nebnext end repair module  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    NEBNext End Repair Module
    Description:
    NEBNext End Repair Module 100 rxns
    Catalog Number:
    E6050L
    Price:
    347
    Size:
    100 rxns
    Category:
    DNA Template Preparation for PCR
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs nebnext end repair module
    NEBNext End Repair Module
    NEBNext End Repair Module 100 rxns
    https://www.bioz.com/result/nebnext end repair module/product/New England Biolabs
    Average 99 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    nebnext end repair module - by Bioz Stars, 2019-10
    99/100 stars

    Images

    1) Product Images from "Stable Patterns of CENH3 Occupancy Through Maize Lineages Containing Genetically Similar Centromeres"

    Article Title: Stable Patterns of CENH3 Occupancy Through Maize Lineages Containing Genetically Similar Centromeres

    Journal: Genetics

    doi: 10.1534/genetics.115.177360

    Genes and repetitive DNA in centromeres. (A) Overlap between CENH3 enrichment and genetic elements. Within the centromere, we assigned each 20-kb locus into one of two categories, “low CENH3 loci” and “high CENH3 loci,” based on whether it exhibited less than or greater than the median CENH3 enrichment. Results are shown for three methods of measuring CENH3 enrichment. The first two are relative to a total nucleosome control produced by MNase digestion of total chromatin and relative to a randomly sheared naked DNA control produced by NEBNext dsDNA Fragmentase ( Gent et al. 2014 ). In both cases, only uniquely mapping reads were considered. In the third method, no control was used, and enrichment was defined by raw read counts, including nonuniquely mapping reads. Errors bars are standard errors of the means for each set of loci. (B) Comparison of genetic elements in centromeric 20-kb loci and whole-genome 20-kb loci, but without regard to relative CENH3 enrichment within centromeres
    Figure Legend Snippet: Genes and repetitive DNA in centromeres. (A) Overlap between CENH3 enrichment and genetic elements. Within the centromere, we assigned each 20-kb locus into one of two categories, “low CENH3 loci” and “high CENH3 loci,” based on whether it exhibited less than or greater than the median CENH3 enrichment. Results are shown for three methods of measuring CENH3 enrichment. The first two are relative to a total nucleosome control produced by MNase digestion of total chromatin and relative to a randomly sheared naked DNA control produced by NEBNext dsDNA Fragmentase ( Gent et al. 2014 ). In both cases, only uniquely mapping reads were considered. In the third method, no control was used, and enrichment was defined by raw read counts, including nonuniquely mapping reads. Errors bars are standard errors of the means for each set of loci. (B) Comparison of genetic elements in centromeric 20-kb loci and whole-genome 20-kb loci, but without regard to relative CENH3 enrichment within centromeres

    Techniques Used: Produced

    Related Articles

    Methylation Sequencing:

    Article Title: Next-generation sequencing methylation profiling of subjects with obesity identifies novel gene changes
    Article Snippet: Paragraph title: Reduced representation bisulfite sequencing (RRBS) ... End-repair A tailing was performed (New England Biolabs, Ipswich, MA) and TruSeq methylated indexed adaptors (Illumina, San Diego, CA) were ligated with T4 DNA ligase (New England Biolabs, Ipswich, MA).

    Clone Assay:

    Article Title: Differences in Vector Genome Processing and Illegitimate Integration of Non-Integrating Lentiviral Vectors
    Article Snippet: Illegitimate integration was quantified by isolating drug-resistant clones after transducing HEK 293 cells with a Bleomycin resistance transgene. .. Starting with 1000 ng of sheared fragments, the ends were repaired using the NEBNext End Repair Module (NEB, Ipswich, MA) and 3’ dA-tailed with the NEBNext dA-Tailing Module (NEB, Ipswich, MA).

    Amplification:

    Article Title: Determining exon connectivity in complex mRNAs by nanopore sequencing
    Article Snippet: Paragraph title: Amplicon library preparation and Oxford Nanopore sequencing ... Briefly, a total of 850 ng (spike-in) and 1 μg (mixed heads) in 80 μL was end repaired using NEBNext End Repair Module (New England Biolabs, Cat No: E6050) and followed by dA tailing using NEBNext dA Tailing Module (New England Biolabs, Cat No: E6053).

    Article Title: Using ultra-sensitive next generation sequencing to dissect DNA damage-induced mutagenesis
    Article Snippet: The recovered DNA can be used for preparing standard NGS libraries. .. The amplified DNA ( ~ 800 ng) was sheared into 700 bp in ddH2 O (85 μl) using Covaris S220 (shearing condition: duty cycle: 5%, intensity: 3, cycles per burst: 200, time: 75 s), then end-repaired using NEBNext® End Repair Module (NEB, E6050S) and purified with 1X Ampure XP beads. .. The NEBNext® dA-Tailing Module (NEB, E6053S) was used for dA-tailing.

    Article Title: Mechanisms Underlying Adaptation to Life in Hydrogen Sulfide–Rich Environments
    Article Snippet: RNA was bound to and eluted twice from Dynabeads to minimize ribosomal RNA contamination. mRNA was fragmented to an average size of 400 nt using NEB’s mRNA Fragmentation Module by incubation at 94 °C for 4 min. Fragmented mRNA was purified using Agencourt RNAClean XP beads and eluted in 12 μl ddH2 O. First-strand cDNA was synthesized in a 20 μl reaction using Invitrogen’s double-stranded cDNA kit, primed with 1 μl of a mix of random hexamers:oligo dT primers (2 μg:1 μg), and incubated with Superscript II at 45 °C for 1 h. Double-stranded cDNA was synthesized directly from the first-strand cDNA using the NEBNext mRNA Second Strand Synthesis kit. .. After second-strand cDNA synthesis, the reaction was purified with Agencourt Ampure XP beads and eluted in 25 μl ddH2 O. Double-stranded cDNA was used as input for Illumina sequencing library preparation with end-repair using the NEBNext end-repair kit, A-tailing with Taq polymerase, ligation with Truseq barcoded adapters, and amplification with Kapa Library Amplification Readymix. .. All steps were cleaned up with Ampure XP beads.

    Article Title: Next-generation sequencing methylation profiling of subjects with obesity identifies novel gene changes
    Article Snippet: End-repair A tailing was performed (New England Biolabs, Ipswich, MA) and TruSeq methylated indexed adaptors (Illumina, San Diego, CA) were ligated with T4 DNA ligase (New England Biolabs, Ipswich, MA). .. Bisulfite conversion was performed using EZ DNA Methylation Kit (Zymo Research, Irvine, CA) as recommended by the manufacturer with the exception that an incubation was performed using 55 cycles of 95 °C for 30 s and 50 °C for 15 min.

    Article Title: Analysis of the mouse gut microbiome using full-length 16S rRNA amplicon sequencing
    Article Snippet: The amount of recovered DNA was quantified using a Qubit 3.0 fluorometer (Life Technologies, Carlsbad, CA, USA), and 300 ng of purified amplicon DNA with 5 μL of internal control DNA (DNA CS from the SQK-MAP006 kit) was used as input for generation of MinION-compatible libraries. .. The amplicons were end repaired using the NEBNext End Repair module (NEB, Ipswich, MA, USA).

    Article Title: The Genome of the Self-Fertilizing Mangrove Rivulus Fish, Kryptolebias marmoratus: A Model for Studying Phenotypic Plasticity and Adaptations to Extreme Environments
    Article Snippet: First-strand and second-stranded cDNA was synthesized and the reaction was purified with Agencourt Ampure XP beads. .. Double-stranded cDNA was used as input for Illumina sequencing library preparation using the NEBNext end-repair kit, A-tailing with Taq polymerase, ligation with barcoded adapters, and amplification with Kapa Library Amplification Readymix or as part of the NEBNext® Ultra Directional RNA Library Prep Kit. .. DNA was extracted from liver tissue from a lab-reared specimen of K. hermaphroditus (strain GITMO), also from the Earley laboratory.

    Article Title: Co-transcriptional R-loops are the main cause of estrogen-induced DNA damage
    Article Snippet: Briefly, input and DRIP DNA was sonicated to approximately 300–700 bp on a Bioruptor (Diagenode). .. End repair (NEB E6050S), A-tailing (NEB M0212S), ligation of adapters (NEB M2200S; Affymetrix Prep2Seq Adapters 79800), and PCR amplification were performed by standard methods as described ( ). .. Ampure XP beads (Beckman Coulter, A63880) were used for size selection.

    Article Title: Differences in Vector Genome Processing and Illegitimate Integration of Non-Integrating Lentiviral Vectors
    Article Snippet: Paragraph title: Amplification of vector-genome junctions ... Starting with 1000 ng of sheared fragments, the ends were repaired using the NEBNext End Repair Module (NEB, Ipswich, MA) and 3’ dA-tailed with the NEBNext dA-Tailing Module (NEB, Ipswich, MA).

    Article Title: Flower preferences and pollen transport networks for cavity‐nesting solitary bees: Implications for the design of agri‐environment schemes, et al. Flower preferences and pollen transport networks for cavity‐nesting solitary bees: Implications for the design of agri‐environment schemes
    Article Snippet: Amplicon libraries were prepared using 200 ng of each PCR product and the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® with dual indexing (barcoding). .. The products were end repaired and “A” tailed using the NEBNext End Prep module, NEBNext adaptors were ligated onto the amplicons using the NEB Adaptor Ligation Module and dual indexes incorporated during the PCR enrichment step using NEBNext Ultra ll Q5 Master Mix and NEB Next Multiplex Oligos for Illumina.

    DNA Ligation:

    Article Title: Differences in Vector Genome Processing and Illegitimate Integration of Non-Integrating Lentiviral Vectors
    Article Snippet: Starting with 1000 ng of sheared fragments, the ends were repaired using the NEBNext End Repair Module (NEB, Ipswich, MA) and 3’ dA-tailed with the NEBNext dA-Tailing Module (NEB, Ipswich, MA). .. Products greater than ~300 bp were selected and purified using a 0.8:1 ratio of AMPure XP beads (Beckman Coulter, Brea, CA) to dA-tailed product.

    Synthesized:

    Article Title: Mechanisms Underlying Adaptation to Life in Hydrogen Sulfide–Rich Environments
    Article Snippet: RNA was bound to and eluted twice from Dynabeads to minimize ribosomal RNA contamination. mRNA was fragmented to an average size of 400 nt using NEB’s mRNA Fragmentation Module by incubation at 94 °C for 4 min. Fragmented mRNA was purified using Agencourt RNAClean XP beads and eluted in 12 μl ddH2 O. First-strand cDNA was synthesized in a 20 μl reaction using Invitrogen’s double-stranded cDNA kit, primed with 1 μl of a mix of random hexamers:oligo dT primers (2 μg:1 μg), and incubated with Superscript II at 45 °C for 1 h. Double-stranded cDNA was synthesized directly from the first-strand cDNA using the NEBNext mRNA Second Strand Synthesis kit. .. After second-strand cDNA synthesis, the reaction was purified with Agencourt Ampure XP beads and eluted in 25 μl ddH2 O. Double-stranded cDNA was used as input for Illumina sequencing library preparation with end-repair using the NEBNext end-repair kit, A-tailing with Taq polymerase, ligation with Truseq barcoded adapters, and amplification with Kapa Library Amplification Readymix.

    Article Title: The Genome of the Self-Fertilizing Mangrove Rivulus Fish, Kryptolebias marmoratus: A Model for Studying Phenotypic Plasticity and Adaptations to Extreme Environments
    Article Snippet: First-strand and second-stranded cDNA was synthesized and the reaction was purified with Agencourt Ampure XP beads. .. Double-stranded cDNA was used as input for Illumina sequencing library preparation using the NEBNext end-repair kit, A-tailing with Taq polymerase, ligation with barcoded adapters, and amplification with Kapa Library Amplification Readymix or as part of the NEBNext® Ultra Directional RNA Library Prep Kit.

    Article Title: The genome sequence of Bipolaris cookei reveals mechanisms of pathogenesis underlying target leaf spot of sorghum
    Article Snippet: First strand cDNA was synthesized from the fragmented mRNA with random hexamers (Integrated DNA Technologies, Inc., Coralville, IA, USA) and M-MLV Reverse Transcriptase (Promega, Madison, WI, USA), and second strand synthesis was performed with a NEBNext mRNA Second Strand Synthesis Module (New England Biolabs). .. End repair was performed on the second strand DNA with a NEBNext End Repair Module (New England Biolabs).

    Lambda DNA Preparation:

    Article Title: A novel method for the multiplexed target enrichment of MinION next generation sequencing libraries using PCR-generated baits
    Article Snippet: We end-repaired the sheared DNA with NEBNext End Repair module, purified it with AMPure XP beads and dA-tailed it with NEBNext dA-tailing module (E6053S, New England BioLabs, Hitchin, UK). .. The hybridization of the pooled biotin-baits with the PCR-adapter-ligated DNA was based on the protocol of SeqCap Hybridization and Wash Kit (05634261001, Roche Diagnostics, Indianapolis, IN, USA), after the modification of the initial hybridization mixture.

    Concentration Assay:

    Article Title: A novel method for the multiplexed target enrichment of MinION next generation sequencing libraries using PCR-generated baits
    Article Snippet: We gel-extracted the PCR products with QIAquick Gel Extraction Kit (28704, Qiagen, Hilden, DE) and we assessed their concentration using the Quant-iT PicoGreen dsDNA kit (P11496, Invitrogen, Carlsbad, CA). .. We end-repaired the sheared DNA with NEBNext End Repair module, purified it with AMPure XP beads and dA-tailed it with NEBNext dA-tailing module (E6053S, New England BioLabs, Hitchin, UK).

    Article Title: Mechanisms Underlying Adaptation to Life in Hydrogen Sulfide–Rich Environments
    Article Snippet: After second-strand cDNA synthesis, the reaction was purified with Agencourt Ampure XP beads and eluted in 25 μl ddH2 O. Double-stranded cDNA was used as input for Illumina sequencing library preparation with end-repair using the NEBNext end-repair kit, A-tailing with Taq polymerase, ligation with Truseq barcoded adapters, and amplification with Kapa Library Amplification Readymix. .. After second-strand cDNA synthesis, the reaction was purified with Agencourt Ampure XP beads and eluted in 25 μl ddH2 O. Double-stranded cDNA was used as input for Illumina sequencing library preparation with end-repair using the NEBNext end-repair kit, A-tailing with Taq polymerase, ligation with Truseq barcoded adapters, and amplification with Kapa Library Amplification Readymix.

    SYBR Green Assay:

    Article Title: Analysis of the mouse gut microbiome using full-length 16S rRNA amplicon sequencing
    Article Snippet: The amplification was monitored with SYBR Green gel staining solution (Invitrogen, Grand Island, NY, USA) on a CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) and stopped at the beginning of the saturation point to reduce PCR bias. .. The amplicons were end repaired using the NEBNext End Repair module (NEB, Ipswich, MA, USA).

    Incubation:

    Article Title: Inter-laboratory testing of the effect of DNA blocking reagent G2 on DNA extraction from low-biomass clay samples
    Article Snippet: A single-end Illumina HiSeq sequencing library was prepared using a modified version of the NEBNext ® DNA library Prep Master Mix Set kit (New England BioLabs, MA, USA). .. Briefly, 20 µl DNA was mixed in a PCR tube with 2.4 µl NEBNext 10X Repair Reaction Buffer and 1.25 µl NEBNext End Repair Enzyme which was incubated for 30 minutes at 30 °C. .. The reaction was purified on a MinElute column (Qiagen, Hilden, Germany) and eluted in 18 µl EB buffer at 37 °C for 15 minutes.

    Article Title: BisQC: an operational pipeline for multiplexed bisulfite sequencing
    Article Snippet: The NEBNext DNA Library Prep Master Mix Set for Illumina separates the filling-in step from dA-tailing reaction. .. Using the MspI fragmented DNA (40–85 μL) described above, the NEBNext End Repair Reaction Buffer (10X; 10 μL), and the NEBNext End Repair Enzyme Mix (5 μL), we incubated the solution (final volume of 100 μl) at 20°C for 30 minutes. .. After incubation, the reaction mixture was diluted to 200 μL with dH2 O.

    Article Title: Haplotype-Phased Synthetic Long Reads from Short-Read Sequencing
    Article Snippet: At this point, 15% (30 μL) of the beads were removed to a new tube for two-tube barcode pairing (see below). .. The remaining beads were resuspended in NEBNext End Repair Module solution (42 μL water, 5 μL End Repair Buffer, and 2.5 μL End Repair Enzyme Mix), incubated at 20°C for 30 minutes, and washed twice with 200 μL of 1X B & W buffer and twice with 200 μL of buffer EB. .. The beads were then resuspended in 17 μL water, 2 μL NEB buffer 2, 0.5 μL 10 mM dATP, and 5 units Klenow exo- polymerase, incubated at 37°C for 30 minutes to add dA tails to the DNA fragments, and washed twice with 200 μL of 1X B & W buffer and twice with 200 μL of buffer EB.

    Article Title: Mechanisms Underlying Adaptation to Life in Hydrogen Sulfide–Rich Environments
    Article Snippet: RNA was bound to and eluted twice from Dynabeads to minimize ribosomal RNA contamination. mRNA was fragmented to an average size of 400 nt using NEB’s mRNA Fragmentation Module by incubation at 94 °C for 4 min. Fragmented mRNA was purified using Agencourt RNAClean XP beads and eluted in 12 μl ddH2 O. First-strand cDNA was synthesized in a 20 μl reaction using Invitrogen’s double-stranded cDNA kit, primed with 1 μl of a mix of random hexamers:oligo dT primers (2 μg:1 μg), and incubated with Superscript II at 45 °C for 1 h. Double-stranded cDNA was synthesized directly from the first-strand cDNA using the NEBNext mRNA Second Strand Synthesis kit. .. After second-strand cDNA synthesis, the reaction was purified with Agencourt Ampure XP beads and eluted in 25 μl ddH2 O. Double-stranded cDNA was used as input for Illumina sequencing library preparation with end-repair using the NEBNext end-repair kit, A-tailing with Taq polymerase, ligation with Truseq barcoded adapters, and amplification with Kapa Library Amplification Readymix.

    Article Title: Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing
    Article Snippet: Second strand synthesis was performed with the NEBNext mRNA Second Strand Synthesis Module (New England BioLabs E6111; New England BioLabs, Ipswich, MA, USA), using 45 µl of nuclease-free water, 10 µl of NEBNext Second Strand Synthesis Reaction Buffer and 5 µl of NEBNext Second Strand Synthesis Enzyme Mix, with incubation at 16 °C for 1 h. Double-stranded cDNA (ds cDNA) was purified using a 1.8× volume of Agencourt AMPure XP beads (Beckman Coulter A63880), with a 5 min binding step (with gentle shaking), two washes in 200 µl 70% ethanol and elution in 51 µl nuclease-free water. .. End-repair was performed using the NEBNext End Repair Module (New England BioLabs E6050; New England BioLabs, Ipswich, MA, USA) with 6 µl of 10× end-repair buffer and 3 µl of end-repair enzyme mix added to each of the 51 µl ds cDNA samples, followed by incubation at room temperature for 25 min and clean-up using a 1.8× volume of Agencourt beads (as above), with elution in 25 µl nuclease-free water. .. Next, the end-repaired ds cDNA was dA-tailed with the NEBNext dA-Tailing Module (New England BioLabs E6053; New England BioLabs, Ipswich, MA, USA), using 3 µl of 10× NEBNext dA-Tailing Reaction Buffer and 2 µl of A-tailing enzyme (Klenow Fragment (3′ → 5′ exo-)) and incubation at 37 °C for 30 min, followed by clean-up with 1.8× Agencourt beads (as above) and elution in 15 µl of nuclease-free water.

    Article Title: Next-generation sequencing methylation profiling of subjects with obesity identifies novel gene changes
    Article Snippet: End-repair A tailing was performed (New England Biolabs, Ipswich, MA) and TruSeq methylated indexed adaptors (Illumina, San Diego, CA) were ligated with T4 DNA ligase (New England Biolabs, Ipswich, MA). .. Size selection was performed with Agencourt AMPure XP beads (Beckman Coulter, Indianapolis, IN).

    Article Title: The Genome of the Self-Fertilizing Mangrove Rivulus Fish, Kryptolebias marmoratus: A Model for Studying Phenotypic Plasticity and Adaptations to Extreme Environments
    Article Snippet: Enriched RNA was fragmented to an average size of 400 nt using NEB mRNA Fragmentation Module by incubation at 94 °C for 4 min. Fragmented enriched RNA was purified using Agencourt RNAClean XP beads. .. Double-stranded cDNA was used as input for Illumina sequencing library preparation using the NEBNext end-repair kit, A-tailing with Taq polymerase, ligation with barcoded adapters, and amplification with Kapa Library Amplification Readymix or as part of the NEBNext® Ultra Directional RNA Library Prep Kit.

    Article Title: On site DNA barcoding by nanopore sequencing
    Article Snippet: Double strand DNA molecules were end-repaired using the NEBNext End Repair Module (New England Biolabs, Ipswich, USA), followed by purification with Agencourt AMPure XP at 1.8:1 beads to DNA ratio. .. Amplicons from the three protocols were used to prepare sequencing libraries using the ONT DNA Sequencing kits (SQK-MAP004, SQK-MAP005, and SQK-MAP006).

    Article Title: Candidate genes responsible for early key events of phenobarbital-promoted mouse hepatocellular tumorigenesis based on differentiation of regulating genes between wild type mice and humanized chimeric mice †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7tx00163k
    Article Snippet: Hundred μM Primer-1 and -2 (see ESI Table S1 ) were mixed equally, denatured for 5 min at 95 °C and cooled down to room temperature. .. Sonicated DNA was then end-repaired by incubation for 30 min at 20 °C using the NEBNext End Repair Module (NEB). .. The reaction mixture was purified using the Agencourt AMPure XP (Beckman Coulter), and subjected to 3′-dA tailing by incubation for 30 min at 37 °C using the NEBNext dA-Tailing Module (NEB).

    Modification:

    Article Title: Inter-laboratory testing of the effect of DNA blocking reagent G2 on DNA extraction from low-biomass clay samples
    Article Snippet: A single-end Illumina HiSeq sequencing library was prepared using a modified version of the NEBNext ® DNA library Prep Master Mix Set kit (New England BioLabs, MA, USA). .. Briefly, 20 µl DNA was mixed in a PCR tube with 2.4 µl NEBNext 10X Repair Reaction Buffer and 1.25 µl NEBNext End Repair Enzyme which was incubated for 30 minutes at 30 °C.

    Article Title: A novel method for the multiplexed target enrichment of MinION next generation sequencing libraries using PCR-generated baits
    Article Snippet: We end-repaired the sheared DNA with NEBNext End Repair module, purified it with AMPure XP beads and dA-tailed it with NEBNext dA-tailing module (E6053S, New England BioLabs, Hitchin, UK). .. Finally we ligated the 3’end T-overhanging Y-formed PCR-adapters that were included in the MAP003-MinION gDNA Sequencing Kit (Adapter Short_Y_LI32—LI33, Table ) to the d-A tailed DNA.

    Article Title: Differences in Vector Genome Processing and Illegitimate Integration of Non-Integrating Lentiviral Vectors
    Article Snippet: Briefly, to perform the modified technique for surveying insertion sites, the genomic DNA was first sheared to an approximate size of 1,000 bp using Covaris sonication (Covaris, Wohurn, MA). .. Starting with 1000 ng of sheared fragments, the ends were repaired using the NEBNext End Repair Module (NEB, Ipswich, MA) and 3’ dA-tailed with the NEBNext dA-Tailing Module (NEB, Ipswich, MA).

    Hybridization:

    Article Title: A novel method for the multiplexed target enrichment of MinION next generation sequencing libraries using PCR-generated baits
    Article Snippet: We rehydrated the biotin conjugated oligos ( ) (Table ) (Sigma Aldrich, Gillingham, UK) directly with hybridization buffer (10mM Tris 1mM EDTA pH 7.5–8.0, 50 mM NaCl) and gradually annealed them to form blunt-ended biotin adapters as described in ( ). .. We end-repaired the sheared DNA with NEBNext End Repair module, purified it with AMPure XP beads and dA-tailed it with NEBNext dA-tailing module (E6053S, New England BioLabs, Hitchin, UK).

    Article Title: Highly multiplexed targeted DNA sequencing from single nuclei
    Article Snippet: Φ29 Polymerase (10 units per 1 μl; NEB, cat. no. M0269L; Polymerase buffer is included) dNTP set, 100 mM (NEB, cat. no. N0446S) PBS 1× Qubit dsDNA high-sensitivity assay kit (Invitrogen, cat. no. ) ! .. NEBNext end repair module (NEB, cat. no. E6050L) NEBNext dA-tailing module (NEB, cat. no. E6053L) NEBNext quick ligation module (NEB, cat. no. E6056L) NEBNext high-fidelity 2× PCR master mix (NEB, cat. no. M0541L) SYBR Fast qPCR master mix (KAPA, cat. no. KK4835) SeqCap EZ Choice library (Roche NimbleGen) SeqCap hybridization and wash kit (Roche NimbleGen, cat. no. 05634253001) SeqCap EZ pure capture bead kit (Roche NimbleGen, cat. no. 06 977 952 001) HiFi HotStart mix, 2× (KAPA, cat. no. KK2602) DTT (Fisher Scientific, cat. no. BP172-5) ! .. CAUTION Direct contact can cause irritation.

    Flow Cytometry:

    Article Title: Determining exon connectivity in complex mRNAs by nanopore sequencing
    Article Snippet: Briefly, a total of 850 ng (spike-in) and 1 μg (mixed heads) in 80 μL was end repaired using NEBNext End Repair Module (New England Biolabs, Cat No: E6050) and followed by dA tailing using NEBNext dA Tailing Module (New England Biolabs, Cat No: E6053). .. This reaction mixture was then purified using Agencourt AMPure XP (Beckman Coulter Inc., cat. no. A63880) beads and washed and eluted in nanopore supplied reagents in 25 μL ultrapure water.

    Ligation:

    Article Title: Inter-laboratory testing of the effect of DNA blocking reagent G2 on DNA extraction from low-biomass clay samples
    Article Snippet: Briefly, 20 µl DNA was mixed in a PCR tube with 2.4 µl NEBNext 10X Repair Reaction Buffer and 1.25 µl NEBNext End Repair Enzyme which was incubated for 30 minutes at 30 °C. .. The reaction was purified on a MinElute column (Qiagen, Hilden, Germany) and eluted in 18 µl EB buffer at 37 °C for 15 minutes.

    Article Title: Using ultra-sensitive next generation sequencing to dissect DNA damage-induced mutagenesis
    Article Snippet: The amplified DNA ( ~ 800 ng) was sheared into 700 bp in ddH2 O (85 μl) using Covaris S220 (shearing condition: duty cycle: 5%, intensity: 3, cycles per burst: 200, time: 75 s), then end-repaired using NEBNext® End Repair Module (NEB, E6050S) and purified with 1X Ampure XP beads. .. The amplified DNA ( ~ 800 ng) was sheared into 700 bp in ddH2 O (85 μl) using Covaris S220 (shearing condition: duty cycle: 5%, intensity: 3, cycles per burst: 200, time: 75 s), then end-repaired using NEBNext® End Repair Module (NEB, E6050S) and purified with 1X Ampure XP beads.

    Article Title: Mechanisms Underlying Adaptation to Life in Hydrogen Sulfide–Rich Environments
    Article Snippet: RNA was bound to and eluted twice from Dynabeads to minimize ribosomal RNA contamination. mRNA was fragmented to an average size of 400 nt using NEB’s mRNA Fragmentation Module by incubation at 94 °C for 4 min. Fragmented mRNA was purified using Agencourt RNAClean XP beads and eluted in 12 μl ddH2 O. First-strand cDNA was synthesized in a 20 μl reaction using Invitrogen’s double-stranded cDNA kit, primed with 1 μl of a mix of random hexamers:oligo dT primers (2 μg:1 μg), and incubated with Superscript II at 45 °C for 1 h. Double-stranded cDNA was synthesized directly from the first-strand cDNA using the NEBNext mRNA Second Strand Synthesis kit. .. After second-strand cDNA synthesis, the reaction was purified with Agencourt Ampure XP beads and eluted in 25 μl ddH2 O. Double-stranded cDNA was used as input for Illumina sequencing library preparation with end-repair using the NEBNext end-repair kit, A-tailing with Taq polymerase, ligation with Truseq barcoded adapters, and amplification with Kapa Library Amplification Readymix. .. All steps were cleaned up with Ampure XP beads.

    Article Title: The Genome of the Self-Fertilizing Mangrove Rivulus Fish, Kryptolebias marmoratus: A Model for Studying Phenotypic Plasticity and Adaptations to Extreme Environments
    Article Snippet: First-strand and second-stranded cDNA was synthesized and the reaction was purified with Agencourt Ampure XP beads. .. Double-stranded cDNA was used as input for Illumina sequencing library preparation using the NEBNext end-repair kit, A-tailing with Taq polymerase, ligation with barcoded adapters, and amplification with Kapa Library Amplification Readymix or as part of the NEBNext® Ultra Directional RNA Library Prep Kit. .. DNA was extracted from liver tissue from a lab-reared specimen of K. hermaphroditus (strain GITMO), also from the Earley laboratory.

    Article Title: Co-transcriptional R-loops are the main cause of estrogen-induced DNA damage
    Article Snippet: Briefly, input and DRIP DNA was sonicated to approximately 300–700 bp on a Bioruptor (Diagenode). .. End repair (NEB E6050S), A-tailing (NEB M0212S), ligation of adapters (NEB M2200S; Affymetrix Prep2Seq Adapters 79800), and PCR amplification were performed by standard methods as described ( ). .. Ampure XP beads (Beckman Coulter, A63880) were used for size selection.

    Article Title: Differences in Vector Genome Processing and Illegitimate Integration of Non-Integrating Lentiviral Vectors
    Article Snippet: Starting with 1000 ng of sheared fragments, the ends were repaired using the NEBNext End Repair Module (NEB, Ipswich, MA) and 3’ dA-tailed with the NEBNext dA-Tailing Module (NEB, Ipswich, MA). .. A partially double stranded linker cassette with a 5’ T-overhang (LamTlinkerL: 5’ GACCCGGGAGATCTGAATTCAGTGGCACAGCAGTTAGGT 3’; LamTlinkerS: 5' CCTAACTGCTGTGCCACT 3’) was then ligated to the ends of the purified products using the Fast-Link DNA Ligation kit (Epicentre, Madison, WI).

    Article Title: Flower preferences and pollen transport networks for cavity‐nesting solitary bees: Implications for the design of agri‐environment schemes, et al. Flower preferences and pollen transport networks for cavity‐nesting solitary bees: Implications for the design of agri‐environment schemes
    Article Snippet: Amplicon libraries were prepared using 200 ng of each PCR product and the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® with dual indexing (barcoding). .. The products were end repaired and “A” tailed using the NEBNext End Prep module, NEBNext adaptors were ligated onto the amplicons using the NEB Adaptor Ligation Module and dual indexes incorporated during the PCR enrichment step using NEBNext Ultra ll Q5 Master Mix and NEB Next Multiplex Oligos for Illumina. .. The final products were cleaned using Ampure XP beads and pooled into 2 batches of 80 samples.

    Article Title: Highly multiplexed targeted DNA sequencing from single nuclei
    Article Snippet: Φ29 Polymerase (10 units per 1 μl; NEB, cat. no. M0269L; Polymerase buffer is included) dNTP set, 100 mM (NEB, cat. no. N0446S) PBS 1× Qubit dsDNA high-sensitivity assay kit (Invitrogen, cat. no. ) ! .. NEBNext end repair module (NEB, cat. no. E6050L) NEBNext dA-tailing module (NEB, cat. no. E6053L) NEBNext quick ligation module (NEB, cat. no. E6056L) NEBNext high-fidelity 2× PCR master mix (NEB, cat. no. M0541L) SYBR Fast qPCR master mix (KAPA, cat. no. KK4835) SeqCap EZ Choice library (Roche NimbleGen) SeqCap hybridization and wash kit (Roche NimbleGen, cat. no. 05634253001) SeqCap EZ pure capture bead kit (Roche NimbleGen, cat. no. 06 977 952 001) HiFi HotStart mix, 2× (KAPA, cat. no. KK2602) DTT (Fisher Scientific, cat. no. BP172-5) ! .. CAUTION Direct contact can cause irritation.

    Article Title: Candidate genes responsible for early key events of phenobarbital-promoted mouse hepatocellular tumorigenesis based on differentiation of regulating genes between wild type mice and humanized chimeric mice †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7tx00163k
    Article Snippet: Sonicated DNA was then end-repaired by incubation for 30 min at 20 °C using the NEBNext End Repair Module (NEB). .. The reaction mixture was purified using the Agencourt AMPure XP (Beckman Coulter), and subjected to 3′-dA tailing by incubation for 30 min at 37 °C using the NEBNext dA-Tailing Module (NEB).

    Methylation:

    Article Title: Next-generation sequencing methylation profiling of subjects with obesity identifies novel gene changes
    Article Snippet: DNA (250 ng) was digested with Msp1 (New England Biolabs, Ipswich, MA) and purified using QIAquick Nucleotide Removal Kit (Qiagen, Valencia, CA). .. End-repair A tailing was performed (New England Biolabs, Ipswich, MA) and TruSeq methylated indexed adaptors (Illumina, San Diego, CA) were ligated with T4 DNA ligase (New England Biolabs, Ipswich, MA). .. Size selection was performed with Agencourt AMPure XP beads (Beckman Coulter, Indianapolis, IN).

    Generated:

    Article Title: The Genome of the Self-Fertilizing Mangrove Rivulus Fish, Kryptolebias marmoratus: A Model for Studying Phenotypic Plasticity and Adaptations to Extreme Environments
    Article Snippet: Double-stranded cDNA was used as input for Illumina sequencing library preparation using the NEBNext end-repair kit, A-tailing with Taq polymerase, ligation with barcoded adapters, and amplification with Kapa Library Amplification Readymix or as part of the NEBNext® Ultra Directional RNA Library Prep Kit. .. Double-stranded cDNA was used as input for Illumina sequencing library preparation using the NEBNext end-repair kit, A-tailing with Taq polymerase, ligation with barcoded adapters, and amplification with Kapa Library Amplification Readymix or as part of the NEBNext® Ultra Directional RNA Library Prep Kit.

    Article Title: Flower preferences and pollen transport networks for cavity‐nesting solitary bees: Implications for the design of agri‐environment schemes, et al. Flower preferences and pollen transport networks for cavity‐nesting solitary bees: Implications for the design of agri‐environment schemes
    Article Snippet: The products were end repaired and “A” tailed using the NEBNext End Prep module, NEBNext adaptors were ligated onto the amplicons using the NEB Adaptor Ligation Module and dual indexes incorporated during the PCR enrichment step using NEBNext Ultra ll Q5 Master Mix and NEB Next Multiplex Oligos for Illumina. .. The products were end repaired and “A” tailed using the NEBNext End Prep module, NEBNext adaptors were ligated onto the amplicons using the NEB Adaptor Ligation Module and dual indexes incorporated during the PCR enrichment step using NEBNext Ultra ll Q5 Master Mix and NEB Next Multiplex Oligos for Illumina.

    DNA Sequencing:

    Article Title: On site DNA barcoding by nanopore sequencing
    Article Snippet: Double strand DNA molecules were end-repaired using the NEBNext End Repair Module (New England Biolabs, Ipswich, USA), followed by purification with Agencourt AMPure XP at 1.8:1 beads to DNA ratio. .. Only in the case of protocol 1, the purified amplicons were then processed using the NEBNext dA-tailing module (New England Biolabs), these steps were skipped in protocol 2 and 3.

    Sequencing:

    Article Title: Inter-laboratory testing of the effect of DNA blocking reagent G2 on DNA extraction from low-biomass clay samples
    Article Snippet: Paragraph title: HiSeq sequencing of potential DNA contamination from G2 ... Briefly, 20 µl DNA was mixed in a PCR tube with 2.4 µl NEBNext 10X Repair Reaction Buffer and 1.25 µl NEBNext End Repair Enzyme which was incubated for 30 minutes at 30 °C.

    Article Title: Determining exon connectivity in complex mRNAs by nanopore sequencing
    Article Snippet: The library preparation for amplicon sequencing was done using SQK-MAP003 following manufacturer’s protocol (ONT). .. Briefly, a total of 850 ng (spike-in) and 1 μg (mixed heads) in 80 μL was end repaired using NEBNext End Repair Module (New England Biolabs, Cat No: E6050) and followed by dA tailing using NEBNext dA Tailing Module (New England Biolabs, Cat No: E6053).

    Article Title: Mechanisms Underlying Adaptation to Life in Hydrogen Sulfide–Rich Environments
    Article Snippet: RNA was bound to and eluted twice from Dynabeads to minimize ribosomal RNA contamination. mRNA was fragmented to an average size of 400 nt using NEB’s mRNA Fragmentation Module by incubation at 94 °C for 4 min. Fragmented mRNA was purified using Agencourt RNAClean XP beads and eluted in 12 μl ddH2 O. First-strand cDNA was synthesized in a 20 μl reaction using Invitrogen’s double-stranded cDNA kit, primed with 1 μl of a mix of random hexamers:oligo dT primers (2 μg:1 μg), and incubated with Superscript II at 45 °C for 1 h. Double-stranded cDNA was synthesized directly from the first-strand cDNA using the NEBNext mRNA Second Strand Synthesis kit. .. After second-strand cDNA synthesis, the reaction was purified with Agencourt Ampure XP beads and eluted in 25 μl ddH2 O. Double-stranded cDNA was used as input for Illumina sequencing library preparation with end-repair using the NEBNext end-repair kit, A-tailing with Taq polymerase, ligation with Truseq barcoded adapters, and amplification with Kapa Library Amplification Readymix. .. All steps were cleaned up with Ampure XP beads.

    Article Title: The Genome of the Self-Fertilizing Mangrove Rivulus Fish, Kryptolebias marmoratus: A Model for Studying Phenotypic Plasticity and Adaptations to Extreme Environments
    Article Snippet: First-strand and second-stranded cDNA was synthesized and the reaction was purified with Agencourt Ampure XP beads. .. Double-stranded cDNA was used as input for Illumina sequencing library preparation using the NEBNext end-repair kit, A-tailing with Taq polymerase, ligation with barcoded adapters, and amplification with Kapa Library Amplification Readymix or as part of the NEBNext® Ultra Directional RNA Library Prep Kit. .. DNA was extracted from liver tissue from a lab-reared specimen of K. hermaphroditus (strain GITMO), also from the Earley laboratory.

    Article Title: Co-transcriptional R-loops are the main cause of estrogen-induced DNA damage
    Article Snippet: Paragraph title: Library preparation and sequencing ... End repair (NEB E6050S), A-tailing (NEB M0212S), ligation of adapters (NEB M2200S; Affymetrix Prep2Seq Adapters 79800), and PCR amplification were performed by standard methods as described ( ).

    Article Title: On site DNA barcoding by nanopore sequencing
    Article Snippet: Paragraph title: Library preparation and MinION sequencing ... Double strand DNA molecules were end-repaired using the NEBNext End Repair Module (New England Biolabs, Ipswich, USA), followed by purification with Agencourt AMPure XP at 1.8:1 beads to DNA ratio.

    Article Title: The genome sequence of Bipolaris cookei reveals mechanisms of pathogenesis underlying target leaf spot of sorghum
    Article Snippet: Paragraph title: DNA and RNA extraction and sequencing ... End repair was performed on the second strand DNA with a NEBNext End Repair Module (New England Biolabs).

    Article Title: Alteration of genic 5-hydroxymethylcytosine patterning in olfactory neurons correlates with changes in gene expression and cell identity
    Article Snippet: Genomic DNA was isolated, prepared for single- or paired-end Illumina sequencing using standard protocols, and immunoprecipitated as in Weber et al. ( ) with minor modifications. .. Specifically, sorted cell gDNA was sonicated to 200–1,000 bp with a mean size of ∼400 bp and end repaired (New England Biolabs Next End Repair).

    Sonication:

    Article Title: Key tumor suppressor genes inactivated by “greater promoter” methylation and somatic mutations in head and neck cancer
    Article Snippet: Tissue samples were digested with 1% SDS and 50 μg/mL proteinase K (Boehringer Mannheim) at 48 °C overnight, followed by phenol/chloroform extraction and ethanol precipitation of DNA. .. Two micrograms of DNA were sonicated to a modal size of ~150–250 bp, and end-repaired using the NEBNext SOLiD DNA library preparation kit end-repair module following the manufacturer's protocol (New England Biolabs). .. After column-purification (using the Qiagen PCR purification kit), SOLiD P1 and P2 adapters lacking 5′ phospate groups (Life Technologies) were ligated using the NEBNext adaptor ligation module and column-purified, and subjected to nick-translation by treating with Platinum Taq polymerase to remove the nick.

    Article Title: Co-transcriptional R-loops are the main cause of estrogen-induced DNA damage
    Article Snippet: Briefly, input and DRIP DNA was sonicated to approximately 300–700 bp on a Bioruptor (Diagenode). .. End repair (NEB E6050S), A-tailing (NEB M0212S), ligation of adapters (NEB M2200S; Affymetrix Prep2Seq Adapters 79800), and PCR amplification were performed by standard methods as described ( ).

    Article Title: Differences in Vector Genome Processing and Illegitimate Integration of Non-Integrating Lentiviral Vectors
    Article Snippet: Briefly, to perform the modified technique for surveying insertion sites, the genomic DNA was first sheared to an approximate size of 1,000 bp using Covaris sonication (Covaris, Wohurn, MA). .. Starting with 1000 ng of sheared fragments, the ends were repaired using the NEBNext End Repair Module (NEB, Ipswich, MA) and 3’ dA-tailed with the NEBNext dA-Tailing Module (NEB, Ipswich, MA).

    Article Title: Alteration of genic 5-hydroxymethylcytosine patterning in olfactory neurons correlates with changes in gene expression and cell identity
    Article Snippet: Genomic DNA was isolated, prepared for single- or paired-end Illumina sequencing using standard protocols, and immunoprecipitated as in Weber et al. ( ) with minor modifications. .. Specifically, sorted cell gDNA was sonicated to 200–1,000 bp with a mean size of ∼400 bp and end repaired (New England Biolabs Next End Repair). .. Adenosine was added to 3′ ends (Klenow, 3′–5′ exo-, New England Biolabs), and 10:1 Illumina adaptor:samples were ligated onto the samples.

    Article Title: Candidate genes responsible for early key events of phenobarbital-promoted mouse hepatocellular tumorigenesis based on differentiation of regulating genes between wild type mice and humanized chimeric mice †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7tx00163k
    Article Snippet: Hundred μM Primer-1 and -2 (see ESI Table S1 ) were mixed equally, denatured for 5 min at 95 °C and cooled down to room temperature. .. Sonicated DNA was then end-repaired by incubation for 30 min at 20 °C using the NEBNext End Repair Module (NEB). .. The reaction mixture was purified using the Agencourt AMPure XP (Beckman Coulter), and subjected to 3′-dA tailing by incubation for 30 min at 37 °C using the NEBNext dA-Tailing Module (NEB).

    Methylated DNA Immunoprecipitation:

    Article Title: Alteration of genic 5-hydroxymethylcytosine patterning in olfactory neurons correlates with changes in gene expression and cell identity
    Article Snippet: Paragraph title: meDIP and hmeDIP-seq. ... Specifically, sorted cell gDNA was sonicated to 200–1,000 bp with a mean size of ∼400 bp and end repaired (New England Biolabs Next End Repair).

    Article Title: Candidate genes responsible for early key events of phenobarbital-promoted mouse hepatocellular tumorigenesis based on differentiation of regulating genes between wild type mice and humanized chimeric mice †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7tx00163k
    Article Snippet: Paragraph title: MeDIP and HmeDIP (5mC and 5hmC immunoprecipitation) ... Sonicated DNA was then end-repaired by incubation for 30 min at 20 °C using the NEBNext End Repair Module (NEB).

    DNA Extraction:

    Article Title: Inter-laboratory testing of the effect of DNA blocking reagent G2 on DNA extraction from low-biomass clay samples
    Article Snippet: DNA was extracted from the 2 ml culture both with and without the addition of the G2 compound using the PowerLyzer PowerSoil DNA Isolation Kit (MOBIO). .. Briefly, 20 µl DNA was mixed in a PCR tube with 2.4 µl NEBNext 10X Repair Reaction Buffer and 1.25 µl NEBNext End Repair Enzyme which was incubated for 30 minutes at 30 °C.

    Magnetic Beads:

    Article Title: Haplotype-Phased Synthetic Long Reads from Short-Read Sequencing
    Article Snippet: 20 μL of Dynabeads M-280 Streptavidin Magnetic Beads (Life Technologies) were washed twice with 200 μL of 2X B & W buffer (1X B & W buffer: 5 mM Tris-HCl (pH 7.5), 0.5 mM EDTA, 1 M NaCl) and resuspended in 100 μL of 2X B & W buffer. .. The remaining beads were resuspended in NEBNext End Repair Module solution (42 μL water, 5 μL End Repair Buffer, and 2.5 μL End Repair Enzyme Mix), incubated at 20°C for 30 minutes, and washed twice with 200 μL of 1X B & W buffer and twice with 200 μL of buffer EB.

    Isolation:

    Article Title: Mechanisms Underlying Adaptation to Life in Hydrogen Sulfide–Rich Environments
    Article Snippet: Paragraph title: RNA Isolation and RNAseq Library Construction ... After second-strand cDNA synthesis, the reaction was purified with Agencourt Ampure XP beads and eluted in 25 μl ddH2 O. Double-stranded cDNA was used as input for Illumina sequencing library preparation with end-repair using the NEBNext end-repair kit, A-tailing with Taq polymerase, ligation with Truseq barcoded adapters, and amplification with Kapa Library Amplification Readymix.

    Article Title: The Genome of the Self-Fertilizing Mangrove Rivulus Fish, Kryptolebias marmoratus: A Model for Studying Phenotypic Plasticity and Adaptations to Extreme Environments
    Article Snippet: Total RNA was enriched for non-rRNA using either Ribo-zero (Epicenter) for liver and gonad NEBNext® Poly(A) mRNA Magnetic Isolation module. .. Double-stranded cDNA was used as input for Illumina sequencing library preparation using the NEBNext end-repair kit, A-tailing with Taq polymerase, ligation with barcoded adapters, and amplification with Kapa Library Amplification Readymix or as part of the NEBNext® Ultra Directional RNA Library Prep Kit.

    Article Title: Differences in Vector Genome Processing and Illegitimate Integration of Non-Integrating Lentiviral Vectors
    Article Snippet: Transduced cells were selected for three weeks prior to isolation, after which genomic DNA was extracted using the Puregene DNA Purification Kit (Gentra Systems, Inc., Minneapolis, MN). .. Starting with 1000 ng of sheared fragments, the ends were repaired using the NEBNext End Repair Module (NEB, Ipswich, MA) and 3’ dA-tailed with the NEBNext dA-Tailing Module (NEB, Ipswich, MA).

    Article Title: Alteration of genic 5-hydroxymethylcytosine patterning in olfactory neurons correlates with changes in gene expression and cell identity
    Article Snippet: Genomic DNA was isolated, prepared for single- or paired-end Illumina sequencing using standard protocols, and immunoprecipitated as in Weber et al. ( ) with minor modifications. .. Specifically, sorted cell gDNA was sonicated to 200–1,000 bp with a mean size of ∼400 bp and end repaired (New England Biolabs Next End Repair).

    RNA Extraction:

    Article Title: The genome sequence of Bipolaris cookei reveals mechanisms of pathogenesis underlying target leaf spot of sorghum
    Article Snippet: Paragraph title: DNA and RNA extraction and sequencing ... End repair was performed on the second strand DNA with a NEBNext End Repair Module (New England Biolabs).

    Purification:

    Article Title: Inter-laboratory testing of the effect of DNA blocking reagent G2 on DNA extraction from low-biomass clay samples
    Article Snippet: Briefly, 20 µl DNA was mixed in a PCR tube with 2.4 µl NEBNext 10X Repair Reaction Buffer and 1.25 µl NEBNext End Repair Enzyme which was incubated for 30 minutes at 30 °C. .. The reaction was purified on a MinElute column (Qiagen, Hilden, Germany) and eluted in 18 µl EB buffer at 37 °C for 15 minutes.

    Article Title: Determining exon connectivity in complex mRNAs by nanopore sequencing
    Article Snippet: Briefly, a total of 850 ng (spike-in) and 1 μg (mixed heads) in 80 μL was end repaired using NEBNext End Repair Module (New England Biolabs, Cat No: E6050) and followed by dA tailing using NEBNext dA Tailing Module (New England Biolabs, Cat No: E6053). .. The dA tailed amplicons were then adapter ligated in a total of 100 μL reaction volume and incubated at room temperature for 10 min.

    Article Title: A novel method for the multiplexed target enrichment of MinION next generation sequencing libraries using PCR-generated baits
    Article Snippet: In parallel, we sheared 1 ug of genomic DNA to approximately 5000 bp. .. We end-repaired the sheared DNA with NEBNext End Repair module, purified it with AMPure XP beads and dA-tailed it with NEBNext dA-tailing module (E6053S, New England BioLabs, Hitchin, UK). .. Finally we ligated the 3’end T-overhanging Y-formed PCR-adapters that were included in the MAP003-MinION gDNA Sequencing Kit (Adapter Short_Y_LI32—LI33, Table ) to the d-A tailed DNA.

    Article Title: Using ultra-sensitive next generation sequencing to dissect DNA damage-induced mutagenesis
    Article Snippet: The recovered DNA can be used for preparing standard NGS libraries. .. The amplified DNA ( ~ 800 ng) was sheared into 700 bp in ddH2 O (85 μl) using Covaris S220 (shearing condition: duty cycle: 5%, intensity: 3, cycles per burst: 200, time: 75 s), then end-repaired using NEBNext® End Repair Module (NEB, E6050S) and purified with 1X Ampure XP beads. .. The NEBNext® dA-Tailing Module (NEB, E6053S) was used for dA-tailing.

    Article Title: Mechanisms Underlying Adaptation to Life in Hydrogen Sulfide–Rich Environments
    Article Snippet: RNA was bound to and eluted twice from Dynabeads to minimize ribosomal RNA contamination. mRNA was fragmented to an average size of 400 nt using NEB’s mRNA Fragmentation Module by incubation at 94 °C for 4 min. Fragmented mRNA was purified using Agencourt RNAClean XP beads and eluted in 12 μl ddH2 O. First-strand cDNA was synthesized in a 20 μl reaction using Invitrogen’s double-stranded cDNA kit, primed with 1 μl of a mix of random hexamers:oligo dT primers (2 μg:1 μg), and incubated with Superscript II at 45 °C for 1 h. Double-stranded cDNA was synthesized directly from the first-strand cDNA using the NEBNext mRNA Second Strand Synthesis kit. .. After second-strand cDNA synthesis, the reaction was purified with Agencourt Ampure XP beads and eluted in 25 μl ddH2 O. Double-stranded cDNA was used as input for Illumina sequencing library preparation with end-repair using the NEBNext end-repair kit, A-tailing with Taq polymerase, ligation with Truseq barcoded adapters, and amplification with Kapa Library Amplification Readymix. .. All steps were cleaned up with Ampure XP beads.

    Article Title: Next-generation sequencing methylation profiling of subjects with obesity identifies novel gene changes
    Article Snippet: DNA (250 ng) was digested with Msp1 (New England Biolabs, Ipswich, MA) and purified using QIAquick Nucleotide Removal Kit (Qiagen, Valencia, CA). .. End-repair A tailing was performed (New England Biolabs, Ipswich, MA) and TruSeq methylated indexed adaptors (Illumina, San Diego, CA) were ligated with T4 DNA ligase (New England Biolabs, Ipswich, MA).

    Article Title: Analysis of the mouse gut microbiome using full-length 16S rRNA amplicon sequencing
    Article Snippet: The amount of recovered DNA was quantified using a Qubit 3.0 fluorometer (Life Technologies, Carlsbad, CA, USA), and 300 ng of purified amplicon DNA with 5 μL of internal control DNA (DNA CS from the SQK-MAP006 kit) was used as input for generation of MinION-compatible libraries. .. The amplicons were end repaired using the NEBNext End Repair module (NEB, Ipswich, MA, USA).

    Article Title: The Genome of the Self-Fertilizing Mangrove Rivulus Fish, Kryptolebias marmoratus: A Model for Studying Phenotypic Plasticity and Adaptations to Extreme Environments
    Article Snippet: First-strand and second-stranded cDNA was synthesized and the reaction was purified with Agencourt Ampure XP beads. .. Double-stranded cDNA was used as input for Illumina sequencing library preparation using the NEBNext end-repair kit, A-tailing with Taq polymerase, ligation with barcoded adapters, and amplification with Kapa Library Amplification Readymix or as part of the NEBNext® Ultra Directional RNA Library Prep Kit.

    Article Title: Differences in Vector Genome Processing and Illegitimate Integration of Non-Integrating Lentiviral Vectors
    Article Snippet: Starting with 1000 ng of sheared fragments, the ends were repaired using the NEBNext End Repair Module (NEB, Ipswich, MA) and 3’ dA-tailed with the NEBNext dA-Tailing Module (NEB, Ipswich, MA). .. Products greater than ~300 bp were selected and purified using a 0.8:1 ratio of AMPure XP beads (Beckman Coulter, Brea, CA) to dA-tailed product.

    Article Title: On site DNA barcoding by nanopore sequencing
    Article Snippet: DNA libraries were prepared from 1.5μg of the purified PCR products. .. Double strand DNA molecules were end-repaired using the NEBNext End Repair Module (New England Biolabs, Ipswich, USA), followed by purification with Agencourt AMPure XP at 1.8:1 beads to DNA ratio. .. Only in the case of protocol 1, the purified amplicons were then processed using the NEBNext dA-tailing module (New England Biolabs), these steps were skipped in protocol 2 and 3.

    Article Title: Candidate genes responsible for early key events of phenobarbital-promoted mouse hepatocellular tumorigenesis based on differentiation of regulating genes between wild type mice and humanized chimeric mice †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7tx00163k
    Article Snippet: Sonicated DNA was then end-repaired by incubation for 30 min at 20 °C using the NEBNext End Repair Module (NEB). .. The reaction mixture was purified using the Agencourt AMPure XP (Beckman Coulter), and subjected to 3′-dA tailing by incubation for 30 min at 37 °C using the NEBNext dA-Tailing Module (NEB).

    Polymerase Chain Reaction:

    Article Title: Inter-laboratory testing of the effect of DNA blocking reagent G2 on DNA extraction from low-biomass clay samples
    Article Snippet: A single-end Illumina HiSeq sequencing library was prepared using a modified version of the NEBNext ® DNA library Prep Master Mix Set kit (New England BioLabs, MA, USA). .. Briefly, 20 µl DNA was mixed in a PCR tube with 2.4 µl NEBNext 10X Repair Reaction Buffer and 1.25 µl NEBNext End Repair Enzyme which was incubated for 30 minutes at 30 °C. .. The reaction was purified on a MinElute column (Qiagen, Hilden, Germany) and eluted in 18 µl EB buffer at 37 °C for 15 minutes.

    Article Title: A novel method for the multiplexed target enrichment of MinION next generation sequencing libraries using PCR-generated baits
    Article Snippet: We ligated them with the mixed PCR products using NEBNext Blunt/TA Ligase (M0367S, New England BioLabs, Hitchin, UK) and we purified the produced baits with AMPure XP beads. .. We end-repaired the sheared DNA with NEBNext End Repair module, purified it with AMPure XP beads and dA-tailed it with NEBNext dA-tailing module (E6053S, New England BioLabs, Hitchin, UK).

    Article Title: Analysis of the mouse gut microbiome using full-length 16S rRNA amplicon sequencing
    Article Snippet: The PCR conditions were as follows: 98 °C for 30 s; 15 cycles of 98 °C for 10 s, 47 °C for 30 s, and 72 °C for 60 s; followed by 72 °C for 5 min. PCR products were purified using a MinElute Gel Extraction kit (Qiagen, Venlo, Netherlands). .. The amplicons were end repaired using the NEBNext End Repair module (NEB, Ipswich, MA, USA).

    Article Title: Co-transcriptional R-loops are the main cause of estrogen-induced DNA damage
    Article Snippet: Briefly, input and DRIP DNA was sonicated to approximately 300–700 bp on a Bioruptor (Diagenode). .. End repair (NEB E6050S), A-tailing (NEB M0212S), ligation of adapters (NEB M2200S; Affymetrix Prep2Seq Adapters 79800), and PCR amplification were performed by standard methods as described ( ). .. Ampure XP beads (Beckman Coulter, A63880) were used for size selection.

    Article Title: Differences in Vector Genome Processing and Illegitimate Integration of Non-Integrating Lentiviral Vectors
    Article Snippet: The vector-genome junctions were then amplified by linear amplification mediated PCR (LAM-PCR) off of the 3’ LTR as previously described in two separate experiments (CS-CZW n =12; IN/D116N n=7, 12; LTR/U3att n=8, 11; LTR/U3att-IN/D116N n=4, 9) and/or by a modified technique adapted from Ravin, et al and Zhou, et al (IN/D116N n=12; LTR/U3att n=18; LTR/U3att-IN/D116N n=22). .. Starting with 1000 ng of sheared fragments, the ends were repaired using the NEBNext End Repair Module (NEB, Ipswich, MA) and 3’ dA-tailed with the NEBNext dA-Tailing Module (NEB, Ipswich, MA).

    Article Title: On site DNA barcoding by nanopore sequencing
    Article Snippet: DNA libraries were prepared from 1.5μg of the purified PCR products. .. Double strand DNA molecules were end-repaired using the NEBNext End Repair Module (New England Biolabs, Ipswich, USA), followed by purification with Agencourt AMPure XP at 1.8:1 beads to DNA ratio.

    Article Title: The genome sequence of Bipolaris cookei reveals mechanisms of pathogenesis underlying target leaf spot of sorghum
    Article Snippet: End repair was performed on the second strand DNA with a NEBNext End Repair Module (New England Biolabs). .. Size selection for 480 bp was performed with an Agencourt AMPure XP kit (Beckman Coulter, Brea, CA, USA).

    Article Title: Flower preferences and pollen transport networks for cavity‐nesting solitary bees: Implications for the design of agri‐environment schemes, et al. Flower preferences and pollen transport networks for cavity‐nesting solitary bees: Implications for the design of agri‐environment schemes
    Article Snippet: Amplicon libraries were prepared using 200 ng of each PCR product and the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® with dual indexing (barcoding). .. The products were end repaired and “A” tailed using the NEBNext End Prep module, NEBNext adaptors were ligated onto the amplicons using the NEB Adaptor Ligation Module and dual indexes incorporated during the PCR enrichment step using NEBNext Ultra ll Q5 Master Mix and NEB Next Multiplex Oligos for Illumina. .. The final products were cleaned using Ampure XP beads and pooled into 2 batches of 80 samples.

    Article Title: Highly multiplexed targeted DNA sequencing from single nuclei
    Article Snippet: Φ29 Polymerase (10 units per 1 μl; NEB, cat. no. M0269L; Polymerase buffer is included) dNTP set, 100 mM (NEB, cat. no. N0446S) PBS 1× Qubit dsDNA high-sensitivity assay kit (Invitrogen, cat. no. ) ! .. NEBNext end repair module (NEB, cat. no. E6050L) NEBNext dA-tailing module (NEB, cat. no. E6053L) NEBNext quick ligation module (NEB, cat. no. E6056L) NEBNext high-fidelity 2× PCR master mix (NEB, cat. no. M0541L) SYBR Fast qPCR master mix (KAPA, cat. no. KK4835) SeqCap EZ Choice library (Roche NimbleGen) SeqCap hybridization and wash kit (Roche NimbleGen, cat. no. 05634253001) SeqCap EZ pure capture bead kit (Roche NimbleGen, cat. no. 06 977 952 001) HiFi HotStart mix, 2× (KAPA, cat. no. KK2602) DTT (Fisher Scientific, cat. no. BP172-5) ! .. CAUTION Direct contact can cause irritation.

    Gel Extraction:

    Article Title: A novel method for the multiplexed target enrichment of MinION next generation sequencing libraries using PCR-generated baits
    Article Snippet: We gel-extracted the PCR products with QIAquick Gel Extraction Kit (28704, Qiagen, Hilden, DE) and we assessed their concentration using the Quant-iT PicoGreen dsDNA kit (P11496, Invitrogen, Carlsbad, CA). .. We end-repaired the sheared DNA with NEBNext End Repair module, purified it with AMPure XP beads and dA-tailed it with NEBNext dA-tailing module (E6053S, New England BioLabs, Hitchin, UK).

    Article Title: Analysis of the mouse gut microbiome using full-length 16S rRNA amplicon sequencing
    Article Snippet: The PCR conditions were as follows: 98 °C for 30 s; 15 cycles of 98 °C for 10 s, 47 °C for 30 s, and 72 °C for 60 s; followed by 72 °C for 5 min. PCR products were purified using a MinElute Gel Extraction kit (Qiagen, Venlo, Netherlands). .. The amplicons were end repaired using the NEBNext End Repair module (NEB, Ipswich, MA, USA).

    IA:

    Article Title: The genome sequence of Bipolaris cookei reveals mechanisms of pathogenesis underlying target leaf spot of sorghum
    Article Snippet: First strand cDNA was synthesized from the fragmented mRNA with random hexamers (Integrated DNA Technologies, Inc., Coralville, IA, USA) and M-MLV Reverse Transcriptase (Promega, Madison, WI, USA), and second strand synthesis was performed with a NEBNext mRNA Second Strand Synthesis Module (New England Biolabs). .. End repair was performed on the second strand DNA with a NEBNext End Repair Module (New England Biolabs).

    Chromatin Immunoprecipitation:

    Article Title: Mechanisms Underlying Adaptation to Life in Hydrogen Sulfide–Rich Environments
    Article Snippet: After second-strand cDNA synthesis, the reaction was purified with Agencourt Ampure XP beads and eluted in 25 μl ddH2 O. Double-stranded cDNA was used as input for Illumina sequencing library preparation with end-repair using the NEBNext end-repair kit, A-tailing with Taq polymerase, ligation with Truseq barcoded adapters, and amplification with Kapa Library Amplification Readymix. .. After second-strand cDNA synthesis, the reaction was purified with Agencourt Ampure XP beads and eluted in 25 μl ddH2 O. Double-stranded cDNA was used as input for Illumina sequencing library preparation with end-repair using the NEBNext end-repair kit, A-tailing with Taq polymerase, ligation with Truseq barcoded adapters, and amplification with Kapa Library Amplification Readymix.

    Plasmid Preparation:

    Article Title: Differences in Vector Genome Processing and Illegitimate Integration of Non-Integrating Lentiviral Vectors
    Article Snippet: Paragraph title: Amplification of vector-genome junctions ... Starting with 1000 ng of sheared fragments, the ends were repaired using the NEBNext End Repair Module (NEB, Ipswich, MA) and 3’ dA-tailed with the NEBNext dA-Tailing Module (NEB, Ipswich, MA).

    Real-time Polymerase Chain Reaction:

    Article Title: Analysis of the mouse gut microbiome using full-length 16S rRNA amplicon sequencing
    Article Snippet: The amplification was monitored with SYBR Green gel staining solution (Invitrogen, Grand Island, NY, USA) on a CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) and stopped at the beginning of the saturation point to reduce PCR bias. .. The amplicons were end repaired using the NEBNext End Repair module (NEB, Ipswich, MA, USA).

    Article Title: Highly multiplexed targeted DNA sequencing from single nuclei
    Article Snippet: Φ29 Polymerase (10 units per 1 μl; NEB, cat. no. M0269L; Polymerase buffer is included) dNTP set, 100 mM (NEB, cat. no. N0446S) PBS 1× Qubit dsDNA high-sensitivity assay kit (Invitrogen, cat. no. ) ! .. NEBNext end repair module (NEB, cat. no. E6050L) NEBNext dA-tailing module (NEB, cat. no. E6053L) NEBNext quick ligation module (NEB, cat. no. E6056L) NEBNext high-fidelity 2× PCR master mix (NEB, cat. no. M0541L) SYBR Fast qPCR master mix (KAPA, cat. no. KK4835) SeqCap EZ Choice library (Roche NimbleGen) SeqCap hybridization and wash kit (Roche NimbleGen, cat. no. 05634253001) SeqCap EZ pure capture bead kit (Roche NimbleGen, cat. no. 06 977 952 001) HiFi HotStart mix, 2× (KAPA, cat. no. KK2602) DTT (Fisher Scientific, cat. no. BP172-5) ! .. CAUTION Direct contact can cause irritation.

    Multiplex Assay:

    Article Title: Flower preferences and pollen transport networks for cavity‐nesting solitary bees: Implications for the design of agri‐environment schemes, et al. Flower preferences and pollen transport networks for cavity‐nesting solitary bees: Implications for the design of agri‐environment schemes
    Article Snippet: Amplicon libraries were prepared using 200 ng of each PCR product and the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® with dual indexing (barcoding). .. The products were end repaired and “A” tailed using the NEBNext End Prep module, NEBNext adaptors were ligated onto the amplicons using the NEB Adaptor Ligation Module and dual indexes incorporated during the PCR enrichment step using NEBNext Ultra ll Q5 Master Mix and NEB Next Multiplex Oligos for Illumina. .. The final products were cleaned using Ampure XP beads and pooled into 2 batches of 80 samples.

    Selection:

    Article Title: The genome sequence of Bipolaris cookei reveals mechanisms of pathogenesis underlying target leaf spot of sorghum
    Article Snippet: End repair was performed on the second strand DNA with a NEBNext End Repair Module (New England Biolabs). .. Following end repair, sequencing adapters were ligated to the double stranded cDNA with a NEBNext Fast DNA Fragmentation & Library Prep Set for Ion Torrent (New England Biolabs).

    Agarose Gel Electrophoresis:

    Article Title: Using ultra-sensitive next generation sequencing to dissect DNA damage-induced mutagenesis
    Article Snippet: The amplified DNA ( ~ 800 ng) was sheared into 700 bp in ddH2 O (85 μl) using Covaris S220 (shearing condition: duty cycle: 5%, intensity: 3, cycles per burst: 200, time: 75 s), then end-repaired using NEBNext® End Repair Module (NEB, E6050S) and purified with 1X Ampure XP beads. .. Ligation was performed at 20 °C for 30 min using NEBNext® Quick Ligation Module (NEB, E6056S) and 1 μl barcode adaptor (Bioo Scientific, NEXTflex™ DNA Barcodes, 514102).

    Article Title: The genome sequence of Bipolaris cookei reveals mechanisms of pathogenesis underlying target leaf spot of sorghum
    Article Snippet: DNA quality and quantity was determined by agarose gel electrophoresis and a NanoDrop ND-1000 Spectrophotometer (Thermo Fisher Scientific). .. End repair was performed on the second strand DNA with a NEBNext End Repair Module (New England Biolabs).

    Ethanol Precipitation:

    Article Title: BisQC: an operational pipeline for multiplexed bisulfite sequencing
    Article Snippet: Using the MspI fragmented DNA (40–85 μL) described above, the NEBNext End Repair Reaction Buffer (10X; 10 μL), and the NEBNext End Repair Enzyme Mix (5 μL), we incubated the solution (final volume of 100 μl) at 20°C for 30 minutes. .. After incubation, the reaction mixture was diluted to 200 μL with dH2 O.

    Article Title: Key tumor suppressor genes inactivated by “greater promoter” methylation and somatic mutations in head and neck cancer
    Article Snippet: Tissue samples were digested with 1% SDS and 50 μg/mL proteinase K (Boehringer Mannheim) at 48 °C overnight, followed by phenol/chloroform extraction and ethanol precipitation of DNA. .. Two micrograms of DNA were sonicated to a modal size of ~150–250 bp, and end-repaired using the NEBNext SOLiD DNA library preparation kit end-repair module following the manufacturer's protocol (New England Biolabs).

    Next-Generation Sequencing:

    Article Title: Using ultra-sensitive next generation sequencing to dissect DNA damage-induced mutagenesis
    Article Snippet: Paragraph title: Standard NGS library preparation ... The amplified DNA ( ~ 800 ng) was sheared into 700 bp in ddH2 O (85 μl) using Covaris S220 (shearing condition: duty cycle: 5%, intensity: 3, cycles per burst: 200, time: 75 s), then end-repaired using NEBNext® End Repair Module (NEB, E6050S) and purified with 1X Ampure XP beads.

    Article Title: Flower preferences and pollen transport networks for cavity‐nesting solitary bees: Implications for the design of agri‐environment schemes, et al. Flower preferences and pollen transport networks for cavity‐nesting solitary bees: Implications for the design of agri‐environment schemes
    Article Snippet: Paragraph title: Next generation sequencing of pollen sample DNA ... The products were end repaired and “A” tailed using the NEBNext End Prep module, NEBNext adaptors were ligated onto the amplicons using the NEB Adaptor Ligation Module and dual indexes incorporated during the PCR enrichment step using NEBNext Ultra ll Q5 Master Mix and NEB Next Multiplex Oligos for Illumina.

    Laser Capture Microdissection:

    Article Title: Differences in Vector Genome Processing and Illegitimate Integration of Non-Integrating Lentiviral Vectors
    Article Snippet: The vector-genome junctions were then amplified by linear amplification mediated PCR (LAM-PCR) off of the 3’ LTR as previously described in two separate experiments (CS-CZW n =12; IN/D116N n=7, 12; LTR/U3att n=8, 11; LTR/U3att-IN/D116N n=4, 9) and/or by a modified technique adapted from Ravin, et al and Zhou, et al (IN/D116N n=12; LTR/U3att n=18; LTR/U3att-IN/D116N n=22). .. Starting with 1000 ng of sheared fragments, the ends were repaired using the NEBNext End Repair Module (NEB, Ipswich, MA) and 3’ dA-tailed with the NEBNext dA-Tailing Module (NEB, Ipswich, MA).

    Spectrophotometry:

    Article Title: The genome sequence of Bipolaris cookei reveals mechanisms of pathogenesis underlying target leaf spot of sorghum
    Article Snippet: DNA quality and quantity was determined by agarose gel electrophoresis and a NanoDrop ND-1000 Spectrophotometer (Thermo Fisher Scientific). .. End repair was performed on the second strand DNA with a NEBNext End Repair Module (New England Biolabs).

    DNA Methylation Assay:

    Article Title: Next-generation sequencing methylation profiling of subjects with obesity identifies novel gene changes
    Article Snippet: End-repair A tailing was performed (New England Biolabs, Ipswich, MA) and TruSeq methylated indexed adaptors (Illumina, San Diego, CA) were ligated with T4 DNA ligase (New England Biolabs, Ipswich, MA). .. Size selection was performed with Agencourt AMPure XP beads (Beckman Coulter, Indianapolis, IN).

    Produced:

    Article Title: A novel method for the multiplexed target enrichment of MinION next generation sequencing libraries using PCR-generated baits
    Article Snippet: We ligated them with the mixed PCR products using NEBNext Blunt/TA Ligase (M0367S, New England BioLabs, Hitchin, UK) and we purified the produced baits with AMPure XP beads. .. We end-repaired the sheared DNA with NEBNext End Repair module, purified it with AMPure XP beads and dA-tailed it with NEBNext dA-tailing module (E6053S, New England BioLabs, Hitchin, UK).

    Immunoprecipitation:

    Article Title: Alteration of genic 5-hydroxymethylcytosine patterning in olfactory neurons correlates with changes in gene expression and cell identity
    Article Snippet: Genomic DNA was isolated, prepared for single- or paired-end Illumina sequencing using standard protocols, and immunoprecipitated as in Weber et al. ( ) with minor modifications. .. Specifically, sorted cell gDNA was sonicated to 200–1,000 bp with a mean size of ∼400 bp and end repaired (New England Biolabs Next End Repair).

    Article Title: Candidate genes responsible for early key events of phenobarbital-promoted mouse hepatocellular tumorigenesis based on differentiation of regulating genes between wild type mice and humanized chimeric mice †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7tx00163k
    Article Snippet: Paragraph title: MeDIP and HmeDIP (5mC and 5hmC immunoprecipitation) ... Sonicated DNA was then end-repaired by incubation for 30 min at 20 °C using the NEBNext End Repair Module (NEB).

    DNA Purification:

    Article Title: Differences in Vector Genome Processing and Illegitimate Integration of Non-Integrating Lentiviral Vectors
    Article Snippet: Transduced cells were selected for three weeks prior to isolation, after which genomic DNA was extracted using the Puregene DNA Purification Kit (Gentra Systems, Inc., Minneapolis, MN). .. Starting with 1000 ng of sheared fragments, the ends were repaired using the NEBNext End Repair Module (NEB, Ipswich, MA) and 3’ dA-tailed with the NEBNext dA-Tailing Module (NEB, Ipswich, MA).

    Staining:

    Article Title: Analysis of the mouse gut microbiome using full-length 16S rRNA amplicon sequencing
    Article Snippet: The amplification was monitored with SYBR Green gel staining solution (Invitrogen, Grand Island, NY, USA) on a CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) and stopped at the beginning of the saturation point to reduce PCR bias. .. The amplicons were end repaired using the NEBNext End Repair module (NEB, Ipswich, MA, USA).

    Nanopore Sequencing:

    Article Title: Determining exon connectivity in complex mRNAs by nanopore sequencing
    Article Snippet: Paragraph title: Amplicon library preparation and Oxford Nanopore sequencing ... Briefly, a total of 850 ng (spike-in) and 1 μg (mixed heads) in 80 μL was end repaired using NEBNext End Repair Module (New England Biolabs, Cat No: E6050) and followed by dA tailing using NEBNext dA Tailing Module (New England Biolabs, Cat No: E6053).

    Article Title: Analysis of the mouse gut microbiome using full-length 16S rRNA amplicon sequencing
    Article Snippet: Paragraph title: Nanopore sequencing library construction ... The amplicons were end repaired using the NEBNext End Repair module (NEB, Ipswich, MA, USA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs nebnext end repair module
    Genes and repetitive DNA in centromeres. (A) Overlap between CENH3 enrichment and genetic elements. Within the centromere, we assigned each 20-kb locus into one of two categories, “low CENH3 loci” and “high CENH3 loci,” based on whether it exhibited less than or greater than the median CENH3 enrichment. Results are shown for three methods of measuring CENH3 enrichment. The first two are relative to a total nucleosome control produced by MNase digestion of total chromatin and relative to a randomly sheared naked DNA control produced by <t>NEBNext</t> dsDNA Fragmentase ( Gent et al. 2014 ). In both cases, only uniquely mapping reads were considered. In the third method, no control was used, and enrichment was defined by raw read counts, including nonuniquely mapping reads. Errors bars are standard errors of the means for each set of loci. (B) Comparison of genetic elements in centromeric 20-kb loci and whole-genome 20-kb loci, but without regard to relative CENH3 enrichment within centromeres
    Nebnext End Repair Module, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 32 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nebnext end repair module/product/New England Biolabs
    Average 99 stars, based on 32 article reviews
    Price from $9.99 to $1999.99
    nebnext end repair module - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs 3 end
    LITE-Seq analysis. a Germline tissue used in this study. Whole gonads were isolated from adult hermaphrodite (XX) and male (XO) worms. Female germline samples were generated by manual removal of the spermatheca. Developmentally staged samples were obtained by microdissection of the distal mitotic proliferation zone, the meiotic pachytene region, and cellularized oocytes. b LITE-Seq protocol. Extracts of total RNA spiked with ERCC RNA standards were reverse transcribed using an anchored hairpin polydT primer. cDNAs were PCR amplified using a biotinylated half-hairpin primer, fragmented, and subjected to <t>3′-end</t> capture with streptavidin beads. Samples were barcoded, pooled, and subjected to paired-end sequencing using the standard Illumina Read 1 primer and a custom Read 2 primer that initiates sequencing immediately upstream of the polyA tail. c Mapping and quantification of transcript 3′ ends. Paired-end reads were mapped to the C. elegans reference genome (WS250) and assigned to genes with overlapping exons or to the closest gene within 1500 nt upstream. Representative 3′ CPA sites (arrowheads) and isoform abundance were determined by clustering 3′ end reads within ±12 nucleotides of the position with the most supported reads
    3 End, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/3 end/product/New England Biolabs
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    3 end - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    Image Search Results


    Genes and repetitive DNA in centromeres. (A) Overlap between CENH3 enrichment and genetic elements. Within the centromere, we assigned each 20-kb locus into one of two categories, “low CENH3 loci” and “high CENH3 loci,” based on whether it exhibited less than or greater than the median CENH3 enrichment. Results are shown for three methods of measuring CENH3 enrichment. The first two are relative to a total nucleosome control produced by MNase digestion of total chromatin and relative to a randomly sheared naked DNA control produced by NEBNext dsDNA Fragmentase ( Gent et al. 2014 ). In both cases, only uniquely mapping reads were considered. In the third method, no control was used, and enrichment was defined by raw read counts, including nonuniquely mapping reads. Errors bars are standard errors of the means for each set of loci. (B) Comparison of genetic elements in centromeric 20-kb loci and whole-genome 20-kb loci, but without regard to relative CENH3 enrichment within centromeres

    Journal: Genetics

    Article Title: Stable Patterns of CENH3 Occupancy Through Maize Lineages Containing Genetically Similar Centromeres

    doi: 10.1534/genetics.115.177360

    Figure Lengend Snippet: Genes and repetitive DNA in centromeres. (A) Overlap between CENH3 enrichment and genetic elements. Within the centromere, we assigned each 20-kb locus into one of two categories, “low CENH3 loci” and “high CENH3 loci,” based on whether it exhibited less than or greater than the median CENH3 enrichment. Results are shown for three methods of measuring CENH3 enrichment. The first two are relative to a total nucleosome control produced by MNase digestion of total chromatin and relative to a randomly sheared naked DNA control produced by NEBNext dsDNA Fragmentase ( Gent et al. 2014 ). In both cases, only uniquely mapping reads were considered. In the third method, no control was used, and enrichment was defined by raw read counts, including nonuniquely mapping reads. Errors bars are standard errors of the means for each set of loci. (B) Comparison of genetic elements in centromeric 20-kb loci and whole-genome 20-kb loci, but without regard to relative CENH3 enrichment within centromeres

    Article Snippet: We end-repaired and 5′-phosphorylated using the End Repair Module (New England Biolabs #E6050L), A-tailed with Klenow exo- (New England Biolabs #M0212S), and ligated to adapters (8.3 nM) with a Quick Ligase Kit (New England Biolabs #M2200S).

    Techniques: Produced

    LITE-Seq analysis. a Germline tissue used in this study. Whole gonads were isolated from adult hermaphrodite (XX) and male (XO) worms. Female germline samples were generated by manual removal of the spermatheca. Developmentally staged samples were obtained by microdissection of the distal mitotic proliferation zone, the meiotic pachytene region, and cellularized oocytes. b LITE-Seq protocol. Extracts of total RNA spiked with ERCC RNA standards were reverse transcribed using an anchored hairpin polydT primer. cDNAs were PCR amplified using a biotinylated half-hairpin primer, fragmented, and subjected to 3′-end capture with streptavidin beads. Samples were barcoded, pooled, and subjected to paired-end sequencing using the standard Illumina Read 1 primer and a custom Read 2 primer that initiates sequencing immediately upstream of the polyA tail. c Mapping and quantification of transcript 3′ ends. Paired-end reads were mapped to the C. elegans reference genome (WS250) and assigned to genes with overlapping exons or to the closest gene within 1500 nt upstream. Representative 3′ CPA sites (arrowheads) and isoform abundance were determined by clustering 3′ end reads within ±12 nucleotides of the position with the most supported reads

    Journal: Genome Biology

    Article Title: Developmental dynamics of gene expression and alternative polyadenylation in the Caenorhabditis elegans germline

    doi: 10.1186/s13059-017-1369-x

    Figure Lengend Snippet: LITE-Seq analysis. a Germline tissue used in this study. Whole gonads were isolated from adult hermaphrodite (XX) and male (XO) worms. Female germline samples were generated by manual removal of the spermatheca. Developmentally staged samples were obtained by microdissection of the distal mitotic proliferation zone, the meiotic pachytene region, and cellularized oocytes. b LITE-Seq protocol. Extracts of total RNA spiked with ERCC RNA standards were reverse transcribed using an anchored hairpin polydT primer. cDNAs were PCR amplified using a biotinylated half-hairpin primer, fragmented, and subjected to 3′-end capture with streptavidin beads. Samples were barcoded, pooled, and subjected to paired-end sequencing using the standard Illumina Read 1 primer and a custom Read 2 primer that initiates sequencing immediately upstream of the polyA tail. c Mapping and quantification of transcript 3′ ends. Paired-end reads were mapped to the C. elegans reference genome (WS250) and assigned to genes with overlapping exons or to the closest gene within 1500 nt upstream. Representative 3′ CPA sites (arrowheads) and isoform abundance were determined by clustering 3′ end reads within ±12 nucleotides of the position with the most supported reads

    Article Snippet: While still attached to beads, the captured cDNA was end-repaired and an adenosine was added to the 3′ end (NEBNext Ultra End Repair/dA-Tailing module).

    Techniques: Isolation, Generated, Laser Capture Microdissection, Polymerase Chain Reaction, Amplification, Sequencing