mrna sequencing  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Name:
    T4 DNA Polymerase
    Description:
    T4 DNA Polymerase 750 units
    Catalog Number:
    m0203l
    Price:
    272
    Size:
    750 units
    Category:
    DNA Polymerases
    Buy from Supplier


    Structured Review

    New England Biolabs mrna sequencing
    T4 DNA Polymerase
    T4 DNA Polymerase 750 units
    https://www.bioz.com/result/mrna sequencing/product/New England Biolabs
    Average 93 stars, based on 1704 article reviews
    Price from $9.99 to $1999.99
    mrna sequencing - by Bioz Stars, 2020-07
    93/100 stars

    Images

    1) Product Images from "A miRNA181a/NFAT5 axis links impaired T cell tolerance induction with autoimmune type 1 diabetes"

    Article Title: A miRNA181a/NFAT5 axis links impaired T cell tolerance induction with autoimmune type 1 diabetes

    Journal: Science translational medicine

    doi: 10.1126/scitranslmed.aag1782

    miRNA181a targets NFAT5 in human CD4 + T cells ( A ) MicroRNA (miRNA) expression profiles in ex vivo CD4 + T cells with an activated phenotype from children with or without autoantibodies by next-generation sequencing (NGS) of pooled samples ( n = 4 per group). A set of most abundant miRNAs relevant for T cell activation and or T reg induction is shown. ( B ) MiRNA181a reads by NGS as in (A) ( n = 4 per group). ( C ) MiRNA181a abundance in ex vivo CD4 + T cells from children with different durations of autoimmunity (no autoimmunity, n = 9; recent onset of autoimmunity, n = 10; long-term autoimmunity, n = 5) by real-time quantitative polymerase chain reaction (RT-qPCR). ( D ) Abundance of signaling intermediates involved in T cell activation in ex vivo CD4 + T cells from autoantibody-negative or autoantibody-positive children by NGS from pooled samples ( n = 4 per group). Open bars, predicted as direct targets of miRNA181a; hatched bars, not predicted as direct targets of miRNA181a. ( E ) Human Nfat5 mRNA abundance in ex vivo CD4 + T cells from individual children with or without islet autoimmunity by RT-qPCR (no autoimmunity, n = 6; recent onset of autoimmunity, n = 7; long-term autoimmunity, n = 6). Data are means ± SEM (B) or are presented as box and whisker plots with minimum to maximum values for data distribution (C and E). * P
    Figure Legend Snippet: miRNA181a targets NFAT5 in human CD4 + T cells ( A ) MicroRNA (miRNA) expression profiles in ex vivo CD4 + T cells with an activated phenotype from children with or without autoantibodies by next-generation sequencing (NGS) of pooled samples ( n = 4 per group). A set of most abundant miRNAs relevant for T cell activation and or T reg induction is shown. ( B ) MiRNA181a reads by NGS as in (A) ( n = 4 per group). ( C ) MiRNA181a abundance in ex vivo CD4 + T cells from children with different durations of autoimmunity (no autoimmunity, n = 9; recent onset of autoimmunity, n = 10; long-term autoimmunity, n = 5) by real-time quantitative polymerase chain reaction (RT-qPCR). ( D ) Abundance of signaling intermediates involved in T cell activation in ex vivo CD4 + T cells from autoantibody-negative or autoantibody-positive children by NGS from pooled samples ( n = 4 per group). Open bars, predicted as direct targets of miRNA181a; hatched bars, not predicted as direct targets of miRNA181a. ( E ) Human Nfat5 mRNA abundance in ex vivo CD4 + T cells from individual children with or without islet autoimmunity by RT-qPCR (no autoimmunity, n = 6; recent onset of autoimmunity, n = 7; long-term autoimmunity, n = 6). Data are means ± SEM (B) or are presented as box and whisker plots with minimum to maximum values for data distribution (C and E). * P

    Techniques Used: Expressing, Ex Vivo, Next-Generation Sequencing, Activation Assay, Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Whisker Assay

    2) Product Images from "The primary transcriptome, small RNAs and regulation of antimicrobial resistance in Acinetobacter baumannii ATCC 17978"

    Article Title: The primary transcriptome, small RNAs and regulation of antimicrobial resistance in Acinetobacter baumannii ATCC 17978

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gky603

    sRNA in A. baumannii ATCC 17978. ( A ) Normalized, mapped sequence reads from RNA-seq show the expression of sRNAs 17, 37, 75, 76, 77, 84, 99 and 100 (yellow arrows). Curved arrows depict TSS identified in this study and lollipop structures are predicted rho-independent terminators. Northern blotting of selected sRNAs are shown to the right. RNA was isolated from ESP and five μg of total RNA was loaded per lane. The sRNA sizes below the individual blots have been predicted from dRNA-seq data. ( B ) Sequence alignment of Group I and Group III sRNAs created with the Geneious Software (v. 8.1.8); colored bases indicate conservation in at least 50% of aligned sequences (A, red; C, blue; G, yellow; T, green). The riboprobes used in Northern blotting are depicted as black bars atop the sRNA alignments.
    Figure Legend Snippet: sRNA in A. baumannii ATCC 17978. ( A ) Normalized, mapped sequence reads from RNA-seq show the expression of sRNAs 17, 37, 75, 76, 77, 84, 99 and 100 (yellow arrows). Curved arrows depict TSS identified in this study and lollipop structures are predicted rho-independent terminators. Northern blotting of selected sRNAs are shown to the right. RNA was isolated from ESP and five μg of total RNA was loaded per lane. The sRNA sizes below the individual blots have been predicted from dRNA-seq data. ( B ) Sequence alignment of Group I and Group III sRNAs created with the Geneious Software (v. 8.1.8); colored bases indicate conservation in at least 50% of aligned sequences (A, red; C, blue; G, yellow; T, green). The riboprobes used in Northern blotting are depicted as black bars atop the sRNA alignments.

    Techniques Used: Sequencing, RNA Sequencing Assay, Expressing, Northern Blot, Isolation, End-sequence Profiling, Software

    3) Product Images from "Tomato DCL2b is required for the biosynthesis of 22-nt small RNAs, the resulting secondary siRNAs, and the host defense against ToMV"

    Article Title: Tomato DCL2b is required for the biosynthesis of 22-nt small RNAs, the resulting secondary siRNAs, and the host defense against ToMV

    Journal: Horticulture Research

    doi: 10.1038/s41438-018-0073-7

    The miRNA levels were influenced in dcl2b mutants. a , c Differentially expressed miRNAs in dcl2b mutants. The 22nt miRNAs are colored dark blue. b A small RNA blot analysis of miRNAs. d The alignment of sec-siRNA triggers. Identical nucleotides and conserved nucleotides among sec-siRNA triggers were marked in red and blue, respectively. e Venn diagram for numbers of downregulated precursors of sec-siRNAs in dcl2b mutants
    Figure Legend Snippet: The miRNA levels were influenced in dcl2b mutants. a , c Differentially expressed miRNAs in dcl2b mutants. The 22nt miRNAs are colored dark blue. b A small RNA blot analysis of miRNAs. d The alignment of sec-siRNA triggers. Identical nucleotides and conserved nucleotides among sec-siRNA triggers were marked in red and blue, respectively. e Venn diagram for numbers of downregulated precursors of sec-siRNAs in dcl2b mutants

    Techniques Used: Northern blot, Size-exclusion Chromatography

    4) Product Images from "Solid-phase enzyme catalysis of DNA end repair and 3′ A-tailing reduces GC-bias in next-generation sequencing of human genomic DNA"

    Article Title: Solid-phase enzyme catalysis of DNA end repair and 3′ A-tailing reduces GC-bias in next-generation sequencing of human genomic DNA

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-34079-2

    Exonuclease-mediated degradation of synthetic double-stranded AT-rich DNA by end repair enzyme mixture PKT using capillary gel electrophoresis (CE). ( a . 3′-5′ exonuclease activity of a DNA polymerase can generate a pool of shortened FAM-labeled oligos from dsDNA substrate, presumably due to high temperature that causes DNA end breathing. ( b ) Degradation analysis of enzyme mixture PKT using a pair of 5′ FAM-labeled synthetic DNA substrates containing a 3′ overhang. The CE data were analyzed by Peak Scanner software and the representative CE data are shown. PKT treatment of 54-AT at 20 °C and 37 °C resulted in detection of degradation species that are smaller than the 51 nt species (the expected blunting product). By contrast, the 54-GC reactions yielded a distinct 51 nt species under the same conditions. The negative control (NC) reactions (in the absence of enzyme) showed the positions of 54 nt and 51 nt strands. ( c ) Degradation study using a pair of 3′ recessed synthetic DNA substrates labeled with 5′ FAM. PKT treatment of 47-AT at 37 °C resulted in detection of degradation species that are smaller than the expected 51 nt product from primer extension whereas the negative control (NC) reactions showed the positions of 47 nt and 51 nt strands. Treatment of 47-GC, however, yielded the expected 51-nt product of polymerase activity with no detectable degradation of the FAM-labeled 47-nt strand.
    Figure Legend Snippet: Exonuclease-mediated degradation of synthetic double-stranded AT-rich DNA by end repair enzyme mixture PKT using capillary gel electrophoresis (CE). ( a . 3′-5′ exonuclease activity of a DNA polymerase can generate a pool of shortened FAM-labeled oligos from dsDNA substrate, presumably due to high temperature that causes DNA end breathing. ( b ) Degradation analysis of enzyme mixture PKT using a pair of 5′ FAM-labeled synthetic DNA substrates containing a 3′ overhang. The CE data were analyzed by Peak Scanner software and the representative CE data are shown. PKT treatment of 54-AT at 20 °C and 37 °C resulted in detection of degradation species that are smaller than the 51 nt species (the expected blunting product). By contrast, the 54-GC reactions yielded a distinct 51 nt species under the same conditions. The negative control (NC) reactions (in the absence of enzyme) showed the positions of 54 nt and 51 nt strands. ( c ) Degradation study using a pair of 3′ recessed synthetic DNA substrates labeled with 5′ FAM. PKT treatment of 47-AT at 37 °C resulted in detection of degradation species that are smaller than the expected 51 nt product from primer extension whereas the negative control (NC) reactions showed the positions of 47 nt and 51 nt strands. Treatment of 47-GC, however, yielded the expected 51-nt product of polymerase activity with no detectable degradation of the FAM-labeled 47-nt strand.

    Techniques Used: Nucleic Acid Electrophoresis, Activity Assay, Labeling, Software, Negative Control

    CE analysis of processing synthetic DNA by soluble enzyme mix PKT and immobilized enzymes. 5′ FAM-labeled blunt-end substrates, 51-AT possessing multiple 3′ terminal A-T base pairs, and 51-GC possessing multiple 3′ terminal G-C base pairs, were incubated with PKT for end repair at 20 °C for 30 min followed by 65 °C for 30 min (PKT mix). The substrates were also treated with immobilized T4 DNA pol and PNK at 20 °C for 30 min, followed by separation of the enzymes on beads and the reaction medium (supernatant). The reaction medium was subsequently treated with immobilized Taq DNA pol for 3′ A-tailing at 37 °C for 30 min (IM PKT mix). The CE data show that incubation with PKT resulted in extensive degradation of 51-AT and little degradation of 51-GC. Treatment of 51-AT or 51-GC with the immobilized enzymes resulted in mostly 3′ A-tailing product, without detectable degradation of the 5′ FAM-labeled oligos. NC, negative control reaction performed in the absence of enzyme.
    Figure Legend Snippet: CE analysis of processing synthetic DNA by soluble enzyme mix PKT and immobilized enzymes. 5′ FAM-labeled blunt-end substrates, 51-AT possessing multiple 3′ terminal A-T base pairs, and 51-GC possessing multiple 3′ terminal G-C base pairs, were incubated with PKT for end repair at 20 °C for 30 min followed by 65 °C for 30 min (PKT mix). The substrates were also treated with immobilized T4 DNA pol and PNK at 20 °C for 30 min, followed by separation of the enzymes on beads and the reaction medium (supernatant). The reaction medium was subsequently treated with immobilized Taq DNA pol for 3′ A-tailing at 37 °C for 30 min (IM PKT mix). The CE data show that incubation with PKT resulted in extensive degradation of 51-AT and little degradation of 51-GC. Treatment of 51-AT or 51-GC with the immobilized enzymes resulted in mostly 3′ A-tailing product, without detectable degradation of the 5′ FAM-labeled oligos. NC, negative control reaction performed in the absence of enzyme.

    Techniques Used: Labeling, Incubation, Negative Control

    5) Product Images from "Solid-phase enzyme catalysis of DNA end repair and 3′ A-tailing reduces GC-bias in next-generation sequencing of human genomic DNA"

    Article Title: Solid-phase enzyme catalysis of DNA end repair and 3′ A-tailing reduces GC-bias in next-generation sequencing of human genomic DNA

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-34079-2

    Genome-wide base composition bias curves in Illumina reads from PCR-free human DNA libraries. ( a ) The GC-bias curves from libraries (in duplicate) produced by the immobilized enzyme method (IM-1 and IM-2 in blue), for end repair for 30 min at 20 °C and 3′ A-tailing at 37 °C in contrast to the data from the libraries generated by the soluble enzyme method, with 3′ A-tailing at 65 °C, using enzyme mixture PKT (PKT-1 and PKT-2 in purple). ( b ) The GC-bias data of the immobilized enzyme method compared to the data from the duplicate libraries generated by Illumina TruSeq DNA PCR-free LT Library Preparation Kit (Illumina), Kapa Hyper Prep Kit (Kapa) or NEBNext Ultra II DNA Library Prep Kit for Illumina (Ultra) according to the protocols of the manufacturers. The Illumina protocol carries out end repair for 30 min at 30 °C and 3′ A-tailing for 30 min at 37 °C, followed by incubation at 70 °C for 5 min, and includes a clean-up and size selection step between end repair and 3′ A-tailing. The Kapa Hyper and NEBNext Ultra workflows include an enzyme mixture to perform end repair for 30 min at 20 °C, followed by 3′ A-tailing for 30 min at 65 °C.
    Figure Legend Snippet: Genome-wide base composition bias curves in Illumina reads from PCR-free human DNA libraries. ( a ) The GC-bias curves from libraries (in duplicate) produced by the immobilized enzyme method (IM-1 and IM-2 in blue), for end repair for 30 min at 20 °C and 3′ A-tailing at 37 °C in contrast to the data from the libraries generated by the soluble enzyme method, with 3′ A-tailing at 65 °C, using enzyme mixture PKT (PKT-1 and PKT-2 in purple). ( b ) The GC-bias data of the immobilized enzyme method compared to the data from the duplicate libraries generated by Illumina TruSeq DNA PCR-free LT Library Preparation Kit (Illumina), Kapa Hyper Prep Kit (Kapa) or NEBNext Ultra II DNA Library Prep Kit for Illumina (Ultra) according to the protocols of the manufacturers. The Illumina protocol carries out end repair for 30 min at 30 °C and 3′ A-tailing for 30 min at 37 °C, followed by incubation at 70 °C for 5 min, and includes a clean-up and size selection step between end repair and 3′ A-tailing. The Kapa Hyper and NEBNext Ultra workflows include an enzyme mixture to perform end repair for 30 min at 20 °C, followed by 3′ A-tailing for 30 min at 65 °C.

    Techniques Used: Genome Wide, Polymerase Chain Reaction, Produced, Generated, Incubation, Selection

    Effect of end repair and 3′ A-tailing at high temperature on GC-bias in Illumina reads from PCR-free human DNA libraries. ( a ) Comparison of GC-bias curves in duplicate libraries prepared by immobilized enzymes with 3′ A-tailing performed at 37 °C (IM 37 °C -1 and IM 37 °C -2, in blue) or 65 °C (IM 65 °C -1 and IM 65 °C -2, in green) revealed a dramatic effect of 3′ A-tailing at high temperature on sequence coverage of the AT-rich regions from human DNA libraries. ( b ) GC-bias curves were generated from two sets of duplicate libraries produced using the soluble enzyme mixture PKT with (PKT purify-1 and PKT purify-2) or without (PKT-1 and PKT-2) a purification step between end repair and high temperature incubation (with Taq DNA pol added to the samples following purification). Although some bias against AT-rich regions can be attributed to the end repair step, the elevated temperature contributes to the majority of the dropouts in the AT-rich regions. ( c ) Shown are the GC-bias curves from 4 sets of duplicate libraries produced by the method of soluble enzymes. Two sets of the duplicate libraries were purified after end repair with PK mixture and then treated at 37 °C with Klenow Fragment (3′-5′ exo − ) (red, Klenow 37 °C-1 and Klenow 37 °C-2) or Taq DNA pol (blue, Taq 37 °C-1 and Taq 37 °C-2). The other two duplicate sets were prepared using the high temperature treatment protocol either with (green, Taq 65 °C-1 and Taq 65 °C-2) or without (orange, PKT-1 and PKT-2) a purification step between end repair with PKT and treatment with Taq DNA pol at 65 °C for 30 min. ( d ) Comparison of library yield of the three sets described above with or without (PKT on the left) a purification step between end repair and 3′ A-tailing indicates that purification caused substantial loss of library DNA.
    Figure Legend Snippet: Effect of end repair and 3′ A-tailing at high temperature on GC-bias in Illumina reads from PCR-free human DNA libraries. ( a ) Comparison of GC-bias curves in duplicate libraries prepared by immobilized enzymes with 3′ A-tailing performed at 37 °C (IM 37 °C -1 and IM 37 °C -2, in blue) or 65 °C (IM 65 °C -1 and IM 65 °C -2, in green) revealed a dramatic effect of 3′ A-tailing at high temperature on sequence coverage of the AT-rich regions from human DNA libraries. ( b ) GC-bias curves were generated from two sets of duplicate libraries produced using the soluble enzyme mixture PKT with (PKT purify-1 and PKT purify-2) or without (PKT-1 and PKT-2) a purification step between end repair and high temperature incubation (with Taq DNA pol added to the samples following purification). Although some bias against AT-rich regions can be attributed to the end repair step, the elevated temperature contributes to the majority of the dropouts in the AT-rich regions. ( c ) Shown are the GC-bias curves from 4 sets of duplicate libraries produced by the method of soluble enzymes. Two sets of the duplicate libraries were purified after end repair with PK mixture and then treated at 37 °C with Klenow Fragment (3′-5′ exo − ) (red, Klenow 37 °C-1 and Klenow 37 °C-2) or Taq DNA pol (blue, Taq 37 °C-1 and Taq 37 °C-2). The other two duplicate sets were prepared using the high temperature treatment protocol either with (green, Taq 65 °C-1 and Taq 65 °C-2) or without (orange, PKT-1 and PKT-2) a purification step between end repair with PKT and treatment with Taq DNA pol at 65 °C for 30 min. ( d ) Comparison of library yield of the three sets described above with or without (PKT on the left) a purification step between end repair and 3′ A-tailing indicates that purification caused substantial loss of library DNA.

    Techniques Used: Polymerase Chain Reaction, Sequencing, Generated, Produced, Purification, Incubation

    Enzyme immobilization and comparison of Illumina library preparation protocols. ( a ) A schematic of covalent conjugation of SNAP-tagged enzyme fusion proteins to magnetic beads functionalized with O 6 . ( b ) Workflow for library construction using immobilized enzymes for Illumina sequencing. A typical streamlined protocol for Illumina library construction is modified by employing immobilized enzymes to catalyze end repair and 3′ A-tailing. This method utilizes SNAP-tagged T4 DNA pol and PNK covalently conjugated to BG-functionalized magnetic beads to carry out end repair of fragmented DNA at 20°C (or 37 °C) for 30 min. The enzymes are removed by magnetic separation from the DNA pool, which is subjected to 3′ A-tailing at 37 °C for 30 min using immobilized Taq DNA pol. ( c ) Streamlined protocol for Illumina amplification-free library preparation using soluble enzymes. Typically, end repair and 3′ A-tailing of fragmented DNA are catalyzed by an enzyme mixture at 20 °C for 30 min, followed by heat treatment at 65 °C for 30 min. ( d ) The workflow of Illumina TruSeq DNA PCR-free LT Library Prep Kit with a purification step. End repair is performed for 30 min at 30 °C, followed by a bead-based step for clean up and size selection. 3′ A-tailing is carried out for 30 min at 37 °C with a subsequent treatment for 5 min at 70 °C. Each library was ligated to preannealed full-length paired-end Illumina adaptors, size-selected and analyzed, and sequenced on an Illumina sequencing platform.
    Figure Legend Snippet: Enzyme immobilization and comparison of Illumina library preparation protocols. ( a ) A schematic of covalent conjugation of SNAP-tagged enzyme fusion proteins to magnetic beads functionalized with O 6 . ( b ) Workflow for library construction using immobilized enzymes for Illumina sequencing. A typical streamlined protocol for Illumina library construction is modified by employing immobilized enzymes to catalyze end repair and 3′ A-tailing. This method utilizes SNAP-tagged T4 DNA pol and PNK covalently conjugated to BG-functionalized magnetic beads to carry out end repair of fragmented DNA at 20°C (or 37 °C) for 30 min. The enzymes are removed by magnetic separation from the DNA pool, which is subjected to 3′ A-tailing at 37 °C for 30 min using immobilized Taq DNA pol. ( c ) Streamlined protocol for Illumina amplification-free library preparation using soluble enzymes. Typically, end repair and 3′ A-tailing of fragmented DNA are catalyzed by an enzyme mixture at 20 °C for 30 min, followed by heat treatment at 65 °C for 30 min. ( d ) The workflow of Illumina TruSeq DNA PCR-free LT Library Prep Kit with a purification step. End repair is performed for 30 min at 30 °C, followed by a bead-based step for clean up and size selection. 3′ A-tailing is carried out for 30 min at 37 °C with a subsequent treatment for 5 min at 70 °C. Each library was ligated to preannealed full-length paired-end Illumina adaptors, size-selected and analyzed, and sequenced on an Illumina sequencing platform.

    Techniques Used: Conjugation Assay, Magnetic Beads, Sequencing, Modification, Amplification, Polymerase Chain Reaction, Purification, Selection

    6) Product Images from "SUMOylation of the m6A-RNA methyltransferase METTL3 modulates its function"

    Article Title: SUMOylation of the m6A-RNA methyltransferase METTL3 modulates its function

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gky156

    SUMO1 modification of METTL3 represses its RNA m 6 A methyltransferase activity. (A–E) Polyadenylated mRNAs were purified for the dot-blot assay (upper panels), and cell lysates were used for immunoblotting with indicated antibodies (lower panels). ( A ) METTL3 is a main component responsible for the abundance of m 6 A in mRNAs. The abundance of m 6 A in mRNAs from shControl or shMETTL3 293T and H1299 cells was detected by the Dot-blot assay with anti-m 6 A antibody, and equal loading of the mRNAs was verified by methylene blue staining (upper panels). METTL3 knockdown efficiency in 293T and H1299 cells was shown (lower panels). ( B ) The level of m 6 A in mRNAs is low in the high SUMOylation status in SENP1 knockdown cells. ( C ) SUMOylation of METTL3 reduces its m 6 A methyltransferase activity. HA-METTL3 with or without His-SUMO1/Flag-Ubc9 were transfected into 293T cells. (D–F) The SUMO-site mutataion 4KR (K 177/211/212/215 R) of METTL3 significantly enhances its m 6 A methyltransferase activity. ( D ) HA-METTL3-WT or -4KR was transiently transfeced into 293T cells, and ( E ) HA-METTL3-WT or -4KR was stably re-expressed H1299-shMETTL3 by using the lentiviral system. ( F ) HA-METTL3-WT or -4KR were transfected with or without His-SUMO1/Flag-Ubc9 into 293T cells. The SUMOylation assays and dot-blot assays were performed as described before. ( G ) LC–MS/MS quantification of the m 6 A/A ratio in polyadenylated RNAs purified from H1299-shMETTL3 cells with METTL3-WT or METTL3-4KR. Error bars indicate mean ± S.D. (two technical replicates). ( H ) The in vitro RNA N6-adenosine methylation activity was tested using purified Flag-METTL3-WT, SUMOlated Flag-METTL3-WT or Flag-METTL3-4KR proteins in combination with purified Flag-METTL14 and RNA-probe (Seq1) with consensus sequence of ‘GGACU’. The methylation of RNA-probe was measured by immunoblotting with the m 6 A antibody.
    Figure Legend Snippet: SUMO1 modification of METTL3 represses its RNA m 6 A methyltransferase activity. (A–E) Polyadenylated mRNAs were purified for the dot-blot assay (upper panels), and cell lysates were used for immunoblotting with indicated antibodies (lower panels). ( A ) METTL3 is a main component responsible for the abundance of m 6 A in mRNAs. The abundance of m 6 A in mRNAs from shControl or shMETTL3 293T and H1299 cells was detected by the Dot-blot assay with anti-m 6 A antibody, and equal loading of the mRNAs was verified by methylene blue staining (upper panels). METTL3 knockdown efficiency in 293T and H1299 cells was shown (lower panels). ( B ) The level of m 6 A in mRNAs is low in the high SUMOylation status in SENP1 knockdown cells. ( C ) SUMOylation of METTL3 reduces its m 6 A methyltransferase activity. HA-METTL3 with or without His-SUMO1/Flag-Ubc9 were transfected into 293T cells. (D–F) The SUMO-site mutataion 4KR (K 177/211/212/215 R) of METTL3 significantly enhances its m 6 A methyltransferase activity. ( D ) HA-METTL3-WT or -4KR was transiently transfeced into 293T cells, and ( E ) HA-METTL3-WT or -4KR was stably re-expressed H1299-shMETTL3 by using the lentiviral system. ( F ) HA-METTL3-WT or -4KR were transfected with or without His-SUMO1/Flag-Ubc9 into 293T cells. The SUMOylation assays and dot-blot assays were performed as described before. ( G ) LC–MS/MS quantification of the m 6 A/A ratio in polyadenylated RNAs purified from H1299-shMETTL3 cells with METTL3-WT or METTL3-4KR. Error bars indicate mean ± S.D. (two technical replicates). ( H ) The in vitro RNA N6-adenosine methylation activity was tested using purified Flag-METTL3-WT, SUMOlated Flag-METTL3-WT or Flag-METTL3-4KR proteins in combination with purified Flag-METTL14 and RNA-probe (Seq1) with consensus sequence of ‘GGACU’. The methylation of RNA-probe was measured by immunoblotting with the m 6 A antibody.

    Techniques Used: Modification, Activity Assay, Purification, Dot Blot, Staining, Transfection, Stable Transfection, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, In Vitro, Methylation, Sequencing

    SUMOylation of METTL3 down-regulates m 6 A modification in mRNAs resulting in the alternation of gene expression profile. ( A ) Cumulative distribution curve for the abundance of m 6 A modification across the transcriptome of H1299-shMETTL3 cells re-expressing METTL3-WT or METTL3-4KR. ( B ) Distribution of m 6 A peaks across around stop codons and 3′ UTRs of the entire set of mRNA transcripts. ( C ) Comparison of the abundance of m 6 A peaks across the transcriptome of H1299-shMETTL3 cells re-expressing METTL3-WT or METTL3-4KR. The fold-change ≥2.0 was considered to be significant, which was the abundance of m 6 A peaks of METTL3-4KR relative to METTL3-WT. IP/Input, was referred to as the abundance of m 6 A peak in mRNAs detected in MeRIP m 6 A-Seq (IP) normalized by that detected in RNA-Seq (Input). ( D ) Heatmap showing the alternation of mRNA expression profiles in H1299-shMETTL3 cells re-expressing METTL3-WT or METTL3-4KR.
    Figure Legend Snippet: SUMOylation of METTL3 down-regulates m 6 A modification in mRNAs resulting in the alternation of gene expression profile. ( A ) Cumulative distribution curve for the abundance of m 6 A modification across the transcriptome of H1299-shMETTL3 cells re-expressing METTL3-WT or METTL3-4KR. ( B ) Distribution of m 6 A peaks across around stop codons and 3′ UTRs of the entire set of mRNA transcripts. ( C ) Comparison of the abundance of m 6 A peaks across the transcriptome of H1299-shMETTL3 cells re-expressing METTL3-WT or METTL3-4KR. The fold-change ≥2.0 was considered to be significant, which was the abundance of m 6 A peaks of METTL3-4KR relative to METTL3-WT. IP/Input, was referred to as the abundance of m 6 A peak in mRNAs detected in MeRIP m 6 A-Seq (IP) normalized by that detected in RNA-Seq (Input). ( D ) Heatmap showing the alternation of mRNA expression profiles in H1299-shMETTL3 cells re-expressing METTL3-WT or METTL3-4KR.

    Techniques Used: Modification, Expressing, RNA Sequencing Assay

    7) Product Images from "Fragmentation Through Polymerization (FTP): A new method to fragment DNA for next-generation sequencing"

    Article Title: Fragmentation Through Polymerization (FTP): A new method to fragment DNA for next-generation sequencing

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0210374

    Agarose-gel electrophoresis of gDNA fragmented by the FTP method. gDNA of E . coli BL21 was incubated as described in Materials and Methods: without enzymes (lane 1), with SD polymerase (lane 2), with DNase I (lane 3), and with both DNase I and SD polymerase (lane 4 and 5). M1: 1 kb DNA Ladder; M2: 100 bp DNA Ladder.
    Figure Legend Snippet: Agarose-gel electrophoresis of gDNA fragmented by the FTP method. gDNA of E . coli BL21 was incubated as described in Materials and Methods: without enzymes (lane 1), with SD polymerase (lane 2), with DNase I (lane 3), and with both DNase I and SD polymerase (lane 4 and 5). M1: 1 kb DNA Ladder; M2: 100 bp DNA Ladder.

    Techniques Used: Agarose Gel Electrophoresis, Incubation

    8) Product Images from "Illustrating and Enhancing the Biosynthesis of Astaxanthin and Docosahexaenoic Acid in Aurantiochytrium sp. SK4"

    Article Title: Illustrating and Enhancing the Biosynthesis of Astaxanthin and Docosahexaenoic Acid in Aurantiochytrium sp. SK4

    Journal: Marine Drugs

    doi: 10.3390/md17010045

    The information on carotenoid biosynthesis in Aurantiochytrium sp. SK4. Putative biosynthetic pathways of carotenoids ( A ), the expression trends of 3-hydroxy-3-methylglutaryl-CoA synthase (HMGS), 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR), mevalonate kinase (MK), phosphomevalonate kinase (PMK), and CrtIBY ( B ), relative carotenoid content ( C ) and percentage ( D ). SQS, squalene synthesis. Data are shown as mean ± SD, n = 3.
    Figure Legend Snippet: The information on carotenoid biosynthesis in Aurantiochytrium sp. SK4. Putative biosynthetic pathways of carotenoids ( A ), the expression trends of 3-hydroxy-3-methylglutaryl-CoA synthase (HMGS), 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR), mevalonate kinase (MK), phosphomevalonate kinase (PMK), and CrtIBY ( B ), relative carotenoid content ( C ) and percentage ( D ). SQS, squalene synthesis. Data are shown as mean ± SD, n = 3.

    Techniques Used: Expressing

    The information of transformant AT26. ( A ) Schematic diagram of the p-VBIG construct containing the endogenous tubulin promotor, − VHb − ble -2A- IDI -2A- GPS (VBIG) genes, and the SV40 terminator. ( B ) Genomic PCR detection of VBIG in the transformants resistance to zeocin. ( C ) Growth curves of Aurantiochytrium sp. SK4 and its transformant AT26. Data are shown as mean ± SD, n = 3.
    Figure Legend Snippet: The information of transformant AT26. ( A ) Schematic diagram of the p-VBIG construct containing the endogenous tubulin promotor, − VHb − ble -2A- IDI -2A- GPS (VBIG) genes, and the SV40 terminator. ( B ) Genomic PCR detection of VBIG in the transformants resistance to zeocin. ( C ) Growth curves of Aurantiochytrium sp. SK4 and its transformant AT26. Data are shown as mean ± SD, n = 3.

    Techniques Used: Construct, Polymerase Chain Reaction

    9) Product Images from "Biosynthesis of histone messenger RNA employs a specific 3' end endonuclease"

    Article Title: Biosynthesis of histone messenger RNA employs a specific 3' end endonuclease

    Journal: eLife

    doi: 10.7554/eLife.39865

    3ʹ end processing defects observed in replication-dependent histone pre-mRNA after MBLAC1 depletion and investigation of the effect of MBLAC1 depletion on the polyadenylated fraction of histone mRNA in HeLa cells. ( A, B ) ChrRNA-seq analyses showing the effect of MBLAC1 or CPSF73 depletion in two biological replicates (Set1 and Set2) on GAPDH or selected RD histone (HIST1H2BC, HIST4H4) genes (UCSC Genome Browser) ( Kent et al., 2002 ). Arrows indicate gene bodies and transcription termination defect orientation. ( C ) RT-qPCR quantification evaluating enrichment of polyadenylated RD histone RNA transcripts in MBLAC1 CRISPR/Cas9-mediated stable knockdown (KD) compared to wildtype (WT) cells. ( D ) The starting abundance of histone transcripts was quantified in total RNA by the standard curve method to ensure similar histone RNA levels before selection. ( E ) GAPDH and 18S rRNA were used as polya +and polyA- controls, respectively. For each primer set, amplicon abundance was calculated using the standard curve method; the relative percentage of transcripts in both, polyA ±fractions was expressed as ratios relative to the abundance of the total RNA used as the starting material for selection. Error bars represent SEM from two biological replicates. For histone genes, amplicons were selected in the gene bodies. Abbreviations: +, polyA plus; -, polyA minus.
    Figure Legend Snippet: 3ʹ end processing defects observed in replication-dependent histone pre-mRNA after MBLAC1 depletion and investigation of the effect of MBLAC1 depletion on the polyadenylated fraction of histone mRNA in HeLa cells. ( A, B ) ChrRNA-seq analyses showing the effect of MBLAC1 or CPSF73 depletion in two biological replicates (Set1 and Set2) on GAPDH or selected RD histone (HIST1H2BC, HIST4H4) genes (UCSC Genome Browser) ( Kent et al., 2002 ). Arrows indicate gene bodies and transcription termination defect orientation. ( C ) RT-qPCR quantification evaluating enrichment of polyadenylated RD histone RNA transcripts in MBLAC1 CRISPR/Cas9-mediated stable knockdown (KD) compared to wildtype (WT) cells. ( D ) The starting abundance of histone transcripts was quantified in total RNA by the standard curve method to ensure similar histone RNA levels before selection. ( E ) GAPDH and 18S rRNA were used as polya +and polyA- controls, respectively. For each primer set, amplicon abundance was calculated using the standard curve method; the relative percentage of transcripts in both, polyA ±fractions was expressed as ratios relative to the abundance of the total RNA used as the starting material for selection. Error bars represent SEM from two biological replicates. For histone genes, amplicons were selected in the gene bodies. Abbreviations: +, polyA plus; -, polyA minus.

    Techniques Used: Quantitative RT-PCR, CRISPR, Selection, Amplification

    10) Product Images from "Sensory Experience Remodels Genome Architecture in Neural Circuit to Drive Motor Learning"

    Article Title: Sensory Experience Remodels Genome Architecture in Neural Circuit to Drive Motor Learning

    Journal: Nature

    doi: 10.1038/s41586-019-1190-7

    Optostimulation of granule neurons potentiates CS pathway-regulated gene modules ( a ) UCSC genome browser tracks of chromatin-bound (Chrom-Seq) and nucleocytoplasmic (NucCyto-Seq) RNA at the fosl2 locus upon optostimulation of granule neurons in the ADCV in mice. The chromatin-bound fraction contained immature unspliced RNA and the nucleocytoplasmic fraction contained spliced mature RNA. ( b-d ) Comparisons of the log2 fold change in chromatin-bound RNA and the log2 fold change in nucleocytoplasmic RNA upon optostimulation of granule neurons together with the log2 fold change in total RNA upon sensorimotor stimulation in the ADCV in mice (n=4,4,18) mice for chromatin, nucleocytoplasmic, total RNA). Data show mean ± standard error. ( e ) Pulse chase analyses were performed by optogenetically stimulating granule neurons in the ADCV for 10 minutes and returning mice to their homecage for 10, 50, or 140 minutes. The ADCV of optostimulated or unstimulated control mice was then subjected to RNA-Seq using the chromatin-bound (nascent) or nucleocytoplasmic (mature) fractions. ( f-i ) Time course of chromatin-bound (nascent) or nucleocytoplasmic (mature) RNA expression following optostimulation of granule neurons as in (e) (n=2 mice).
    Figure Legend Snippet: Optostimulation of granule neurons potentiates CS pathway-regulated gene modules ( a ) UCSC genome browser tracks of chromatin-bound (Chrom-Seq) and nucleocytoplasmic (NucCyto-Seq) RNA at the fosl2 locus upon optostimulation of granule neurons in the ADCV in mice. The chromatin-bound fraction contained immature unspliced RNA and the nucleocytoplasmic fraction contained spliced mature RNA. ( b-d ) Comparisons of the log2 fold change in chromatin-bound RNA and the log2 fold change in nucleocytoplasmic RNA upon optostimulation of granule neurons together with the log2 fold change in total RNA upon sensorimotor stimulation in the ADCV in mice (n=4,4,18) mice for chromatin, nucleocytoplasmic, total RNA). Data show mean ± standard error. ( e ) Pulse chase analyses were performed by optogenetically stimulating granule neurons in the ADCV for 10 minutes and returning mice to their homecage for 10, 50, or 140 minutes. The ADCV of optostimulated or unstimulated control mice was then subjected to RNA-Seq using the chromatin-bound (nascent) or nucleocytoplasmic (mature) fractions. ( f-i ) Time course of chromatin-bound (nascent) or nucleocytoplasmic (mature) RNA expression following optostimulation of granule neurons as in (e) (n=2 mice).

    Techniques Used: Mouse Assay, Pulse Chase, RNA Sequencing Assay, RNA Expression

    11) Product Images from "Single-cell RNA-seq reveals AML hierarchies relevant to disease progression and immunity"

    Article Title: Single-cell RNA-seq reveals AML hierarchies relevant to disease progression and immunity

    Journal: Cell

    doi: 10.1016/j.cell.2019.01.031

    AML cellular hierarchies correlate with underlying genetic alterations A . Genome plot illustrates nanopore reads for four selected FLT3 transcripts from AML419A. For each transcript, 100 reads are shown. Black arrow indicates the location of the primer used for amplification (exon 11). Base mismatches encoding A680V (exon 16; green) or N841K (exon 20; red) mutations are indicated. Base insertions representing a 24 bp ITD are indicated in exon 14 (pink). The mutations do not co-occur on the same transcripts. B-C . Diagrams show AML419 evolution inferred from co-occurrence of mutations in single cells ( B ) and VAFs from bulk DNA sequencing ( C ). The most likely model yields one subclone with an A680V mutation, a second subclone with an ITD, and a third subclone that exclusively harbors an N841K mutation. D . Diagram shows FLT3 protein domains and location of mutations. E . Heatmap shows expression of 180 signature genes for the six malignant cell types (rows) in 40 single cells from AML419A (columns). Cells were assigned to subclone A or B, or subclone C on the basis of FLT3 genotypes. F . Heatmap shows expression of 180 signature genes for the six malignant cell types (rows) in 179 AMLs profiled by bulk RNA-seq (columns). Unsupervised clustering revealed seven subsets of patients with different inferred cell type abundances (clusters A-G). G . Charts indicate chromosomal aberrations (top), mutations (middle) and FAB classifications (bottom) for AMLs in F . Correspondence between cell type compositions and genetics is evident. P -values indicate non-random distribution of events between clusters (Fisher’s exact test). n.s., not significant. H . Flow cytometry histograms show expression of the primitive cell marker CD34 in MUTZ-3 cells, four days after transduction with FLT3-WT, FLT3-D835Y, FLT3-ITD or a control gene ( luciferase ). I . Plot shows change in the percent of CD34 + cells following transduction of FLT3 variants as in H . P -values were calculated using Student’s t -test compared to CTRL (mean + SD of n = 6 transductions). * P
    Figure Legend Snippet: AML cellular hierarchies correlate with underlying genetic alterations A . Genome plot illustrates nanopore reads for four selected FLT3 transcripts from AML419A. For each transcript, 100 reads are shown. Black arrow indicates the location of the primer used for amplification (exon 11). Base mismatches encoding A680V (exon 16; green) or N841K (exon 20; red) mutations are indicated. Base insertions representing a 24 bp ITD are indicated in exon 14 (pink). The mutations do not co-occur on the same transcripts. B-C . Diagrams show AML419 evolution inferred from co-occurrence of mutations in single cells ( B ) and VAFs from bulk DNA sequencing ( C ). The most likely model yields one subclone with an A680V mutation, a second subclone with an ITD, and a third subclone that exclusively harbors an N841K mutation. D . Diagram shows FLT3 protein domains and location of mutations. E . Heatmap shows expression of 180 signature genes for the six malignant cell types (rows) in 40 single cells from AML419A (columns). Cells were assigned to subclone A or B, or subclone C on the basis of FLT3 genotypes. F . Heatmap shows expression of 180 signature genes for the six malignant cell types (rows) in 179 AMLs profiled by bulk RNA-seq (columns). Unsupervised clustering revealed seven subsets of patients with different inferred cell type abundances (clusters A-G). G . Charts indicate chromosomal aberrations (top), mutations (middle) and FAB classifications (bottom) for AMLs in F . Correspondence between cell type compositions and genetics is evident. P -values indicate non-random distribution of events between clusters (Fisher’s exact test). n.s., not significant. H . Flow cytometry histograms show expression of the primitive cell marker CD34 in MUTZ-3 cells, four days after transduction with FLT3-WT, FLT3-D835Y, FLT3-ITD or a control gene ( luciferase ). I . Plot shows change in the percent of CD34 + cells following transduction of FLT3 variants as in H . P -values were calculated using Student’s t -test compared to CTRL (mean + SD of n = 6 transductions). * P

    Techniques Used: Amplification, DNA Sequencing, Mutagenesis, Expressing, RNA Sequencing Assay, Flow Cytometry, Marker, Transduction, Luciferase

    12) Product Images from "A ligation-based single-stranded library preparation method to analyze cell-free DNA and synthetic oligos"

    Article Title: A ligation-based single-stranded library preparation method to analyze cell-free DNA and synthetic oligos

    Journal: BMC Genomics

    doi: 10.1186/s12864-019-6355-0

    Standard NGS metrics for merged reads from SRSLY and NEBNext Ultra II libraries from healthy human cfDNA extracts H-69 and H-81. Unless otherwise stated, all libraries for each method were combined by cfDNA extract prior to analysis and filtered for PCR duplicates and a quality score equal to or greater than q20. ( a ) Insert distribution plots for cfDNA extracts H-69 and H-81, respectively. ( b ) Fold coverage by base percent across the human genome ( hg19 ) for SRSLY and NEBNext by cfDNA extract. Combined libraries were subsampled to similar read depth prior to fold coverage calculations. Subsampled depth was set at 295 M reads, the limit of sequenced reads for SRSLY-H-81. ( c ) Preseq complexity estimate for SRSLY and NEBNext by cfDNA extract. Three libraries of equivalent sequencing depth per method were combined to estimate complexity, since more libraries were made via SRSLY than NEBNext. Files containing the PCR duplicate reads were used to facilitate complexity estimates ( d ) Normalized coverage as a function of GC content over 100 bp sliding scale across the human genome for SRSLY and NEBNext by cfDNA extract. Green histogram represents the human genome GC across the 100 bp sliding window. ( e ) Normalized, log-transformed base composition at each position of read termini starting 2 bp upstream and extending to 34 bp downstream of read start site for combined cfDNA extracts for SRSLY and NEBNext. All reads regardless of insert length considered
    Figure Legend Snippet: Standard NGS metrics for merged reads from SRSLY and NEBNext Ultra II libraries from healthy human cfDNA extracts H-69 and H-81. Unless otherwise stated, all libraries for each method were combined by cfDNA extract prior to analysis and filtered for PCR duplicates and a quality score equal to or greater than q20. ( a ) Insert distribution plots for cfDNA extracts H-69 and H-81, respectively. ( b ) Fold coverage by base percent across the human genome ( hg19 ) for SRSLY and NEBNext by cfDNA extract. Combined libraries were subsampled to similar read depth prior to fold coverage calculations. Subsampled depth was set at 295 M reads, the limit of sequenced reads for SRSLY-H-81. ( c ) Preseq complexity estimate for SRSLY and NEBNext by cfDNA extract. Three libraries of equivalent sequencing depth per method were combined to estimate complexity, since more libraries were made via SRSLY than NEBNext. Files containing the PCR duplicate reads were used to facilitate complexity estimates ( d ) Normalized coverage as a function of GC content over 100 bp sliding scale across the human genome for SRSLY and NEBNext by cfDNA extract. Green histogram represents the human genome GC across the 100 bp sliding window. ( e ) Normalized, log-transformed base composition at each position of read termini starting 2 bp upstream and extending to 34 bp downstream of read start site for combined cfDNA extracts for SRSLY and NEBNext. All reads regardless of insert length considered

    Techniques Used: Next-Generation Sequencing, Polymerase Chain Reaction, Sequencing, Transformation Assay

    cfDNA analysis. ( a ) Normalized genomic dinucleotide frequencies as a function of read length for SRSLY data for three discrete fragment lengths including 100 bp ± the read mapped coordinates. Read midpoint is centered at 0. Negative numbers denote genomic regions upstream (5-prime) of the midpoint and positive numbers denote genomic regions downstream (3-prime) of the midpoint. Input data is from the combined H-69 and H-81 SRSLY datasets. ( b ) Same as (a) except for NEBNext data. ( c ) Normalized genomic dinucleotide frequency as a function of read length for SRSLY data for the termini of three discrete fragment lengths including a 9 bp region into the read (positive numbers) and 10 bp outside the read (negative numbers). Read start and end coordinates are centered on 0. Input data is from the combined H-69 and H-81 SRSLY datasets. ( d ) Same as (c) except for NEBNext data. ( e ) Normalized WPS values (120 bp window; 120–180 bp fragments) for SRSLY data compared to sample CH01 [ 16 ] at the same pericentromeric locus on chromosome 12 used to initially showcase WPS. ( f ) Average normalized WPS score within ±1 kb of annotated CTCF binding sites for long fragment length binned data (120 bp window, 120–180 bp fragments) and short fragment length binned data (16 bp window, 35–80 bp fragments) for SRSLY data compared to sample CH01 [ 16 ]
    Figure Legend Snippet: cfDNA analysis. ( a ) Normalized genomic dinucleotide frequencies as a function of read length for SRSLY data for three discrete fragment lengths including 100 bp ± the read mapped coordinates. Read midpoint is centered at 0. Negative numbers denote genomic regions upstream (5-prime) of the midpoint and positive numbers denote genomic regions downstream (3-prime) of the midpoint. Input data is from the combined H-69 and H-81 SRSLY datasets. ( b ) Same as (a) except for NEBNext data. ( c ) Normalized genomic dinucleotide frequency as a function of read length for SRSLY data for the termini of three discrete fragment lengths including a 9 bp region into the read (positive numbers) and 10 bp outside the read (negative numbers). Read start and end coordinates are centered on 0. Input data is from the combined H-69 and H-81 SRSLY datasets. ( d ) Same as (c) except for NEBNext data. ( e ) Normalized WPS values (120 bp window; 120–180 bp fragments) for SRSLY data compared to sample CH01 [ 16 ] at the same pericentromeric locus on chromosome 12 used to initially showcase WPS. ( f ) Average normalized WPS score within ±1 kb of annotated CTCF binding sites for long fragment length binned data (120 bp window, 120–180 bp fragments) and short fragment length binned data (16 bp window, 35–80 bp fragments) for SRSLY data compared to sample CH01 [ 16 ]

    Techniques Used: Binding Assay

    13) Product Images from "Enhanced Anti-lymphoma Activity of CAR19-iNKT Cells Underpinned by Dual CD19 and CD1d Targeting"

    Article Title: Enhanced Anti-lymphoma Activity of CAR19-iNKT Cells Underpinned by Dual CD19 and CD1d Targeting

    Journal: Cancer Cell

    doi: 10.1016/j.ccell.2018.08.017

    Enhanced Short- and Long-Term Reactivity of CAR19-iNKT Cells against B Lineage Malignancies (A) Second- and third-generation CAR19-T and CAR19-iNKT cell expansion (fold change) and absolute cell numbers (cell count) over a period of 3 weeks (n = 4). p value is for CAR19-iNKT versus CAR19-T cells using Friedman test. Error bars represent SEM. (B) Proliferation analysis of second- and third-generation CAR19-T and CAR19-iNKT cells in the presence (stimulated) or not (resting) of irradiated CD1d + CD19 + (C1R-CD1d) cells over 7 days. p value is for CAR19-iNKT versus CAR19-T cells using Friedman test. (C) Cytotoxicity of third-generation CAR19-T and -NKT cells against C1R-CD1d (representative of n = 3) and Farage lymphoma cell lines (representative of n = 2) pre-loaded or not with αGalCer. Error bars represent SEM of triplicate assays. (D) IncuCyte images of representative wells showing the final effector (gray) and live target cells (red) after 7 days. Effectors were second-generation CAR19-T and CAR19-NKT cells. Targets were CD19 + ARH-77-CD1d cells expressing mCherry red fluorescent protein. Scale bar represents 400 μm. (E) Seven-day trajectory of effector and target cell proliferation and elimination respectively as per (D). p value is for CAR19-iNKT versus CAR19-T cells using Friedman test. (F) Cytotoxicity of second-generation CAR19-iNKT, CAR19-T, and of untransduced iNKT cells against lymphoma cells from one patient with mantle cell lymphoma (MCL; top) and two patients with marginal zone B lymphoma (MZL; bottom) using three different T/iNKT cell healthy donors (A, B, and C). Error bars represent SEM of triplicate assays. ∗∗ p
    Figure Legend Snippet: Enhanced Short- and Long-Term Reactivity of CAR19-iNKT Cells against B Lineage Malignancies (A) Second- and third-generation CAR19-T and CAR19-iNKT cell expansion (fold change) and absolute cell numbers (cell count) over a period of 3 weeks (n = 4). p value is for CAR19-iNKT versus CAR19-T cells using Friedman test. Error bars represent SEM. (B) Proliferation analysis of second- and third-generation CAR19-T and CAR19-iNKT cells in the presence (stimulated) or not (resting) of irradiated CD1d + CD19 + (C1R-CD1d) cells over 7 days. p value is for CAR19-iNKT versus CAR19-T cells using Friedman test. (C) Cytotoxicity of third-generation CAR19-T and -NKT cells against C1R-CD1d (representative of n = 3) and Farage lymphoma cell lines (representative of n = 2) pre-loaded or not with αGalCer. Error bars represent SEM of triplicate assays. (D) IncuCyte images of representative wells showing the final effector (gray) and live target cells (red) after 7 days. Effectors were second-generation CAR19-T and CAR19-NKT cells. Targets were CD19 + ARH-77-CD1d cells expressing mCherry red fluorescent protein. Scale bar represents 400 μm. (E) Seven-day trajectory of effector and target cell proliferation and elimination respectively as per (D). p value is for CAR19-iNKT versus CAR19-T cells using Friedman test. (F) Cytotoxicity of second-generation CAR19-iNKT, CAR19-T, and of untransduced iNKT cells against lymphoma cells from one patient with mantle cell lymphoma (MCL; top) and two patients with marginal zone B lymphoma (MZL; bottom) using three different T/iNKT cell healthy donors (A, B, and C). Error bars represent SEM of triplicate assays. ∗∗ p

    Techniques Used: Cell Counting, Irradiation, Expressing

    14) Product Images from "A multi-functional AAV-CRISPR-Cas9 and its host response"

    Article Title: A multi-functional AAV-CRISPR-Cas9 and its host response

    Journal: Nature methods

    doi: 10.1038/nmeth.3993

    AAV9 and Cas9 evoke host immune responses. ( a ) Intramuscular Cas9-expression via AAV9-split-Cas9 injection or plasmid-Cas9 FL electroporation. ( b ) Heat maps depict fold-difference of each immune cell-type fraction compared to that of vehicle-injected muscles ( right column ) (n = 4 mice per condition). ( c ) Lymphocyte TCR-β CDR3 repertoires after Cas9-exposure (n = 4 mice per condition; 6 pair-wise comparisons) (Welch’s t-test, Bonferroni corrected). ( d ) Clonotypic abundance of Vβ16 CDR3 CASSLDRGQDTQYF (Welch’s t-test). Numbers in parentheses denote clonotypic rank within each TCR-β CDR3 repertoire after Cas9 re-stimulation. ( e ) Epitope mapping by M13 phage display (all Ig subclasses). ( f ) Cas9 epitopes from Cas9-exposed animals ( top , n = 4 DNA-electroporated; bottom , n = 4 AAV9-delivered). P-values from Wald test, Benjamini-Hochberg adjusted for FDR = 0.1. ( g ) Capsid epitopes from AAV9-exposed animals (n = 8). Counts denote number of animals with capsid-specific antibodies covering each amino acid position ( x-axis ), and red bars denote positions of immunodominant epitopes. AAV9 capsid expresses as three isoforms (VP1/2/3).
    Figure Legend Snippet: AAV9 and Cas9 evoke host immune responses. ( a ) Intramuscular Cas9-expression via AAV9-split-Cas9 injection or plasmid-Cas9 FL electroporation. ( b ) Heat maps depict fold-difference of each immune cell-type fraction compared to that of vehicle-injected muscles ( right column ) (n = 4 mice per condition). ( c ) Lymphocyte TCR-β CDR3 repertoires after Cas9-exposure (n = 4 mice per condition; 6 pair-wise comparisons) (Welch’s t-test, Bonferroni corrected). ( d ) Clonotypic abundance of Vβ16 CDR3 CASSLDRGQDTQYF (Welch’s t-test). Numbers in parentheses denote clonotypic rank within each TCR-β CDR3 repertoire after Cas9 re-stimulation. ( e ) Epitope mapping by M13 phage display (all Ig subclasses). ( f ) Cas9 epitopes from Cas9-exposed animals ( top , n = 4 DNA-electroporated; bottom , n = 4 AAV9-delivered). P-values from Wald test, Benjamini-Hochberg adjusted for FDR = 0.1. ( g ) Capsid epitopes from AAV9-exposed animals (n = 8). Counts denote number of animals with capsid-specific antibodies covering each amino acid position ( x-axis ), and red bars denote positions of immunodominant epitopes. AAV9 capsid expresses as three isoforms (VP1/2/3).

    Techniques Used: Expressing, Injection, Plasmid Preparation, Electroporation, Mouse Assay

    15) Product Images from "Hili Inhibits HIV Replication in Activated T Cells"

    Article Title: Hili Inhibits HIV Replication in Activated T Cells

    Journal: Journal of Virology

    doi: 10.1128/JVI.00237-17

    Hili inhibits expression of GFP but not of codon-optimized EGFP proteins. (A) Codon usage of GFP and EGFP genes. Of two rare codons analyzed, GFP contains one Ile-AUA codon and 5 Arg-AGA codons. In EGFP, they were all optimized for abundant human Ile and Arg codons. (B) Hili inhibits the expression of GFP. GFP was coexpressed transiently with an empty vector (C bar) or Hili (hili bar) in 293T cells. Western blots reveal levels of coexpressed proteins and were normalized to tubulin. Densitometry of Western blots (performed using a Li-Cor instrument) revealed the relative expression levels of GFP in these cells (bar graphs below the Western blots). At the same time, RNA levels of GFP transcripts were determined by RT-qPCR. (C) Hili does not affect the expression of EGFP. The codon-optimized EGFP was coexpressed transiently with an empty vector (C bar) or with Hili (hili bar) in 293T cells. The quantitation of Western blots and EGFP transcripts was performed as described for panel A.
    Figure Legend Snippet: Hili inhibits expression of GFP but not of codon-optimized EGFP proteins. (A) Codon usage of GFP and EGFP genes. Of two rare codons analyzed, GFP contains one Ile-AUA codon and 5 Arg-AGA codons. In EGFP, they were all optimized for abundant human Ile and Arg codons. (B) Hili inhibits the expression of GFP. GFP was coexpressed transiently with an empty vector (C bar) or Hili (hili bar) in 293T cells. Western blots reveal levels of coexpressed proteins and were normalized to tubulin. Densitometry of Western blots (performed using a Li-Cor instrument) revealed the relative expression levels of GFP in these cells (bar graphs below the Western blots). At the same time, RNA levels of GFP transcripts were determined by RT-qPCR. (C) Hili does not affect the expression of EGFP. The codon-optimized EGFP was coexpressed transiently with an empty vector (C bar) or with Hili (hili bar) in 293T cells. The quantitation of Western blots and EGFP transcripts was performed as described for panel A.

    Techniques Used: Expressing, Plasmid Preparation, Western Blot, Quantitative RT-PCR, Quantitation Assay

    Mili binds preferentially to some tRNAs in cells. (A) Mili binds to tRNA in cells. 293T.mili cells were UV irradiated and lysed. Anti-GFP and anti-Piwil 2 antibodies were used to immunoprecipitate associated RNA species (lanes 3 and 4). RNA species were separated by the use of a 15% TBE-urea gel and stained with Sybr gold reagent. Bands were visualized with a Li-Cor instrument. Yeast tRNA was used as the marker for tRNA (lane 5). The additional RNA size marker is presented in lane 1. IgG served as the negative control (lane 2). Note that the tRNAs coimmunoprecipitated with Mili, but no smaller RNA species were observed (lanes 3 and 4). mw, molecular weight. (B) Mili binds preferentially to some tRNAs in cells. UV-irradiated (cross-linked) and anti-Piwil 2 immunoprecipitated RNA was subjected to 3′ end labeling with 32 P, separated by the use of 10% TBE-urea gels, and submitted to autoradiography. The band corresponding to tRNA was cut out of the gel, eluted, and hybridized to a human tRNA microarray. A heat map of this microarray is presented. Relative abundances of these tRNA species on Mili are compared to those in cells. Increasing intensities of red and green signify greater and lesser abundances of these species, respectively. (C) Data corresponding to up- or downregulated tRNAs from the experiment described in the panel B legend are presented in this bar graph, with arrows highlighting rare tRNAs. Note that the rare tRNA Ile (UAU) and tRNA Arg (UCU) are overrepresented on Mili and are highlighted as red bars. Fold increased and decreased abundance values are given below the bar graph.
    Figure Legend Snippet: Mili binds preferentially to some tRNAs in cells. (A) Mili binds to tRNA in cells. 293T.mili cells were UV irradiated and lysed. Anti-GFP and anti-Piwil 2 antibodies were used to immunoprecipitate associated RNA species (lanes 3 and 4). RNA species were separated by the use of a 15% TBE-urea gel and stained with Sybr gold reagent. Bands were visualized with a Li-Cor instrument. Yeast tRNA was used as the marker for tRNA (lane 5). The additional RNA size marker is presented in lane 1. IgG served as the negative control (lane 2). Note that the tRNAs coimmunoprecipitated with Mili, but no smaller RNA species were observed (lanes 3 and 4). mw, molecular weight. (B) Mili binds preferentially to some tRNAs in cells. UV-irradiated (cross-linked) and anti-Piwil 2 immunoprecipitated RNA was subjected to 3′ end labeling with 32 P, separated by the use of 10% TBE-urea gels, and submitted to autoradiography. The band corresponding to tRNA was cut out of the gel, eluted, and hybridized to a human tRNA microarray. A heat map of this microarray is presented. Relative abundances of these tRNA species on Mili are compared to those in cells. Increasing intensities of red and green signify greater and lesser abundances of these species, respectively. (C) Data corresponding to up- or downregulated tRNAs from the experiment described in the panel B legend are presented in this bar graph, with arrows highlighting rare tRNAs. Note that the rare tRNA Ile (UAU) and tRNA Arg (UCU) are overrepresented on Mili and are highlighted as red bars. Fold increased and decreased abundance values are given below the bar graph.

    Techniques Used: Irradiation, Staining, Marker, Negative Control, Molecular Weight, Immunoprecipitation, End Labeling, Autoradiography, Microarray

    Piwil proteins inhibit HIV replication. (A) Schematic representation of effectors and targets. Human and mouse Piwil 2 proteins (Hili and Mili, respectively) are 88% identical and 93% similar. They contain PAZ (piwi, argonaute, and zwili) and PIWI (P-element-induced wimpy) domains that bind to RNA. They contain 973 and 971 residues, respectively. pNL4-3 and pNL4-3.Luc plasmids encode the WT HIV-1 NL4-3 provirus and the mutant provirus, where the luciferase reporter gene was inserted into the Nef ORF (open reading frame), respectively. The env gene was inactivated by introducing a stop codon. Other ORFs are intact, including those coding for Gag, Pol, Vif (f), Vpr (r), Vpu (u), Tat, and Rev proteins. Their transcription is regulated by 5′ and 3′ long terminal repeats (LTRs) of HIV. The luciferase reporter gene was codon optimized for expression in human cells. (B) Expression of Hili and Mili inhibits HIV replication in 293T cells. Equivalent amounts of HIV-1 NL4-3 were transfected in 293T cells. Virus production was monitored with p24 ELISA in supernatants of infected cells. For the experiments whose results are represented by bar 2, Hili was expressed transiently in 293T cells (hili). For the experiments whose results are represented by bar 3, 293T cells stably expressed mili.EGFP (293T.mili). Supernatants were harvested 2 days after infection. Values were normalized to those of viruses produced in WT cells, which were 293T cells transfected with an empty vector (bar 1 [C bar]). The expression of Hili and Mili was monitored with anti-FLAG (Hili) and anti-GFP (Mili) antibodies by Western blotting. Tubulin represented the loading control. Error bars represent standard errors of the means (SEM) of results from 3 independent experiments ( n = 3), which were performed in duplicate. Student's t test was used to measure the significance of the data (*, P
    Figure Legend Snippet: Piwil proteins inhibit HIV replication. (A) Schematic representation of effectors and targets. Human and mouse Piwil 2 proteins (Hili and Mili, respectively) are 88% identical and 93% similar. They contain PAZ (piwi, argonaute, and zwili) and PIWI (P-element-induced wimpy) domains that bind to RNA. They contain 973 and 971 residues, respectively. pNL4-3 and pNL4-3.Luc plasmids encode the WT HIV-1 NL4-3 provirus and the mutant provirus, where the luciferase reporter gene was inserted into the Nef ORF (open reading frame), respectively. The env gene was inactivated by introducing a stop codon. Other ORFs are intact, including those coding for Gag, Pol, Vif (f), Vpr (r), Vpu (u), Tat, and Rev proteins. Their transcription is regulated by 5′ and 3′ long terminal repeats (LTRs) of HIV. The luciferase reporter gene was codon optimized for expression in human cells. (B) Expression of Hili and Mili inhibits HIV replication in 293T cells. Equivalent amounts of HIV-1 NL4-3 were transfected in 293T cells. Virus production was monitored with p24 ELISA in supernatants of infected cells. For the experiments whose results are represented by bar 2, Hili was expressed transiently in 293T cells (hili). For the experiments whose results are represented by bar 3, 293T cells stably expressed mili.EGFP (293T.mili). Supernatants were harvested 2 days after infection. Values were normalized to those of viruses produced in WT cells, which were 293T cells transfected with an empty vector (bar 1 [C bar]). The expression of Hili and Mili was monitored with anti-FLAG (Hili) and anti-GFP (Mili) antibodies by Western blotting. Tubulin represented the loading control. Error bars represent standard errors of the means (SEM) of results from 3 independent experiments ( n = 3), which were performed in duplicate. Student's t test was used to measure the significance of the data (*, P

    Techniques Used: Mutagenesis, Luciferase, Expressing, Transfection, Enzyme-linked Immunosorbent Assay, Infection, Stable Transfection, Produced, Plasmid Preparation, Western Blot

    Levels of tRNA Arg (UCU) are low in cells, and antisense Arg(UCU) oligonucleotides inhibit HIV replication. (A) tRNA Arg (UCU) represents 5% of all tRNA Arg in human cells. tRNA Arg (CGU) represents the vast majority of tRNA Arg in cells, determined by a tRNA sequencing analysis performed using 293T cells. The pie chart represents these ratios. (B) Five loci on different human chromosomes encode tRNA Arg (UCU). The locations of these loci and their relative abundances are presented in this pie chart. (C) HIV-1 NL4-3 contains 122 Arg-AGA codons. They are distributed in all reading frames and abundant in the gag-pol frame-shifting site (FS) and the RRE. The distribution in various ORFs of the virus is presented in this table. (D) Antisense Arg(UCU) oligonucleotides inhibit HIV replication in 293T cells. Specific and scrambled oligonucleotides were expressed in 293T cells for 24 h, and cells were then transfected with HIV-1 NL4-3 . At 48 h later, supernatants were harvested for levels of Gag p24 (top bar graph) and cells were examined for levels of tRNA Arg (UCU) by RT-qPCR (middle graph) and for viability (bottom graph). C, scrambled oligonucleotide; AS, Arg(UCU) oligonucleotide. Error bars represent SEM ( n = 3). (E) Antisense Arg(UCU) oligonucleotides inhibit HIV replication in CD4 + T cells. Specific and scrambled oligonucleotides were expressed in activated CD4 + T cells for 24 h. Cells were then infected with HIV-1 NL4-3 and examined as described for panel C. Error bars are as described for panel C. For panels D and E, error bars represent SEM of results from 3 independent experiments ( n = 3), which were performed in duplicate. Student's t test was used to measure the significance of the data (*, P
    Figure Legend Snippet: Levels of tRNA Arg (UCU) are low in cells, and antisense Arg(UCU) oligonucleotides inhibit HIV replication. (A) tRNA Arg (UCU) represents 5% of all tRNA Arg in human cells. tRNA Arg (CGU) represents the vast majority of tRNA Arg in cells, determined by a tRNA sequencing analysis performed using 293T cells. The pie chart represents these ratios. (B) Five loci on different human chromosomes encode tRNA Arg (UCU). The locations of these loci and their relative abundances are presented in this pie chart. (C) HIV-1 NL4-3 contains 122 Arg-AGA codons. They are distributed in all reading frames and abundant in the gag-pol frame-shifting site (FS) and the RRE. The distribution in various ORFs of the virus is presented in this table. (D) Antisense Arg(UCU) oligonucleotides inhibit HIV replication in 293T cells. Specific and scrambled oligonucleotides were expressed in 293T cells for 24 h, and cells were then transfected with HIV-1 NL4-3 . At 48 h later, supernatants were harvested for levels of Gag p24 (top bar graph) and cells were examined for levels of tRNA Arg (UCU) by RT-qPCR (middle graph) and for viability (bottom graph). C, scrambled oligonucleotide; AS, Arg(UCU) oligonucleotide. Error bars represent SEM ( n = 3). (E) Antisense Arg(UCU) oligonucleotides inhibit HIV replication in CD4 + T cells. Specific and scrambled oligonucleotides were expressed in activated CD4 + T cells for 24 h. Cells were then infected with HIV-1 NL4-3 and examined as described for panel C. Error bars are as described for panel C. For panels D and E, error bars represent SEM of results from 3 independent experiments ( n = 3), which were performed in duplicate. Student's t test was used to measure the significance of the data (*, P

    Techniques Used: Sequencing, Transfection, Quantitative RT-PCR, Infection

    16) Product Images from "The Caulobacter crescentus phage phiCbK: genomics of a canonical phage"

    Article Title: The Caulobacter crescentus phage phiCbK: genomics of a canonical phage

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-13-542

    Non-proportional synteny map showing the relationships between related C. crescentus phages at the protein level. The black blocks represent protein-coding genes in the order they appear in each phage genome, starting with gp1 at the top and running clockwise, with red tick marks indicating 10-gene intervals in phage phiCbK. Black lines connecting blocks indicate similarity of proteins between phages. From innermost to outermost, tracks represent phages phiCbK, Karma, Magneto, Swift and Rogue. Blue, green and purple arcs on the inside track indicate the boundaries of the phage morphogenesis, lysis and DNA replication modules, respectively. Terminal repeat regions were excluded from this figure for clarity.
    Figure Legend Snippet: Non-proportional synteny map showing the relationships between related C. crescentus phages at the protein level. The black blocks represent protein-coding genes in the order they appear in each phage genome, starting with gp1 at the top and running clockwise, with red tick marks indicating 10-gene intervals in phage phiCbK. Black lines connecting blocks indicate similarity of proteins between phages. From innermost to outermost, tracks represent phages phiCbK, Karma, Magneto, Swift and Rogue. Blue, green and purple arcs on the inside track indicate the boundaries of the phage morphogenesis, lysis and DNA replication modules, respectively. Terminal repeat regions were excluded from this figure for clarity.

    Techniques Used: Lysis

    The left and right genomic terminal repeat boundaries of phage phiCbK and four phiCbK-like phages. Terminal boundaries are indicated by the vertical red lines. Above: aligned DNA sequences 12 bp up- and downstream of each terminus are shown; alignments show that the experimentally confirmed boundary sequences of phiCbK are nearly identical to those found in the other four close phiCbK-like relatives. Below: average fold coverage at each base position for all five genomic sequences; note the coverage within the terminal repeats is approximately twofold greater than the surrounding genome, and the breakpoints are identical.
    Figure Legend Snippet: The left and right genomic terminal repeat boundaries of phage phiCbK and four phiCbK-like phages. Terminal boundaries are indicated by the vertical red lines. Above: aligned DNA sequences 12 bp up- and downstream of each terminus are shown; alignments show that the experimentally confirmed boundary sequences of phiCbK are nearly identical to those found in the other four close phiCbK-like relatives. Below: average fold coverage at each base position for all five genomic sequences; note the coverage within the terminal repeats is approximately twofold greater than the surrounding genome, and the breakpoints are identical.

    Techniques Used: Genomic Sequencing

    Genomic map of C. crescentus phage phiCbK. Predicted genes are represented by boxes above and below the black line; boxes above the line are genes encoded on the forward strand, those below the line are on the reverse strand. Segments of heavier black line at each end of the genome represent the 10.3 kb terminal repeats present in the genome. Gene features (conserved, unique, hypothetical novel and virion-associated proteins; tRNA genes) and genome modules (assembly, lysis and DNA replication) are color-coded according to the legend below the figure. Selected genes and gene modules are annotated based on predicted function, as documented in Table S1 and the text. The ruler below the genomes indicates scale in kb.
    Figure Legend Snippet: Genomic map of C. crescentus phage phiCbK. Predicted genes are represented by boxes above and below the black line; boxes above the line are genes encoded on the forward strand, those below the line are on the reverse strand. Segments of heavier black line at each end of the genome represent the 10.3 kb terminal repeats present in the genome. Gene features (conserved, unique, hypothetical novel and virion-associated proteins; tRNA genes) and genome modules (assembly, lysis and DNA replication) are color-coded according to the legend below the figure. Selected genes and gene modules are annotated based on predicted function, as documented in Table S1 and the text. The ruler below the genomes indicates scale in kb.

    Techniques Used: Lysis

    DNA sequence relatedness of six phiCbK-like phages. Upper section: pairwise percent DNA sequence identities between all six phages, as determined by BlastN analysis [ 37 ] followed by multiplication of the mean percent identity of matched segments by the percent length of the genomes matched. Lower section: dotplots visually representing DNA sequence homology between phages. For clarity, terminal repeat regions were removed from the DNA sequences prior to analysis.
    Figure Legend Snippet: DNA sequence relatedness of six phiCbK-like phages. Upper section: pairwise percent DNA sequence identities between all six phages, as determined by BlastN analysis [ 37 ] followed by multiplication of the mean percent identity of matched segments by the percent length of the genomes matched. Lower section: dotplots visually representing DNA sequence homology between phages. For clarity, terminal repeat regions were removed from the DNA sequences prior to analysis.

    Techniques Used: Sequencing

    17) Product Images from "A Modified RNA-Seq Approach for Whole Genome Sequencing of RNA Viruses from Faecal and Blood Samples"

    Article Title: A Modified RNA-Seq Approach for Whole Genome Sequencing of RNA Viruses from Faecal and Blood Samples

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0066129

    Schematic representation of different strategies for viral genome resequencing. A) Total RNA library: all the RNA species present in the sample are sequenced, no assumption on which genome is present, B) Hybridisation capture of a mRNA library: a good reference genome is needed to design the probes for capture, C) PCR enrichment: the desired genome is amplified from cDNA, a reference genome is needed to design specific oligos. Red lines, genomes of interest; Blue segments, Illumina adapters; Black lines, other RNA species.
    Figure Legend Snippet: Schematic representation of different strategies for viral genome resequencing. A) Total RNA library: all the RNA species present in the sample are sequenced, no assumption on which genome is present, B) Hybridisation capture of a mRNA library: a good reference genome is needed to design the probes for capture, C) PCR enrichment: the desired genome is amplified from cDNA, a reference genome is needed to design specific oligos. Red lines, genomes of interest; Blue segments, Illumina adapters; Black lines, other RNA species.

    Techniques Used: Hybridization, Capture-C, Polymerase Chain Reaction, Amplification

    18) Product Images from "Fine-mapping and transcriptome analysis of a candidate gene controlling plant height in Brassica napus L."

    Article Title: Fine-mapping and transcriptome analysis of a candidate gene controlling plant height in Brassica napus L.

    Journal: Biotechnology for Biofuels

    doi: 10.1186/s13068-020-01687-y

    KEGG pathway categories of differentially expressed genes between NY18 and df59 at the stem elongation stage
    Figure Legend Snippet: KEGG pathway categories of differentially expressed genes between NY18 and df59 at the stem elongation stage

    Techniques Used:

    Phenotypic characterization of NY18, df59 , and their F 1 at different developmental stages. a Morphology of the NY18, df59 and their F 1 at the seedling stage; b comparison of leaf phenotypes at the seedling stage; c comparison of internode lengths at the mature stage; d comparison of petal phenotypes at the flowering stage; e comparison of silique-related traits at the mature stage; f comparison of plant heights and plant architecture at the mature stage. Scale bars = 10 cm
    Figure Legend Snippet: Phenotypic characterization of NY18, df59 , and their F 1 at different developmental stages. a Morphology of the NY18, df59 and their F 1 at the seedling stage; b comparison of leaf phenotypes at the seedling stage; c comparison of internode lengths at the mature stage; d comparison of petal phenotypes at the flowering stage; e comparison of silique-related traits at the mature stage; f comparison of plant heights and plant architecture at the mature stage. Scale bars = 10 cm

    Techniques Used:

    19) Product Images from "Assessment of piRNA biogenesis and function in testicular germ cell tumors and their precursor germ cell neoplasia in situ"

    Article Title: Assessment of piRNA biogenesis and function in testicular germ cell tumors and their precursor germ cell neoplasia in situ

    Journal: BMC Cancer

    doi: 10.1186/s12885-017-3945-6

    Knockdown of PL2L60A in TERA1 cell line leads to transcriptional upregulation of transposable elements. a , Transcription level of PL2L60A gene and the following retrotransposons: full-length L1HS/L1PA2/L1PA3s, all Alu elements, AluYa5 subfamily. b , Fraction of TE-deriving small RNAs for full-length L1HS/L1PA2/L1PA3s, all Alu elements, AluYa5 subfamily. c , Chromatin modifications (H3K4me3 and H3K9me3) around all Alu elements, AluYa5 subfamily, and 5’UTR promoter of full-length L1HS/L1PA2/L1PA3. d , DNA methylation level around 5’UTR promoter of full-length L1HS/L1PA2/L1PA3 TEs. The graphs show mean and standard deviation across three biological replicates. P-value for two-tailed Mann-Whitney test is presented (n.s. – non-significant). scRNA – control scrambled RNA, siRNA – anti-PL2L60A siRNA
    Figure Legend Snippet: Knockdown of PL2L60A in TERA1 cell line leads to transcriptional upregulation of transposable elements. a , Transcription level of PL2L60A gene and the following retrotransposons: full-length L1HS/L1PA2/L1PA3s, all Alu elements, AluYa5 subfamily. b , Fraction of TE-deriving small RNAs for full-length L1HS/L1PA2/L1PA3s, all Alu elements, AluYa5 subfamily. c , Chromatin modifications (H3K4me3 and H3K9me3) around all Alu elements, AluYa5 subfamily, and 5’UTR promoter of full-length L1HS/L1PA2/L1PA3. d , DNA methylation level around 5’UTR promoter of full-length L1HS/L1PA2/L1PA3 TEs. The graphs show mean and standard deviation across three biological replicates. P-value for two-tailed Mann-Whitney test is presented (n.s. – non-significant). scRNA – control scrambled RNA, siRNA – anti-PL2L60A siRNA

    Techniques Used: DNA Methylation Assay, Standard Deviation, Two Tailed Test, MANN-WHITNEY

    20) Product Images from "Comparative analyses of the major royal jelly protein gene cluster in three Apis species with long amplicon sequencing"

    Article Title: Comparative analyses of the major royal jelly protein gene cluster in three Apis species with long amplicon sequencing

    Journal: DNA Research: An International Journal for Rapid Publication of Reports on Genes and Genomes

    doi: 10.1093/dnares/dsw064

    Graphical presentation of the data analysis pipeline. 2D raw reads (1) were size-selected (minimum read length of 6.5 kb) (2) and mapped against the three reference genomes, in order to assign the reads by species and genomic target (3). Only those reads that matched our quality filters (similarity fraction: 0.6 [0.5 for adAmp3, 6 and 7], length fraction: 0.7 [0.5 for adAmp3, 6 and 7]) were included in further analyses (4). Per amplicon sixteen reads (minimum number of reads that mapped to an amplicon—amAmp6) were selected and aligned to each other independent of a reference sequence to build the nanopore-derived consensus sequence (5). Finally, the consensus sequence and the reference sequence were aligned (6). In order to correct the genomic reference sequences of the mrjp gene cluster of A. mellifera , A. florea and A. dorsata , assembly gaps (N) and local mis-assemblies were identified based on this consensus/reference sequence alignment. Assembly gaps (N) in the reference sequence were replaced with the consensus sequence and mis-assemblies were either discarded (when only present in the reference but not in the consensus sequence) or included (when only present in the consensus but not in the reference sequence).
    Figure Legend Snippet: Graphical presentation of the data analysis pipeline. 2D raw reads (1) were size-selected (minimum read length of 6.5 kb) (2) and mapped against the three reference genomes, in order to assign the reads by species and genomic target (3). Only those reads that matched our quality filters (similarity fraction: 0.6 [0.5 for adAmp3, 6 and 7], length fraction: 0.7 [0.5 for adAmp3, 6 and 7]) were included in further analyses (4). Per amplicon sixteen reads (minimum number of reads that mapped to an amplicon—amAmp6) were selected and aligned to each other independent of a reference sequence to build the nanopore-derived consensus sequence (5). Finally, the consensus sequence and the reference sequence were aligned (6). In order to correct the genomic reference sequences of the mrjp gene cluster of A. mellifera , A. florea and A. dorsata , assembly gaps (N) and local mis-assemblies were identified based on this consensus/reference sequence alignment. Assembly gaps (N) in the reference sequence were replaced with the consensus sequence and mis-assemblies were either discarded (when only present in the reference but not in the consensus sequence) or included (when only present in the consensus but not in the reference sequence).

    Techniques Used: Amplification, Sequencing, Derivative Assay

    21) Product Images from "Efficient generation of complete sequences of MDR-encoding plasmids by rapid assembly of MinION barcoding sequencing data"

    Article Title: Efficient generation of complete sequences of MDR-encoding plasmids by rapid assembly of MinION barcoding sequencing data

    Journal: GigaScience

    doi: 10.1093/gigascience/gix132

    Workflow and time span overview of the MinION nanopore sequencing and assembly process. This workflow was based on the rapid barcoding sequencing kit, which could pool 12 samples in a single run. The time for basecalling and de novo assembly depended on the computational performance of the computer utilized, and Illumina short reads were needed if Unicycler was used to obtain high-quality assembled plasmids.
    Figure Legend Snippet: Workflow and time span overview of the MinION nanopore sequencing and assembly process. This workflow was based on the rapid barcoding sequencing kit, which could pool 12 samples in a single run. The time for basecalling and de novo assembly depended on the computational performance of the computer utilized, and Illumina short reads were needed if Unicycler was used to obtain high-quality assembled plasmids.

    Techniques Used: Nanopore Sequencing, Sequencing

    22) Product Images from "Time-resolved dual transcriptomics reveal early induced Nicotiana benthamiana root genes and conserved infection-promoting Phytophthora palmivora effectors"

    Article Title: Time-resolved dual transcriptomics reveal early induced Nicotiana benthamiana root genes and conserved infection-promoting Phytophthora palmivora effectors

    Journal: BMC Biology

    doi: 10.1186/s12915-017-0379-1

    Spatial distribution of REX effectors in N. benthamiana roots. a – d Transgenic N. benthamiana plants expressing GFP:FLAG-REX fusion proteins were regenerated from leaf explants and grown to seeds. Subcellular localisation of GFP:FLAG-REX1–4 was assessed on seedling roots stained with propidium iodide ( PI ). GFP:FLAG-REX1 ( a ), GFP:FLAG-REX2 ( b ) and GFP:FLAG-REX4 ( d ) accumulated in the cytoplasm and in the nucleus. GFP:FLAG-REX3 ( c ) was detected in the cytoplasm but was excluded from the nucleus. Scale bar is 10 μm
    Figure Legend Snippet: Spatial distribution of REX effectors in N. benthamiana roots. a – d Transgenic N. benthamiana plants expressing GFP:FLAG-REX fusion proteins were regenerated from leaf explants and grown to seeds. Subcellular localisation of GFP:FLAG-REX1–4 was assessed on seedling roots stained with propidium iodide ( PI ). GFP:FLAG-REX1 ( a ), GFP:FLAG-REX2 ( b ) and GFP:FLAG-REX4 ( d ) accumulated in the cytoplasm and in the nucleus. GFP:FLAG-REX3 ( c ) was detected in the cytoplasm but was excluded from the nucleus. Scale bar is 10 μm

    Techniques Used: Transgenic Assay, Expressing, Staining

    REX2 and REX3 increase N. benthamiana susceptibility to P. palmivora , and REX3 interferes with host secretion . Transgenic N. benthamiana plants expressing GFP16c (control) or GFP:FLAG-REX1 to GFP:FLAG-REX4 were challenged with zoospores from P. palmivora YKDEL, and disease progression was ranked over time using the previously defined symptom extent stages ( SESs ). a Representative disease progression curves for transgenic plants expressing GFP:FLAG-REX1 ( yellow ), GFP:FLAG-REX2 ( blue ), GFP:FLAG-REX3 ( green ) or GFP:FLAG-REX4 ( magenta ) compared to GFP16c control plants ( red dashed ). p values were determined based on Scheirer-Ray-Hare nonparametric two-way analysis of variance ( ANOVA ) for ranked data. The experiment was carried out in duplicate ( N = 22 plants). b Representative pictures of infected plants, 8 days after infection. c Disease-promoting effectors REX2 and REX3 were co-expressed with a secreted GFP construct (SP PR1 -GFP) in N. benthamiana leaves. GFP fluorescence was quantified along the nucleus
    Figure Legend Snippet: REX2 and REX3 increase N. benthamiana susceptibility to P. palmivora , and REX3 interferes with host secretion . Transgenic N. benthamiana plants expressing GFP16c (control) or GFP:FLAG-REX1 to GFP:FLAG-REX4 were challenged with zoospores from P. palmivora YKDEL, and disease progression was ranked over time using the previously defined symptom extent stages ( SESs ). a Representative disease progression curves for transgenic plants expressing GFP:FLAG-REX1 ( yellow ), GFP:FLAG-REX2 ( blue ), GFP:FLAG-REX3 ( green ) or GFP:FLAG-REX4 ( magenta ) compared to GFP16c control plants ( red dashed ). p values were determined based on Scheirer-Ray-Hare nonparametric two-way analysis of variance ( ANOVA ) for ranked data. The experiment was carried out in duplicate ( N = 22 plants). b Representative pictures of infected plants, 8 days after infection. c Disease-promoting effectors REX2 and REX3 were co-expressed with a secreted GFP construct (SP PR1 -GFP) in N. benthamiana leaves. GFP fluorescence was quantified along the nucleus

    Techniques Used: Transgenic Assay, Expressing, Infection, Construct, Fluorescence

    The promoter of a gene encoding the secreted peptide TIPTOP is upregulated during early biotrophy in N. benthamiana roots. a Representative pictures of beta-glucuronidase ( GUS )-stained whole root systems of N. benthamiana transgenics carrying TIPTOP pro ::GFP:GUS, non-infected or 16 h after infection with P. palmivora LILI-tdTomato. Stars represent unstained root tips. Arrowheads represent stained root tips. b Representative pictures of infected root tips after GUS staining, showing GUS signal at the vicinity of infection sites (top panels). Uninfected root tips from the same plant do not show any staining (bottom panels). Scale bar is 25 μm. c Representative pictures of GFP signal at the root tip of infected N. benthamiana transgenics expressing GFP:GUS fusion under the control of TIPTOP promoter
    Figure Legend Snippet: The promoter of a gene encoding the secreted peptide TIPTOP is upregulated during early biotrophy in N. benthamiana roots. a Representative pictures of beta-glucuronidase ( GUS )-stained whole root systems of N. benthamiana transgenics carrying TIPTOP pro ::GFP:GUS, non-infected or 16 h after infection with P. palmivora LILI-tdTomato. Stars represent unstained root tips. Arrowheads represent stained root tips. b Representative pictures of infected root tips after GUS staining, showing GUS signal at the vicinity of infection sites (top panels). Uninfected root tips from the same plant do not show any staining (bottom panels). Scale bar is 25 μm. c Representative pictures of GFP signal at the root tip of infected N. benthamiana transgenics expressing GFP:GUS fusion under the control of TIPTOP promoter

    Techniques Used: Staining, Infection, Expressing

    Phytophthora palmivora exerts a hemibiotrophic lifestyle in Nicotiana benthamiana roots. a Representative pictures of root-infected plantlets during P. palmivora infection, showing disease progression on the aboveground tissues. The successive symptom extent stages ( SESs ) were used to define a disease index in order to quantitate disease progression over time. b – h Microscopic analysis of N. benthamiana roots inoculated with transgenic P. palmivora LILI expressing an endoplasmic reticulum ( ER )-targeted yellow fluorescent protein ( YFP ). Pictures were taken during penetration ( b , 3 h after inoculation ( hai )), early infection ( c , 6 hai), biotrophy ( d , 18 hai and e , 24 hai), switch to necrotrophy ( f , 30 hai) and necrotrophy ( g , 48 hai and h , 72 hai). Each panel shows transmission light ( Transmission ) and merged YFP fluorescence with propidium iodide ( PI ) staining ( YFP + PI ). Hy hypha, Ve vesicle, Cy cyst, Ha haustorium. Scale bar is 10 μm. i Quantification of P. palmivora biomass accumulation over time in N. benthamiana roots was measured by expression of P. palmivora WS21 relative to N. benthamiana L23 and F-box reference genes. j , k Expression of P. palmivora lifestyle marker genes Hmp1 ( j ) and Cdc14 ( k ) were measured over time relative to P. palmivora WS21 and OPEL reference genes. Quantitative RT-PCR experiments were performed in triplicate. Circles represent values for each replicate. Bars represent the mean value. Statistical significance has been assessed using one-way analysis of variance ( ANOVA ) and Tukey’s honestly significant difference ( HSD ) test ( p
    Figure Legend Snippet: Phytophthora palmivora exerts a hemibiotrophic lifestyle in Nicotiana benthamiana roots. a Representative pictures of root-infected plantlets during P. palmivora infection, showing disease progression on the aboveground tissues. The successive symptom extent stages ( SESs ) were used to define a disease index in order to quantitate disease progression over time. b – h Microscopic analysis of N. benthamiana roots inoculated with transgenic P. palmivora LILI expressing an endoplasmic reticulum ( ER )-targeted yellow fluorescent protein ( YFP ). Pictures were taken during penetration ( b , 3 h after inoculation ( hai )), early infection ( c , 6 hai), biotrophy ( d , 18 hai and e , 24 hai), switch to necrotrophy ( f , 30 hai) and necrotrophy ( g , 48 hai and h , 72 hai). Each panel shows transmission light ( Transmission ) and merged YFP fluorescence with propidium iodide ( PI ) staining ( YFP + PI ). Hy hypha, Ve vesicle, Cy cyst, Ha haustorium. Scale bar is 10 μm. i Quantification of P. palmivora biomass accumulation over time in N. benthamiana roots was measured by expression of P. palmivora WS21 relative to N. benthamiana L23 and F-box reference genes. j , k Expression of P. palmivora lifestyle marker genes Hmp1 ( j ) and Cdc14 ( k ) were measured over time relative to P. palmivora WS21 and OPEL reference genes. Quantitative RT-PCR experiments were performed in triplicate. Circles represent values for each replicate. Bars represent the mean value. Statistical significance has been assessed using one-way analysis of variance ( ANOVA ) and Tukey’s honestly significant difference ( HSD ) test ( p

    Techniques Used: Infection, Transgenic Assay, Expressing, Transmission Assay, Fluorescence, Staining, Marker, Quantitative RT-PCR

    N. benthamiana and P. palmivora transcriptomes show different temporal dynamics during interaction. a , b PCA clustering of full transcriptional profiles of N. benthamiana ( a ) and P. palmivora ( b ). c , d Venn diagrams show shared genes expressed in groups identified by PCA analysis for N. benthamiana ( c ) and P. palmivora ( d ). Genes with transcripts per million ( TPM ) ≥5 were considered to be expressed. e , f Hierarchical clustering of major classes of differentially expressed genes ( p value
    Figure Legend Snippet: N. benthamiana and P. palmivora transcriptomes show different temporal dynamics during interaction. a , b PCA clustering of full transcriptional profiles of N. benthamiana ( a ) and P. palmivora ( b ). c , d Venn diagrams show shared genes expressed in groups identified by PCA analysis for N. benthamiana ( c ) and P. palmivora ( d ). Genes with transcripts per million ( TPM ) ≥5 were considered to be expressed. e , f Hierarchical clustering of major classes of differentially expressed genes ( p value

    Techniques Used:

    23) Product Images from "Small RNA-mediated DNA (cytosine-5) methyltransferase 1 inhibition leads to aberrant DNA methylation"

    Article Title: Small RNA-mediated DNA (cytosine-5) methyltransferase 1 inhibition leads to aberrant DNA methylation

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkv518

    Genome-wide DNA methylation profile of miR-155-5p transfected cells. ( A ) Scatter plot displaying differentially methylated regions in the genome after HCT116 cells were transfected with miR-155-5p or random 23-mers control RNA. The methylation difference (miR-155-5p minus random 23-mers transfected, average value of two biological replicates) was plotted against the –log 10 P- value. Green dots represent significantly changed regions. Numbers of differentially methylated regions were annotated in the plot. ( B ) Box plot showing the methylation level in replicates across the bins with increasing methylation level averages. ( C ) CpG site density curve per 10 kb in all regions, hypermethylated regions and hypomethylated regions. ( D ) Average differential methylation in genomic repetitive elements.
    Figure Legend Snippet: Genome-wide DNA methylation profile of miR-155-5p transfected cells. ( A ) Scatter plot displaying differentially methylated regions in the genome after HCT116 cells were transfected with miR-155-5p or random 23-mers control RNA. The methylation difference (miR-155-5p minus random 23-mers transfected, average value of two biological replicates) was plotted against the –log 10 P- value. Green dots represent significantly changed regions. Numbers of differentially methylated regions were annotated in the plot. ( B ) Box plot showing the methylation level in replicates across the bins with increasing methylation level averages. ( C ) CpG site density curve per 10 kb in all regions, hypermethylated regions and hypomethylated regions. ( D ) Average differential methylation in genomic repetitive elements.

    Techniques Used: Genome Wide, DNA Methylation Assay, Transfection, Methylation

    24) Product Images from "A Robust Analytical Pipeline for Genome-Wide Identification of the Genes Regulated by a Transcription Factor: Combinatorial Analysis Performed Using gSELEX-Seq and RNA-Seq"

    Article Title: A Robust Analytical Pipeline for Genome-Wide Identification of the Genes Regulated by a Transcription Factor: Combinatorial Analysis Performed Using gSELEX-Seq and RNA-Seq

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0159011

    Flow cytometric analysis of selected DNA pools from gSELEX by using bead display. (A) Dot-plot of log fluorescence analysis. X-axis: quantified fluorescence intensity detected within the FL1 (fluorescein) channel; Y-axis: quantified fluorescence intensity detected within the FL5 (Cy5) channel. (B) Relative binding affinities measured against AmyR. The binding affinity was defined as the geometric mean of the intensity of FL1 divided by that of FL5 and the binding affinity of agdAΔ53 (a mutant of AmyR-binding DNA) against AmyR, which was set as 1.
    Figure Legend Snippet: Flow cytometric analysis of selected DNA pools from gSELEX by using bead display. (A) Dot-plot of log fluorescence analysis. X-axis: quantified fluorescence intensity detected within the FL1 (fluorescein) channel; Y-axis: quantified fluorescence intensity detected within the FL5 (Cy5) channel. (B) Relative binding affinities measured against AmyR. The binding affinity was defined as the geometric mean of the intensity of FL1 divided by that of FL5 and the binding affinity of agdAΔ53 (a mutant of AmyR-binding DNA) against AmyR, which was set as 1.

    Techniques Used: Fluorescence, Binding Assay, Mutagenesis

    Schematic presentation of gSELEX-Seq used for selecting TF-binding sites in a genome. (1) A MalE-tagged TF is added to a genomic library mixture and the DNA-binding reaction of the TF is performed. (2) Amylose resin is added. (3) The MalE-tagged TF-amylose-resin complex is recovered. (4) The DNA fragments bound by the TF are amplified using PCR. This recovered DNA pool is used in a subsequent selection round (5) or high-throughput DNA sequencing (6).
    Figure Legend Snippet: Schematic presentation of gSELEX-Seq used for selecting TF-binding sites in a genome. (1) A MalE-tagged TF is added to a genomic library mixture and the DNA-binding reaction of the TF is performed. (2) Amylose resin is added. (3) The MalE-tagged TF-amylose-resin complex is recovered. (4) The DNA fragments bound by the TF are amplified using PCR. This recovered DNA pool is used in a subsequent selection round (5) or high-throughput DNA sequencing (6).

    Techniques Used: Binding Assay, Amplification, Polymerase Chain Reaction, Selection, High Throughput Screening Assay, DNA Sequencing

    25) Product Images from "A high throughput screen for active human transposable elements"

    Article Title: A high throughput screen for active human transposable elements

    Journal: BMC Genomics

    doi: 10.1186/s12864-018-4485-4

    TE-NGS sequencing workflow. Enrichment for genomic fragments spanning active TEs and their unique flanking sequence is achieved by several enzymatic steps as described in the main text. First, genomic DNA is sheared, and adapters for sequencing are ligated to the genomic fragments following standard library preparation protocols. Next, a small aliquot (10 ng) of library is used as template for targeted amplification with primers complementary to TE subfamily-specific sequences and to the Illumina Universal PCR (P5) primer. Remaining genomic background fragments and inverted TEs in head-to-head orientation are removed by ssDNA exonuclease digestion after linear PCR amplification with TE-target primers or Illumina Universal primer, respectively. Last, amplification with nested primers targeting TE diagnostic bases, and containing Illumina i7 index and P7 primer sequences generates full double-stranded dual-adapter libraries containing unique indices for each sample and each TE subfamily, allowing for downstream pooling and multiplexing of many samples simultaneously. High throughput sequencing followed by alignment to the reference genome demarcates the TE insertion site by its 3′ end (read 2) and unique flanking sequence (read 1). TE insertions present in the reference genome can be identified by clustering of read pairs, whereas read 2 generated from polymorphic or novel TE insertions absent from the reference will map with lower quality and/or not at all; these TE can be identified by clusters of read 1 alone (see Methods; Supplemental Material for detailed procedures)
    Figure Legend Snippet: TE-NGS sequencing workflow. Enrichment for genomic fragments spanning active TEs and their unique flanking sequence is achieved by several enzymatic steps as described in the main text. First, genomic DNA is sheared, and adapters for sequencing are ligated to the genomic fragments following standard library preparation protocols. Next, a small aliquot (10 ng) of library is used as template for targeted amplification with primers complementary to TE subfamily-specific sequences and to the Illumina Universal PCR (P5) primer. Remaining genomic background fragments and inverted TEs in head-to-head orientation are removed by ssDNA exonuclease digestion after linear PCR amplification with TE-target primers or Illumina Universal primer, respectively. Last, amplification with nested primers targeting TE diagnostic bases, and containing Illumina i7 index and P7 primer sequences generates full double-stranded dual-adapter libraries containing unique indices for each sample and each TE subfamily, allowing for downstream pooling and multiplexing of many samples simultaneously. High throughput sequencing followed by alignment to the reference genome demarcates the TE insertion site by its 3′ end (read 2) and unique flanking sequence (read 1). TE insertions present in the reference genome can be identified by clustering of read pairs, whereas read 2 generated from polymorphic or novel TE insertions absent from the reference will map with lower quality and/or not at all; these TE can be identified by clusters of read 1 alone (see Methods; Supplemental Material for detailed procedures)

    Techniques Used: Next-Generation Sequencing, Sequencing, Amplification, Polymerase Chain Reaction, Diagnostic Assay, Multiplexing, Generated

    26) Product Images from "A high throughput screen for active human transposable elements"

    Article Title: A high throughput screen for active human transposable elements

    Journal: BMC Genomics

    doi: 10.1186/s12864-018-4485-4

    TE-NGS sequencing workflow. Enrichment for genomic fragments spanning active TEs and their unique flanking sequence is achieved by several enzymatic steps as described in the main text. First, genomic DNA is sheared, and adapters for sequencing are ligated to the genomic fragments following standard library preparation protocols. Next, a small aliquot (10 ng) of library is used as template for targeted amplification with primers complementary to TE subfamily-specific sequences and to the Illumina Universal PCR (P5) primer. Remaining genomic background fragments and inverted TEs in head-to-head orientation are removed by ssDNA exonuclease digestion after linear PCR amplification with TE-target primers or Illumina Universal primer, respectively. Last, amplification with nested primers targeting TE diagnostic bases, and containing Illumina i7 index and P7 primer sequences generates full double-stranded dual-adapter libraries containing unique indices for each sample and each TE subfamily, allowing for downstream pooling and multiplexing of many samples simultaneously. High throughput sequencing followed by alignment to the reference genome demarcates the TE insertion site by its 3′ end (read 2) and unique flanking sequence (read 1). TE insertions present in the reference genome can be identified by clustering of read pairs, whereas read 2 generated from polymorphic or novel TE insertions absent from the reference will map with lower quality and/or not at all; these TE can be identified by clusters of read 1 alone (see Methods; Supplemental Material for detailed procedures)
    Figure Legend Snippet: TE-NGS sequencing workflow. Enrichment for genomic fragments spanning active TEs and their unique flanking sequence is achieved by several enzymatic steps as described in the main text. First, genomic DNA is sheared, and adapters for sequencing are ligated to the genomic fragments following standard library preparation protocols. Next, a small aliquot (10 ng) of library is used as template for targeted amplification with primers complementary to TE subfamily-specific sequences and to the Illumina Universal PCR (P5) primer. Remaining genomic background fragments and inverted TEs in head-to-head orientation are removed by ssDNA exonuclease digestion after linear PCR amplification with TE-target primers or Illumina Universal primer, respectively. Last, amplification with nested primers targeting TE diagnostic bases, and containing Illumina i7 index and P7 primer sequences generates full double-stranded dual-adapter libraries containing unique indices for each sample and each TE subfamily, allowing for downstream pooling and multiplexing of many samples simultaneously. High throughput sequencing followed by alignment to the reference genome demarcates the TE insertion site by its 3′ end (read 2) and unique flanking sequence (read 1). TE insertions present in the reference genome can be identified by clustering of read pairs, whereas read 2 generated from polymorphic or novel TE insertions absent from the reference will map with lower quality and/or not at all; these TE can be identified by clusters of read 1 alone (see Methods; Supplemental Material for detailed procedures)

    Techniques Used: Next-Generation Sequencing, Sequencing, Amplification, Polymerase Chain Reaction, Diagnostic Assay, Multiplexing, Generated

    27) Product Images from "de novo assembly and population genomic survey of natural yeast isolates with the Oxford Nanopore MinION sequencer"

    Article Title: de novo assembly and population genomic survey of natural yeast isolates with the Oxford Nanopore MinION sequencer

    Journal: GigaScience

    doi: 10.1093/gigascience/giw018

    Cartography of the Ty transposon family. First and second tracks show, respectively, the percentage identity of the SMARTdenovo S288C assembly before and after polishing with Illumina paired-end reads using Pilon. The third track shows the 80th percentile number of contigs obtained for each strain and for all chromosomes. The remaining tracks show the density of Ty transposons or positions of the Ty1, Ty2, Ty3, Ty4, and Ty5 transposons across all the yeast strains. The red dot on the karyotype track shows the position of the rDNA cluster.
    Figure Legend Snippet: Cartography of the Ty transposon family. First and second tracks show, respectively, the percentage identity of the SMARTdenovo S288C assembly before and after polishing with Illumina paired-end reads using Pilon. The third track shows the 80th percentile number of contigs obtained for each strain and for all chromosomes. The remaining tracks show the density of Ty transposons or positions of the Ty1, Ty2, Ty3, Ty4, and Ty5 transposons across all the yeast strains. The red dot on the karyotype track shows the position of the rDNA cluster.

    Techniques Used:

    28) Product Images from "FBXL19 recruits CDK-Mediator to CpG islands of developmental genes priming them for activation during lineage commitment"

    Article Title: FBXL19 recruits CDK-Mediator to CpG islands of developmental genes priming them for activation during lineage commitment

    Journal: eLife

    doi: 10.7554/eLife.37084

    CDK8/19 peptide sequences identified by mass spectrometry.
    Figure Legend Snippet: CDK8/19 peptide sequences identified by mass spectrometry.

    Techniques Used: Mass Spectrometry

    FBXL19 interacts with the CDK-Mediator complex in ES cells. ( A ) A representative silver-stained gel for FS2-FBXL19 purification and an empty vector control (EV) purification. Asterisk identifies the band corresponding to FS2-FBXL19 protein. ( B ) In order to visualize FBXL19 protein by western blot in Figure 2—figure supplement 1D and Figure 4B , the Fbxl19 gene was tagged by T7 knock-in in Fbxl19 fl/fl ES cells using the CRISPR Cas9 system. A schematic representation of the generation of the C-terminal T7 knock-in Fbxl19 is shown. HA1/2 indicate the homology arms of the targeting construct. ( C ) Western blot analysis of the expression of T7-FBXL19 from nuclear extract of the generated T7 knock-in ES cell line. ( D ) Western blot analysis of endogenous co-immunoprecipitation (IP) of FBXL19, CDK8 and MED12 from ES cell nuclear extracts. A control IP using a non-specific antibody (α-ΗΑ) was included. ( E ) A schematic illustration of the different FS2-FBXL19 truncation mutants and Western blot analysis of purification of FS2-FBXL19 mutants from HEK293T cells probed with the indicated antibodies. ( F ) Western blot analysis of FS2-FBXL19 and control purifications (EV) probed with the indicated antibodies. ( G ) Western blot analysis of histone extracts generated from Fbxl19 fl/fl (WT) and Fbxl19 ΔCXXC (OHT) ES cells probed with two different antibodies recognizing ubiquitylated H2B K120 (H2Bub1). H4 was used as a loading control. ( H ) Western blot analysis of nuclear extracts from HEK293T cells transiently transfected with empty vector (EV) or Flag-FBXL19-expressing vector without (-) or following MG132 treatment (+). Blots were probed with the indicated antibodies. TBP was used as loading control.
    Figure Legend Snippet: FBXL19 interacts with the CDK-Mediator complex in ES cells. ( A ) A representative silver-stained gel for FS2-FBXL19 purification and an empty vector control (EV) purification. Asterisk identifies the band corresponding to FS2-FBXL19 protein. ( B ) In order to visualize FBXL19 protein by western blot in Figure 2—figure supplement 1D and Figure 4B , the Fbxl19 gene was tagged by T7 knock-in in Fbxl19 fl/fl ES cells using the CRISPR Cas9 system. A schematic representation of the generation of the C-terminal T7 knock-in Fbxl19 is shown. HA1/2 indicate the homology arms of the targeting construct. ( C ) Western blot analysis of the expression of T7-FBXL19 from nuclear extract of the generated T7 knock-in ES cell line. ( D ) Western blot analysis of endogenous co-immunoprecipitation (IP) of FBXL19, CDK8 and MED12 from ES cell nuclear extracts. A control IP using a non-specific antibody (α-ΗΑ) was included. ( E ) A schematic illustration of the different FS2-FBXL19 truncation mutants and Western blot analysis of purification of FS2-FBXL19 mutants from HEK293T cells probed with the indicated antibodies. ( F ) Western blot analysis of FS2-FBXL19 and control purifications (EV) probed with the indicated antibodies. ( G ) Western blot analysis of histone extracts generated from Fbxl19 fl/fl (WT) and Fbxl19 ΔCXXC (OHT) ES cells probed with two different antibodies recognizing ubiquitylated H2B K120 (H2Bub1). H4 was used as a loading control. ( H ) Western blot analysis of nuclear extracts from HEK293T cells transiently transfected with empty vector (EV) or Flag-FBXL19-expressing vector without (-) or following MG132 treatment (+). Blots were probed with the indicated antibodies. TBP was used as loading control.

    Techniques Used: Staining, Purification, Plasmid Preparation, Western Blot, Knock-In, CRISPR, Construct, Expressing, Generated, Immunoprecipitation, Transfection

    FBXL19 targets CDK8 to promoters of silent developmental genes in ES cells. ( A ) Metaplots showing enrichment of H3K27me3 (left) and H3K4me3 (right) ChIPseq signal at all (top), reduced (↓) and increased (↑) CDK8 peaks. ( B ) Heatmaps showing enrichment of CDK8, H3K27me3 and H3K4me3 ChIPseq signal at H3K27me3 peaks (n = 5588) divided by overlap with CDK8 peaks (CDK8 +n = 3637, CDK8- n = 1950) sorted by decreasing H3K27me3 signal. Distance from the peak center is shown. ( C ) Volcano plots showing alterations in expression (log2 fold change) comparing ES cells and RA-treated cells. Genes that rely on FBXL19 for normal CDK8 binding in the ES cells state are plotted. Top: reduced levels of CDK8 (red, n = 673 of which 203 genes are significantly induced by RA and 55 genes are ES-specific). Bottom: increased levels of CDK8 (green, n = 255 of which 28 genes are significantly induced by RA and 26 genes are ES-specific). ( D ) Genes for Figure 5D–F were separated into two categories (low and high expression) based on FPKM value cut-off represented by the dashed line. ( E ) Gene ontology analysis of the genes associated with unchanged CDK8 levels in FBXL19 ΔCxxC ES cells (n = 14767).
    Figure Legend Snippet: FBXL19 targets CDK8 to promoters of silent developmental genes in ES cells. ( A ) Metaplots showing enrichment of H3K27me3 (left) and H3K4me3 (right) ChIPseq signal at all (top), reduced (↓) and increased (↑) CDK8 peaks. ( B ) Heatmaps showing enrichment of CDK8, H3K27me3 and H3K4me3 ChIPseq signal at H3K27me3 peaks (n = 5588) divided by overlap with CDK8 peaks (CDK8 +n = 3637, CDK8- n = 1950) sorted by decreasing H3K27me3 signal. Distance from the peak center is shown. ( C ) Volcano plots showing alterations in expression (log2 fold change) comparing ES cells and RA-treated cells. Genes that rely on FBXL19 for normal CDK8 binding in the ES cells state are plotted. Top: reduced levels of CDK8 (red, n = 673 of which 203 genes are significantly induced by RA and 55 genes are ES-specific). Bottom: increased levels of CDK8 (green, n = 255 of which 28 genes are significantly induced by RA and 26 genes are ES-specific). ( D ) Genes for Figure 5D–F were separated into two categories (low and high expression) based on FPKM value cut-off represented by the dashed line. ( E ) Gene ontology analysis of the genes associated with unchanged CDK8 levels in FBXL19 ΔCxxC ES cells (n = 14767).

    Techniques Used: Expressing, Binding Assay

    FBXL19 is required for appropriate CDK8 occupancy at a subset of CpG island promoters. ( A ) A Venn diagram showing the overlap between CDK8 peaks (n = 24273) and NMIs (n = 27698). ( B ) A scatter plot showing Spearman correlation between CDK8 signal and BioCAP at NMIs. ( C ) Heatmaps showing enrichment of CDK8, FS2-FBXL19 and BioCAP at FBXL19 peaks (n = 11322) sorted by decreasing FBXL19 signal. ( D ) A Venn diagram showing the overlap between FBXL19 peaks (n = 11322), CDK8 peaks (n = 24273), and NMIs (n = 27698). Percent overlap of all FBXL19 peaks is shown. ( E ) A schematic of the Fbxl19 fl/fl allele showing the location of the loxP sites. Treatment with tamoxifen (OHT) results in Cre-mediated deletion of the second exon, encoding for the ZF-CxxC domain but leaving the rest of the gene and protein intact. ( F ) RT-qPCR of FBXL19 expression in Fbxl19 fl/fl ES cells before (WT) and following tamoxifen treatment (OHT). Primers specific for the ZF-CxxC and LRR domains were used. Expression is relative to expression in WT ES cells. Error bars show SEM of three biological experiments. ( G ) A Western blot analysis of the expression of Mediator subunits in Fbxl19 fl/fl (WT) and Fbxl19 ΔCXXC (OHT) ES cells. HDAC1 and TBP were probed as loading controls. ( H ) Heatmaps showing enrichment of CDK8 in Fbxl19 fl/fl (WT) and Fbxl19 ΔCXXC (OHT), FS2-FBXL19 and BioCAP signal at ATAC peaks divided based on change in CDK8 binding in Fbxl19 ΔCXXC ES cells as in Figure 4E . The mean of the enrichment for each group is shown above the heatmaps. Left: zoomed heatmaps for ATAC peaks associated with a decrease (↓) or an increase (↑) in CDK8 binding and a differential heatmap representing log2 fold change of CDK8 signal between OHT and WT samples at the differential peaks. ( I ) Percent overlap between CDK8 peaks (as in Figure 4E ) and transcription start sites of genes (TSS, left) or FBXL19 peaks (right). ( J ) Metaplots showing enrichment of FS2-FBXL19, BioCAP and CDK8 ChIPseq signal at all CDK8 peaks (left), FBXL19-bound CDK8 peaks (FBXL19+, middle) and nonFBXL19 CDK8 peaks (FBXL19-, right). Peaks were divided based on change in CDK8 binding in Fbxl19 ΔCXXC ES cells as in Figure 4E .
    Figure Legend Snippet: FBXL19 is required for appropriate CDK8 occupancy at a subset of CpG island promoters. ( A ) A Venn diagram showing the overlap between CDK8 peaks (n = 24273) and NMIs (n = 27698). ( B ) A scatter plot showing Spearman correlation between CDK8 signal and BioCAP at NMIs. ( C ) Heatmaps showing enrichment of CDK8, FS2-FBXL19 and BioCAP at FBXL19 peaks (n = 11322) sorted by decreasing FBXL19 signal. ( D ) A Venn diagram showing the overlap between FBXL19 peaks (n = 11322), CDK8 peaks (n = 24273), and NMIs (n = 27698). Percent overlap of all FBXL19 peaks is shown. ( E ) A schematic of the Fbxl19 fl/fl allele showing the location of the loxP sites. Treatment with tamoxifen (OHT) results in Cre-mediated deletion of the second exon, encoding for the ZF-CxxC domain but leaving the rest of the gene and protein intact. ( F ) RT-qPCR of FBXL19 expression in Fbxl19 fl/fl ES cells before (WT) and following tamoxifen treatment (OHT). Primers specific for the ZF-CxxC and LRR domains were used. Expression is relative to expression in WT ES cells. Error bars show SEM of three biological experiments. ( G ) A Western blot analysis of the expression of Mediator subunits in Fbxl19 fl/fl (WT) and Fbxl19 ΔCXXC (OHT) ES cells. HDAC1 and TBP were probed as loading controls. ( H ) Heatmaps showing enrichment of CDK8 in Fbxl19 fl/fl (WT) and Fbxl19 ΔCXXC (OHT), FS2-FBXL19 and BioCAP signal at ATAC peaks divided based on change in CDK8 binding in Fbxl19 ΔCXXC ES cells as in Figure 4E . The mean of the enrichment for each group is shown above the heatmaps. Left: zoomed heatmaps for ATAC peaks associated with a decrease (↓) or an increase (↑) in CDK8 binding and a differential heatmap representing log2 fold change of CDK8 signal between OHT and WT samples at the differential peaks. ( I ) Percent overlap between CDK8 peaks (as in Figure 4E ) and transcription start sites of genes (TSS, left) or FBXL19 peaks (right). ( J ) Metaplots showing enrichment of FS2-FBXL19, BioCAP and CDK8 ChIPseq signal at all CDK8 peaks (left), FBXL19-bound CDK8 peaks (FBXL19+, middle) and nonFBXL19 CDK8 peaks (FBXL19-, right). Peaks were divided based on change in CDK8 binding in Fbxl19 ΔCXXC ES cells as in Figure 4E .

    Techniques Used: Quantitative RT-PCR, Expressing, Western Blot, Binding Assay

    29) Product Images from "TET2 functions as a resistance factor against DNA methylation acquisition during Epstein-Barr virus infection"

    Article Title: TET2 functions as a resistance factor against DNA methylation acquisition during Epstein-Barr virus infection

    Journal: Oncotarget

    doi: 10.18632/oncotarget.13130

    Hydroxymethylation target genes by TET2 A. A TET2 -expressing vector was transfected into GES1 and the expression level of TET2 relative to GAPDH at 30 days after transfection was analyzed by real-time RT-PCR. Mock , GES1 cells transfected with an empty vector as negative controls. TET2OE , GES1 overexpressing TET2 . B. Immunoblotting analysis was conducted for TET2 and α-Tubulin expression in Mock and TET2OE cells. C. Representative results of hMeDIP-seq and MeDIP-seq around FRG1B are shown. The hydroxymethylation level of the region was increased in cells with TET2 overexpression, whereas the methylation level was increased in EBV infection. D. hMeDIP was repeated, and increase of hmC in 5′ region of FRG1B was validated by hMeDIP-PCR at the region indicated in Figure 3C , and normalized against a positive control region NEDD9 . E. Increase of mC was validated by quantitative pyrosequencing assay at the region indicated in Figure 3C . F. Among 2,619 hydroxymethylation target genes showing hydroxymethylation peaks within ±1 kb of the TSS in both Mock and TET2OE cells, 527 genes (20.1%) were methylation target genes during EBV infection ( P
    Figure Legend Snippet: Hydroxymethylation target genes by TET2 A. A TET2 -expressing vector was transfected into GES1 and the expression level of TET2 relative to GAPDH at 30 days after transfection was analyzed by real-time RT-PCR. Mock , GES1 cells transfected with an empty vector as negative controls. TET2OE , GES1 overexpressing TET2 . B. Immunoblotting analysis was conducted for TET2 and α-Tubulin expression in Mock and TET2OE cells. C. Representative results of hMeDIP-seq and MeDIP-seq around FRG1B are shown. The hydroxymethylation level of the region was increased in cells with TET2 overexpression, whereas the methylation level was increased in EBV infection. D. hMeDIP was repeated, and increase of hmC in 5′ region of FRG1B was validated by hMeDIP-PCR at the region indicated in Figure 3C , and normalized against a positive control region NEDD9 . E. Increase of mC was validated by quantitative pyrosequencing assay at the region indicated in Figure 3C . F. Among 2,619 hydroxymethylation target genes showing hydroxymethylation peaks within ±1 kb of the TSS in both Mock and TET2OE cells, 527 genes (20.1%) were methylation target genes during EBV infection ( P

    Techniques Used: Expressing, Plasmid Preparation, Transfection, Quantitative RT-PCR, Methylated DNA Immunoprecipitation, Over Expression, Methylation, Infection, Polymerase Chain Reaction, Positive Control, Pyrosequencing Assay

    30) Product Images from "Improved TGIRT-seq methods for comprehensive transcriptome profiling with decreased adapter dimer formation and bias correction"

    Article Title: Improved TGIRT-seq methods for comprehensive transcriptome profiling with decreased adapter dimer formation and bias correction

    Journal: Scientific Reports

    doi: 10.1038/s41598-019-44457-z

    TGIRT-seq of the Miltenyi miRXplore miRNA reference set using the NTT or NTC adapters and comparison of different methods for mitigating 5′- and 3′-end biases. TGIRT-seq libraries were prepared from the Miltenyi miRXplore miRNA reference set containing 962 equimolar human miRNAs (Supplementary Table S2 and Methods). Datasets for each method (three combined datasets for NTC, NTT, MTT, and NTT and a single dataset for NTT/6N) were used to plot both the empirical cumulative distribution function (ECDF) of the log 2 median-normalized counts for each miRNA ranked from least to most abundant (left panels), and the abundance-adjusted nucleotide frequencies at the 5′ end (positions +1 to +6) and 3′ end (positions −1 to −6) of the miRNA sequences in the dataset relative to those in the miRNA reference set (middle and right panels). Only uniquely mapped reads were counted. The numbers within the ECDF plots for each method indicate the root-mean-square error (RMSE) for over-represented miRNAs (top right), under-represented miRNAs (bottom left), and all miRNAs (top left). The curve plotted as a dashed line at the bottom of the ECDF plots indicates the distribution density of the 962 miRNAs in the dataset. ( A ) Miltenyi miRXplore reference set showing the ECDF plot layout (left panel) and the aggregate 5′- and 3′-nucleotide frequencies for all miRNAs in the Miltenyi miRXplore reference set assuming equimolar concentrations of the 962 miRNAs. ( B–G ) ECDF plots (left panels) and plots of the abundance-adjusted nucleotide frequencies at the 5′- and 3′- ends of miRNAs in TGIRT-seq datasets relative to those in the miRNA reference set (middle and right panels) for datasets obtained using ( B ) the NTC adapter; ( C ) the NTT adapter; ( D ) a modified NTT adapter mix in which the 3′ A overhang was replaced with a 3′ diaminopurine (denoted MTT); ( E ) a modified NTT adapter mix with an altered ratio of 3′ overhangs (A:C:G:T = 6.6:0.4:1:1; denoted NTTR); ( F ) the NTT adapter used in combination with an R1R adapter with six randomized nucleotides at its 5′ end (denoted NTT/6N); and ( G ) the NTT adapter after computational correction of 5′- and 3′-end biases (denoted NTTc).
    Figure Legend Snippet: TGIRT-seq of the Miltenyi miRXplore miRNA reference set using the NTT or NTC adapters and comparison of different methods for mitigating 5′- and 3′-end biases. TGIRT-seq libraries were prepared from the Miltenyi miRXplore miRNA reference set containing 962 equimolar human miRNAs (Supplementary Table S2 and Methods). Datasets for each method (three combined datasets for NTC, NTT, MTT, and NTT and a single dataset for NTT/6N) were used to plot both the empirical cumulative distribution function (ECDF) of the log 2 median-normalized counts for each miRNA ranked from least to most abundant (left panels), and the abundance-adjusted nucleotide frequencies at the 5′ end (positions +1 to +6) and 3′ end (positions −1 to −6) of the miRNA sequences in the dataset relative to those in the miRNA reference set (middle and right panels). Only uniquely mapped reads were counted. The numbers within the ECDF plots for each method indicate the root-mean-square error (RMSE) for over-represented miRNAs (top right), under-represented miRNAs (bottom left), and all miRNAs (top left). The curve plotted as a dashed line at the bottom of the ECDF plots indicates the distribution density of the 962 miRNAs in the dataset. ( A ) Miltenyi miRXplore reference set showing the ECDF plot layout (left panel) and the aggregate 5′- and 3′-nucleotide frequencies for all miRNAs in the Miltenyi miRXplore reference set assuming equimolar concentrations of the 962 miRNAs. ( B–G ) ECDF plots (left panels) and plots of the abundance-adjusted nucleotide frequencies at the 5′- and 3′- ends of miRNAs in TGIRT-seq datasets relative to those in the miRNA reference set (middle and right panels) for datasets obtained using ( B ) the NTC adapter; ( C ) the NTT adapter; ( D ) a modified NTT adapter mix in which the 3′ A overhang was replaced with a 3′ diaminopurine (denoted MTT); ( E ) a modified NTT adapter mix with an altered ratio of 3′ overhangs (A:C:G:T = 6.6:0.4:1:1; denoted NTTR); ( F ) the NTT adapter used in combination with an R1R adapter with six randomized nucleotides at its 5′ end (denoted NTT/6N); and ( G ) the NTT adapter after computational correction of 5′- and 3′-end biases (denoted NTTc).

    Techniques Used: MTT Assay, Modification

    Bioanalyzer traces of TGIRT-seq libraries constructed from varying amounts of different-sized RNA oligonucleotides using either the NTC or NTT adapter. TGIRT-seq libraries were prepared from ( A ) 40-nt or ( B ) 20-nt RNA oligonucleotides using the workflow of Fig. 1A . After PCR for 12 cycles and one round of 1.4X AMPure beads clean-up, the libraries were analyzed on a 2100 Bioanalyzer (Agilent) using a high sensitivity DNA chip. M: internal markers.
    Figure Legend Snippet: Bioanalyzer traces of TGIRT-seq libraries constructed from varying amounts of different-sized RNA oligonucleotides using either the NTC or NTT adapter. TGIRT-seq libraries were prepared from ( A ) 40-nt or ( B ) 20-nt RNA oligonucleotides using the workflow of Fig. 1A . After PCR for 12 cycles and one round of 1.4X AMPure beads clean-up, the libraries were analyzed on a 2100 Bioanalyzer (Agilent) using a high sensitivity DNA chip. M: internal markers.

    Techniques Used: Construct, Polymerase Chain Reaction, Chromatin Immunoprecipitation

    Saturation curves and differences in coverage for the 962 miRNAs in the Miltenyi miRXplore miRNA reference set for TGIRT-seq with or without different bias correction compared to published datasets for established small RNA-seq methods. For published datasets containing additional miRNAs, in silico subsamples containing only the 962 reference set miRNAs were used for the comparisons. ( A ) RNA-seq saturation curves. The curves show the number of reference set miRNAs with at least 10 reads at bins of 200 reads. As additional reads were included, the number of miRNAs with at least 10 reads increased. Curves were truncated at 3 million reads. The dotted red line at the top indicates the number of miRNAs in the Miltenyi miRXplore reference set. Each curve represents combined datasets, color-coded by the sequencing method as shown in the Figure for the best (4N ligation/NEXTflex; n = 24) and worst (NEBNext; n = 12) methods from the comparison of Giraldez et al . 36 , as well as TGIRT-seq (n = 3 for libraries prepared with the NTT, MTT, and NTC adapters), TGIRT-seq with the NTTR adapter (n = 3), TGIRT-seq with the NTT adapter and an R1R adapter containing six randomized 5′-end positions (NTT/6N; n = 1), and the TGIRT-CircLigase method (n = 1; Mohr et al . 6 ). Other library preparation methods (gray lines) include NEBNext, TruSeq and CleanTag. ( B ) Violin plots of miRNA abundance in datasets obtained by different methods. The plots show the distribution of log 10 CPM for each miRNA in the reference set for each library preparation method (miRNA count = 2,886 for NTTc, 2,885 for NTCc, 23,088 for 4N ligation, 961 for TGIRT-CircLigase, 2,886 for NTTR, 5,522 for NEXTflex, 2,886 for MTT, 2,886 for NTC, 2,886 for NTT, 962 for NTT/6N, 30,757 for TruSeq, 3,815 for CleanTag, and 11,452 for NEBNext). NTTc and NTCc denote TGIRT-seq datasets obtained using the NTT or NTC adapters that were computationally corrected using the random forest regression model trained with the combined NTT datasets (Fig. 5C,D ). The black horizontal line indicates the expected CPM values (CPM = 1,039.5) for each miRNA for a uniform distribution of 1,000,000 reads to 962 miRNAs ( i . e ., unbiased sampling for each miRNA). The library preparation and correction methods are ordered from the lowest to highest deviation between the median CPM (white point within the violin) and the expected CPM. The black boxes in the violins indicate the interval between first and third quartiles, and the vertical lines indicate the 95% confidence interval for each method.
    Figure Legend Snippet: Saturation curves and differences in coverage for the 962 miRNAs in the Miltenyi miRXplore miRNA reference set for TGIRT-seq with or without different bias correction compared to published datasets for established small RNA-seq methods. For published datasets containing additional miRNAs, in silico subsamples containing only the 962 reference set miRNAs were used for the comparisons. ( A ) RNA-seq saturation curves. The curves show the number of reference set miRNAs with at least 10 reads at bins of 200 reads. As additional reads were included, the number of miRNAs with at least 10 reads increased. Curves were truncated at 3 million reads. The dotted red line at the top indicates the number of miRNAs in the Miltenyi miRXplore reference set. Each curve represents combined datasets, color-coded by the sequencing method as shown in the Figure for the best (4N ligation/NEXTflex; n = 24) and worst (NEBNext; n = 12) methods from the comparison of Giraldez et al . 36 , as well as TGIRT-seq (n = 3 for libraries prepared with the NTT, MTT, and NTC adapters), TGIRT-seq with the NTTR adapter (n = 3), TGIRT-seq with the NTT adapter and an R1R adapter containing six randomized 5′-end positions (NTT/6N; n = 1), and the TGIRT-CircLigase method (n = 1; Mohr et al . 6 ). Other library preparation methods (gray lines) include NEBNext, TruSeq and CleanTag. ( B ) Violin plots of miRNA abundance in datasets obtained by different methods. The plots show the distribution of log 10 CPM for each miRNA in the reference set for each library preparation method (miRNA count = 2,886 for NTTc, 2,885 for NTCc, 23,088 for 4N ligation, 961 for TGIRT-CircLigase, 2,886 for NTTR, 5,522 for NEXTflex, 2,886 for MTT, 2,886 for NTC, 2,886 for NTT, 962 for NTT/6N, 30,757 for TruSeq, 3,815 for CleanTag, and 11,452 for NEBNext). NTTc and NTCc denote TGIRT-seq datasets obtained using the NTT or NTC adapters that were computationally corrected using the random forest regression model trained with the combined NTT datasets (Fig. 5C,D ). The black horizontal line indicates the expected CPM values (CPM = 1,039.5) for each miRNA for a uniform distribution of 1,000,000 reads to 962 miRNAs ( i . e ., unbiased sampling for each miRNA). The library preparation and correction methods are ordered from the lowest to highest deviation between the median CPM (white point within the violin) and the expected CPM. The black boxes in the violins indicate the interval between first and third quartiles, and the vertical lines indicate the 95% confidence interval for each method.

    Techniques Used: RNA Sequencing Assay, In Silico, Sequencing, Ligation, MTT Assay, Sampling

    TGIRT-seq of ribo-depleted fragmented UHRR with ERCC spike-ins using the NTT and NTC adapters. TGIRT-seq libraries were prepared in triplicate for each adapter and sequenced on an Illumina NextSeq 500 to obtain 58–105 million 75-nt paired-end reads, which were mapped to a human reference genomic (Ensembl GRCh38) modified to include additional rRNA repeats (Methods and Supplementary Table S1 ). The datasets were used to generate stacked bar graphs showing the percentages of: ( A ) read-pairs that mapped concordantly in the annotated orientation to different categories of genomic features; ( B ) small ncRNA reads that mapped to different classes of small ncRNAs; ( C ) protein-coding gene reads that mapped to the sense or antisense strand; ( D ) bases in protein-coding gene reads that mapped to coding sequences (CDS), introns, 5′- and 3′-untranslated regions (UTRs), and intergenic regions. The name of the dataset is indicated below. ( E ) Aggregate nucleotide frequencies at the beginning of Read 1 (5′-RNA end; positions 1 to 14) and Read 2 (3′-RNA end; positions −1 to −14) in combined datasets for technical replicates obtained by TGIRT-seq of fragmented UHRR plus ERCC spike-ins with either the NTC or NTT adapter (datasets NTC-F1 to F3 and NTT-F1 to F3, respectively).
    Figure Legend Snippet: TGIRT-seq of ribo-depleted fragmented UHRR with ERCC spike-ins using the NTT and NTC adapters. TGIRT-seq libraries were prepared in triplicate for each adapter and sequenced on an Illumina NextSeq 500 to obtain 58–105 million 75-nt paired-end reads, which were mapped to a human reference genomic (Ensembl GRCh38) modified to include additional rRNA repeats (Methods and Supplementary Table S1 ). The datasets were used to generate stacked bar graphs showing the percentages of: ( A ) read-pairs that mapped concordantly in the annotated orientation to different categories of genomic features; ( B ) small ncRNA reads that mapped to different classes of small ncRNAs; ( C ) protein-coding gene reads that mapped to the sense or antisense strand; ( D ) bases in protein-coding gene reads that mapped to coding sequences (CDS), introns, 5′- and 3′-untranslated regions (UTRs), and intergenic regions. The name of the dataset is indicated below. ( E ) Aggregate nucleotide frequencies at the beginning of Read 1 (5′-RNA end; positions 1 to 14) and Read 2 (3′-RNA end; positions −1 to −14) in combined datasets for technical replicates obtained by TGIRT-seq of fragmented UHRR plus ERCC spike-ins with either the NTC or NTT adapter (datasets NTC-F1 to F3 and NTT-F1 to F3, respectively).

    Techniques Used: Modification

    TGIRT-seq workflow and design of an improved R2R adapter that decreases adapter-dimer formation. ( A ) TGIRT-seq workflow. In the first step, TGIRT enzyme binds to an artificial template-primer substrate comprised of an RNA oligonucleotide containing an Illumina R2 sequence with a 3′-end blocking group (3SpC3) annealed to a complementary DNA oligonucleotide (R2R) that leaves a single nucleotide 3′ overhang, which can direct template-switching by base pairing to the 3′ end of an RNA template. For the preparation of TGIRT-seq libraries from pools of RNAs, the DNA primer consists of a mixture of DNA oligonucleotides that leave A, C, G, and T 3′ overhangs (denoted N). After pre-incubation of the TGIRT enzyme with the target RNAs and template-primer (see Methods), template-switching and reverse transcription of an RNA template are initiated by adding dNTPs. The resulting cDNA with an R2R adapter attached to its 5′ end is incubated with NaOH to degrade the RNA template and neutralized with HCl, followed by two rounds of MinElute clean-up using the same MinElute column (Qiagen). A pre-adenylated oligonucleotide containing the reverse complement of an Illumina R1 sequence (R1R) is then ligated to the 3′ end of the cDNA by using thermostable 5′ App DNA/RNA ligase (New England Biolabs), followed by MinElute clean-up and 12 cycles of PCR amplification with primers that add indices and capture sites for Illumina sequencing. Unused R2R adapters that are carried over from previous steps are also ligated to the R1R adapter by the 5′ App DNA/RNA ligase (New England Biolabs), resulting in the formation of adapter dimers (pathway at right), which are removed by AMPure beads clean-up prior to sequencing. ( B ) Taking into account known biases of the 5′ App DNA/RNA ligase 7 , 28 , 29 , the R2R adapter used previously in TGIRT-seq (denoted NTC) was modified by inserting a single T-residue at position −3, creating a modified R2R adapter (denoted NTT), which decreases adapter-dimer formation. ( C ) Bioanalyzer traces comparing adapter-dimer formation using the previous NTC and improved NTT R2R adapters. 2 pmole of the NTC or NTC R2R adapter was ligated to 40 pmole of adenylated R1R adapter followed by 12 cycles of PCR according to the TGIRT-seq protocol and 1 round of clean-up with 1.4X AMPure beads to remove salt, PCR primers, and adapter dimers. The products were analyzed by using a 2100 Bioanalyzer (Agilent) with a high sensitivity DNA chip. M: internal markers in the NTC (red) or NTT (blue) traces.
    Figure Legend Snippet: TGIRT-seq workflow and design of an improved R2R adapter that decreases adapter-dimer formation. ( A ) TGIRT-seq workflow. In the first step, TGIRT enzyme binds to an artificial template-primer substrate comprised of an RNA oligonucleotide containing an Illumina R2 sequence with a 3′-end blocking group (3SpC3) annealed to a complementary DNA oligonucleotide (R2R) that leaves a single nucleotide 3′ overhang, which can direct template-switching by base pairing to the 3′ end of an RNA template. For the preparation of TGIRT-seq libraries from pools of RNAs, the DNA primer consists of a mixture of DNA oligonucleotides that leave A, C, G, and T 3′ overhangs (denoted N). After pre-incubation of the TGIRT enzyme with the target RNAs and template-primer (see Methods), template-switching and reverse transcription of an RNA template are initiated by adding dNTPs. The resulting cDNA with an R2R adapter attached to its 5′ end is incubated with NaOH to degrade the RNA template and neutralized with HCl, followed by two rounds of MinElute clean-up using the same MinElute column (Qiagen). A pre-adenylated oligonucleotide containing the reverse complement of an Illumina R1 sequence (R1R) is then ligated to the 3′ end of the cDNA by using thermostable 5′ App DNA/RNA ligase (New England Biolabs), followed by MinElute clean-up and 12 cycles of PCR amplification with primers that add indices and capture sites for Illumina sequencing. Unused R2R adapters that are carried over from previous steps are also ligated to the R1R adapter by the 5′ App DNA/RNA ligase (New England Biolabs), resulting in the formation of adapter dimers (pathway at right), which are removed by AMPure beads clean-up prior to sequencing. ( B ) Taking into account known biases of the 5′ App DNA/RNA ligase 7 , 28 , 29 , the R2R adapter used previously in TGIRT-seq (denoted NTC) was modified by inserting a single T-residue at position −3, creating a modified R2R adapter (denoted NTT), which decreases adapter-dimer formation. ( C ) Bioanalyzer traces comparing adapter-dimer formation using the previous NTC and improved NTT R2R adapters. 2 pmole of the NTC or NTC R2R adapter was ligated to 40 pmole of adenylated R1R adapter followed by 12 cycles of PCR according to the TGIRT-seq protocol and 1 round of clean-up with 1.4X AMPure beads to remove salt, PCR primers, and adapter dimers. The products were analyzed by using a 2100 Bioanalyzer (Agilent) with a high sensitivity DNA chip. M: internal markers in the NTC (red) or NTT (blue) traces.

    Techniques Used: Sequencing, Blocking Assay, Incubation, Polymerase Chain Reaction, Amplification, Modification, Chromatin Immunoprecipitation

    31) Product Images from "Solid-phase enzyme catalysis of DNA end repair and 3′ A-tailing reduces GC-bias in next-generation sequencing of human genomic DNA"

    Article Title: Solid-phase enzyme catalysis of DNA end repair and 3′ A-tailing reduces GC-bias in next-generation sequencing of human genomic DNA

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-34079-2

    CE analysis of processing synthetic DNA by soluble enzyme mix PKT and immobilized enzymes. 5′ FAM-labeled blunt-end substrates, 51-AT possessing multiple 3′ terminal A-T base pairs, and 51-GC possessing multiple 3′ terminal G-C base pairs, were incubated with PKT for end repair at 20 °C for 30 min followed by 65 °C for 30 min (PKT mix). The substrates were also treated with immobilized T4 DNA pol and PNK at 20 °C for 30 min, followed by separation of the enzymes on beads and the reaction medium (supernatant). The reaction medium was subsequently treated with immobilized Taq DNA pol for 3′ A-tailing at 37 °C for 30 min (IM PKT mix). The CE data show that incubation with PKT resulted in extensive degradation of 51-AT and little degradation of 51-GC. Treatment of 51-AT or 51-GC with the immobilized enzymes resulted in mostly 3′ A-tailing product, without detectable degradation of the 5′ FAM-labeled oligos. NC, negative control reaction performed in the absence of enzyme.
    Figure Legend Snippet: CE analysis of processing synthetic DNA by soluble enzyme mix PKT and immobilized enzymes. 5′ FAM-labeled blunt-end substrates, 51-AT possessing multiple 3′ terminal A-T base pairs, and 51-GC possessing multiple 3′ terminal G-C base pairs, were incubated with PKT for end repair at 20 °C for 30 min followed by 65 °C for 30 min (PKT mix). The substrates were also treated with immobilized T4 DNA pol and PNK at 20 °C for 30 min, followed by separation of the enzymes on beads and the reaction medium (supernatant). The reaction medium was subsequently treated with immobilized Taq DNA pol for 3′ A-tailing at 37 °C for 30 min (IM PKT mix). The CE data show that incubation with PKT resulted in extensive degradation of 51-AT and little degradation of 51-GC. Treatment of 51-AT or 51-GC with the immobilized enzymes resulted in mostly 3′ A-tailing product, without detectable degradation of the 5′ FAM-labeled oligos. NC, negative control reaction performed in the absence of enzyme.

    Techniques Used: Labeling, Incubation, Negative Control

    Effect of end repair and 3′ A-tailing at high temperature on GC-bias in Illumina reads from PCR-free human DNA libraries. ( a ) Comparison of GC-bias curves in duplicate libraries prepared by immobilized enzymes with 3′ A-tailing performed at 37 °C (IM 37 °C -1 and IM 37 °C -2, in blue) or 65 °C (IM 65 °C -1 and IM 65 °C -2, in green) revealed a dramatic effect of 3′ A-tailing at high temperature on sequence coverage of the AT-rich regions from human DNA libraries. ( b ) GC-bias curves were generated from two sets of duplicate libraries produced using the soluble enzyme mixture PKT with (PKT purify-1 and PKT purify-2) or without (PKT-1 and PKT-2) a purification step between end repair and high temperature incubation (with Taq DNA pol added to the samples following purification). Although some bias against AT-rich regions can be attributed to the end repair step, the elevated temperature contributes to the majority of the dropouts in the AT-rich regions. ( c ) Shown are the GC-bias curves from 4 sets of duplicate libraries produced by the method of soluble enzymes. Two sets of the duplicate libraries were purified after end repair with PK mixture and then treated at 37 °C with Klenow Fragment (3′-5′ exo − ) (red, Klenow 37 °C-1 and Klenow 37 °C-2) or Taq DNA pol (blue, Taq 37 °C-1 and Taq 37 °C-2). The other two duplicate sets were prepared using the high temperature treatment protocol either with (green, Taq 65 °C-1 and Taq 65 °C-2) or without (orange, PKT-1 and PKT-2) a purification step between end repair with PKT and treatment with Taq DNA pol at 65 °C for 30 min. ( d ) Comparison of library yield of the three sets described above with or without (PKT on the left) a purification step between end repair and 3′ A-tailing indicates that purification caused substantial loss of library DNA.
    Figure Legend Snippet: Effect of end repair and 3′ A-tailing at high temperature on GC-bias in Illumina reads from PCR-free human DNA libraries. ( a ) Comparison of GC-bias curves in duplicate libraries prepared by immobilized enzymes with 3′ A-tailing performed at 37 °C (IM 37 °C -1 and IM 37 °C -2, in blue) or 65 °C (IM 65 °C -1 and IM 65 °C -2, in green) revealed a dramatic effect of 3′ A-tailing at high temperature on sequence coverage of the AT-rich regions from human DNA libraries. ( b ) GC-bias curves were generated from two sets of duplicate libraries produced using the soluble enzyme mixture PKT with (PKT purify-1 and PKT purify-2) or without (PKT-1 and PKT-2) a purification step between end repair and high temperature incubation (with Taq DNA pol added to the samples following purification). Although some bias against AT-rich regions can be attributed to the end repair step, the elevated temperature contributes to the majority of the dropouts in the AT-rich regions. ( c ) Shown are the GC-bias curves from 4 sets of duplicate libraries produced by the method of soluble enzymes. Two sets of the duplicate libraries were purified after end repair with PK mixture and then treated at 37 °C with Klenow Fragment (3′-5′ exo − ) (red, Klenow 37 °C-1 and Klenow 37 °C-2) or Taq DNA pol (blue, Taq 37 °C-1 and Taq 37 °C-2). The other two duplicate sets were prepared using the high temperature treatment protocol either with (green, Taq 65 °C-1 and Taq 65 °C-2) or without (orange, PKT-1 and PKT-2) a purification step between end repair with PKT and treatment with Taq DNA pol at 65 °C for 30 min. ( d ) Comparison of library yield of the three sets described above with or without (PKT on the left) a purification step between end repair and 3′ A-tailing indicates that purification caused substantial loss of library DNA.

    Techniques Used: Polymerase Chain Reaction, Sequencing, Generated, Produced, Purification, Incubation

    Enzyme immobilization and comparison of Illumina library preparation protocols. ( a ) A schematic of covalent conjugation of SNAP-tagged enzyme fusion proteins to magnetic beads functionalized with O 6 -benzylguanine (BG) moieties that specifically react with active site cysteine residues of SNAP-tag proteins, forming a stable covalent thioether bond 15 , 16 . ( b ) Workflow for library construction using immobilized enzymes for Illumina sequencing. A typical streamlined protocol for Illumina library construction is modified by employing immobilized enzymes to catalyze end repair and 3′ A-tailing. This method utilizes SNAP-tagged T4 DNA pol and PNK covalently conjugated to BG-functionalized magnetic beads to carry out end repair of fragmented DNA at 20°C (or 37 °C) for 30 min. The enzymes are removed by magnetic separation from the DNA pool, which is subjected to 3′ A-tailing at 37 °C for 30 min using immobilized Taq DNA pol. ( c ) Streamlined protocol for Illumina amplification-free library preparation using soluble enzymes. Typically, end repair and 3′ A-tailing of fragmented DNA are catalyzed by an enzyme mixture at 20 °C for 30 min, followed by heat treatment at 65 °C for 30 min. ( d ) The workflow of Illumina TruSeq DNA PCR-free LT Library Prep Kit with a purification step. End repair is performed for 30 min at 30 °C, followed by a bead-based step for clean up and size selection. 3′ A-tailing is carried out for 30 min at 37 °C with a subsequent treatment for 5 min at 70 °C. Each library was ligated to preannealed full-length paired-end Illumina adaptors, size-selected and analyzed, and sequenced on an Illumina sequencing platform.
    Figure Legend Snippet: Enzyme immobilization and comparison of Illumina library preparation protocols. ( a ) A schematic of covalent conjugation of SNAP-tagged enzyme fusion proteins to magnetic beads functionalized with O 6 -benzylguanine (BG) moieties that specifically react with active site cysteine residues of SNAP-tag proteins, forming a stable covalent thioether bond 15 , 16 . ( b ) Workflow for library construction using immobilized enzymes for Illumina sequencing. A typical streamlined protocol for Illumina library construction is modified by employing immobilized enzymes to catalyze end repair and 3′ A-tailing. This method utilizes SNAP-tagged T4 DNA pol and PNK covalently conjugated to BG-functionalized magnetic beads to carry out end repair of fragmented DNA at 20°C (or 37 °C) for 30 min. The enzymes are removed by magnetic separation from the DNA pool, which is subjected to 3′ A-tailing at 37 °C for 30 min using immobilized Taq DNA pol. ( c ) Streamlined protocol for Illumina amplification-free library preparation using soluble enzymes. Typically, end repair and 3′ A-tailing of fragmented DNA are catalyzed by an enzyme mixture at 20 °C for 30 min, followed by heat treatment at 65 °C for 30 min. ( d ) The workflow of Illumina TruSeq DNA PCR-free LT Library Prep Kit with a purification step. End repair is performed for 30 min at 30 °C, followed by a bead-based step for clean up and size selection. 3′ A-tailing is carried out for 30 min at 37 °C with a subsequent treatment for 5 min at 70 °C. Each library was ligated to preannealed full-length paired-end Illumina adaptors, size-selected and analyzed, and sequenced on an Illumina sequencing platform.

    Techniques Used: Conjugation Assay, Magnetic Beads, Sequencing, Modification, Amplification, Polymerase Chain Reaction, Purification, Selection

    A model for GC-related sequence coverage bias in amplification-free NGS data. ( a ) A schematic of DNA end “breathing” (or “fraying”) present in the AT-rich fraction of a DNA library. DNA thermal breathing refers to spontaneous local conformational fluctuations, leading to unpaired bases at the ends of DNA duplex. The extent of breathing is highly dependent upon temperature and DNA sequence so that AT-rich segments (AT) melt before GC-rich segments (GC). The difference of the end breathing profile relevant to GC-content leads to less efficient end-polishing of AT-rich fragments during library construction using DNA modifying enzymes, resulting in the under-representation of the AT-rich regions. ( b ) Degradation of AT-rich DNA by 3′-5′ exonuclease activity of T4 DNA pol (blue). Preferential degradation of AT-rich DNA fragments that undergo terminal base pair breathing may occur at the end repair step or during high temperature incubation. ( c ) Processing AT-rich DNA by Taq DNA pol at elevated temperatures. During high temperature incubation, for example, at 65 °C or 70 °C, the ends of AT-rich DNA fragments melt into transient or predominant single-stranded structures. Taq DNA pol (red) can act on these DNA substrates by its polymerization and 5′ nuclease activities as previously described 34 , yielding unintended cleavage and primer extension products. Arrow (red) indicates the position of cleavage whereas arrow in black indicates the orientation of primer extension due to intermolecular annealing of two single-stranded 3′ terminal sequences. Primer extension may also occur from intramolecular annealing of a single-stranded 3′ terminal sequence.
    Figure Legend Snippet: A model for GC-related sequence coverage bias in amplification-free NGS data. ( a ) A schematic of DNA end “breathing” (or “fraying”) present in the AT-rich fraction of a DNA library. DNA thermal breathing refers to spontaneous local conformational fluctuations, leading to unpaired bases at the ends of DNA duplex. The extent of breathing is highly dependent upon temperature and DNA sequence so that AT-rich segments (AT) melt before GC-rich segments (GC). The difference of the end breathing profile relevant to GC-content leads to less efficient end-polishing of AT-rich fragments during library construction using DNA modifying enzymes, resulting in the under-representation of the AT-rich regions. ( b ) Degradation of AT-rich DNA by 3′-5′ exonuclease activity of T4 DNA pol (blue). Preferential degradation of AT-rich DNA fragments that undergo terminal base pair breathing may occur at the end repair step or during high temperature incubation. ( c ) Processing AT-rich DNA by Taq DNA pol at elevated temperatures. During high temperature incubation, for example, at 65 °C or 70 °C, the ends of AT-rich DNA fragments melt into transient or predominant single-stranded structures. Taq DNA pol (red) can act on these DNA substrates by its polymerization and 5′ nuclease activities as previously described 34 , yielding unintended cleavage and primer extension products. Arrow (red) indicates the position of cleavage whereas arrow in black indicates the orientation of primer extension due to intermolecular annealing of two single-stranded 3′ terminal sequences. Primer extension may also occur from intramolecular annealing of a single-stranded 3′ terminal sequence.

    Techniques Used: Sequencing, Amplification, Next-Generation Sequencing, Activity Assay, Incubation

    32) Product Images from "Solid-phase enzyme catalysis of DNA end repair and 3′ A-tailing reduces GC-bias in next-generation sequencing of human genomic DNA"

    Article Title: Solid-phase enzyme catalysis of DNA end repair and 3′ A-tailing reduces GC-bias in next-generation sequencing of human genomic DNA

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-34079-2

    Genome-wide base composition bias curves in Illumina reads from PCR-free human DNA libraries. ( a ) The GC-bias curves from libraries (in duplicate) produced by the immobilized enzyme method (IM-1 and IM-2 in blue), for end repair for 30 min at 20 °C and 3′ A-tailing at 37 °C in contrast to the data from the libraries generated by the soluble enzyme method, with 3′ A-tailing at 65 °C, using enzyme mixture PKT (PKT-1 and PKT-2 in purple). ( b ) The GC-bias data of the immobilized enzyme method compared to the data from the duplicate libraries generated by Illumina TruSeq DNA PCR-free LT Library Preparation Kit (Illumina), Kapa Hyper Prep Kit (Kapa) or NEBNext Ultra II DNA Library Prep Kit for Illumina (Ultra) according to the protocols of the manufacturers. The Illumina protocol carries out end repair for 30 min at 30 °C and 3′ A-tailing for 30 min at 37 °C, followed by incubation at 70 °C for 5 min, and includes a clean-up and size selection step between end repair and 3′ A-tailing. The Kapa Hyper and NEBNext Ultra workflows include an enzyme mixture to perform end repair for 30 min at 20 °C, followed by 3′ A-tailing for 30 min at 65 °C.
    Figure Legend Snippet: Genome-wide base composition bias curves in Illumina reads from PCR-free human DNA libraries. ( a ) The GC-bias curves from libraries (in duplicate) produced by the immobilized enzyme method (IM-1 and IM-2 in blue), for end repair for 30 min at 20 °C and 3′ A-tailing at 37 °C in contrast to the data from the libraries generated by the soluble enzyme method, with 3′ A-tailing at 65 °C, using enzyme mixture PKT (PKT-1 and PKT-2 in purple). ( b ) The GC-bias data of the immobilized enzyme method compared to the data from the duplicate libraries generated by Illumina TruSeq DNA PCR-free LT Library Preparation Kit (Illumina), Kapa Hyper Prep Kit (Kapa) or NEBNext Ultra II DNA Library Prep Kit for Illumina (Ultra) according to the protocols of the manufacturers. The Illumina protocol carries out end repair for 30 min at 30 °C and 3′ A-tailing for 30 min at 37 °C, followed by incubation at 70 °C for 5 min, and includes a clean-up and size selection step between end repair and 3′ A-tailing. The Kapa Hyper and NEBNext Ultra workflows include an enzyme mixture to perform end repair for 30 min at 20 °C, followed by 3′ A-tailing for 30 min at 65 °C.

    Techniques Used: Genome Wide, Polymerase Chain Reaction, Produced, Generated, Incubation, Selection

    33) Product Images from "Taxogenomic assessment and genomic characterisation of Weissella cibaria strain 92 able to metabolise oligosaccharides derived from dietary fibres"

    Article Title: Taxogenomic assessment and genomic characterisation of Weissella cibaria strain 92 able to metabolise oligosaccharides derived from dietary fibres

    Journal: Scientific Reports

    doi: 10.1038/s41598-020-62610-x

    Phylogenetic tree of the genus Weissella based on 106 genes. The tree has a midpoint root with Lactobacillus plantarum WCFS1 as an outgroup. The scales represent the genetic distance as number of substitutions divided by length of the sequences. The numbers adjacent to each branch node are the bootstrap support values expressed as percentages. The amino acid sequences of the 106 analysed genes of W. cibaria CMS2 were identical to the corresponding genes in W. cibaria CMS3, W. cibaria CMU and W. cibaria KACC 11862 and the 106 analysed genes of W . sp. strain 142 were identical to W . sp. strains 85 and AV1. Thus, the latter strains were excluded from the analysis but can be expected in the same position of the tree as W. cibaria CMS2 and W . sp. strain 142, respectively.
    Figure Legend Snippet: Phylogenetic tree of the genus Weissella based on 106 genes. The tree has a midpoint root with Lactobacillus plantarum WCFS1 as an outgroup. The scales represent the genetic distance as number of substitutions divided by length of the sequences. The numbers adjacent to each branch node are the bootstrap support values expressed as percentages. The amino acid sequences of the 106 analysed genes of W. cibaria CMS2 were identical to the corresponding genes in W. cibaria CMS3, W. cibaria CMU and W. cibaria KACC 11862 and the 106 analysed genes of W . sp. strain 142 were identical to W . sp. strains 85 and AV1. Thus, the latter strains were excluded from the analysis but can be expected in the same position of the tree as W. cibaria CMS2 and W . sp. strain 142, respectively.

    Techniques Used:

    Dendrogram of strains of  Weissella cibaria  and  W. confusa, W. paramesenteroides  ATCC 33313 and  W . sp. strains 85, 92, 142, AV1 and DD23. The dendrogram is built from a distance matrix where the distance,  d , is measured as the part of unshared annotated genes between each pair of genomes according to Eq. (  1 ).
    Figure Legend Snippet: Dendrogram of strains of Weissella cibaria and W. confusa, W. paramesenteroides ATCC 33313 and W . sp. strains 85, 92, 142, AV1 and DD23. The dendrogram is built from a distance matrix where the distance, d , is measured as the part of unshared annotated genes between each pair of genomes according to Eq. ( 1 ).

    Techniques Used:

    34) Product Images from "The genomes of invasive coral Tubastraea spp. (Dendrophylliidae) as tool for the development of biotechnological solutions"

    Article Title: The genomes of invasive coral Tubastraea spp. (Dendrophylliidae) as tool for the development of biotechnological solutions

    Journal: bioRxiv

    doi: 10.1101/2020.04.24.060574

    Representative metaphase and karyogram of (A and A1) T. tagusensis (2n= 46), (B and B1) T. coccinea (2n= 44), and (C and C1) Tubastraea sp. (2n= 42). Two metaphase plates of each morphotype were counted. Scale bar 5 µm.
    Figure Legend Snippet: Representative metaphase and karyogram of (A and A1) T. tagusensis (2n= 46), (B and B1) T. coccinea (2n= 44), and (C and C1) Tubastraea sp. (2n= 42). Two metaphase plates of each morphotype were counted. Scale bar 5 µm.

    Techniques Used:

    TapeStation evaluation of the DNA from T. tagusensis extracted with CTAB buffer combined with MoBio PowerSoil kit.
    Figure Legend Snippet: TapeStation evaluation of the DNA from T. tagusensis extracted with CTAB buffer combined with MoBio PowerSoil kit.

    Techniques Used:

    Mitochondrial analysis and comparison of the molecular and morphology identification. A - ML tree using the whole mitochondrial genome of SC065, SC082, SC100 and other Dendrophylliidae. Tubastraea clade is highlighted with a black star and T. tagusensis and T. coccinea subclades with a red and green ones. All forty-nine polymorphic sites occurring in between the three morphotypes sequenced in this work are shown. The schematic diagram of the mitochondrial genome indicates where the positions taking NC_030352.1 as reference are. B - ML tree built with the sequences of the CytB, COI and IGR of eighteen specimens (“SC” prefix) sampled in Buzios (BU), Cabo Frio (CF), Angra dos Reis (AR), Arraial do Cabo (AR), Ilhas Tijuca (IT) and Macae (MA). NC_030352.1 and KX024566 were collected in São Sebastião (SS). The red “X” in SC085 indicates that this morpho-type could not be identified through their morphological characters. For a better visualization, the tree based on morphological characters was mirrored. T. tagusensis (Tt) clade is coloured in red, Tubastraea sp. (?) - yellow and T. coccinea (Tc) - green. Thirteen positions occuring in the three gene markers are shown. C - NJ tree built with the same sequences used in the analysis shown on figure B. Only bootstraps higher than 70% were shown in the trees.
    Figure Legend Snippet: Mitochondrial analysis and comparison of the molecular and morphology identification. A - ML tree using the whole mitochondrial genome of SC065, SC082, SC100 and other Dendrophylliidae. Tubastraea clade is highlighted with a black star and T. tagusensis and T. coccinea subclades with a red and green ones. All forty-nine polymorphic sites occurring in between the three morphotypes sequenced in this work are shown. The schematic diagram of the mitochondrial genome indicates where the positions taking NC_030352.1 as reference are. B - ML tree built with the sequences of the CytB, COI and IGR of eighteen specimens (“SC” prefix) sampled in Buzios (BU), Cabo Frio (CF), Angra dos Reis (AR), Arraial do Cabo (AR), Ilhas Tijuca (IT) and Macae (MA). NC_030352.1 and KX024566 were collected in São Sebastião (SS). The red “X” in SC085 indicates that this morpho-type could not be identified through their morphological characters. For a better visualization, the tree based on morphological characters was mirrored. T. tagusensis (Tt) clade is coloured in red, Tubastraea sp. (?) - yellow and T. coccinea (Tc) - green. Thirteen positions occuring in the three gene markers are shown. C - NJ tree built with the same sequences used in the analysis shown on figure B. Only bootstraps higher than 70% were shown in the trees.

    Techniques Used:

    In vivo colonies and details of their skeletons: (A) Morphotype of T. tagusensis (SC065) in viv o, with yellow polyps connected by coenosarc with the same colour; (C) Corallum phaceloid forming colony with 9.1 cm in diameter; (B) Detail of septa arrangement, with primaries (S1) and secondaries (S2) septa reaching the center of corallite. (D) Morphotype of Tubastraea sp. (SC100) in vivo , with coenosarc orange-red in color, while tentacles and mouth are yellow and red-orange bright, respectively; (E) Corallum placoid forming colony with 6.7 cm in diameter; (F) Detail of septa arrangement, with part of cycle septal with initial stage of Pourtalés Plan. (G) Morphotype of T. coccinea (SC082) in vivo ; (H) Corallum placoid forming colony with 6.7 cm in diameter; (I) Detail of septa arrangement, with S1 and S2 reaching the center of corallite.
    Figure Legend Snippet: In vivo colonies and details of their skeletons: (A) Morphotype of T. tagusensis (SC065) in viv o, with yellow polyps connected by coenosarc with the same colour; (C) Corallum phaceloid forming colony with 9.1 cm in diameter; (B) Detail of septa arrangement, with primaries (S1) and secondaries (S2) septa reaching the center of corallite. (D) Morphotype of Tubastraea sp. (SC100) in vivo , with coenosarc orange-red in color, while tentacles and mouth are yellow and red-orange bright, respectively; (E) Corallum placoid forming colony with 6.7 cm in diameter; (F) Detail of septa arrangement, with part of cycle septal with initial stage of Pourtalés Plan. (G) Morphotype of T. coccinea (SC082) in vivo ; (H) Corallum placoid forming colony with 6.7 cm in diameter; (I) Detail of septa arrangement, with S1 and S2 reaching the center of corallite.

    Techniques Used: In Vivo

    Ideogram of (A) T. tagusensis (2n= 46), (B) T. coccinea (2n= 44), and (C) Tubastraea sp. (2n= 42).
    Figure Legend Snippet: Ideogram of (A) T. tagusensis (2n= 46), (B) T. coccinea (2n= 44), and (C) Tubastraea sp. (2n= 42).

    Techniques Used:

    Representative histograms of DNA staining in nuclei with propidium iodide. In black or pink nuclear DNA fluorescence of the standard P. sativum (pea) and in blue fluorescence of Tubastraea spp. The 2C nuclear DNA content of (A) T. tagusensis was 2.61 pg (± 0.78), equivalent to 2,555 Mb (±77) and the genome size was estimated at 1,277 Mb (± 82). The nuclear DNA content of (B) T. coccinea was 2.35 pg (± 0.03), equivalent to 2,294 Mb (±22), and the genome size was estimated at approximately 1,147 Mb (± 15). And (C) the nuclear DNA content of Tubastraea sp. was 2.75 pg (±0.16), equivalent to 2,690 Mb (± 163), and the genome size was estimated in approximately 1,345 Mb (± 82).
    Figure Legend Snippet: Representative histograms of DNA staining in nuclei with propidium iodide. In black or pink nuclear DNA fluorescence of the standard P. sativum (pea) and in blue fluorescence of Tubastraea spp. The 2C nuclear DNA content of (A) T. tagusensis was 2.61 pg (± 0.78), equivalent to 2,555 Mb (±77) and the genome size was estimated at 1,277 Mb (± 82). The nuclear DNA content of (B) T. coccinea was 2.35 pg (± 0.03), equivalent to 2,294 Mb (±22), and the genome size was estimated at approximately 1,147 Mb (± 15). And (C) the nuclear DNA content of Tubastraea sp. was 2.75 pg (±0.16), equivalent to 2,690 Mb (± 163), and the genome size was estimated in approximately 1,345 Mb (± 82).

    Techniques Used: Staining, Fluorescence

    Electropherogram and RNA Integrity Number (RIN) of T. tagusensis RNA.
    Figure Legend Snippet: Electropherogram and RNA Integrity Number (RIN) of T. tagusensis RNA.

    Techniques Used:

    TapeStation evaluation of the DNA from T. tagusensis extracted with DN easy Blood Tissue kit.
    Figure Legend Snippet: TapeStation evaluation of the DNA from T. tagusensis extracted with DN easy Blood Tissue kit.

    Techniques Used:

    Tubastraea tagusensis library size evaluation. Electropherogram traces of the constructed Illumina library.
    Figure Legend Snippet: Tubastraea tagusensis library size evaluation. Electropherogram traces of the constructed Illumina library.

    Techniques Used: Construct

    35) Product Images from "PIWIL1 Promotes Gastric Cancer via a piRNA-Independent Mechanism"

    Article Title: PIWIL1 Promotes Gastric Cancer via a piRNA-Independent Mechanism

    Journal: bioRxiv

    doi: 10.1101/2020.05.03.075390

    PIWIL1 target RNAs and transcriptomic changes in PIWIL1-KO SNU-1 cells. (A) WGCNA analysis of RNA co-expression modules regulated by PIWIL1. Topological overlap dissimilarity measure is clustered by average linkage hierarchical clustering. Module assignments (using a dynamic hybrid algorithm) are denoted in the color bar (bottom). (B) Heatmap of the correlation between module eigengenes and the trait of with or without PIWIL1 expression. Red color represents a positive correlation between a module and the trait, and blue color represents a negative correlation. Each cell contained the corresponding correlation and P-value . (C) KEGG pathway analysis of hub genes of the blue or turquoise module. Any gene with KME ≥0.9 was assigned as a hub gene. GSEA/MSigDB gene sets tool was used for the KEGG pathway analysis. (D) Venn diagram of RNAs positively or negatively regulated by PIWIL1 or bound by PIWIL1. PIWIL1-positively or negatively regulated RNAs are identified by DESeq2 analysis with P
    Figure Legend Snippet: PIWIL1 target RNAs and transcriptomic changes in PIWIL1-KO SNU-1 cells. (A) WGCNA analysis of RNA co-expression modules regulated by PIWIL1. Topological overlap dissimilarity measure is clustered by average linkage hierarchical clustering. Module assignments (using a dynamic hybrid algorithm) are denoted in the color bar (bottom). (B) Heatmap of the correlation between module eigengenes and the trait of with or without PIWIL1 expression. Red color represents a positive correlation between a module and the trait, and blue color represents a negative correlation. Each cell contained the corresponding correlation and P-value . (C) KEGG pathway analysis of hub genes of the blue or turquoise module. Any gene with KME ≥0.9 was assigned as a hub gene. GSEA/MSigDB gene sets tool was used for the KEGG pathway analysis. (D) Venn diagram of RNAs positively or negatively regulated by PIWIL1 or bound by PIWIL1. PIWIL1-positively or negatively regulated RNAs are identified by DESeq2 analysis with P

    Techniques Used: Expressing

    36) Product Images from "GATA-1-dependent histone H3K27ac mediates erythroid cell-specific interaction between CTCF sites"

    Article Title: GATA-1-dependent histone H3K27ac mediates erythroid cell-specific interaction between CTCF sites

    Journal: bioRxiv

    doi: 10.1101/2020.05.14.095547

    Chromatin structures at CTCF sites around the β-globin locus having deletion of GATA-1 binding motifs. ChIP was performed with antibodies specific to CTCF (A), Rad21 (B), histone H3 (C) and H3K27ac (D) in control cells (Con) and HS3ΔΔGA and HS2ΔGA clones. Amounts of immunoprecipitated DNA were determined as described in Fig 1C . The mouse Necdin gene served as an internal control. The results are the means of four independent experiments ± SEM. *P
    Figure Legend Snippet: Chromatin structures at CTCF sites around the β-globin locus having deletion of GATA-1 binding motifs. ChIP was performed with antibodies specific to CTCF (A), Rad21 (B), histone H3 (C) and H3K27ac (D) in control cells (Con) and HS3ΔΔGA and HS2ΔGA clones. Amounts of immunoprecipitated DNA were determined as described in Fig 1C . The mouse Necdin gene served as an internal control. The results are the means of four independent experiments ± SEM. *P

    Techniques Used: Binding Assay, Chromatin Immunoprecipitation, Clone Assay, Immunoprecipitation

    Chromatin interaction between CTCF sites around the β-globin locus in TSA treated MEL/ch11 cells. (A) MEL/ch11 cells were treated with 25 ng/ml of TSA for 6 h or 24 h. Histone H3 acetylated at K27 was detected by Western blotting in nuclear extract from control cells (Con) and cells treated with TSA. Histone H3 was used as an experimental control. (B) H3K27ac was determined in CTCF sites around the β-globin locus by ChIP. DNA immunoprecipitated by H3K27ac antibodies were quantitatively compared with DNA immunoprecipitated by H3, and then normalized to value in control cells. Normal IgG (IgG) was used as an experimental negative control. (C) Relative cross-linking frequencies was determined between CTCF sites around the β-globin locus in 3C assay as described in Fig 1E . Fragments containing C5 and C3 were used as anchors. Occupancies of CTCF (D) and Rad21 (E) were determined at the CTCF sites by ChIP. Results are presented as the means ± SEM of four to six independent experiments in ChIP and 3C assay. *P
    Figure Legend Snippet: Chromatin interaction between CTCF sites around the β-globin locus in TSA treated MEL/ch11 cells. (A) MEL/ch11 cells were treated with 25 ng/ml of TSA for 6 h or 24 h. Histone H3 acetylated at K27 was detected by Western blotting in nuclear extract from control cells (Con) and cells treated with TSA. Histone H3 was used as an experimental control. (B) H3K27ac was determined in CTCF sites around the β-globin locus by ChIP. DNA immunoprecipitated by H3K27ac antibodies were quantitatively compared with DNA immunoprecipitated by H3, and then normalized to value in control cells. Normal IgG (IgG) was used as an experimental negative control. (C) Relative cross-linking frequencies was determined between CTCF sites around the β-globin locus in 3C assay as described in Fig 1E . Fragments containing C5 and C3 were used as anchors. Occupancies of CTCF (D) and Rad21 (E) were determined at the CTCF sites by ChIP. Results are presented as the means ± SEM of four to six independent experiments in ChIP and 3C assay. *P

    Techniques Used: Western Blot, Chromatin Immunoprecipitation, Immunoprecipitation, Negative Control

    37) Product Images from "Bleomycin-induced genome structural variations in normal, non-tumor cells"

    Article Title: Bleomycin-induced genome structural variations in normal, non-tumor cells

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-34580-8

    Ligation-mediated Chimera-Free (LCF) protocol ensures preparation of sequencing libraries virtually free from artificial chimeras. ( A ) LCF protocol outline. LCF is based on assignment of sequencing adapters as single-stranded oligonucleotides at elevated temperature using thermostable Taq DNA ligase. The ligation is facilitated by hybridization of adapter carrying thymine residuals on 3′-end and DNA fragment with A-overhangs at 3′-ends of both strands. At the final step sequencing library is completed by treatment with T4 DNA polymerase in the presence of dNTPs. ( B ) Frequency of artificial chimeras in sequencing libraries prepared with different approaches. ( C ) Spectra of artificial chimeras in sequencing libraries prepared with different approaches. Data in ( B ) shown as the average ± s.d.; n = 3 for each, ligation-based and MuPlus libraries and n = 8 for LCF libraries; statistically significant differences determined by two-tailed t-test.
    Figure Legend Snippet: Ligation-mediated Chimera-Free (LCF) protocol ensures preparation of sequencing libraries virtually free from artificial chimeras. ( A ) LCF protocol outline. LCF is based on assignment of sequencing adapters as single-stranded oligonucleotides at elevated temperature using thermostable Taq DNA ligase. The ligation is facilitated by hybridization of adapter carrying thymine residuals on 3′-end and DNA fragment with A-overhangs at 3′-ends of both strands. At the final step sequencing library is completed by treatment with T4 DNA polymerase in the presence of dNTPs. ( B ) Frequency of artificial chimeras in sequencing libraries prepared with different approaches. ( C ) Spectra of artificial chimeras in sequencing libraries prepared with different approaches. Data in ( B ) shown as the average ± s.d.; n = 3 for each, ligation-based and MuPlus libraries and n = 8 for LCF libraries; statistically significant differences determined by two-tailed t-test.

    Techniques Used: Ligation, Sequencing, Hybridization, Two Tailed Test

    38) Product Images from "Solid-phase enzyme catalysis of DNA end repair and 3′ A-tailing reduces GC-bias in next-generation sequencing of human genomic DNA"

    Article Title: Solid-phase enzyme catalysis of DNA end repair and 3′ A-tailing reduces GC-bias in next-generation sequencing of human genomic DNA

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-34079-2

    CE analysis of processing synthetic DNA by soluble enzyme mix PKT and immobilized enzymes. 5′ FAM-labeled blunt-end substrates, 51-AT possessing multiple 3′ terminal A-T base pairs, and 51-GC possessing multiple 3′ terminal G-C base pairs, were incubated with PKT for end repair at 20 °C for 30 min followed by 65 °C for 30 min (PKT mix). The substrates were also treated with immobilized T4 DNA pol and PNK at 20 °C for 30 min, followed by separation of the enzymes on beads and the reaction medium (supernatant). The reaction medium was subsequently treated with immobilized Taq DNA pol for 3′ A-tailing at 37 °C for 30 min (IM PKT mix). The CE data show that incubation with PKT resulted in extensive degradation of 51-AT and little degradation of 51-GC. Treatment of 51-AT or 51-GC with the immobilized enzymes resulted in mostly 3′ A-tailing product, without detectable degradation of the 5′ FAM-labeled oligos. NC, negative control reaction performed in the absence of enzyme.
    Figure Legend Snippet: CE analysis of processing synthetic DNA by soluble enzyme mix PKT and immobilized enzymes. 5′ FAM-labeled blunt-end substrates, 51-AT possessing multiple 3′ terminal A-T base pairs, and 51-GC possessing multiple 3′ terminal G-C base pairs, were incubated with PKT for end repair at 20 °C for 30 min followed by 65 °C for 30 min (PKT mix). The substrates were also treated with immobilized T4 DNA pol and PNK at 20 °C for 30 min, followed by separation of the enzymes on beads and the reaction medium (supernatant). The reaction medium was subsequently treated with immobilized Taq DNA pol for 3′ A-tailing at 37 °C for 30 min (IM PKT mix). The CE data show that incubation with PKT resulted in extensive degradation of 51-AT and little degradation of 51-GC. Treatment of 51-AT or 51-GC with the immobilized enzymes resulted in mostly 3′ A-tailing product, without detectable degradation of the 5′ FAM-labeled oligos. NC, negative control reaction performed in the absence of enzyme.

    Techniques Used: Labeling, Incubation, Negative Control

    Enzyme immobilization and comparison of Illumina library preparation protocols. ( a ) A schematic of covalent conjugation of SNAP-tagged enzyme fusion proteins to magnetic beads functionalized with O 6 . ( b ) Workflow for library construction using immobilized enzymes for Illumina sequencing. A typical streamlined protocol for Illumina library construction is modified by employing immobilized enzymes to catalyze end repair and 3′ A-tailing. This method utilizes SNAP-tagged T4 DNA pol and PNK covalently conjugated to BG-functionalized magnetic beads to carry out end repair of fragmented DNA at 20°C (or 37 °C) for 30 min. The enzymes are removed by magnetic separation from the DNA pool, which is subjected to 3′ A-tailing at 37 °C for 30 min using immobilized Taq DNA pol. ( c ) Streamlined protocol for Illumina amplification-free library preparation using soluble enzymes. Typically, end repair and 3′ A-tailing of fragmented DNA are catalyzed by an enzyme mixture at 20 °C for 30 min, followed by heat treatment at 65 °C for 30 min. ( d ) The workflow of Illumina TruSeq DNA PCR-free LT Library Prep Kit with a purification step. End repair is performed for 30 min at 30 °C, followed by a bead-based step for clean up and size selection. 3′ A-tailing is carried out for 30 min at 37 °C with a subsequent treatment for 5 min at 70 °C. Each library was ligated to preannealed full-length paired-end Illumina adaptors, size-selected and analyzed, and sequenced on an Illumina sequencing platform.
    Figure Legend Snippet: Enzyme immobilization and comparison of Illumina library preparation protocols. ( a ) A schematic of covalent conjugation of SNAP-tagged enzyme fusion proteins to magnetic beads functionalized with O 6 . ( b ) Workflow for library construction using immobilized enzymes for Illumina sequencing. A typical streamlined protocol for Illumina library construction is modified by employing immobilized enzymes to catalyze end repair and 3′ A-tailing. This method utilizes SNAP-tagged T4 DNA pol and PNK covalently conjugated to BG-functionalized magnetic beads to carry out end repair of fragmented DNA at 20°C (or 37 °C) for 30 min. The enzymes are removed by magnetic separation from the DNA pool, which is subjected to 3′ A-tailing at 37 °C for 30 min using immobilized Taq DNA pol. ( c ) Streamlined protocol for Illumina amplification-free library preparation using soluble enzymes. Typically, end repair and 3′ A-tailing of fragmented DNA are catalyzed by an enzyme mixture at 20 °C for 30 min, followed by heat treatment at 65 °C for 30 min. ( d ) The workflow of Illumina TruSeq DNA PCR-free LT Library Prep Kit with a purification step. End repair is performed for 30 min at 30 °C, followed by a bead-based step for clean up and size selection. 3′ A-tailing is carried out for 30 min at 37 °C with a subsequent treatment for 5 min at 70 °C. Each library was ligated to preannealed full-length paired-end Illumina adaptors, size-selected and analyzed, and sequenced on an Illumina sequencing platform.

    Techniques Used: Conjugation Assay, Magnetic Beads, Sequencing, Modification, Amplification, Polymerase Chain Reaction, Purification, Selection

    A model for GC-related sequence coverage bias in amplification-free NGS data. ( a ) A schematic of DNA end “breathing” (or “fraying”) present in the AT-rich fraction of a DNA library. DNA thermal breathing refers to spontaneous local conformational fluctuations, leading to unpaired bases at the ends of DNA duplex. The extent of breathing is highly dependent upon temperature and DNA sequence so that AT-rich segments (AT) melt before GC-rich segments (GC). The difference of the end breathing profile relevant to GC-content leads to less efficient end-polishing of AT-rich fragments during library construction using DNA modifying enzymes, resulting in the under-representation of the AT-rich regions. ( b ) Degradation of AT-rich DNA by 3′-5′ exonuclease activity of T4 DNA pol (blue). Preferential degradation of AT-rich DNA fragments that undergo terminal base pair breathing may occur at the end repair step or during high temperature incubation. ( c , yielding unintended cleavage and primer extension products. Arrow (red) indicates the position of cleavage whereas arrow in black indicates the orientation of primer extension due to intermolecular annealing of two single-stranded 3′ terminal sequences. Primer extension may also occur from intramolecular annealing of a single-stranded 3′ terminal sequence.
    Figure Legend Snippet: A model for GC-related sequence coverage bias in amplification-free NGS data. ( a ) A schematic of DNA end “breathing” (or “fraying”) present in the AT-rich fraction of a DNA library. DNA thermal breathing refers to spontaneous local conformational fluctuations, leading to unpaired bases at the ends of DNA duplex. The extent of breathing is highly dependent upon temperature and DNA sequence so that AT-rich segments (AT) melt before GC-rich segments (GC). The difference of the end breathing profile relevant to GC-content leads to less efficient end-polishing of AT-rich fragments during library construction using DNA modifying enzymes, resulting in the under-representation of the AT-rich regions. ( b ) Degradation of AT-rich DNA by 3′-5′ exonuclease activity of T4 DNA pol (blue). Preferential degradation of AT-rich DNA fragments that undergo terminal base pair breathing may occur at the end repair step or during high temperature incubation. ( c , yielding unintended cleavage and primer extension products. Arrow (red) indicates the position of cleavage whereas arrow in black indicates the orientation of primer extension due to intermolecular annealing of two single-stranded 3′ terminal sequences. Primer extension may also occur from intramolecular annealing of a single-stranded 3′ terminal sequence.

    Techniques Used: Sequencing, Amplification, Next-Generation Sequencing, Activity Assay, Incubation

    39) Product Images from "Saturating Mutagenesis of an Essential Gene: a Majority of the Neisseria gonorrhoeae Major Outer Membrane Porin (PorB) Is Mutable"

    Article Title: Saturating Mutagenesis of an Essential Gene: a Majority of the Neisseria gonorrhoeae Major Outer Membrane Porin (PorB) Is Mutable

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.01073-13

    Sequencing strategy for identifying mutable residues in PorB. Mutated porin sequences were amplified from input plasmid and output genomic DNA pools to generate 200-bp-long amplicons offset by 50 nt along the length of the porB gene. Each amplicon contained both mutated and unmutated sequences (represented by colored and black line segments, respectively), and amplifications were done in triplicate. After purification and quantitation, the amplicons were pooled and ligated to Illumina TruSeq and indexed adapters (represented by the gray line segments) for sequencing. Sequences in the reverse orientation were discarded in the data analysis, with the exception of the two amplicons at the C terminus of the protein, where only the reverse complement sequence was read.
    Figure Legend Snippet: Sequencing strategy for identifying mutable residues in PorB. Mutated porin sequences were amplified from input plasmid and output genomic DNA pools to generate 200-bp-long amplicons offset by 50 nt along the length of the porB gene. Each amplicon contained both mutated and unmutated sequences (represented by colored and black line segments, respectively), and amplifications were done in triplicate. After purification and quantitation, the amplicons were pooled and ligated to Illumina TruSeq and indexed adapters (represented by the gray line segments) for sequencing. Sequences in the reverse orientation were discarded in the data analysis, with the exception of the two amplicons at the C terminus of the protein, where only the reverse complement sequence was read.

    Techniques Used: Sequencing, Amplification, Plasmid Preparation, Purification, Quantitation Assay

    40) Product Images from "BisQC: an operational pipeline for multiplexed bisulfite sequencing"

    Article Title: BisQC: an operational pipeline for multiplexed bisulfite sequencing

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-15-290

    Major RRBS library construction steps. This figure demonstrates adaptor ligation (step 1) and barcode indexing (step 2) for Illumina two-step library preparation, as well as in between steps including bisulfite treatment. We show how the 2-step procedure affects DNA inserts when used for RRBS directional sequencing. First, DNA inserts (underlined) with ‘A’ overhangs are ligated to methylated Illumina adaptors (methylated cytosines are marked in bold), meC-PE1 and meC-PE2. Next, adaptor ligated-DNA inserts are bisulfite treated and amplified using primer indPEPCR1F and indPEPCR2R. All unmethylated cytosines deaminate to uracil. We show two cycles of the PCR reaction toamplify bisulfite fragments to show how DNA inserts change after bisulfite treatment and amplification, as well as to track original top (OT) and original bottom (OB) strands. After an appropriate number of cycles (appropriate is defined by the visualization of bands shown in this manuscript in the library preparation stage), bisulfite treated libraries can be indexed, then sent for sequencing. Note that for directional sequencing all sequencing reads are either from the original top (OT) or the original bottom (OB) strands. The first three bases of almost all RRBS reads are either CGG or TGG, depending on their genomic methylation state and this applies to reads generated from both OT and OB strand. Therefore almost every read in a directional RRBS sequencing experiment that use MspI digestion contains at least one CpG at the 2nd and 3rd base positions, plus any internal CpGs (provided they are not in CCGG or CCGG sequences). Internal CpGs can be in CCGG sequence where MspI does not cut when the first C is methylated. Abbreviations: C (Bold): methylated C; p: phosphate; s: phosphorothioate bond. Illustrated insert DNA is underlined. P5 (5′ AATGATACGGCGACCACCGA 3′) and P7 (5′ CAAGCAGAAGACGGCATACGA 3′) are flow cell attachment sites.
    Figure Legend Snippet: Major RRBS library construction steps. This figure demonstrates adaptor ligation (step 1) and barcode indexing (step 2) for Illumina two-step library preparation, as well as in between steps including bisulfite treatment. We show how the 2-step procedure affects DNA inserts when used for RRBS directional sequencing. First, DNA inserts (underlined) with ‘A’ overhangs are ligated to methylated Illumina adaptors (methylated cytosines are marked in bold), meC-PE1 and meC-PE2. Next, adaptor ligated-DNA inserts are bisulfite treated and amplified using primer indPEPCR1F and indPEPCR2R. All unmethylated cytosines deaminate to uracil. We show two cycles of the PCR reaction toamplify bisulfite fragments to show how DNA inserts change after bisulfite treatment and amplification, as well as to track original top (OT) and original bottom (OB) strands. After an appropriate number of cycles (appropriate is defined by the visualization of bands shown in this manuscript in the library preparation stage), bisulfite treated libraries can be indexed, then sent for sequencing. Note that for directional sequencing all sequencing reads are either from the original top (OT) or the original bottom (OB) strands. The first three bases of almost all RRBS reads are either CGG or TGG, depending on their genomic methylation state and this applies to reads generated from both OT and OB strand. Therefore almost every read in a directional RRBS sequencing experiment that use MspI digestion contains at least one CpG at the 2nd and 3rd base positions, plus any internal CpGs (provided they are not in CCGG or CCGG sequences). Internal CpGs can be in CCGG sequence where MspI does not cut when the first C is methylated. Abbreviations: C (Bold): methylated C; p: phosphate; s: phosphorothioate bond. Illustrated insert DNA is underlined. P5 (5′ AATGATACGGCGACCACCGA 3′) and P7 (5′ CAAGCAGAAGACGGCATACGA 3′) are flow cell attachment sites.

    Techniques Used: Ligation, Sequencing, Methylation, Amplification, Polymerase Chain Reaction, Generated, Cell Attachment Assay

    Illumina HiSeq2000 QC of one representative sample. A) Raw quality scores (FASTQ) of reads from one bisulfite treated library (G12; lane 6). B) Graph showing the representation of each base at each position in a 50 base read. Notice the very low level of Cytosine residues compared to the high content of Adenosine residues; non-bisulifte converted DNA shows approximately equal base composition at each site. One metric of C-T conversion rate is the ratio of C residues at bases 1–10 and 40–50. In the graph above, this ratio is about 1, as expected. In RRBS libraries, a large increase in Guanidine at positions 2 and 3 (~95% of reads have GG at these positions) should also be observed.
    Figure Legend Snippet: Illumina HiSeq2000 QC of one representative sample. A) Raw quality scores (FASTQ) of reads from one bisulfite treated library (G12; lane 6). B) Graph showing the representation of each base at each position in a 50 base read. Notice the very low level of Cytosine residues compared to the high content of Adenosine residues; non-bisulifte converted DNA shows approximately equal base composition at each site. One metric of C-T conversion rate is the ratio of C residues at bases 1–10 and 40–50. In the graph above, this ratio is about 1, as expected. In RRBS libraries, a large increase in Guanidine at positions 2 and 3 (~95% of reads have GG at these positions) should also be observed.

    Techniques Used:

    Related Articles

    Sequencing:

    Article Title: Bleomycin-induced genome structural variations in normal, non-tumor cells
    Article Snippet: .. The sequencing adaptor oligos were: 5′-CCTCTCTATGGGCAGTCGGTGATTTTTTTT-3′ (universal adaptor) and 5′-CCATCTCATCCCTGCGTGTCTCCGACTCAG NNNNNNNNNN TTTTTTTT-3′ (barcoded adaptors, where NNNNNNNNNN represents an IonXpress barcode); End-repair II using T4 DNA polymerase (NEB) and dNTP mix (NEB). .. All completed libraries were size selected using the PippinHT System (Sage Science, Beverly, MA, USA) and quantified using KAPA Library Quantification Kit for Ion Torrent Platform (Kapa Biosystems, Inc., Wilmington, MA, USA).

    Article Title: Rapid Restriction Enzyme-Free Cloning of PCR Products: A High-Throughput Method Applicable for Library Construction
    Article Snippet: .. After clean up ∼5 µg dsDNA was treated with T4 DNA polymerase in the presence of dTTP, which resulted in 4- base long 5′ overhangs, CGGC and CCTC at the 5′ and 3′ ends of the fragments (H). the part sequence (7 bases) of the adapter is shown in H and I as the remaining portion of the adapter can vary depending upon the requirement. .. These two ends are compatible with BsaI-digested vector pVCEPI23764.

    Methylation:

    Article Title: Guide Positioning Sequencing identifies aberrant DNA methylation patterns that alter cell identity and tumor-immune surveillance networks
    Article Snippet: .. If the T4 DNA polymerase sufficiently treated the 3′-end of the fragment, the cytosines (Cs) in the 3′-end of the fragment could be all methylated. ..

    Purification:

    Article Title: High-Throughput Protein Expression Using a Combination of Ligation-Independent Cloning (LIC) and Infrared Fluorescent Protein (IFP) Detection
    Article Snippet: .. PCR products were treated at 22°C for 30 min with T4 DNA polymerase in the presence of dTTP, using the following reaction setup: 0.2 pmol purified PCR product, 2 µL 10× buffer 2 (NEB), 2 µL dATP (25 mM), 1 µL DTT (100 mM), 2 µL 10× BSA (10 mg/mL; NEB), 1 U T4 DNA polymerase (NEB) in a volume of 20 µL (filled up with ddH2 O). .. The reaction mix was heat inactivated for 20 min at 75°C, followed by purification using the NucleoSpin Extract II kit (Macherey & Nagel) and eluting with 20 µL elution buffer included in the kit.

    Concentration Assay:

    Article Title: Guide Positioning Sequencing identifies aberrant DNA methylation patterns that alter cell identity and tumor-immune surveillance networks
    Article Snippet: .. Thirty units of T4 DNA polymerase (New England BioLabs, M0203L) was used to perform 3′→5′ digestion of the DNA fragments for 100 min at 12°C followed by adding 10 µL dNTP mix which contained dATP, dTTP, dGTP, and 5′-methyl-dCTP nucleotide (final concentration 0.5 mM) and incubating for 30 min at 37°C. .. Then, A-tailing was performed by klenow fragment (3′→5′ exo-) from NEB (M0212L), and methylated adapter was ligated to DNA fragments using T4 DNA ligase from NEB (M0203L) according to the manufacturer's instruction.

    other:

    Article Title: Rapid Restriction Enzyme-Free Cloning of PCR Products: A High-Throughput Method Applicable for Library Construction
    Article Snippet: The strategy of insert preparation by T4 DNA polymerase in the presence of single dNTPs can also be used to produce modules with compatible ends to ligate multiple fragments thus expanding the scope of previously described strategy which is based on the use of type IIs restriction endonucleases, which limits the use only to those modules that are devoid of those restriction sites , .

    Polymerase Chain Reaction:

    Article Title: High-Throughput Protein Expression Using a Combination of Ligation-Independent Cloning (LIC) and Infrared Fluorescent Protein (IFP) Detection
    Article Snippet: .. PCR products were treated at 22°C for 30 min with T4 DNA polymerase in the presence of dTTP, using the following reaction setup: 0.2 pmol purified PCR product, 2 µL 10× buffer 2 (NEB), 2 µL dATP (25 mM), 1 µL DTT (100 mM), 2 µL 10× BSA (10 mg/mL; NEB), 1 U T4 DNA polymerase (NEB) in a volume of 20 µL (filled up with ddH2 O). .. The reaction mix was heat inactivated for 20 min at 75°C, followed by purification using the NucleoSpin Extract II kit (Macherey & Nagel) and eluting with 20 µL elution buffer included in the kit.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs nebnext end repair module
    Genes and repetitive DNA in centromeres. (A) Overlap between CENH3 enrichment and genetic elements. Within the centromere, we assigned each 20-kb locus into one of two categories, “low CENH3 loci” and “high CENH3 loci,” based on whether it exhibited less than or greater than the median CENH3 enrichment. Results are shown for three methods of measuring CENH3 enrichment. The first two are relative to a total nucleosome control produced by MNase digestion of total chromatin and relative to a randomly sheared naked DNA control produced by <t>NEBNext</t> dsDNA Fragmentase ( Gent et al. 2014 ). In both cases, only uniquely mapping reads were considered. In the third method, no control was used, and enrichment was defined by raw read counts, including nonuniquely mapping reads. Errors bars are standard errors of the means for each set of loci. (B) Comparison of genetic elements in centromeric 20-kb loci and whole-genome 20-kb loci, but without regard to relative CENH3 enrichment within centromeres
    Nebnext End Repair Module, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nebnext end repair module/product/New England Biolabs
    Average 99 stars, based on 17 article reviews
    Price from $9.99 to $1999.99
    nebnext end repair module - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    93
    New England Biolabs nebnext ultra ii end repair da tailing module
    Genes and repetitive DNA in centromeres. (A) Overlap between CENH3 enrichment and genetic elements. Within the centromere, we assigned each 20-kb locus into one of two categories, “low CENH3 loci” and “high CENH3 loci,” based on whether it exhibited less than or greater than the median CENH3 enrichment. Results are shown for three methods of measuring CENH3 enrichment. The first two are relative to a total nucleosome control produced by MNase digestion of total chromatin and relative to a randomly sheared naked DNA control produced by <t>NEBNext</t> dsDNA Fragmentase ( Gent et al. 2014 ). In both cases, only uniquely mapping reads were considered. In the third method, no control was used, and enrichment was defined by raw read counts, including nonuniquely mapping reads. Errors bars are standard errors of the means for each set of loci. (B) Comparison of genetic elements in centromeric 20-kb loci and whole-genome 20-kb loci, but without regard to relative CENH3 enrichment within centromeres
    Nebnext Ultra Ii End Repair Da Tailing Module, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 93/100, based on 67 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nebnext ultra ii end repair da tailing module/product/New England Biolabs
    Average 93 stars, based on 67 article reviews
    Price from $9.99 to $1999.99
    nebnext ultra ii end repair da tailing module - by Bioz Stars, 2020-07
    93/100 stars
      Buy from Supplier

    Image Search Results


    Genes and repetitive DNA in centromeres. (A) Overlap between CENH3 enrichment and genetic elements. Within the centromere, we assigned each 20-kb locus into one of two categories, “low CENH3 loci” and “high CENH3 loci,” based on whether it exhibited less than or greater than the median CENH3 enrichment. Results are shown for three methods of measuring CENH3 enrichment. The first two are relative to a total nucleosome control produced by MNase digestion of total chromatin and relative to a randomly sheared naked DNA control produced by NEBNext dsDNA Fragmentase ( Gent et al. 2014 ). In both cases, only uniquely mapping reads were considered. In the third method, no control was used, and enrichment was defined by raw read counts, including nonuniquely mapping reads. Errors bars are standard errors of the means for each set of loci. (B) Comparison of genetic elements in centromeric 20-kb loci and whole-genome 20-kb loci, but without regard to relative CENH3 enrichment within centromeres

    Journal: Genetics

    Article Title: Stable Patterns of CENH3 Occupancy Through Maize Lineages Containing Genetically Similar Centromeres

    doi: 10.1534/genetics.115.177360

    Figure Lengend Snippet: Genes and repetitive DNA in centromeres. (A) Overlap between CENH3 enrichment and genetic elements. Within the centromere, we assigned each 20-kb locus into one of two categories, “low CENH3 loci” and “high CENH3 loci,” based on whether it exhibited less than or greater than the median CENH3 enrichment. Results are shown for three methods of measuring CENH3 enrichment. The first two are relative to a total nucleosome control produced by MNase digestion of total chromatin and relative to a randomly sheared naked DNA control produced by NEBNext dsDNA Fragmentase ( Gent et al. 2014 ). In both cases, only uniquely mapping reads were considered. In the third method, no control was used, and enrichment was defined by raw read counts, including nonuniquely mapping reads. Errors bars are standard errors of the means for each set of loci. (B) Comparison of genetic elements in centromeric 20-kb loci and whole-genome 20-kb loci, but without regard to relative CENH3 enrichment within centromeres

    Article Snippet: We end-repaired and 5′-phosphorylated using the End Repair Module (New England Biolabs #E6050L), A-tailed with Klenow exo- (New England Biolabs #M0212S), and ligated to adapters (8.3 nM) with a Quick Ligase Kit (New England Biolabs #M2200S).

    Techniques: Produced