE4, an eLtaS monoclonal antibody, blocks Staphylococcus aureus virulence
    Article Snippet: The fusion protein was purified by Ni-NTA agarose (Qiagen). .. Protein concentrations were determined by use of the bicinchoninic acid (BCA) protein assay, and proteins were stored at −70 °C until use.


    Article Title: Arabidopsis PROTEASOME REGULATOR1 is required for auxin-mediated suppression of proteasome activity and regulates auxin signalling
    Article Snippet: After confirmation by sequencing, the construct was transformed into Escherichia coli Rosetta cells, and expression of the fusion protein was induced by adding isopropyl-β-D -thiogalactoside (final concentration 1 mM) at 37 °C. .. The cells were lysed by sonication in lysis buffer (50 mM NaH2 PO4 , 300 mM NaCl and 10 mM imidazole, pH 8.0) and PTRE1-His protein was purified using Ni-NTA Agarose (Qiagen) under native conditions.

    Article Title: Loss of BAP1 function leads to EZH2-dependent transformation
    Article Snippet: Ubiquitin assays HEK293T cells were seeded in a 10-cm dish and 24 hours later were transduced with 4 μg of a Myc-His-Ubi expression construct and control, 1 μg L3MBTL2 and/or 1–10 μg BAP1-GFP overexpression constructs. .. His-Ubi proteins were purified by incubation by 20 μL of Ni-NTA agarose (Qiagen) for 4 hours at room temperature.

    Article Title: Extracellular Superoxide Dismutase Attenuates Renal Oxidative Stress Through the Activation of Adenosine Monophosphate-Activated Protein Kinase in Diabetic Nephropathy
    Article Snippet: .. In brief, 293 cells were transient transfected with SOD3 construct for 48 h. The supernatant was collected and purified using a column containing Ni-NTA agarose (Qiagen, Valencia, CA), followed by dialysis. .. The purified SOD3 activity was measured with an SOD assay kit (Dojindo, Sunnyvale, CA).

    Article Title: Flagella-mediated secretion of a novel Vibrio cholerae cytotoxin affecting both vertebrate and invertebrate hosts
    Article Snippet: The construct was expressed in E. coli BL21(DE3) in LB broth supplemented with 50 μg/mL kanamycin. .. The supernatant was loaded onto a column packed with Ni-NTA agarose (Qiagen).

    Enzyme-linked Immunosorbent Assay:

    Article Title: Arabidopsis PROTEASOME REGULATOR1 is required for auxin-mediated suppression of proteasome activity and regulates auxin signalling
    Article Snippet: The cells were lysed by sonication in lysis buffer (50 mM NaH2 PO4 , 300 mM NaCl and 10 mM imidazole, pH 8.0) and PTRE1-His protein was purified using Ni-NTA Agarose (Qiagen) under native conditions. .. For PTRE1 antibody generation, the purified PTRE1-His (pET-28a-PTRE1) protein was used to immunize rabbits more than three times, and the serum-antibody titre was detected by enzyme-linked immunosorbent assay.


    Article Title: Cyclic GMP-dependent Stimulation of Serotonin Transport Does Not Involve Direct Transporter Phosphorylation by cGMP-dependent Protein Kinase *
    Article Snippet: Ni-NTA agarose was from Qiagen. .. Briefly, 1 μg of myelin basic protein was incubated with purified p38 MAPK (1–100 ng) in 10 m m HEPES buffer, pH 7.4, containing 0.5 μCi [γ-33 P]ATP, 50 μ m ATP, 5 m m MgCl2 , 0.2 m m EDTA, and 1 m m DTT.

    Article Title: Photoexcited CRYPTOCHROME1 Interacts with Dephosphorylated BES1 to Regulate Brassinosteroid Signaling and Photomorphogenesis in Arabidopsis
    Article Snippet: EMSA was performed with 100 ng of His-BES1, His-TF, His-TF-CCT1, or His-TF-CNT1, which was expressed in E. coli , concentrated, and purified with Ni-NTA Agarose (Qiagen) and Amicon Ultra centrifugal filter units (Ultra-4; MWCO:10 kD) (Merck Millipore; catalog no. UFC801024). .. After 20 min incubation at room temperature, the reactions were resolved by 6% native polyacrylamide gel electrophoresis at 4°C, and the DNA-protein complexes were transferred to a nylon membrane (GE Healthcare).

    Article Title: Nitric Oxide Impairs Normoxic Degradation of HIF-1? by Inhibition of Prolyl Hydroxylases
    Article Snippet: .. Protein of the supernatant, 500 μg, was mixed with 100 μl Ni-NTA-agarose (1:1 resuspended in lysis buffer A) and incubated, while rolling, at room temperature for 1 h. Afterward, beads were pelleted by centrifuging at 1000 × g for 5 min, washed three times with 200 μl lysis buffer A, resuspended in 50 μl 2× sample buffer (125 mM Tris/HCl, 2% SDS, 10% glycerin, 1 mM dithiothreitol (DTT), 0.002% bromophenol blue, pH 6.9) and heated at 95°C for 10 min. Beads were removed by centrifugation. .. Proteins were electrophoretically separated on 7.5% SDS-gels, followed by Western analysis using HIF-1α antibodies.

    Article Title: E2-EPF UCP regulates stability and functions of missense mutant pVHL via ubiquitin mediated proteolysis
    Article Snippet: Subsequently, the membrane was incubated with secondary antibody in PBST containing 0.5 % skim milk for 1 h at RT, and the proteins were visualized using a chemiluminescence kit (Intron). .. The cell lysate was prepared in NET gel buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.1 % NP-40, 1 mM EDTA, pH 8.0) supplemented complete proteinase inhibitor cocktail (Roche), and GST-tagged and His-tagged proteins were pulled-down with the glutathione sepharose beads (GE healthcare) and Ni-NTA agarose (Qiagen).

    Article Title: Cell-Penetrating Function of the Poly(ADP-Ribose) (PAR)-Binding Motif Derived from the PAR-Dependent E3 Ubiquitin Ligase Iduna
    Article Snippet: .. 6His-tagged proteins were incubated with Ni-NTA agarose (Qiagen, Hilden, Germany) for 1 h on the rocker. .. The proteins were applied into Poly-prep column (Bio-Rad, Hercules, CA, USA) and washed with native condition wash buffer (50 mM NaH2 PO4 , 300 mM NaCl, 50 mM Imidazole, pH 8.0) and eluted with native condition elution buffer (50 mM NaH2 PO4 , 300 mM NaCl, 250 mM Imidazole, pH 8.0).

    Article Title: A novel EF-hand protein, CRACR2A, is a cytosolic Ca2+ sensor that stabilizes CRAC channels in T cells
    Article Snippet: .. After sonication and clearing, the supernatant was incubated with Ni-NTA agarose (Qiagen). ..

    Article Title: Loss of BAP1 function leads to EZH2-dependent transformation
    Article Snippet: .. His-Ubi proteins were purified by incubation by 20 μL of Ni-NTA agarose (Qiagen) for 4 hours at room temperature. ..

    Article Title: Flagella-mediated secretion of a novel Vibrio cholerae cytotoxin affecting both vertebrate and invertebrate hosts
    Article Snippet: The supernatant was loaded onto a column packed with Ni-NTA agarose (Qiagen). .. The buffer of the eluate was exchanged by dialysis to lysis buffer and incubated with 1% (w/w) TEV protease overnight.

    Activity Assay:

    Article Title: Cyclic GMP-dependent Stimulation of Serotonin Transport Does Not Involve Direct Transporter Phosphorylation by cGMP-dependent Protein Kinase *
    Article Snippet: Ni-NTA agarose was from Qiagen. .. Kinase activity of the purified p38 MAPK was evaluated by in vitro 33 P labeling of myelin basic protein.

    Article Title: Extracellular Superoxide Dismutase Attenuates Renal Oxidative Stress Through the Activation of Adenosine Monophosphate-Activated Protein Kinase in Diabetic Nephropathy
    Article Snippet: In brief, 293 cells were transient transfected with SOD3 construct for 48 h. The supernatant was collected and purified using a column containing Ni-NTA agarose (Qiagen, Valencia, CA), followed by dialysis. .. The purified SOD3 activity was measured with an SOD assay kit (Dojindo, Sunnyvale, CA).


    Article Title: Clathrin Coat Disassembly Illuminates the Mechanisms of Hsp70 Force Generation
    Article Snippet: .. CLCA1 was co-expressed with His-tagged CHC as expression of CLCA1 alone led to its degradation, and purified by Ni-NTA agarose as described above. .. Co-purified proteins were incubated at 95°C for 5min to precipitate CHC, which was removed by centrifugation.

    Article Title: Arabidopsis PROTEASOME REGULATOR1 is required for auxin-mediated suppression of proteasome activity and regulates auxin signalling
    Article Snippet: Paragraph title: Recombinant expression of PTRE1 and antibody generation ... The cells were lysed by sonication in lysis buffer (50 mM NaH2 PO4 , 300 mM NaCl and 10 mM imidazole, pH 8.0) and PTRE1-His protein was purified using Ni-NTA Agarose (Qiagen) under native conditions.

    Article Title: A novel EF-hand protein, CRACR2A, is a cytosolic Ca2+ sensor that stabilizes CRAC channels in T cells
    Article Snippet: GST fusion protein expressing transformants were grown in liquid cultures and induced with isopropyl-1-thio-β-D-galactopyranoside (IPTG, 0.2 mM) at 18°C overnight. .. After sonication and clearing, the supernatant was incubated with Ni-NTA agarose (Qiagen).

    Article Title: Loss of BAP1 function leads to EZH2-dependent transformation
    Article Snippet: Ubiquitin assays HEK293T cells were seeded in a 10-cm dish and 24 hours later were transduced with 4 μg of a Myc-His-Ubi expression construct and control, 1 μg L3MBTL2 and/or 1–10 μg BAP1-GFP overexpression constructs. .. His-Ubi proteins were purified by incubation by 20 μL of Ni-NTA agarose (Qiagen) for 4 hours at room temperature.

    Article Title: MAE4, an eLtaS monoclonal antibody, blocks Staphylococcus aureus virulence
    Article Snippet: Paragraph title: eLtaS protein expression and purification ... The fusion protein was purified by Ni-NTA agarose (Qiagen).

    Article Title: Generation of a recombinant Aggregatibacter actinomycetemcomitans RTX toxin in Escherichia coli
    Article Snippet: Overnight Express™ Autoinduction System 1 (Novagen) was found to produce higher levels of the toxin expression than 1 mM IPTG and was therefore used in these studies. .. The toxins purified from the cell lysates on Ni-NTA agarose (Qiagen) typically yield ~20 mg/L per liter of culture.

    Bradford Assay:

    Article Title: Cell-Penetrating Function of the Poly(ADP-Ribose) (PAR)-Binding Motif Derived from the PAR-Dependent E3 Ubiquitin Ligase Iduna
    Article Snippet: 6His-tagged proteins were incubated with Ni-NTA agarose (Qiagen, Hilden, Germany) for 1 h on the rocker. .. Eluted proteins were desalted using a PD-10 Sephadex G-25 column (GE Healthcare, Little Chalfont, UK) and quantified with Bradford assay (Bio-Rad) [ ].

    Transformation Assay:

    Article Title: Arabidopsis PROTEASOME REGULATOR1 is required for auxin-mediated suppression of proteasome activity and regulates auxin signalling
    Article Snippet: After confirmation by sequencing, the construct was transformed into Escherichia coli Rosetta cells, and expression of the fusion protein was induced by adding isopropyl-β-D -thiogalactoside (final concentration 1 mM) at 37 °C. .. The cells were lysed by sonication in lysis buffer (50 mM NaH2 PO4 , 300 mM NaCl and 10 mM imidazole, pH 8.0) and PTRE1-His protein was purified using Ni-NTA Agarose (Qiagen) under native conditions.

    Over Expression:

    Article Title: Loss of BAP1 function leads to EZH2-dependent transformation
    Article Snippet: Ubiquitin assays HEK293T cells were seeded in a 10-cm dish and 24 hours later were transduced with 4 μg of a Myc-His-Ubi expression construct and control, 1 μg L3MBTL2 and/or 1–10 μg BAP1-GFP overexpression constructs. .. His-Ubi proteins were purified by incubation by 20 μL of Ni-NTA agarose (Qiagen) for 4 hours at room temperature.

    Article Title: Flagella-mediated secretion of a novel Vibrio cholerae cytotoxin affecting both vertebrate and invertebrate hosts
    Article Snippet: Paragraph title: Cloning, overexpression, and purification of MakA ... The supernatant was loaded onto a column packed with Ni-NTA agarose (Qiagen).


    Article Title: Loss of BAP1 function leads to EZH2-dependent transformation
    Article Snippet: Forty-eight hours after the transfection, cells were lysed in a Guanidine HCl based lysis buffer: 6 M guanidine, 0.1 M NaH2 PO4, 10 mM Tris, pH 8.0, and 10 mM BME. .. His-Ubi proteins were purified by incubation by 20 μL of Ni-NTA agarose (Qiagen) for 4 hours at room temperature.

    Article Title: Extracellular Superoxide Dismutase Attenuates Renal Oxidative Stress Through the Activation of Adenosine Monophosphate-Activated Protein Kinase in Diabetic Nephropathy
    Article Snippet: .. In brief, 293 cells were transient transfected with SOD3 construct for 48 h. The supernatant was collected and purified using a column containing Ni-NTA agarose (Qiagen, Valencia, CA), followed by dialysis. .. The purified SOD3 activity was measured with an SOD assay kit (Dojindo, Sunnyvale, CA).

    Protease Inhibitor:

    Article Title: E2-EPF UCP regulates stability and functions of missense mutant pVHL via ubiquitin mediated proteolysis
    Article Snippet: Immunoblot analysis and pull down assay Cells were lysed on ice using RIPA buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.5 mM EDTA, 1 % NP40, 0.1 % SDS, 1 mM PMSF, 1X protease inhibitor) and were separated by 12 % SDS-PAGE. .. The cell lysate was prepared in NET gel buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.1 % NP-40, 1 mM EDTA, pH 8.0) supplemented complete proteinase inhibitor cocktail (Roche), and GST-tagged and His-tagged proteins were pulled-down with the glutathione sepharose beads (GE healthcare) and Ni-NTA agarose (Qiagen).


    Article Title: Arabidopsis PROTEASOME REGULATOR1 is required for auxin-mediated suppression of proteasome activity and regulates auxin signalling
    Article Snippet: After confirmation by sequencing, the construct was transformed into Escherichia coli Rosetta cells, and expression of the fusion protein was induced by adding isopropyl-β-D -thiogalactoside (final concentration 1 mM) at 37 °C. .. The cells were lysed by sonication in lysis buffer (50 mM NaH2 PO4 , 300 mM NaCl and 10 mM imidazole, pH 8.0) and PTRE1-His protein was purified using Ni-NTA Agarose (Qiagen) under native conditions.

    Article Title: Flagella-mediated secretion of a novel Vibrio cholerae cytotoxin affecting both vertebrate and invertebrate hosts
    Article Snippet: After cleavage with TEV protease the final protein had the sequence GAMG followed by MakA residues 2–369. .. The supernatant was loaded onto a column packed with Ni-NTA agarose (Qiagen).


    Article Title: Cell-Penetrating Function of the Poly(ADP-Ribose) (PAR)-Binding Motif Derived from the PAR-Dependent E3 Ubiquitin Ligase Iduna
    Article Snippet: The suspended pellets were sonicated to disrupt the bacterial membrane, and the soluble fraction was harvested by centrifugation and filtered with a 0.45 µm filter (Sartorious, Gottingen, Germany). .. 6His-tagged proteins were incubated with Ni-NTA agarose (Qiagen, Hilden, Germany) for 1 h on the rocker.

    Article Title: Arabidopsis PROTEASOME REGULATOR1 is required for auxin-mediated suppression of proteasome activity and regulates auxin signalling
    Article Snippet: .. The cells were lysed by sonication in lysis buffer (50 mM NaH2 PO4 , 300 mM NaCl and 10 mM imidazole, pH 8.0) and PTRE1-His protein was purified using Ni-NTA Agarose (Qiagen) under native conditions. .. His-tag antibody (cat-M089, 1: 5,000, MBL) was used to confirm the expression of recombinant PTRE1 in E. coli .

    Article Title: A novel EF-hand protein, CRACR2A, is a cytosolic Ca2+ sensor that stabilizes CRAC channels in T cells
    Article Snippet: .. After sonication and clearing, the supernatant was incubated with Ni-NTA agarose (Qiagen). ..

    Article Title: Flagella-mediated secretion of a novel Vibrio cholerae cytotoxin affecting both vertebrate and invertebrate hosts
    Article Snippet: The cell pellet was resuspended in 50 mM Tris-HCl pH 7.6, 0.3 M NaCl and 10 mM imidazole (lysis buffer) supplemented with 1% triton-X100 and sonicated on ice. .. The supernatant was loaded onto a column packed with Ni-NTA agarose (Qiagen).


    Article Title: Extracellular Superoxide Dismutase Attenuates Renal Oxidative Stress Through the Activation of Adenosine Monophosphate-Activated Protein Kinase in Diabetic Nephropathy
    Article Snippet: In brief, 293 cells were transient transfected with SOD3 construct for 48 h. The supernatant was collected and purified using a column containing Ni-NTA agarose (Qiagen, Valencia, CA), followed by dialysis. .. For injection into the mice or treatment in vitro , SOD3 was filtered to eliminate endotoxin.


    Article Title: Cell-Penetrating Function of the Poly(ADP-Ribose) (PAR)-Binding Motif Derived from the PAR-Dependent E3 Ubiquitin Ligase Iduna
    Article Snippet: Paragraph title: 4.1. Recombinant Protein Purification ... 6His-tagged proteins were incubated with Ni-NTA agarose (Qiagen, Hilden, Germany) for 1 h on the rocker.

    Article Title: Arabidopsis PROTEASOME REGULATOR1 is required for auxin-mediated suppression of proteasome activity and regulates auxin signalling
    Article Snippet: Paragraph title: Recombinant expression of PTRE1 and antibody generation ... The cells were lysed by sonication in lysis buffer (50 mM NaH2 PO4 , 300 mM NaCl and 10 mM imidazole, pH 8.0) and PTRE1-His protein was purified using Ni-NTA Agarose (Qiagen) under native conditions.

    Article Title: A novel EF-hand protein, CRACR2A, is a cytosolic Ca2+ sensor that stabilizes CRAC channels in T cells
    Article Snippet: Paragraph title: Purification of recombinant proteins from insect cells and E. coli ... After sonication and clearing, the supernatant was incubated with Ni-NTA agarose (Qiagen).

    Article Title: Generation of a recombinant Aggregatibacter actinomycetemcomitans RTX toxin in Escherichia coli
    Article Snippet: Paragraph title: Purification of recombinant toxins ... The toxins purified from the cell lysates on Ni-NTA agarose (Qiagen) typically yield ~20 mg/L per liter of culture.

    Article Title: Extracellular Superoxide Dismutase Attenuates Renal Oxidative Stress Through the Activation of Adenosine Monophosphate-Activated Protein Kinase in Diabetic Nephropathy
    Article Snippet: Paragraph title: Preparation of recombinant EC-SOD ... In brief, 293 cells were transient transfected with SOD3 construct for 48 h. The supernatant was collected and purified using a column containing Ni-NTA agarose (Qiagen, Valencia, CA), followed by dialysis.

    DNA Extraction:

    Article Title: Differential Recognition of Vibrio parahaemolyticus OmpU by Toll-Like Receptors in Monocytes and Macrophages for the Induction of Proinflammatory Responses
    Article Snippet: Plasmid and DNA isolation kits were obtained from Qiagen. .. Ni-NTA agarose was obtained from Qiagen.

    Pull Down Assay:

    Article Title: E2-EPF UCP regulates stability and functions of missense mutant pVHL via ubiquitin mediated proteolysis
    Article Snippet: Paragraph title: Immunoblot analysis and pull down assay ... The cell lysate was prepared in NET gel buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.1 % NP-40, 1 mM EDTA, pH 8.0) supplemented complete proteinase inhibitor cocktail (Roche), and GST-tagged and His-tagged proteins were pulled-down with the glutathione sepharose beads (GE healthcare) and Ni-NTA agarose (Qiagen).


    Article Title: Flagella-mediated secretion of a novel Vibrio cholerae cytotoxin affecting both vertebrate and invertebrate hosts
    Article Snippet: Since the introduction of an NcoI site in the 5´primer causes a mutation it was designed so that the initial MakA residue, Met, was mutated to Gly keeping the sequence from the second residue intact. .. The supernatant was loaded onto a column packed with Ni-NTA agarose (Qiagen).


    Article Title: Arabidopsis PROTEASOME REGULATOR1 is required for auxin-mediated suppression of proteasome activity and regulates auxin signalling
    Article Snippet: The cells were lysed by sonication in lysis buffer (50 mM NaH2 PO4 , 300 mM NaCl and 10 mM imidazole, pH 8.0) and PTRE1-His protein was purified using Ni-NTA Agarose (Qiagen) under native conditions. .. The antiserum was collected and isolated to obtain PTRE1 antibody (Abmart).

    Flow Cytometry:

    Article Title: Flagella-mediated secretion of a novel Vibrio cholerae cytotoxin affecting both vertebrate and invertebrate hosts
    Article Snippet: The supernatant was loaded onto a column packed with Ni-NTA agarose (Qiagen). .. The cleaved protein was purified on the Ni-NTA agarose column again and the flow through and wash fractions were concentrated by an Amicon Ultra centrifugal filter device (Millipore).


    Article Title: Cyclic GMP-dependent Stimulation of Serotonin Transport Does Not Involve Direct Transporter Phosphorylation by cGMP-dependent Protein Kinase *
    Article Snippet: Ni-NTA agarose was from Qiagen. .. Kinase activity of the purified p38 MAPK was evaluated by in vitro 33 P labeling of myelin basic protein.

    Article Title: Photoexcited CRYPTOCHROME1 Interacts with Dephosphorylated BES1 to Regulate Brassinosteroid Signaling and Photomorphogenesis in Arabidopsis
    Article Snippet: EMSA was performed with 100 ng of His-BES1, His-TF, His-TF-CCT1, or His-TF-CNT1, which was expressed in E. coli , concentrated, and purified with Ni-NTA Agarose (Qiagen) and Amicon Ultra centrifugal filter units (Ultra-4; MWCO:10 kD) (Merck Millipore; catalog no. UFC801024). .. Biotin-labeled probes were obtained by synthesizing, annealing, and labeling the probes with biotin, followed by annealing.


    Article Title: Cyclic GMP-dependent Stimulation of Serotonin Transport Does Not Involve Direct Transporter Phosphorylation by cGMP-dependent Protein Kinase *
    Article Snippet: N 6 -benzyl-ADP, N 6 -benzyl-ATP, and purified His-tagged nucleoside diphosphate kinase, prepared as described ( , ), were generous gifts from Dr. A. J. Koleske (Yale University). .. Ni-NTA agarose was from Qiagen.

    Article Title: Photoexcited CRYPTOCHROME1 Interacts with Dephosphorylated BES1 to Regulate Brassinosteroid Signaling and Photomorphogenesis in Arabidopsis
    Article Snippet: .. EMSA was performed with 100 ng of His-BES1, His-TF, His-TF-CCT1, or His-TF-CNT1, which was expressed in E. coli , concentrated, and purified with Ni-NTA Agarose (Qiagen) and Amicon Ultra centrifugal filter units (Ultra-4; MWCO:10 kD) (Merck Millipore; catalog no. UFC801024). .. Biotin-labeled probes were obtained by synthesizing, annealing, and labeling the probes with biotin, followed by annealing.

    Article Title: Clathrin Coat Disassembly Illuminates the Mechanisms of Hsp70 Force Generation
    Article Snippet: .. CLCA1 was co-expressed with His-tagged CHC as expression of CLCA1 alone led to its degradation, and purified by Ni-NTA agarose as described above. .. Co-purified proteins were incubated at 95°C for 5min to precipitate CHC, which was removed by centrifugation.

    Article Title: Arabidopsis PROTEASOME REGULATOR1 is required for auxin-mediated suppression of proteasome activity and regulates auxin signalling
    Article Snippet: .. The cells were lysed by sonication in lysis buffer (50 mM NaH2 PO4 , 300 mM NaCl and 10 mM imidazole, pH 8.0) and PTRE1-His protein was purified using Ni-NTA Agarose (Qiagen) under native conditions. .. His-tag antibody (cat-M089, 1: 5,000, MBL) was used to confirm the expression of recombinant PTRE1 in E. coli .

    Article Title: A novel EF-hand protein, CRACR2A, is a cytosolic Ca2+ sensor that stabilizes CRAC channels in T cells
    Article Snippet: Paragraph title: Purification of recombinant proteins from insect cells and E. coli ... After sonication and clearing, the supernatant was incubated with Ni-NTA agarose (Qiagen).

    Article Title: Loss of BAP1 function leads to EZH2-dependent transformation
    Article Snippet: .. His-Ubi proteins were purified by incubation by 20 μL of Ni-NTA agarose (Qiagen) for 4 hours at room temperature. ..

    Article Title: MAE4, an eLtaS monoclonal antibody, blocks Staphylococcus aureus virulence
    Article Snippet: .. The fusion protein was purified by Ni-NTA agarose (Qiagen). .. Purified eLtaS protein was passed through the pierce high-capacity endotoxin removal resin to remove residual E. coli endotoxins (Thermo Scientific).

    Article Title: Generation of a recombinant Aggregatibacter actinomycetemcomitans RTX toxin in Escherichia coli
    Article Snippet: .. The toxins purified from the cell lysates on Ni-NTA agarose (Qiagen) typically yield ~20 mg/L per liter of culture. .. The toxin was bound to the column at 5 mM imidazole concentration and eluted with 500 mM imidazole. shows batch purification on LtxAREC on Ni-NTA column.

    Article Title: Extracellular Superoxide Dismutase Attenuates Renal Oxidative Stress Through the Activation of Adenosine Monophosphate-Activated Protein Kinase in Diabetic Nephropathy
    Article Snippet: .. In brief, 293 cells were transient transfected with SOD3 construct for 48 h. The supernatant was collected and purified using a column containing Ni-NTA agarose (Qiagen, Valencia, CA), followed by dialysis. .. The purified SOD3 activity was measured with an SOD assay kit (Dojindo, Sunnyvale, CA).

    Article Title: Flagella-mediated secretion of a novel Vibrio cholerae cytotoxin affecting both vertebrate and invertebrate hosts
    Article Snippet: Paragraph title: Cloning, overexpression, and purification of MakA ... The supernatant was loaded onto a column packed with Ni-NTA agarose (Qiagen).

    Protein Purification:

    Article Title: Cell-Penetrating Function of the Poly(ADP-Ribose) (PAR)-Binding Motif Derived from the PAR-Dependent E3 Ubiquitin Ligase Iduna
    Article Snippet: Paragraph title: 4.1. Recombinant Protein Purification ... 6His-tagged proteins were incubated with Ni-NTA agarose (Qiagen, Hilden, Germany) for 1 h on the rocker.

    Polymerase Chain Reaction:

    Article Title: MAE4, an eLtaS monoclonal antibody, blocks Staphylococcus aureus virulence
    Article Snippet: The PCR fragment was subcloned into the expression vector pET-28(a) and expressed in Escherichia coli (BL21) as an N-terminal his-tag fusion protein. .. The fusion protein was purified by Ni-NTA agarose (Qiagen).

    Polyacrylamide Gel Electrophoresis:

    Article Title: Photoexcited CRYPTOCHROME1 Interacts with Dephosphorylated BES1 to Regulate Brassinosteroid Signaling and Photomorphogenesis in Arabidopsis
    Article Snippet: EMSA was performed with 100 ng of His-BES1, His-TF, His-TF-CCT1, or His-TF-CNT1, which was expressed in E. coli , concentrated, and purified with Ni-NTA Agarose (Qiagen) and Amicon Ultra centrifugal filter units (Ultra-4; MWCO:10 kD) (Merck Millipore; catalog no. UFC801024). .. After 20 min incubation at room temperature, the reactions were resolved by 6% native polyacrylamide gel electrophoresis at 4°C, and the DNA-protein complexes were transferred to a nylon membrane (GE Healthcare).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Arabidopsis PROTEASOME REGULATOR1 is required for auxin-mediated suppression of proteasome activity and regulates auxin signalling
    Article Snippet: The cells were lysed by sonication in lysis buffer (50 mM NaH2 PO4 , 300 mM NaCl and 10 mM imidazole, pH 8.0) and PTRE1-His protein was purified using Ni-NTA Agarose (Qiagen) under native conditions. .. His-tag antibody (cat-M089, 1: 5,000, MBL) was used to confirm the expression of recombinant PTRE1 in E. coli .

    Mouse Assay:

    Article Title: Extracellular Superoxide Dismutase Attenuates Renal Oxidative Stress Through the Activation of Adenosine Monophosphate-Activated Protein Kinase in Diabetic Nephropathy
    Article Snippet: In brief, 293 cells were transient transfected with SOD3 construct for 48 h. The supernatant was collected and purified using a column containing Ni-NTA agarose (Qiagen, Valencia, CA), followed by dialysis. .. For injection into the mice or treatment in vitro , SOD3 was filtered to eliminate endotoxin.

    SDS Page:

    Article Title: E2-EPF UCP regulates stability and functions of missense mutant pVHL via ubiquitin mediated proteolysis
    Article Snippet: Immunoblot analysis and pull down assay Cells were lysed on ice using RIPA buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.5 mM EDTA, 1 % NP40, 0.1 % SDS, 1 mM PMSF, 1X protease inhibitor) and were separated by 12 % SDS-PAGE. .. The cell lysate was prepared in NET gel buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.1 % NP-40, 1 mM EDTA, pH 8.0) supplemented complete proteinase inhibitor cocktail (Roche), and GST-tagged and His-tagged proteins were pulled-down with the glutathione sepharose beads (GE healthcare) and Ni-NTA agarose (Qiagen).

    Plasmid Preparation:

    Article Title: Differential Recognition of Vibrio parahaemolyticus OmpU by Toll-Like Receptors in Monocytes and Macrophages for the Induction of Proinflammatory Responses
    Article Snippet: Plasmid and DNA isolation kits were obtained from Qiagen. .. Ni-NTA agarose was obtained from Qiagen.

    Article Title: Arabidopsis PROTEASOME REGULATOR1 is required for auxin-mediated suppression of proteasome activity and regulates auxin signalling
    Article Snippet: The amplified fragment was cloned into the pET-28a(+) vector (Novagen) to generate PTRE1–6 × His-tag construct. .. The cells were lysed by sonication in lysis buffer (50 mM NaH2 PO4 , 300 mM NaCl and 10 mM imidazole, pH 8.0) and PTRE1-His protein was purified using Ni-NTA Agarose (Qiagen) under native conditions.

    Article Title: MAE4, an eLtaS monoclonal antibody, blocks Staphylococcus aureus virulence
    Article Snippet: The PCR fragment was subcloned into the expression vector pET-28(a) and expressed in Escherichia coli (BL21) as an N-terminal his-tag fusion protein. .. The fusion protein was purified by Ni-NTA agarose (Qiagen).

    Positron Emission Tomography:

    Article Title: Arabidopsis PROTEASOME REGULATOR1 is required for auxin-mediated suppression of proteasome activity and regulates auxin signalling
    Article Snippet: The amplified fragment was cloned into the pET-28a(+) vector (Novagen) to generate PTRE1–6 × His-tag construct. .. The cells were lysed by sonication in lysis buffer (50 mM NaH2 PO4 , 300 mM NaCl and 10 mM imidazole, pH 8.0) and PTRE1-His protein was purified using Ni-NTA Agarose (Qiagen) under native conditions.

    Article Title: MAE4, an eLtaS monoclonal antibody, blocks Staphylococcus aureus virulence
    Article Snippet: The PCR fragment was subcloned into the expression vector pET-28(a) and expressed in Escherichia coli (BL21) as an N-terminal his-tag fusion protein. .. The fusion protein was purified by Ni-NTA agarose (Qiagen).

    In Vitro:

    Article Title: Cyclic GMP-dependent Stimulation of Serotonin Transport Does Not Involve Direct Transporter Phosphorylation by cGMP-dependent Protein Kinase *
    Article Snippet: Ni-NTA agarose was from Qiagen. .. Kinase activity of the purified p38 MAPK was evaluated by in vitro 33 P labeling of myelin basic protein.

    Article Title: Extracellular Superoxide Dismutase Attenuates Renal Oxidative Stress Through the Activation of Adenosine Monophosphate-Activated Protein Kinase in Diabetic Nephropathy
    Article Snippet: In brief, 293 cells were transient transfected with SOD3 construct for 48 h. The supernatant was collected and purified using a column containing Ni-NTA agarose (Qiagen, Valencia, CA), followed by dialysis. .. For injection into the mice or treatment in vitro , SOD3 was filtered to eliminate endotoxin.


    Article Title: Generation of a recombinant Aggregatibacter actinomycetemcomitans RTX toxin in Escherichia coli
    Article Snippet: The LtxAREC and proLtxA proteins were produced as double–His6 tag proteins in E. coli BL21(λDE3) cells. .. The toxins purified from the cell lysates on Ni-NTA agarose (Qiagen) typically yield ~20 mg/L per liter of culture.

    Concentration Assay:

    Article Title: Arabidopsis PROTEASOME REGULATOR1 is required for auxin-mediated suppression of proteasome activity and regulates auxin signalling
    Article Snippet: After confirmation by sequencing, the construct was transformed into Escherichia coli Rosetta cells, and expression of the fusion protein was induced by adding isopropyl-β-D -thiogalactoside (final concentration 1 mM) at 37 °C. .. The cells were lysed by sonication in lysis buffer (50 mM NaH2 PO4 , 300 mM NaCl and 10 mM imidazole, pH 8.0) and PTRE1-His protein was purified using Ni-NTA Agarose (Qiagen) under native conditions.

    Article Title: Generation of a recombinant Aggregatibacter actinomycetemcomitans RTX toxin in Escherichia coli
    Article Snippet: The toxins purified from the cell lysates on Ni-NTA agarose (Qiagen) typically yield ~20 mg/L per liter of culture. .. The toxin was bound to the column at 5 mM imidazole concentration and eluted with 500 mM imidazole. shows batch purification on LtxAREC on Ni-NTA column.


    Article Title: Nitric Oxide Impairs Normoxic Degradation of HIF-1? by Inhibition of Prolyl Hydroxylases
    Article Snippet: .. Protein of the supernatant, 500 μg, was mixed with 100 μl Ni-NTA-agarose (1:1 resuspended in lysis buffer A) and incubated, while rolling, at room temperature for 1 h. Afterward, beads were pelleted by centrifuging at 1000 × g for 5 min, washed three times with 200 μl lysis buffer A, resuspended in 50 μl 2× sample buffer (125 mM Tris/HCl, 2% SDS, 10% glycerin, 1 mM dithiothreitol (DTT), 0.002% bromophenol blue, pH 6.9) and heated at 95°C for 10 min. Beads were removed by centrifugation. .. Proteins were electrophoretically separated on 7.5% SDS-gels, followed by Western analysis using HIF-1α antibodies.

    Article Title: Cell-Penetrating Function of the Poly(ADP-Ribose) (PAR)-Binding Motif Derived from the PAR-Dependent E3 Ubiquitin Ligase Iduna
    Article Snippet: After induction, the culture was centrifuged, and the pellet was suspended in native condition lysis buffer (50 mM NaH2 PO4 , 300 mM NaCl, 20 mM Imidazole, pH 8.0). .. 6His-tagged proteins were incubated with Ni-NTA agarose (Qiagen, Hilden, Germany) for 1 h on the rocker.

    Article Title: Arabidopsis PROTEASOME REGULATOR1 is required for auxin-mediated suppression of proteasome activity and regulates auxin signalling
    Article Snippet: .. The cells were lysed by sonication in lysis buffer (50 mM NaH2 PO4 , 300 mM NaCl and 10 mM imidazole, pH 8.0) and PTRE1-His protein was purified using Ni-NTA Agarose (Qiagen) under native conditions. .. His-tag antibody (cat-M089, 1: 5,000, MBL) was used to confirm the expression of recombinant PTRE1 in E. coli .

    Article Title: A novel EF-hand protein, CRACR2A, is a cytosolic Ca2+ sensor that stabilizes CRAC channels in T cells
    Article Snippet: For 6× His-tagged proteins, cells were harvested and resuspended in lysis buffer (50 mM NaH2 PO4 , 500 mM NaCl, 10% glycerol, 0.5% Triton X-100, and 10 mM Imidazole, pH 8.0). .. After sonication and clearing, the supernatant was incubated with Ni-NTA agarose (Qiagen).

    Article Title: Loss of BAP1 function leads to EZH2-dependent transformation
    Article Snippet: Forty-eight hours after the transfection, cells were lysed in a Guanidine HCl based lysis buffer: 6 M guanidine, 0.1 M NaH2 PO4, 10 mM Tris, pH 8.0, and 10 mM BME. .. His-Ubi proteins were purified by incubation by 20 μL of Ni-NTA agarose (Qiagen) for 4 hours at room temperature.

    Article Title: Cyclic GMP-dependent Stimulation of Serotonin Transport Does Not Involve Direct Transporter Phosphorylation by cGMP-dependent Protein Kinase *
    Article Snippet: .. The supernatant fraction was collected, and His10 -tagged PKG Iα was captured by incubating with 250 μl of Ni-NTA-agarose (50% suspension in lysis buffer) with gentle agitation at 4 °C overnight. ..

    Article Title: Flagella-mediated secretion of a novel Vibrio cholerae cytotoxin affecting both vertebrate and invertebrate hosts
    Article Snippet: The cell pellet was resuspended in 50 mM Tris-HCl pH 7.6, 0.3 M NaCl and 10 mM imidazole (lysis buffer) supplemented with 1% triton-X100 and sonicated on ice. .. The supernatant was loaded onto a column packed with Ni-NTA agarose (Qiagen).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Qiagen ni nta agarose
    Ni Nta Agarose, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 485 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more nta agarose/product/Qiagen
    Average 90 stars, based on 485 article reviews
    Price from $9.99 to $1999.99
    ni nta agarose - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results