nebuffer 2  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    NEBuffer 2
    Description:
    NEBuffer 2 5 0 ml
    Catalog Number:
    b7002s
    Price:
    24
    Size:
    5 0 ml
    Category:
    Buffers
    Buy from Supplier


    Structured Review

    New England Biolabs nebuffer 2
    NEBuffer 2
    NEBuffer 2 5 0 ml
    https://www.bioz.com/result/nebuffer 2/product/New England Biolabs
    Average 99 stars, based on 17 article reviews
    Price from $9.99 to $1999.99
    nebuffer 2 - by Bioz Stars, 2020-07
    99/100 stars

    Images

    Related Articles

    Ligation:

    Article Title: Development of an Illumina-based ChIP-exonuclease method provides insight into FoxA1-DNA binding properties
    Article Snippet: .. The beads then undergo five successive incubations in a 2 mL tube agitated at 900 rpm in a thermomixer as followed: 1) End polishing: 1 mM ATP, 100 uM dNTP, 15 U T4 DNA polymerase, 5 U Klenow DNA polymerase, 50 U T4 PolyNucleotide Kinase, in 100 uL 1× NEBuffer 2 (50 mM NaCl, 10 mM Tris–HCl, 10 mM MgCl2, 1 mM DTT, pH 7.9) at 30°C for 30 min. 2) Ligation of the P7 exo-adapter: 1 mM ATP, 150 pmol P7 exo-adapter, 2000 U T4 DNA ligase, in 100 uL 1× NEBuffer 2 at 25°C for 60 min. 3) Nick repair: 150 uM dNTP, 15 U phi29 DNA polymerase in 100 uL 1× phi29 reaction buffer (50 mM Tris–HCl pH 7.5, 10 mM MgCl2, 10 mM (NH4)2SO4, 1 mM DTT, pH 7.5) at 30°C for 20 min. 4) Lambda exonuclease digestion: 10 U Lambda exonuclease in 100 uL 1× NEB Lambda exonuclease buffer (67 mM Glycine-KOH, 2.5 mM MgCl2, 50 μg/mL BSA, pH 9.4) at 37°C for 30 min. 5) RecJf exonuclease digestion: 30 U RecJf exonuclease in 100 uL NEBuffer 2 at 37°C for 30 min. .. The beads are washed two times in 1 mL RIPA buffer and two times in 1 mL Tris HCl pH 8 after every incubation.

    Random Hexamer Labeling:

    Article Title: miR-206 knockout shows it is critical for myogenesis and directly regulates newly identified target mRNAs.
    Article Snippet: .. Second strand cDNA was prepared by incubating 0.5 µM dNTPs, 1 µM Illumina-compatible random hexamer primer (5’-TCCCTACACGACGCTCTTCCGATCTNNNNNN-3’), and 0.15 U Klenow Ac ce pte d M an us cri pt Fragment (3’5’ exo-) (NEB) in 1X NEBuffer 2 at 37°C for 30 minutes (cite). .. Double stranded DNA was purified using the E.Z.N.A Cycle-Pure Kit (Omega Bio-Tek) then PCR amplified for 13 cycles using 200 µM dNTPs, 240 µM TruSeq Indexed Adapters (AD001; AD003; AD008; AD009), 240 µM TruSeq Universal Adapter (5’- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT3’) and 0.025 U Taq DNA Polymerase (NEB) in 1X Standard Taq Reaction Buffer (NEB).

    Incubation:

    Article Title: Identifying cis elements for spatio-temporal control of mammalian DNA replication
    Article Snippet: .. Hi-C libraries were divided into 8 tubes, and 5μg of Hi-C library with 0.5μl 10 mg/ml BSA, 5μl 10× NEBuffer 2, 2μl 2.5mM dATP, and 5μl T4 DNA polymerase (NEB M0203L) were added and incubated at 20°C for 4 hours. ..

    other:

    Article Title: A single quantum dot-based nanosensor with multilayer of multiple acceptors for ultrasensitive detection of human alkyladenine DNA glycosylase single quantum dot-based nanosensor with multilayer of multiple acceptors for ultrasensitive detection of human alkyladenine DNA glycosylase †Electronic supplementary information (ESI) available. See DOI: 10.1039/c9sc02137j
    Article Snippet: Human alkyladenine DNA glycosylase (hAAG), human apurinic/apyrimidinic endonuclease 1 (APE1), Klenow fragment (3′ → 5′ exo– ), human 8-oxoguanine-DNA glycosylase 1 (hOGG1), uracil DNA glycosylase (UDG), T4 polynucleotide kinase (PNK), 10× NEBuffer 2 (500 mM NaCl, 100 mM Tris–HCl, 100 mM MgCl2 , 10 mM DTT, pH 7.9), and 10× NEBuffer 4 (500 mM potassium acetate, 200 mM Tris–acetate, 100 mM magnesium acetate, 10 mM DTT, pH 7.9) were purchased from New England Biolabs (Ipswich, MA, USA).

    Polymerase Chain Reaction:

    Article Title: Simplified CRISPR tools for efficient genome editing and streamlined protocols for their delivery into mammalian cells and mouse zygotes
    Article Snippet: .. We prefer to do this in a PCR thermal cycler, using the program: Ramp Rate 1 – 95–85 °C = −2 °C/s Ramp Rate 2 – 85–25 °C = −0.3 °C/s T7EI is diluted by taking 1 μL (10 U/μL stock) and adding 1 μL 10X NEBuffer 2 and 8 μL water. .. Digest heteroduplexes with 2 μL of diluted T7EI (2 U) with incubation at 37 °C for 60 min. Cleavage products can be visualized by agarose gel electrophoresis (or any other method that can separate DNA fragments in this size range).

    Article Title: The Carnivorous Pale Pitcher Plant Harbors Diverse, Distinct, and Time-Dependent Bacterial Communities ▿The Carnivorous Pale Pitcher Plant Harbors Diverse, Distinct, and Time-Dependent Bacterial Communities ▿ †
    Article Snippet: .. Twenty microliters of cleaned PCR product was digested using the restriction enzyme HaeIII (10 μl 10× NEBuffer 2, 0.5 μl HaeIII enzyme [New England Biolabs, Ipswich, MA], 69.5 μl water) for 4 h at 37°C. ..

    Hi-C:

    Article Title: Identifying cis elements for spatio-temporal control of mammalian DNA replication
    Article Snippet: .. Hi-C libraries were divided into 8 tubes, and 5μg of Hi-C library with 0.5μl 10 mg/ml BSA, 5μl 10× NEBuffer 2, 2μl 2.5mM dATP, and 5μl T4 DNA polymerase (NEB M0203L) were added and incubated at 20°C for 4 hours. ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs nebuffer3 1
    Nebuffer3 1, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nebuffer3 1/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    nebuffer3 1 - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs t4 dna polymerase
    T4 Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 107 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 dna polymerase/product/New England Biolabs
    Average 99 stars, based on 107 article reviews
    Price from $9.99 to $1999.99
    t4 dna polymerase - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs nebuffer2
    Nebuffer2, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nebuffer2/product/New England Biolabs
    Average 99 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    nebuffer2 - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    Image Search Results