neb 5 alpha  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    NEB 5 alpha Electrocompetent E coli
    Description:
    NEB 5 alpha Electrocompetent E coli 6x0 1 ml
    Catalog Number:
    c2989k
    Price:
    185
    Size:
    0 6 ml
    Category:
    Competent Bacteria
    Buy from Supplier


    Structured Review

    New England Biolabs neb 5 alpha
    NEB 5 alpha Electrocompetent E coli
    NEB 5 alpha Electrocompetent E coli 6x0 1 ml
    https://www.bioz.com/result/neb 5 alpha/product/New England Biolabs
    Average 95 stars, based on 15 article reviews
    Price from $9.99 to $1999.99
    neb 5 alpha - by Bioz Stars, 2020-02
    95/100 stars

    Images

    1) Product Images from "ZeBRα a universal, multi-fragment DNA-assembly-system with minimal hands-on time requirement"

    Article Title: ZeBRα a universal, multi-fragment DNA-assembly-system with minimal hands-on time requirement

    Journal: Scientific Reports

    doi: 10.1038/s41598-019-39768-0

    Three or four fragments can efficiently be assembled with PPY-cell extracts, while iVEC/“transformation-cloning” with three fragments is markedly less efficient. ( a ) The assembly of four fragments in a single reaction reduces the number of successful assemblies by a factor of two to ten as compared to the three-fragment-assembly. Cell-extracts were prepared from autoinduced PPY cells and the assemblies were purified prior transformation. ( b ) Assembly of three fragments by iVEC/“transformation-cloning” with NEB 5-alpha resulted in roughly 250 recombinant colonies/µg transformed DNA. A significant number of colonies harboring plasmids with defective inserts (grey bar) and PCR-template carry-over (dotted bar) were present on the plates.
    Figure Legend Snippet: Three or four fragments can efficiently be assembled with PPY-cell extracts, while iVEC/“transformation-cloning” with three fragments is markedly less efficient. ( a ) The assembly of four fragments in a single reaction reduces the number of successful assemblies by a factor of two to ten as compared to the three-fragment-assembly. Cell-extracts were prepared from autoinduced PPY cells and the assemblies were purified prior transformation. ( b ) Assembly of three fragments by iVEC/“transformation-cloning” with NEB 5-alpha resulted in roughly 250 recombinant colonies/µg transformed DNA. A significant number of colonies harboring plasmids with defective inserts (grey bar) and PCR-template carry-over (dotted bar) were present on the plates.

    Techniques Used: Clone Assay, Purification, Transformation Assay, Recombinant, Polymerase Chain Reaction

    Strategy for SLiCE optimization and evaluation. ( a ) Flow chart of the optimization process for generating a recombinogenic E. coli lysate. The PPY strain is a DH10B-derivative used to prepare the recombinogenic cell lysate and expresses the coding sequences for Redαβγ. The extracts, derived from arabinose autoinduced PPY-cells, were compared to extracts made from non-induced PPY-cells. ( b ) Structure of the examined non-ionic detergents used to prepare the recombinogenic PPY-extracts, CHAPS, Sulfo-Betain (SB-12), n-Octyl-β-D-thioglucopyranosid (OTG), n-Octyl-β-D-glucopyranosid (OG) Dodecyl-β-D-maltosid (DDM). ( c ) PPY-extracts were tested for their recombination capacity by assembling three DNA fragments with overlapping ends, to generate a recombinant plasmid constitutively expressing a blue chromoprotein. To examine the effects detergents had on the transformation, samples were split after the assembly reaction. One part was transformed into NEB 5-alpha unpurified; the other fraction was purified by silica-column chromatography prior to transformation.
    Figure Legend Snippet: Strategy for SLiCE optimization and evaluation. ( a ) Flow chart of the optimization process for generating a recombinogenic E. coli lysate. The PPY strain is a DH10B-derivative used to prepare the recombinogenic cell lysate and expresses the coding sequences for Redαβγ. The extracts, derived from arabinose autoinduced PPY-cells, were compared to extracts made from non-induced PPY-cells. ( b ) Structure of the examined non-ionic detergents used to prepare the recombinogenic PPY-extracts, CHAPS, Sulfo-Betain (SB-12), n-Octyl-β-D-thioglucopyranosid (OTG), n-Octyl-β-D-glucopyranosid (OG) Dodecyl-β-D-maltosid (DDM). ( c ) PPY-extracts were tested for their recombination capacity by assembling three DNA fragments with overlapping ends, to generate a recombinant plasmid constitutively expressing a blue chromoprotein. To examine the effects detergents had on the transformation, samples were split after the assembly reaction. One part was transformed into NEB 5-alpha unpurified; the other fraction was purified by silica-column chromatography prior to transformation.

    Techniques Used: Flow Cytometry, Derivative Assay, Recombinant, Plasmid Preparation, Expressing, Transformation Assay, Purification, Column Chromatography

    Comparison of the influence of detergent, autoinduction, post-assembly purification and competency of used bacteria on DNA assembling efficiency. ( a ) In four of the five PPY lysis conditions induction of Redα had moderate effects. Five different detergents were tested on PPY-cells grown with either lactose (Redα un-induced) or arabinose (Redα induced). All assemblies were column-purified before transformation into NEB 5-alpha. Bars indicate standard error of three independent replicates of an assembly reaction in all following graphs. PPY recombinogenic capacity was assessed in three-fragment assemblies. ( b ) Column-purification of the three-fragment-assembly reactions led to markedly increased number of recombinant colonies for all tested detergents. In the case of CHAPS and SB-12, unpurified samples resulted in no colonies. The OTG derived PPY-extract resulted in the highest number of recombinant colonies without purification. All assemblies were arabinose-induced. ( c ) Chemical competency has profound influence on recombination efficiency. OTG prepared PPY-lysate was used in a three-fragment-assembly and transformed into commercial NEB 5-alpha competent E. coli (1 × 10 9 cfu/µg pUC DNA) or the same strain prepared by the Inoue-method 21 (2.3 × 10 6 cfu/µg DNA). ( d ) For convenient readout of the potency of the PPY-extracts PCR-fragments used for the three- and four-way assembly reactions consisted of a blue chromoprotein coding ORF, a kanamycin resistance gene an origin-of-replication (on one fragment for the three-fragment assembly) and a bacterial basal-promoter-fragment. Only successful recombinants could produce blue colonies on kanamycin plates. The PCR-fragments to be assembled had overlapping bases that summed up to about 15 bp overlapping ends.
    Figure Legend Snippet: Comparison of the influence of detergent, autoinduction, post-assembly purification and competency of used bacteria on DNA assembling efficiency. ( a ) In four of the five PPY lysis conditions induction of Redα had moderate effects. Five different detergents were tested on PPY-cells grown with either lactose (Redα un-induced) or arabinose (Redα induced). All assemblies were column-purified before transformation into NEB 5-alpha. Bars indicate standard error of three independent replicates of an assembly reaction in all following graphs. PPY recombinogenic capacity was assessed in three-fragment assemblies. ( b ) Column-purification of the three-fragment-assembly reactions led to markedly increased number of recombinant colonies for all tested detergents. In the case of CHAPS and SB-12, unpurified samples resulted in no colonies. The OTG derived PPY-extract resulted in the highest number of recombinant colonies without purification. All assemblies were arabinose-induced. ( c ) Chemical competency has profound influence on recombination efficiency. OTG prepared PPY-lysate was used in a three-fragment-assembly and transformed into commercial NEB 5-alpha competent E. coli (1 × 10 9 cfu/µg pUC DNA) or the same strain prepared by the Inoue-method 21 (2.3 × 10 6 cfu/µg DNA). ( d ) For convenient readout of the potency of the PPY-extracts PCR-fragments used for the three- and four-way assembly reactions consisted of a blue chromoprotein coding ORF, a kanamycin resistance gene an origin-of-replication (on one fragment for the three-fragment assembly) and a bacterial basal-promoter-fragment. Only successful recombinants could produce blue colonies on kanamycin plates. The PCR-fragments to be assembled had overlapping bases that summed up to about 15 bp overlapping ends.

    Techniques Used: Purification, Lysis, Transformation Assay, Recombinant, Derivative Assay, Polymerase Chain Reaction

    The recombinogenic capacity of OTG extracts from autoinduced PPY and NEB 5-alpha extracts are equivalent or better than PPY-extracts generated by the original protocol. ( a ) Plasmid map of pT7- Hin dIII- ccdB used to assess three-fragment ZeBRα assemblies. Two Hin dIII and two Bsa I sites flank the toxic-placeholder- ccdB , allowing linearization and removal of ccdB . Unique sites are available on either side of ccdB . Chloramphenicol-acetyl-transferase coding gene ( CmR ), is part of the placeholder cassette and prevents ccdB -loss during plasmid propagation. The hatched region encompasses the fragment removed during cloning. ( b ) Map of the vector pT7-GFP antisense resulting from the three-fragment test-assembly of the pT7- Hin dIII- ccdB as recipient for a GFP-ORF and a bacterial promoter containing PCR-fragment, to evaluate the efficacy of the ZeBRα-procedure. Criss-cross lines mark the fusion-sites of the assembled fragments. ( c ) Comparison of the recombination capacity of extracts prepared with OTG or CelLyticB TM from manually induced and autoinduced (denoted as “auto” in the column) PPY-cells and NEB 5-alpha. The iVEC/“transformation-cloning” of the respective fragments is shown as last column. ( d ) Green fluorescent NEB 5-alpha colonies harboring the constitutively GFP-expressing vector pT7-GFP antisense.
    Figure Legend Snippet: The recombinogenic capacity of OTG extracts from autoinduced PPY and NEB 5-alpha extracts are equivalent or better than PPY-extracts generated by the original protocol. ( a ) Plasmid map of pT7- Hin dIII- ccdB used to assess three-fragment ZeBRα assemblies. Two Hin dIII and two Bsa I sites flank the toxic-placeholder- ccdB , allowing linearization and removal of ccdB . Unique sites are available on either side of ccdB . Chloramphenicol-acetyl-transferase coding gene ( CmR ), is part of the placeholder cassette and prevents ccdB -loss during plasmid propagation. The hatched region encompasses the fragment removed during cloning. ( b ) Map of the vector pT7-GFP antisense resulting from the three-fragment test-assembly of the pT7- Hin dIII- ccdB as recipient for a GFP-ORF and a bacterial promoter containing PCR-fragment, to evaluate the efficacy of the ZeBRα-procedure. Criss-cross lines mark the fusion-sites of the assembled fragments. ( c ) Comparison of the recombination capacity of extracts prepared with OTG or CelLyticB TM from manually induced and autoinduced (denoted as “auto” in the column) PPY-cells and NEB 5-alpha. The iVEC/“transformation-cloning” of the respective fragments is shown as last column. ( d ) Green fluorescent NEB 5-alpha colonies harboring the constitutively GFP-expressing vector pT7-GFP antisense.

    Techniques Used: Generated, Plasmid Preparation, Chloramphenicol Acetyltransferase Assay, Clone Assay, Polymerase Chain Reaction, Expressing

    Rendering the CcdB in the placeholder non-toxic increases the number of GFP – background colonies markedly, showing that ccdB is an essential element if working with non-gel purified vector. ( a ) The pT7- Hin dIII-dead- ccdB differs by a four base-pair deletion in the ccdB -coding sequence from it’s predecessor pT7- Hin dIII- ccdB . The dotted lines encompass the region removed during cloning. ( b ) Sequence alignment of the region encompassing the small deletion in the ccdB -ORF, in pT7- Hin dIII-dead- ccdB compared to the region in pT7- Hin dIII- ccdB and the resulting frameshift rendering the ΔCcdB non-toxic for E. coli NEB 5-alpha. The numbers denote bases in the vector. ( c ) The three-fragment assembly as shown in Fig. 6c uses the pT7-HindIII-dead- ccdB vector and OTG-derived PPY-extract to assemble pT7-GFP antisense analogous to the assemblies shown in Fig. 5 . The percentage of GFP + colonies drops from nearly 100% for pT7- Hin dIII- ccdB to 57% for pT7- Hin dIII-dead- ccdB . ( d ) Image of the mixture of GFP + and GFP − resulting from the assembly (100 µl outgrowth medium spread). The red arrow points at a cluster of GFP − colonies representing un-digested vector that would have to be screened for in a non-model assembly.
    Figure Legend Snippet: Rendering the CcdB in the placeholder non-toxic increases the number of GFP – background colonies markedly, showing that ccdB is an essential element if working with non-gel purified vector. ( a ) The pT7- Hin dIII-dead- ccdB differs by a four base-pair deletion in the ccdB -coding sequence from it’s predecessor pT7- Hin dIII- ccdB . The dotted lines encompass the region removed during cloning. ( b ) Sequence alignment of the region encompassing the small deletion in the ccdB -ORF, in pT7- Hin dIII-dead- ccdB compared to the region in pT7- Hin dIII- ccdB and the resulting frameshift rendering the ΔCcdB non-toxic for E. coli NEB 5-alpha. The numbers denote bases in the vector. ( c ) The three-fragment assembly as shown in Fig. 6c uses the pT7-HindIII-dead- ccdB vector and OTG-derived PPY-extract to assemble pT7-GFP antisense analogous to the assemblies shown in Fig. 5 . The percentage of GFP + colonies drops from nearly 100% for pT7- Hin dIII- ccdB to 57% for pT7- Hin dIII-dead- ccdB . ( d ) Image of the mixture of GFP + and GFP − resulting from the assembly (100 µl outgrowth medium spread). The red arrow points at a cluster of GFP − colonies representing un-digested vector that would have to be screened for in a non-model assembly.

    Techniques Used: Purification, Plasmid Preparation, Sequencing, Clone Assay, Derivative Assay

    2) Product Images from "ZeBRα a universal, multi-fragment DNA-assembly-system with minimal hands-on time requirement"

    Article Title: ZeBRα a universal, multi-fragment DNA-assembly-system with minimal hands-on time requirement

    Journal: Scientific Reports

    doi: 10.1038/s41598-019-39768-0

    Three or four fragments can efficiently be assembled with PPY-cell extracts, while iVEC/“transformation-cloning” with three fragments is markedly less efficient. ( a ) The assembly of four fragments in a single reaction reduces the number of successful assemblies by a factor of two to ten as compared to the three-fragment-assembly. Cell-extracts were prepared from autoinduced PPY cells and the assemblies were purified prior transformation. ( b ) Assembly of three fragments by iVEC/“transformation-cloning” with NEB 5-alpha resulted in roughly 250 recombinant colonies/µg transformed DNA. A significant number of colonies harboring plasmids with defective inserts (grey bar) and PCR-template carry-over (dotted bar) were present on the plates.
    Figure Legend Snippet: Three or four fragments can efficiently be assembled with PPY-cell extracts, while iVEC/“transformation-cloning” with three fragments is markedly less efficient. ( a ) The assembly of four fragments in a single reaction reduces the number of successful assemblies by a factor of two to ten as compared to the three-fragment-assembly. Cell-extracts were prepared from autoinduced PPY cells and the assemblies were purified prior transformation. ( b ) Assembly of three fragments by iVEC/“transformation-cloning” with NEB 5-alpha resulted in roughly 250 recombinant colonies/µg transformed DNA. A significant number of colonies harboring plasmids with defective inserts (grey bar) and PCR-template carry-over (dotted bar) were present on the plates.

    Techniques Used: Clone Assay, Purification, Transformation Assay, Recombinant, Polymerase Chain Reaction

    Strategy for SLiCE optimization and evaluation. ( a ) Flow chart of the optimization process for generating a recombinogenic E. coli lysate. The PPY strain is a DH10B-derivative used to prepare the recombinogenic cell lysate and expresses the coding sequences for Redαβγ. The extracts, derived from arabinose autoinduced PPY-cells, were compared to extracts made from non-induced PPY-cells. ( b ) Structure of the examined non-ionic detergents used to prepare the recombinogenic PPY-extracts, CHAPS, Sulfo-Betain (SB-12), n-Octyl-β-D-thioglucopyranosid (OTG), n-Octyl-β-D-glucopyranosid (OG) Dodecyl-β-D-maltosid (DDM). ( c ) PPY-extracts were tested for their recombination capacity by assembling three DNA fragments with overlapping ends, to generate a recombinant plasmid constitutively expressing a blue chromoprotein. To examine the effects detergents had on the transformation, samples were split after the assembly reaction. One part was transformed into NEB 5-alpha unpurified; the other fraction was purified by silica-column chromatography prior to transformation.
    Figure Legend Snippet: Strategy for SLiCE optimization and evaluation. ( a ) Flow chart of the optimization process for generating a recombinogenic E. coli lysate. The PPY strain is a DH10B-derivative used to prepare the recombinogenic cell lysate and expresses the coding sequences for Redαβγ. The extracts, derived from arabinose autoinduced PPY-cells, were compared to extracts made from non-induced PPY-cells. ( b ) Structure of the examined non-ionic detergents used to prepare the recombinogenic PPY-extracts, CHAPS, Sulfo-Betain (SB-12), n-Octyl-β-D-thioglucopyranosid (OTG), n-Octyl-β-D-glucopyranosid (OG) Dodecyl-β-D-maltosid (DDM). ( c ) PPY-extracts were tested for their recombination capacity by assembling three DNA fragments with overlapping ends, to generate a recombinant plasmid constitutively expressing a blue chromoprotein. To examine the effects detergents had on the transformation, samples were split after the assembly reaction. One part was transformed into NEB 5-alpha unpurified; the other fraction was purified by silica-column chromatography prior to transformation.

    Techniques Used: Flow Cytometry, Derivative Assay, Recombinant, Plasmid Preparation, Expressing, Transformation Assay, Purification, Column Chromatography

    Comparison of the influence of detergent, autoinduction, post-assembly purification and competency of used bacteria on DNA assembling efficiency. ( a ) In four of the five PPY lysis conditions induction of Redα had moderate effects. Five different detergents were tested on PPY-cells grown with either lactose (Redα un-induced) or arabinose (Redα induced). All assemblies were column-purified before transformation into NEB 5-alpha. Bars indicate standard error of three independent replicates of an assembly reaction in all following graphs. PPY recombinogenic capacity was assessed in three-fragment assemblies. ( b ) Column-purification of the three-fragment-assembly reactions led to markedly increased number of recombinant colonies for all tested detergents. In the case of CHAPS and SB-12, unpurified samples resulted in no colonies. The OTG derived PPY-extract resulted in the highest number of recombinant colonies without purification. All assemblies were arabinose-induced. ( c ) Chemical competency has profound influence on recombination efficiency. OTG prepared PPY-lysate was used in a three-fragment-assembly and transformed into commercial NEB 5-alpha competent E. coli (1 × 10 9 cfu/µg pUC DNA) or the same strain prepared by the Inoue-method 21 (2.3 × 10 6 cfu/µg DNA). ( d ) For convenient readout of the potency of the PPY-extracts PCR-fragments used for the three- and four-way assembly reactions consisted of a blue chromoprotein coding ORF, a kanamycin resistance gene an origin-of-replication (on one fragment for the three-fragment assembly) and a bacterial basal-promoter-fragment. Only successful recombinants could produce blue colonies on kanamycin plates. The PCR-fragments to be assembled had overlapping bases that summed up to about 15 bp overlapping ends.
    Figure Legend Snippet: Comparison of the influence of detergent, autoinduction, post-assembly purification and competency of used bacteria on DNA assembling efficiency. ( a ) In four of the five PPY lysis conditions induction of Redα had moderate effects. Five different detergents were tested on PPY-cells grown with either lactose (Redα un-induced) or arabinose (Redα induced). All assemblies were column-purified before transformation into NEB 5-alpha. Bars indicate standard error of three independent replicates of an assembly reaction in all following graphs. PPY recombinogenic capacity was assessed in three-fragment assemblies. ( b ) Column-purification of the three-fragment-assembly reactions led to markedly increased number of recombinant colonies for all tested detergents. In the case of CHAPS and SB-12, unpurified samples resulted in no colonies. The OTG derived PPY-extract resulted in the highest number of recombinant colonies without purification. All assemblies were arabinose-induced. ( c ) Chemical competency has profound influence on recombination efficiency. OTG prepared PPY-lysate was used in a three-fragment-assembly and transformed into commercial NEB 5-alpha competent E. coli (1 × 10 9 cfu/µg pUC DNA) or the same strain prepared by the Inoue-method 21 (2.3 × 10 6 cfu/µg DNA). ( d ) For convenient readout of the potency of the PPY-extracts PCR-fragments used for the three- and four-way assembly reactions consisted of a blue chromoprotein coding ORF, a kanamycin resistance gene an origin-of-replication (on one fragment for the three-fragment assembly) and a bacterial basal-promoter-fragment. Only successful recombinants could produce blue colonies on kanamycin plates. The PCR-fragments to be assembled had overlapping bases that summed up to about 15 bp overlapping ends.

    Techniques Used: Purification, Lysis, Transformation Assay, Recombinant, Derivative Assay, Polymerase Chain Reaction

    The recombinogenic capacity of OTG extracts from autoinduced PPY and NEB 5-alpha extracts are equivalent or better than PPY-extracts generated by the original protocol. ( a ) Plasmid map of pT7- Hin dIII- ccdB used to assess three-fragment ZeBRα assemblies. Two Hin dIII and two Bsa I sites flank the toxic-placeholder- ccdB , allowing linearization and removal of ccdB . Unique sites are available on either side of ccdB . Chloramphenicol-acetyl-transferase coding gene ( CmR ), is part of the placeholder cassette and prevents ccdB -loss during plasmid propagation. The hatched region encompasses the fragment removed during cloning. ( b ) Map of the vector pT7-GFP antisense resulting from the three-fragment test-assembly of the pT7- Hin dIII- ccdB as recipient for a GFP-ORF and a bacterial promoter containing PCR-fragment, to evaluate the efficacy of the ZeBRα-procedure. Criss-cross lines mark the fusion-sites of the assembled fragments. ( c ) Comparison of the recombination capacity of extracts prepared with OTG or CelLyticB TM from manually induced and autoinduced (denoted as “auto” in the column) PPY-cells and NEB 5-alpha. The iVEC/“transformation-cloning” of the respective fragments is shown as last column. ( d ) Green fluorescent NEB 5-alpha colonies harboring the constitutively GFP-expressing vector pT7-GFP antisense.
    Figure Legend Snippet: The recombinogenic capacity of OTG extracts from autoinduced PPY and NEB 5-alpha extracts are equivalent or better than PPY-extracts generated by the original protocol. ( a ) Plasmid map of pT7- Hin dIII- ccdB used to assess three-fragment ZeBRα assemblies. Two Hin dIII and two Bsa I sites flank the toxic-placeholder- ccdB , allowing linearization and removal of ccdB . Unique sites are available on either side of ccdB . Chloramphenicol-acetyl-transferase coding gene ( CmR ), is part of the placeholder cassette and prevents ccdB -loss during plasmid propagation. The hatched region encompasses the fragment removed during cloning. ( b ) Map of the vector pT7-GFP antisense resulting from the three-fragment test-assembly of the pT7- Hin dIII- ccdB as recipient for a GFP-ORF and a bacterial promoter containing PCR-fragment, to evaluate the efficacy of the ZeBRα-procedure. Criss-cross lines mark the fusion-sites of the assembled fragments. ( c ) Comparison of the recombination capacity of extracts prepared with OTG or CelLyticB TM from manually induced and autoinduced (denoted as “auto” in the column) PPY-cells and NEB 5-alpha. The iVEC/“transformation-cloning” of the respective fragments is shown as last column. ( d ) Green fluorescent NEB 5-alpha colonies harboring the constitutively GFP-expressing vector pT7-GFP antisense.

    Techniques Used: Generated, Plasmid Preparation, Chloramphenicol Acetyltransferase Assay, Clone Assay, Polymerase Chain Reaction, Expressing

    Rendering the CcdB in the placeholder non-toxic increases the number of GFP – background colonies markedly, showing that ccdB is an essential element if working with non-gel purified vector. ( a ) The pT7- Hin dIII-dead- ccdB differs by a four base-pair deletion in the ccdB -coding sequence from it’s predecessor pT7- Hin dIII- ccdB . The dotted lines encompass the region removed during cloning. ( b ) Sequence alignment of the region encompassing the small deletion in the ccdB -ORF, in pT7- Hin dIII-dead- ccdB compared to the region in pT7- Hin dIII- ccdB and the resulting frameshift rendering the ΔCcdB non-toxic for E. coli NEB 5-alpha. The numbers denote bases in the vector. ( c ) The three-fragment assembly as shown in Fig. 6c uses the pT7-HindIII-dead- ccdB vector and OTG-derived PPY-extract to assemble pT7-GFP antisense analogous to the assemblies shown in Fig. 5 . The percentage of GFP + colonies drops from nearly 100% for pT7- Hin dIII- ccdB to 57% for pT7- Hin dIII-dead- ccdB . ( d ) Image of the mixture of GFP + and GFP − resulting from the assembly (100 µl outgrowth medium spread). The red arrow points at a cluster of GFP − colonies representing un-digested vector that would have to be screened for in a non-model assembly.
    Figure Legend Snippet: Rendering the CcdB in the placeholder non-toxic increases the number of GFP – background colonies markedly, showing that ccdB is an essential element if working with non-gel purified vector. ( a ) The pT7- Hin dIII-dead- ccdB differs by a four base-pair deletion in the ccdB -coding sequence from it’s predecessor pT7- Hin dIII- ccdB . The dotted lines encompass the region removed during cloning. ( b ) Sequence alignment of the region encompassing the small deletion in the ccdB -ORF, in pT7- Hin dIII-dead- ccdB compared to the region in pT7- Hin dIII- ccdB and the resulting frameshift rendering the ΔCcdB non-toxic for E. coli NEB 5-alpha. The numbers denote bases in the vector. ( c ) The three-fragment assembly as shown in Fig. 6c uses the pT7-HindIII-dead- ccdB vector and OTG-derived PPY-extract to assemble pT7-GFP antisense analogous to the assemblies shown in Fig. 5 . The percentage of GFP + colonies drops from nearly 100% for pT7- Hin dIII- ccdB to 57% for pT7- Hin dIII-dead- ccdB . ( d ) Image of the mixture of GFP + and GFP − resulting from the assembly (100 µl outgrowth medium spread). The red arrow points at a cluster of GFP − colonies representing un-digested vector that would have to be screened for in a non-model assembly.

    Techniques Used: Purification, Plasmid Preparation, Sequencing, Clone Assay, Derivative Assay

    3) Product Images from "ZeBRα a universal, multi-fragment DNA-assembly-system with minimal hands-on time requirement"

    Article Title: ZeBRα a universal, multi-fragment DNA-assembly-system with minimal hands-on time requirement

    Journal: Scientific Reports

    doi: 10.1038/s41598-019-39768-0

    Three or four fragments can efficiently be assembled with PPY-cell extracts, while iVEC/“transformation-cloning” with three fragments is markedly less efficient. ( a ) The assembly of four fragments in a single reaction reduces the number of successful assemblies by a factor of two to ten as compared to the three-fragment-assembly. Cell-extracts were prepared from autoinduced PPY cells and the assemblies were purified prior transformation. ( b ) Assembly of three fragments by iVEC/“transformation-cloning” with NEB 5-alpha resulted in roughly 250 recombinant colonies/µg transformed DNA. A significant number of colonies harboring plasmids with defective inserts (grey bar) and PCR-template carry-over (dotted bar) were present on the plates.
    Figure Legend Snippet: Three or four fragments can efficiently be assembled with PPY-cell extracts, while iVEC/“transformation-cloning” with three fragments is markedly less efficient. ( a ) The assembly of four fragments in a single reaction reduces the number of successful assemblies by a factor of two to ten as compared to the three-fragment-assembly. Cell-extracts were prepared from autoinduced PPY cells and the assemblies were purified prior transformation. ( b ) Assembly of three fragments by iVEC/“transformation-cloning” with NEB 5-alpha resulted in roughly 250 recombinant colonies/µg transformed DNA. A significant number of colonies harboring plasmids with defective inserts (grey bar) and PCR-template carry-over (dotted bar) were present on the plates.

    Techniques Used: Clone Assay, Purification, Transformation Assay, Recombinant, Polymerase Chain Reaction

    Strategy for SLiCE optimization and evaluation. ( a ) Flow chart of the optimization process for generating a recombinogenic E. coli lysate. The PPY strain is a DH10B-derivative used to prepare the recombinogenic cell lysate and expresses the coding sequences for Redαβγ. The extracts, derived from arabinose autoinduced PPY-cells, were compared to extracts made from non-induced PPY-cells. ( b ) Structure of the examined non-ionic detergents used to prepare the recombinogenic PPY-extracts, CHAPS, Sulfo-Betain (SB-12), n-Octyl-β-D-thioglucopyranosid (OTG), n-Octyl-β-D-glucopyranosid (OG) Dodecyl-β-D-maltosid (DDM). ( c ) PPY-extracts were tested for their recombination capacity by assembling three DNA fragments with overlapping ends, to generate a recombinant plasmid constitutively expressing a blue chromoprotein. To examine the effects detergents had on the transformation, samples were split after the assembly reaction. One part was transformed into NEB 5-alpha unpurified; the other fraction was purified by silica-column chromatography prior to transformation.
    Figure Legend Snippet: Strategy for SLiCE optimization and evaluation. ( a ) Flow chart of the optimization process for generating a recombinogenic E. coli lysate. The PPY strain is a DH10B-derivative used to prepare the recombinogenic cell lysate and expresses the coding sequences for Redαβγ. The extracts, derived from arabinose autoinduced PPY-cells, were compared to extracts made from non-induced PPY-cells. ( b ) Structure of the examined non-ionic detergents used to prepare the recombinogenic PPY-extracts, CHAPS, Sulfo-Betain (SB-12), n-Octyl-β-D-thioglucopyranosid (OTG), n-Octyl-β-D-glucopyranosid (OG) Dodecyl-β-D-maltosid (DDM). ( c ) PPY-extracts were tested for their recombination capacity by assembling three DNA fragments with overlapping ends, to generate a recombinant plasmid constitutively expressing a blue chromoprotein. To examine the effects detergents had on the transformation, samples were split after the assembly reaction. One part was transformed into NEB 5-alpha unpurified; the other fraction was purified by silica-column chromatography prior to transformation.

    Techniques Used: Flow Cytometry, Derivative Assay, Recombinant, Plasmid Preparation, Expressing, Transformation Assay, Purification, Column Chromatography

    Comparison of the influence of detergent, autoinduction, post-assembly purification and competency of used bacteria on DNA assembling efficiency. ( a ) In four of the five PPY lysis conditions induction of Redα had moderate effects. Five different detergents were tested on PPY-cells grown with either lactose (Redα un-induced) or arabinose (Redα induced). All assemblies were column-purified before transformation into NEB 5-alpha. Bars indicate standard error of three independent replicates of an assembly reaction in all following graphs. PPY recombinogenic capacity was assessed in three-fragment assemblies. ( b ) Column-purification of the three-fragment-assembly reactions led to markedly increased number of recombinant colonies for all tested detergents. In the case of CHAPS and SB-12, unpurified samples resulted in no colonies. The OTG derived PPY-extract resulted in the highest number of recombinant colonies without purification. All assemblies were arabinose-induced. ( c ) Chemical competency has profound influence on recombination efficiency. OTG prepared PPY-lysate was used in a three-fragment-assembly and transformed into commercial NEB 5-alpha competent E. coli (1 × 10 9 cfu/µg pUC DNA) or the same strain prepared by the Inoue-method 21 (2.3 × 10 6 cfu/µg DNA). ( d ) For convenient readout of the potency of the PPY-extracts PCR-fragments used for the three- and four-way assembly reactions consisted of a blue chromoprotein coding ORF, a kanamycin resistance gene an origin-of-replication (on one fragment for the three-fragment assembly) and a bacterial basal-promoter-fragment. Only successful recombinants could produce blue colonies on kanamycin plates. The PCR-fragments to be assembled had overlapping bases that summed up to about 15 bp overlapping ends.
    Figure Legend Snippet: Comparison of the influence of detergent, autoinduction, post-assembly purification and competency of used bacteria on DNA assembling efficiency. ( a ) In four of the five PPY lysis conditions induction of Redα had moderate effects. Five different detergents were tested on PPY-cells grown with either lactose (Redα un-induced) or arabinose (Redα induced). All assemblies were column-purified before transformation into NEB 5-alpha. Bars indicate standard error of three independent replicates of an assembly reaction in all following graphs. PPY recombinogenic capacity was assessed in three-fragment assemblies. ( b ) Column-purification of the three-fragment-assembly reactions led to markedly increased number of recombinant colonies for all tested detergents. In the case of CHAPS and SB-12, unpurified samples resulted in no colonies. The OTG derived PPY-extract resulted in the highest number of recombinant colonies without purification. All assemblies were arabinose-induced. ( c ) Chemical competency has profound influence on recombination efficiency. OTG prepared PPY-lysate was used in a three-fragment-assembly and transformed into commercial NEB 5-alpha competent E. coli (1 × 10 9 cfu/µg pUC DNA) or the same strain prepared by the Inoue-method 21 (2.3 × 10 6 cfu/µg DNA). ( d ) For convenient readout of the potency of the PPY-extracts PCR-fragments used for the three- and four-way assembly reactions consisted of a blue chromoprotein coding ORF, a kanamycin resistance gene an origin-of-replication (on one fragment for the three-fragment assembly) and a bacterial basal-promoter-fragment. Only successful recombinants could produce blue colonies on kanamycin plates. The PCR-fragments to be assembled had overlapping bases that summed up to about 15 bp overlapping ends.

    Techniques Used: Purification, Lysis, Transformation Assay, Recombinant, Derivative Assay, Polymerase Chain Reaction

    The recombinogenic capacity of OTG extracts from autoinduced PPY and NEB 5-alpha extracts are equivalent or better than PPY-extracts generated by the original protocol. ( a ) Plasmid map of pT7- Hin dIII- ccdB used to assess three-fragment ZeBRα assemblies. Two Hin dIII and two Bsa I sites flank the toxic-placeholder- ccdB , allowing linearization and removal of ccdB . Unique sites are available on either side of ccdB . Chloramphenicol-acetyl-transferase coding gene ( CmR ), is part of the placeholder cassette and prevents ccdB -loss during plasmid propagation. The hatched region encompasses the fragment removed during cloning. ( b ) Map of the vector pT7-GFP antisense resulting from the three-fragment test-assembly of the pT7- Hin dIII- ccdB as recipient for a GFP-ORF and a bacterial promoter containing PCR-fragment, to evaluate the efficacy of the ZeBRα-procedure. Criss-cross lines mark the fusion-sites of the assembled fragments. ( c ) Comparison of the recombination capacity of extracts prepared with OTG or CelLyticB TM from manually induced and autoinduced (denoted as “auto” in the column) PPY-cells and NEB 5-alpha. The iVEC/“transformation-cloning” of the respective fragments is shown as last column. ( d ) Green fluorescent NEB 5-alpha colonies harboring the constitutively GFP-expressing vector pT7-GFP antisense.
    Figure Legend Snippet: The recombinogenic capacity of OTG extracts from autoinduced PPY and NEB 5-alpha extracts are equivalent or better than PPY-extracts generated by the original protocol. ( a ) Plasmid map of pT7- Hin dIII- ccdB used to assess three-fragment ZeBRα assemblies. Two Hin dIII and two Bsa I sites flank the toxic-placeholder- ccdB , allowing linearization and removal of ccdB . Unique sites are available on either side of ccdB . Chloramphenicol-acetyl-transferase coding gene ( CmR ), is part of the placeholder cassette and prevents ccdB -loss during plasmid propagation. The hatched region encompasses the fragment removed during cloning. ( b ) Map of the vector pT7-GFP antisense resulting from the three-fragment test-assembly of the pT7- Hin dIII- ccdB as recipient for a GFP-ORF and a bacterial promoter containing PCR-fragment, to evaluate the efficacy of the ZeBRα-procedure. Criss-cross lines mark the fusion-sites of the assembled fragments. ( c ) Comparison of the recombination capacity of extracts prepared with OTG or CelLyticB TM from manually induced and autoinduced (denoted as “auto” in the column) PPY-cells and NEB 5-alpha. The iVEC/“transformation-cloning” of the respective fragments is shown as last column. ( d ) Green fluorescent NEB 5-alpha colonies harboring the constitutively GFP-expressing vector pT7-GFP antisense.

    Techniques Used: Generated, Plasmid Preparation, Chloramphenicol Acetyltransferase Assay, Clone Assay, Polymerase Chain Reaction, Expressing

    Rendering the CcdB in the placeholder non-toxic increases the number of GFP – background colonies markedly, showing that ccdB is an essential element if working with non-gel purified vector. ( a ) The pT7- Hin dIII-dead- ccdB differs by a four base-pair deletion in the ccdB -coding sequence from it’s predecessor pT7- Hin dIII- ccdB . The dotted lines encompass the region removed during cloning. ( b ) Sequence alignment of the region encompassing the small deletion in the ccdB -ORF, in pT7- Hin dIII-dead- ccdB compared to the region in pT7- Hin dIII- ccdB and the resulting frameshift rendering the ΔCcdB non-toxic for E. coli NEB 5-alpha. The numbers denote bases in the vector. ( c ) The three-fragment assembly as shown in Fig. 6c uses the pT7-HindIII-dead- ccdB vector and OTG-derived PPY-extract to assemble pT7-GFP antisense analogous to the assemblies shown in Fig. 5 . The percentage of GFP + colonies drops from nearly 100% for pT7- Hin dIII- ccdB to 57% for pT7- Hin dIII-dead- ccdB . ( d ) Image of the mixture of GFP + and GFP − resulting from the assembly (100 µl outgrowth medium spread). The red arrow points at a cluster of GFP − colonies representing un-digested vector that would have to be screened for in a non-model assembly.
    Figure Legend Snippet: Rendering the CcdB in the placeholder non-toxic increases the number of GFP – background colonies markedly, showing that ccdB is an essential element if working with non-gel purified vector. ( a ) The pT7- Hin dIII-dead- ccdB differs by a four base-pair deletion in the ccdB -coding sequence from it’s predecessor pT7- Hin dIII- ccdB . The dotted lines encompass the region removed during cloning. ( b ) Sequence alignment of the region encompassing the small deletion in the ccdB -ORF, in pT7- Hin dIII-dead- ccdB compared to the region in pT7- Hin dIII- ccdB and the resulting frameshift rendering the ΔCcdB non-toxic for E. coli NEB 5-alpha. The numbers denote bases in the vector. ( c ) The three-fragment assembly as shown in Fig. 6c uses the pT7-HindIII-dead- ccdB vector and OTG-derived PPY-extract to assemble pT7-GFP antisense analogous to the assemblies shown in Fig. 5 . The percentage of GFP + colonies drops from nearly 100% for pT7- Hin dIII- ccdB to 57% for pT7- Hin dIII-dead- ccdB . ( d ) Image of the mixture of GFP + and GFP − resulting from the assembly (100 µl outgrowth medium spread). The red arrow points at a cluster of GFP − colonies representing un-digested vector that would have to be screened for in a non-model assembly.

    Techniques Used: Purification, Plasmid Preparation, Sequencing, Clone Assay, Derivative Assay

    4) Product Images from "ZeBRα a universal, multi-fragment DNA-assembly-system with minimal hands-on time requirement"

    Article Title: ZeBRα a universal, multi-fragment DNA-assembly-system with minimal hands-on time requirement

    Journal: Scientific Reports

    doi: 10.1038/s41598-019-39768-0

    Three or four fragments can efficiently be assembled with PPY-cell extracts, while iVEC/“transformation-cloning” with three fragments is markedly less efficient. ( a ) The assembly of four fragments in a single reaction reduces the number of successful assemblies by a factor of two to ten as compared to the three-fragment-assembly. Cell-extracts were prepared from autoinduced PPY cells and the assemblies were purified prior transformation. ( b ) Assembly of three fragments by iVEC/“transformation-cloning” with NEB 5-alpha resulted in roughly 250 recombinant colonies/µg transformed DNA. A significant number of colonies harboring plasmids with defective inserts (grey bar) and PCR-template carry-over (dotted bar) were present on the plates.
    Figure Legend Snippet: Three or four fragments can efficiently be assembled with PPY-cell extracts, while iVEC/“transformation-cloning” with three fragments is markedly less efficient. ( a ) The assembly of four fragments in a single reaction reduces the number of successful assemblies by a factor of two to ten as compared to the three-fragment-assembly. Cell-extracts were prepared from autoinduced PPY cells and the assemblies were purified prior transformation. ( b ) Assembly of three fragments by iVEC/“transformation-cloning” with NEB 5-alpha resulted in roughly 250 recombinant colonies/µg transformed DNA. A significant number of colonies harboring plasmids with defective inserts (grey bar) and PCR-template carry-over (dotted bar) were present on the plates.

    Techniques Used: Clone Assay, Purification, Transformation Assay, Recombinant, Polymerase Chain Reaction

    Strategy for SLiCE optimization and evaluation. ( a ) Flow chart of the optimization process for generating a recombinogenic E. coli lysate. The PPY strain is a DH10B-derivative used to prepare the recombinogenic cell lysate and expresses the coding sequences for Redαβγ. The extracts, derived from arabinose autoinduced PPY-cells, were compared to extracts made from non-induced PPY-cells. ( b ) Structure of the examined non-ionic detergents used to prepare the recombinogenic PPY-extracts, CHAPS, Sulfo-Betain (SB-12), n-Octyl-β-D-thioglucopyranosid (OTG), n-Octyl-β-D-glucopyranosid (OG) Dodecyl-β-D-maltosid (DDM). ( c ) PPY-extracts were tested for their recombination capacity by assembling three DNA fragments with overlapping ends, to generate a recombinant plasmid constitutively expressing a blue chromoprotein. To examine the effects detergents had on the transformation, samples were split after the assembly reaction. One part was transformed into NEB 5-alpha unpurified; the other fraction was purified by silica-column chromatography prior to transformation.
    Figure Legend Snippet: Strategy for SLiCE optimization and evaluation. ( a ) Flow chart of the optimization process for generating a recombinogenic E. coli lysate. The PPY strain is a DH10B-derivative used to prepare the recombinogenic cell lysate and expresses the coding sequences for Redαβγ. The extracts, derived from arabinose autoinduced PPY-cells, were compared to extracts made from non-induced PPY-cells. ( b ) Structure of the examined non-ionic detergents used to prepare the recombinogenic PPY-extracts, CHAPS, Sulfo-Betain (SB-12), n-Octyl-β-D-thioglucopyranosid (OTG), n-Octyl-β-D-glucopyranosid (OG) Dodecyl-β-D-maltosid (DDM). ( c ) PPY-extracts were tested for their recombination capacity by assembling three DNA fragments with overlapping ends, to generate a recombinant plasmid constitutively expressing a blue chromoprotein. To examine the effects detergents had on the transformation, samples were split after the assembly reaction. One part was transformed into NEB 5-alpha unpurified; the other fraction was purified by silica-column chromatography prior to transformation.

    Techniques Used: Flow Cytometry, Derivative Assay, Recombinant, Plasmid Preparation, Expressing, Transformation Assay, Purification, Column Chromatography

    Comparison of the influence of detergent, autoinduction, post-assembly purification and competency of used bacteria on DNA assembling efficiency. ( a ) In four of the five PPY lysis conditions induction of Redα had moderate effects. Five different detergents were tested on PPY-cells grown with either lactose (Redα un-induced) or arabinose (Redα induced). All assemblies were column-purified before transformation into NEB 5-alpha. Bars indicate standard error of three independent replicates of an assembly reaction in all following graphs. PPY recombinogenic capacity was assessed in three-fragment assemblies. ( b ) Column-purification of the three-fragment-assembly reactions led to markedly increased number of recombinant colonies for all tested detergents. In the case of CHAPS and SB-12, unpurified samples resulted in no colonies. The OTG derived PPY-extract resulted in the highest number of recombinant colonies without purification. All assemblies were arabinose-induced. ( c ) Chemical competency has profound influence on recombination efficiency. OTG prepared PPY-lysate was used in a three-fragment-assembly and transformed into commercial NEB 5-alpha competent E. coli (1 × 10 9 cfu/µg pUC DNA) or the same strain prepared by the Inoue-method 21 (2.3 × 10 6 cfu/µg DNA). ( d ) For convenient readout of the potency of the PPY-extracts PCR-fragments used for the three- and four-way assembly reactions consisted of a blue chromoprotein coding ORF, a kanamycin resistance gene an origin-of-replication (on one fragment for the three-fragment assembly) and a bacterial basal-promoter-fragment. Only successful recombinants could produce blue colonies on kanamycin plates. The PCR-fragments to be assembled had overlapping bases that summed up to about 15 bp overlapping ends.
    Figure Legend Snippet: Comparison of the influence of detergent, autoinduction, post-assembly purification and competency of used bacteria on DNA assembling efficiency. ( a ) In four of the five PPY lysis conditions induction of Redα had moderate effects. Five different detergents were tested on PPY-cells grown with either lactose (Redα un-induced) or arabinose (Redα induced). All assemblies were column-purified before transformation into NEB 5-alpha. Bars indicate standard error of three independent replicates of an assembly reaction in all following graphs. PPY recombinogenic capacity was assessed in three-fragment assemblies. ( b ) Column-purification of the three-fragment-assembly reactions led to markedly increased number of recombinant colonies for all tested detergents. In the case of CHAPS and SB-12, unpurified samples resulted in no colonies. The OTG derived PPY-extract resulted in the highest number of recombinant colonies without purification. All assemblies were arabinose-induced. ( c ) Chemical competency has profound influence on recombination efficiency. OTG prepared PPY-lysate was used in a three-fragment-assembly and transformed into commercial NEB 5-alpha competent E. coli (1 × 10 9 cfu/µg pUC DNA) or the same strain prepared by the Inoue-method 21 (2.3 × 10 6 cfu/µg DNA). ( d ) For convenient readout of the potency of the PPY-extracts PCR-fragments used for the three- and four-way assembly reactions consisted of a blue chromoprotein coding ORF, a kanamycin resistance gene an origin-of-replication (on one fragment for the three-fragment assembly) and a bacterial basal-promoter-fragment. Only successful recombinants could produce blue colonies on kanamycin plates. The PCR-fragments to be assembled had overlapping bases that summed up to about 15 bp overlapping ends.

    Techniques Used: Purification, Lysis, Transformation Assay, Recombinant, Derivative Assay, Polymerase Chain Reaction

    The recombinogenic capacity of OTG extracts from autoinduced PPY and NEB 5-alpha extracts are equivalent or better than PPY-extracts generated by the original protocol. ( a ) Plasmid map of pT7- Hin dIII- ccdB used to assess three-fragment ZeBRα assemblies. Two Hin dIII and two Bsa I sites flank the toxic-placeholder- ccdB , allowing linearization and removal of ccdB . Unique sites are available on either side of ccdB . Chloramphenicol-acetyl-transferase coding gene ( CmR ), is part of the placeholder cassette and prevents ccdB -loss during plasmid propagation. The hatched region encompasses the fragment removed during cloning. ( b ) Map of the vector pT7-GFP antisense resulting from the three-fragment test-assembly of the pT7- Hin dIII- ccdB as recipient for a GFP-ORF and a bacterial promoter containing PCR-fragment, to evaluate the efficacy of the ZeBRα-procedure. Criss-cross lines mark the fusion-sites of the assembled fragments. ( c ) Comparison of the recombination capacity of extracts prepared with OTG or CelLyticB TM from manually induced and autoinduced (denoted as “auto” in the column) PPY-cells and NEB 5-alpha. The iVEC/“transformation-cloning” of the respective fragments is shown as last column. ( d ) Green fluorescent NEB 5-alpha colonies harboring the constitutively GFP-expressing vector pT7-GFP antisense.
    Figure Legend Snippet: The recombinogenic capacity of OTG extracts from autoinduced PPY and NEB 5-alpha extracts are equivalent or better than PPY-extracts generated by the original protocol. ( a ) Plasmid map of pT7- Hin dIII- ccdB used to assess three-fragment ZeBRα assemblies. Two Hin dIII and two Bsa I sites flank the toxic-placeholder- ccdB , allowing linearization and removal of ccdB . Unique sites are available on either side of ccdB . Chloramphenicol-acetyl-transferase coding gene ( CmR ), is part of the placeholder cassette and prevents ccdB -loss during plasmid propagation. The hatched region encompasses the fragment removed during cloning. ( b ) Map of the vector pT7-GFP antisense resulting from the three-fragment test-assembly of the pT7- Hin dIII- ccdB as recipient for a GFP-ORF and a bacterial promoter containing PCR-fragment, to evaluate the efficacy of the ZeBRα-procedure. Criss-cross lines mark the fusion-sites of the assembled fragments. ( c ) Comparison of the recombination capacity of extracts prepared with OTG or CelLyticB TM from manually induced and autoinduced (denoted as “auto” in the column) PPY-cells and NEB 5-alpha. The iVEC/“transformation-cloning” of the respective fragments is shown as last column. ( d ) Green fluorescent NEB 5-alpha colonies harboring the constitutively GFP-expressing vector pT7-GFP antisense.

    Techniques Used: Generated, Plasmid Preparation, Chloramphenicol Acetyltransferase Assay, Clone Assay, Polymerase Chain Reaction, Expressing

    Rendering the CcdB in the placeholder non-toxic increases the number of GFP – background colonies markedly, showing that ccdB is an essential element if working with non-gel purified vector. ( a ) The pT7- Hin dIII-dead- ccdB differs by a four base-pair deletion in the ccdB -coding sequence from it’s predecessor pT7- Hin dIII- ccdB . The dotted lines encompass the region removed during cloning. ( b ) Sequence alignment of the region encompassing the small deletion in the ccdB -ORF, in pT7- Hin dIII-dead- ccdB compared to the region in pT7- Hin dIII- ccdB and the resulting frameshift rendering the ΔCcdB non-toxic for E. coli NEB 5-alpha. The numbers denote bases in the vector. ( c ) The three-fragment assembly as shown in Fig. 6c uses the pT7-HindIII-dead- ccdB vector and OTG-derived PPY-extract to assemble pT7-GFP antisense analogous to the assemblies shown in Fig. 5 . The percentage of GFP + colonies drops from nearly 100% for pT7- Hin dIII- ccdB to 57% for pT7- Hin dIII-dead- ccdB . ( d ) Image of the mixture of GFP + and GFP − resulting from the assembly (100 µl outgrowth medium spread). The red arrow points at a cluster of GFP − colonies representing un-digested vector that would have to be screened for in a non-model assembly.
    Figure Legend Snippet: Rendering the CcdB in the placeholder non-toxic increases the number of GFP – background colonies markedly, showing that ccdB is an essential element if working with non-gel purified vector. ( a ) The pT7- Hin dIII-dead- ccdB differs by a four base-pair deletion in the ccdB -coding sequence from it’s predecessor pT7- Hin dIII- ccdB . The dotted lines encompass the region removed during cloning. ( b ) Sequence alignment of the region encompassing the small deletion in the ccdB -ORF, in pT7- Hin dIII-dead- ccdB compared to the region in pT7- Hin dIII- ccdB and the resulting frameshift rendering the ΔCcdB non-toxic for E. coli NEB 5-alpha. The numbers denote bases in the vector. ( c ) The three-fragment assembly as shown in Fig. 6c uses the pT7-HindIII-dead- ccdB vector and OTG-derived PPY-extract to assemble pT7-GFP antisense analogous to the assemblies shown in Fig. 5 . The percentage of GFP + colonies drops from nearly 100% for pT7- Hin dIII- ccdB to 57% for pT7- Hin dIII-dead- ccdB . ( d ) Image of the mixture of GFP + and GFP − resulting from the assembly (100 µl outgrowth medium spread). The red arrow points at a cluster of GFP − colonies representing un-digested vector that would have to be screened for in a non-model assembly.

    Techniques Used: Purification, Plasmid Preparation, Sequencing, Clone Assay, Derivative Assay

    5) Product Images from "ZeBRα a universal, multi-fragment DNA-assembly-system with minimal hands-on time requirement"

    Article Title: ZeBRα a universal, multi-fragment DNA-assembly-system with minimal hands-on time requirement

    Journal: Scientific Reports

    doi: 10.1038/s41598-019-39768-0

    Three or four fragments can efficiently be assembled with PPY-cell extracts, while iVEC/“transformation-cloning” with three fragments is markedly less efficient. ( a ) The assembly of four fragments in a single reaction reduces the number of successful assemblies by a factor of two to ten as compared to the three-fragment-assembly. Cell-extracts were prepared from autoinduced PPY cells and the assemblies were purified prior transformation. ( b ) Assembly of three fragments by iVEC/“transformation-cloning” with NEB 5-alpha resulted in roughly 250 recombinant colonies/µg transformed DNA. A significant number of colonies harboring plasmids with defective inserts (grey bar) and PCR-template carry-over (dotted bar) were present on the plates.
    Figure Legend Snippet: Three or four fragments can efficiently be assembled with PPY-cell extracts, while iVEC/“transformation-cloning” with three fragments is markedly less efficient. ( a ) The assembly of four fragments in a single reaction reduces the number of successful assemblies by a factor of two to ten as compared to the three-fragment-assembly. Cell-extracts were prepared from autoinduced PPY cells and the assemblies were purified prior transformation. ( b ) Assembly of three fragments by iVEC/“transformation-cloning” with NEB 5-alpha resulted in roughly 250 recombinant colonies/µg transformed DNA. A significant number of colonies harboring plasmids with defective inserts (grey bar) and PCR-template carry-over (dotted bar) were present on the plates.

    Techniques Used: Clone Assay, Purification, Transformation Assay, Recombinant, Polymerase Chain Reaction

    Strategy for SLiCE optimization and evaluation. ( a ) Flow chart of the optimization process for generating a recombinogenic E. coli lysate. The PPY strain is a DH10B-derivative used to prepare the recombinogenic cell lysate and expresses the coding sequences for Redαβγ. The extracts, derived from arabinose autoinduced PPY-cells, were compared to extracts made from non-induced PPY-cells. ( b ) Structure of the examined non-ionic detergents used to prepare the recombinogenic PPY-extracts, CHAPS, Sulfo-Betain (SB-12), n-Octyl-β-D-thioglucopyranosid (OTG), n-Octyl-β-D-glucopyranosid (OG) Dodecyl-β-D-maltosid (DDM). ( c ) PPY-extracts were tested for their recombination capacity by assembling three DNA fragments with overlapping ends, to generate a recombinant plasmid constitutively expressing a blue chromoprotein. To examine the effects detergents had on the transformation, samples were split after the assembly reaction. One part was transformed into NEB 5-alpha unpurified; the other fraction was purified by silica-column chromatography prior to transformation.
    Figure Legend Snippet: Strategy for SLiCE optimization and evaluation. ( a ) Flow chart of the optimization process for generating a recombinogenic E. coli lysate. The PPY strain is a DH10B-derivative used to prepare the recombinogenic cell lysate and expresses the coding sequences for Redαβγ. The extracts, derived from arabinose autoinduced PPY-cells, were compared to extracts made from non-induced PPY-cells. ( b ) Structure of the examined non-ionic detergents used to prepare the recombinogenic PPY-extracts, CHAPS, Sulfo-Betain (SB-12), n-Octyl-β-D-thioglucopyranosid (OTG), n-Octyl-β-D-glucopyranosid (OG) Dodecyl-β-D-maltosid (DDM). ( c ) PPY-extracts were tested for their recombination capacity by assembling three DNA fragments with overlapping ends, to generate a recombinant plasmid constitutively expressing a blue chromoprotein. To examine the effects detergents had on the transformation, samples were split after the assembly reaction. One part was transformed into NEB 5-alpha unpurified; the other fraction was purified by silica-column chromatography prior to transformation.

    Techniques Used: Flow Cytometry, Derivative Assay, Recombinant, Plasmid Preparation, Expressing, Transformation Assay, Purification, Column Chromatography

    Comparison of the influence of detergent, autoinduction, post-assembly purification and competency of used bacteria on DNA assembling efficiency. ( a ) In four of the five PPY lysis conditions induction of Redα had moderate effects. Five different detergents were tested on PPY-cells grown with either lactose (Redα un-induced) or arabinose (Redα induced). All assemblies were column-purified before transformation into NEB 5-alpha. Bars indicate standard error of three independent replicates of an assembly reaction in all following graphs. PPY recombinogenic capacity was assessed in three-fragment assemblies. ( b ) Column-purification of the three-fragment-assembly reactions led to markedly increased number of recombinant colonies for all tested detergents. In the case of CHAPS and SB-12, unpurified samples resulted in no colonies. The OTG derived PPY-extract resulted in the highest number of recombinant colonies without purification. All assemblies were arabinose-induced. ( c ) Chemical competency has profound influence on recombination efficiency. OTG prepared PPY-lysate was used in a three-fragment-assembly and transformed into commercial NEB 5-alpha competent E. coli (1 × 10 9 cfu/µg pUC DNA) or the same strain prepared by the Inoue-method 21 (2.3 × 10 6 cfu/µg DNA). ( d ) For convenient readout of the potency of the PPY-extracts PCR-fragments used for the three- and four-way assembly reactions consisted of a blue chromoprotein coding ORF, a kanamycin resistance gene an origin-of-replication (on one fragment for the three-fragment assembly) and a bacterial basal-promoter-fragment. Only successful recombinants could produce blue colonies on kanamycin plates. The PCR-fragments to be assembled had overlapping bases that summed up to about 15 bp overlapping ends.
    Figure Legend Snippet: Comparison of the influence of detergent, autoinduction, post-assembly purification and competency of used bacteria on DNA assembling efficiency. ( a ) In four of the five PPY lysis conditions induction of Redα had moderate effects. Five different detergents were tested on PPY-cells grown with either lactose (Redα un-induced) or arabinose (Redα induced). All assemblies were column-purified before transformation into NEB 5-alpha. Bars indicate standard error of three independent replicates of an assembly reaction in all following graphs. PPY recombinogenic capacity was assessed in three-fragment assemblies. ( b ) Column-purification of the three-fragment-assembly reactions led to markedly increased number of recombinant colonies for all tested detergents. In the case of CHAPS and SB-12, unpurified samples resulted in no colonies. The OTG derived PPY-extract resulted in the highest number of recombinant colonies without purification. All assemblies were arabinose-induced. ( c ) Chemical competency has profound influence on recombination efficiency. OTG prepared PPY-lysate was used in a three-fragment-assembly and transformed into commercial NEB 5-alpha competent E. coli (1 × 10 9 cfu/µg pUC DNA) or the same strain prepared by the Inoue-method 21 (2.3 × 10 6 cfu/µg DNA). ( d ) For convenient readout of the potency of the PPY-extracts PCR-fragments used for the three- and four-way assembly reactions consisted of a blue chromoprotein coding ORF, a kanamycin resistance gene an origin-of-replication (on one fragment for the three-fragment assembly) and a bacterial basal-promoter-fragment. Only successful recombinants could produce blue colonies on kanamycin plates. The PCR-fragments to be assembled had overlapping bases that summed up to about 15 bp overlapping ends.

    Techniques Used: Purification, Lysis, Transformation Assay, Recombinant, Derivative Assay, Polymerase Chain Reaction

    The recombinogenic capacity of OTG extracts from autoinduced PPY and NEB 5-alpha extracts are equivalent or better than PPY-extracts generated by the original protocol. ( a ) Plasmid map of pT7- Hin dIII- ccdB used to assess three-fragment ZeBRα assemblies. Two Hin dIII and two Bsa I sites flank the toxic-placeholder- ccdB , allowing linearization and removal of ccdB . Unique sites are available on either side of ccdB . Chloramphenicol-acetyl-transferase coding gene ( CmR ), is part of the placeholder cassette and prevents ccdB -loss during plasmid propagation. The hatched region encompasses the fragment removed during cloning. ( b ) Map of the vector pT7-GFP antisense resulting from the three-fragment test-assembly of the pT7- Hin dIII- ccdB as recipient for a GFP-ORF and a bacterial promoter containing PCR-fragment, to evaluate the efficacy of the ZeBRα-procedure. Criss-cross lines mark the fusion-sites of the assembled fragments. ( c ) Comparison of the recombination capacity of extracts prepared with OTG or CelLyticB TM from manually induced and autoinduced (denoted as “auto” in the column) PPY-cells and NEB 5-alpha. The iVEC/“transformation-cloning” of the respective fragments is shown as last column. ( d ) Green fluorescent NEB 5-alpha colonies harboring the constitutively GFP-expressing vector pT7-GFP antisense.
    Figure Legend Snippet: The recombinogenic capacity of OTG extracts from autoinduced PPY and NEB 5-alpha extracts are equivalent or better than PPY-extracts generated by the original protocol. ( a ) Plasmid map of pT7- Hin dIII- ccdB used to assess three-fragment ZeBRα assemblies. Two Hin dIII and two Bsa I sites flank the toxic-placeholder- ccdB , allowing linearization and removal of ccdB . Unique sites are available on either side of ccdB . Chloramphenicol-acetyl-transferase coding gene ( CmR ), is part of the placeholder cassette and prevents ccdB -loss during plasmid propagation. The hatched region encompasses the fragment removed during cloning. ( b ) Map of the vector pT7-GFP antisense resulting from the three-fragment test-assembly of the pT7- Hin dIII- ccdB as recipient for a GFP-ORF and a bacterial promoter containing PCR-fragment, to evaluate the efficacy of the ZeBRα-procedure. Criss-cross lines mark the fusion-sites of the assembled fragments. ( c ) Comparison of the recombination capacity of extracts prepared with OTG or CelLyticB TM from manually induced and autoinduced (denoted as “auto” in the column) PPY-cells and NEB 5-alpha. The iVEC/“transformation-cloning” of the respective fragments is shown as last column. ( d ) Green fluorescent NEB 5-alpha colonies harboring the constitutively GFP-expressing vector pT7-GFP antisense.

    Techniques Used: Generated, Plasmid Preparation, Chloramphenicol Acetyltransferase Assay, Clone Assay, Polymerase Chain Reaction, Expressing

    Rendering the CcdB in the placeholder non-toxic increases the number of GFP – background colonies markedly, showing that ccdB is an essential element if working with non-gel purified vector. ( a ) The pT7- Hin dIII-dead- ccdB differs by a four base-pair deletion in the ccdB -coding sequence from it’s predecessor pT7- Hin dIII- ccdB . The dotted lines encompass the region removed during cloning. ( b ) Sequence alignment of the region encompassing the small deletion in the ccdB -ORF, in pT7- Hin dIII-dead- ccdB compared to the region in pT7- Hin dIII- ccdB and the resulting frameshift rendering the ΔCcdB non-toxic for E. coli NEB 5-alpha. The numbers denote bases in the vector. ( c ) The three-fragment assembly as shown in Fig. 6c uses the pT7-HindIII-dead- ccdB vector and OTG-derived PPY-extract to assemble pT7-GFP antisense analogous to the assemblies shown in Fig. 5 . The percentage of GFP + colonies drops from nearly 100% for pT7- Hin dIII- ccdB to 57% for pT7- Hin dIII-dead- ccdB . ( d ) Image of the mixture of GFP + and GFP − resulting from the assembly (100 µl outgrowth medium spread). The red arrow points at a cluster of GFP − colonies representing un-digested vector that would have to be screened for in a non-model assembly.
    Figure Legend Snippet: Rendering the CcdB in the placeholder non-toxic increases the number of GFP – background colonies markedly, showing that ccdB is an essential element if working with non-gel purified vector. ( a ) The pT7- Hin dIII-dead- ccdB differs by a four base-pair deletion in the ccdB -coding sequence from it’s predecessor pT7- Hin dIII- ccdB . The dotted lines encompass the region removed during cloning. ( b ) Sequence alignment of the region encompassing the small deletion in the ccdB -ORF, in pT7- Hin dIII-dead- ccdB compared to the region in pT7- Hin dIII- ccdB and the resulting frameshift rendering the ΔCcdB non-toxic for E. coli NEB 5-alpha. The numbers denote bases in the vector. ( c ) The three-fragment assembly as shown in Fig. 6c uses the pT7-HindIII-dead- ccdB vector and OTG-derived PPY-extract to assemble pT7-GFP antisense analogous to the assemblies shown in Fig. 5 . The percentage of GFP + colonies drops from nearly 100% for pT7- Hin dIII- ccdB to 57% for pT7- Hin dIII-dead- ccdB . ( d ) Image of the mixture of GFP + and GFP − resulting from the assembly (100 µl outgrowth medium spread). The red arrow points at a cluster of GFP − colonies representing un-digested vector that would have to be screened for in a non-model assembly.

    Techniques Used: Purification, Plasmid Preparation, Sequencing, Clone Assay, Derivative Assay

    6) Product Images from "ZeBRα a universal, multi-fragment DNA-assembly-system with minimal hands-on time requirement"

    Article Title: ZeBRα a universal, multi-fragment DNA-assembly-system with minimal hands-on time requirement

    Journal: Scientific Reports

    doi: 10.1038/s41598-019-39768-0

    Three or four fragments can efficiently be assembled with PPY-cell extracts, while iVEC/“transformation-cloning” with three fragments is markedly less efficient. ( a ) The assembly of four fragments in a single reaction reduces the number of successful assemblies by a factor of two to ten as compared to the three-fragment-assembly. Cell-extracts were prepared from autoinduced PPY cells and the assemblies were purified prior transformation. ( b ) Assembly of three fragments by iVEC/“transformation-cloning” with NEB 5-alpha resulted in roughly 250 recombinant colonies/µg transformed DNA. A significant number of colonies harboring plasmids with defective inserts (grey bar) and PCR-template carry-over (dotted bar) were present on the plates.
    Figure Legend Snippet: Three or four fragments can efficiently be assembled with PPY-cell extracts, while iVEC/“transformation-cloning” with three fragments is markedly less efficient. ( a ) The assembly of four fragments in a single reaction reduces the number of successful assemblies by a factor of two to ten as compared to the three-fragment-assembly. Cell-extracts were prepared from autoinduced PPY cells and the assemblies were purified prior transformation. ( b ) Assembly of three fragments by iVEC/“transformation-cloning” with NEB 5-alpha resulted in roughly 250 recombinant colonies/µg transformed DNA. A significant number of colonies harboring plasmids with defective inserts (grey bar) and PCR-template carry-over (dotted bar) were present on the plates.

    Techniques Used: Clone Assay, Purification, Transformation Assay, Recombinant, Polymerase Chain Reaction

    Strategy for SLiCE optimization and evaluation. ( a ) Flow chart of the optimization process for generating a recombinogenic E. coli lysate. The PPY strain is a DH10B-derivative used to prepare the recombinogenic cell lysate and expresses the coding sequences for Redαβγ. The extracts, derived from arabinose autoinduced PPY-cells, were compared to extracts made from non-induced PPY-cells. ( b ) Structure of the examined non-ionic detergents used to prepare the recombinogenic PPY-extracts, CHAPS, Sulfo-Betain (SB-12), n-Octyl-β-D-thioglucopyranosid (OTG), n-Octyl-β-D-glucopyranosid (OG) Dodecyl-β-D-maltosid (DDM). ( c ) PPY-extracts were tested for their recombination capacity by assembling three DNA fragments with overlapping ends, to generate a recombinant plasmid constitutively expressing a blue chromoprotein. To examine the effects detergents had on the transformation, samples were split after the assembly reaction. One part was transformed into NEB 5-alpha unpurified; the other fraction was purified by silica-column chromatography prior to transformation.
    Figure Legend Snippet: Strategy for SLiCE optimization and evaluation. ( a ) Flow chart of the optimization process for generating a recombinogenic E. coli lysate. The PPY strain is a DH10B-derivative used to prepare the recombinogenic cell lysate and expresses the coding sequences for Redαβγ. The extracts, derived from arabinose autoinduced PPY-cells, were compared to extracts made from non-induced PPY-cells. ( b ) Structure of the examined non-ionic detergents used to prepare the recombinogenic PPY-extracts, CHAPS, Sulfo-Betain (SB-12), n-Octyl-β-D-thioglucopyranosid (OTG), n-Octyl-β-D-glucopyranosid (OG) Dodecyl-β-D-maltosid (DDM). ( c ) PPY-extracts were tested for their recombination capacity by assembling three DNA fragments with overlapping ends, to generate a recombinant plasmid constitutively expressing a blue chromoprotein. To examine the effects detergents had on the transformation, samples were split after the assembly reaction. One part was transformed into NEB 5-alpha unpurified; the other fraction was purified by silica-column chromatography prior to transformation.

    Techniques Used: Flow Cytometry, Derivative Assay, Recombinant, Plasmid Preparation, Expressing, Transformation Assay, Purification, Column Chromatography

    Comparison of the influence of detergent, autoinduction, post-assembly purification and competency of used bacteria on DNA assembling efficiency. ( a ) In four of the five PPY lysis conditions induction of Redα had moderate effects. Five different detergents were tested on PPY-cells grown with either lactose (Redα un-induced) or arabinose (Redα induced). All assemblies were column-purified before transformation into NEB 5-alpha. Bars indicate standard error of three independent replicates of an assembly reaction in all following graphs. PPY recombinogenic capacity was assessed in three-fragment assemblies. ( b ) Column-purification of the three-fragment-assembly reactions led to markedly increased number of recombinant colonies for all tested detergents. In the case of CHAPS and SB-12, unpurified samples resulted in no colonies. The OTG derived PPY-extract resulted in the highest number of recombinant colonies without purification. All assemblies were arabinose-induced. ( c ) Chemical competency has profound influence on recombination efficiency. OTG prepared PPY-lysate was used in a three-fragment-assembly and transformed into commercial NEB 5-alpha competent E. coli (1 × 10 9 cfu/µg pUC DNA) or the same strain prepared by the Inoue-method 21 (2.3 × 10 6 cfu/µg DNA). ( d ) For convenient readout of the potency of the PPY-extracts PCR-fragments used for the three- and four-way assembly reactions consisted of a blue chromoprotein coding ORF, a kanamycin resistance gene an origin-of-replication (on one fragment for the three-fragment assembly) and a bacterial basal-promoter-fragment. Only successful recombinants could produce blue colonies on kanamycin plates. The PCR-fragments to be assembled had overlapping bases that summed up to about 15 bp overlapping ends.
    Figure Legend Snippet: Comparison of the influence of detergent, autoinduction, post-assembly purification and competency of used bacteria on DNA assembling efficiency. ( a ) In four of the five PPY lysis conditions induction of Redα had moderate effects. Five different detergents were tested on PPY-cells grown with either lactose (Redα un-induced) or arabinose (Redα induced). All assemblies were column-purified before transformation into NEB 5-alpha. Bars indicate standard error of three independent replicates of an assembly reaction in all following graphs. PPY recombinogenic capacity was assessed in three-fragment assemblies. ( b ) Column-purification of the three-fragment-assembly reactions led to markedly increased number of recombinant colonies for all tested detergents. In the case of CHAPS and SB-12, unpurified samples resulted in no colonies. The OTG derived PPY-extract resulted in the highest number of recombinant colonies without purification. All assemblies were arabinose-induced. ( c ) Chemical competency has profound influence on recombination efficiency. OTG prepared PPY-lysate was used in a three-fragment-assembly and transformed into commercial NEB 5-alpha competent E. coli (1 × 10 9 cfu/µg pUC DNA) or the same strain prepared by the Inoue-method 21 (2.3 × 10 6 cfu/µg DNA). ( d ) For convenient readout of the potency of the PPY-extracts PCR-fragments used for the three- and four-way assembly reactions consisted of a blue chromoprotein coding ORF, a kanamycin resistance gene an origin-of-replication (on one fragment for the three-fragment assembly) and a bacterial basal-promoter-fragment. Only successful recombinants could produce blue colonies on kanamycin plates. The PCR-fragments to be assembled had overlapping bases that summed up to about 15 bp overlapping ends.

    Techniques Used: Purification, Lysis, Transformation Assay, Recombinant, Derivative Assay, Polymerase Chain Reaction

    The recombinogenic capacity of OTG extracts from autoinduced PPY and NEB 5-alpha extracts are equivalent or better than PPY-extracts generated by the original protocol. ( a ) Plasmid map of pT7- Hin dIII- ccdB used to assess three-fragment ZeBRα assemblies. Two Hin dIII and two Bsa I sites flank the toxic-placeholder- ccdB , allowing linearization and removal of ccdB . Unique sites are available on either side of ccdB . Chloramphenicol-acetyl-transferase coding gene ( CmR ), is part of the placeholder cassette and prevents ccdB -loss during plasmid propagation. The hatched region encompasses the fragment removed during cloning. ( b ) Map of the vector pT7-GFP antisense resulting from the three-fragment test-assembly of the pT7- Hin dIII- ccdB as recipient for a GFP-ORF and a bacterial promoter containing PCR-fragment, to evaluate the efficacy of the ZeBRα-procedure. Criss-cross lines mark the fusion-sites of the assembled fragments. ( c ) Comparison of the recombination capacity of extracts prepared with OTG or CelLyticB TM from manually induced and autoinduced (denoted as “auto” in the column) PPY-cells and NEB 5-alpha. The iVEC/“transformation-cloning” of the respective fragments is shown as last column. ( d ) Green fluorescent NEB 5-alpha colonies harboring the constitutively GFP-expressing vector pT7-GFP antisense.
    Figure Legend Snippet: The recombinogenic capacity of OTG extracts from autoinduced PPY and NEB 5-alpha extracts are equivalent or better than PPY-extracts generated by the original protocol. ( a ) Plasmid map of pT7- Hin dIII- ccdB used to assess three-fragment ZeBRα assemblies. Two Hin dIII and two Bsa I sites flank the toxic-placeholder- ccdB , allowing linearization and removal of ccdB . Unique sites are available on either side of ccdB . Chloramphenicol-acetyl-transferase coding gene ( CmR ), is part of the placeholder cassette and prevents ccdB -loss during plasmid propagation. The hatched region encompasses the fragment removed during cloning. ( b ) Map of the vector pT7-GFP antisense resulting from the three-fragment test-assembly of the pT7- Hin dIII- ccdB as recipient for a GFP-ORF and a bacterial promoter containing PCR-fragment, to evaluate the efficacy of the ZeBRα-procedure. Criss-cross lines mark the fusion-sites of the assembled fragments. ( c ) Comparison of the recombination capacity of extracts prepared with OTG or CelLyticB TM from manually induced and autoinduced (denoted as “auto” in the column) PPY-cells and NEB 5-alpha. The iVEC/“transformation-cloning” of the respective fragments is shown as last column. ( d ) Green fluorescent NEB 5-alpha colonies harboring the constitutively GFP-expressing vector pT7-GFP antisense.

    Techniques Used: Generated, Plasmid Preparation, Chloramphenicol Acetyltransferase Assay, Clone Assay, Polymerase Chain Reaction, Expressing

    Rendering the CcdB in the placeholder non-toxic increases the number of GFP – background colonies markedly, showing that ccdB is an essential element if working with non-gel purified vector. ( a ) The pT7- Hin dIII-dead- ccdB differs by a four base-pair deletion in the ccdB -coding sequence from it’s predecessor pT7- Hin dIII- ccdB . The dotted lines encompass the region removed during cloning. ( b ) Sequence alignment of the region encompassing the small deletion in the ccdB -ORF, in pT7- Hin dIII-dead- ccdB compared to the region in pT7- Hin dIII- ccdB and the resulting frameshift rendering the ΔCcdB non-toxic for E. coli NEB 5-alpha. The numbers denote bases in the vector. ( c ) The three-fragment assembly as shown in Fig. 6c uses the pT7-HindIII-dead- ccdB vector and OTG-derived PPY-extract to assemble pT7-GFP antisense analogous to the assemblies shown in Fig. 5 . The percentage of GFP + colonies drops from nearly 100% for pT7- Hin dIII- ccdB to 57% for pT7- Hin dIII-dead- ccdB . ( d ) Image of the mixture of GFP + and GFP − resulting from the assembly (100 µl outgrowth medium spread). The red arrow points at a cluster of GFP − colonies representing un-digested vector that would have to be screened for in a non-model assembly.
    Figure Legend Snippet: Rendering the CcdB in the placeholder non-toxic increases the number of GFP – background colonies markedly, showing that ccdB is an essential element if working with non-gel purified vector. ( a ) The pT7- Hin dIII-dead- ccdB differs by a four base-pair deletion in the ccdB -coding sequence from it’s predecessor pT7- Hin dIII- ccdB . The dotted lines encompass the region removed during cloning. ( b ) Sequence alignment of the region encompassing the small deletion in the ccdB -ORF, in pT7- Hin dIII-dead- ccdB compared to the region in pT7- Hin dIII- ccdB and the resulting frameshift rendering the ΔCcdB non-toxic for E. coli NEB 5-alpha. The numbers denote bases in the vector. ( c ) The three-fragment assembly as shown in Fig. 6c uses the pT7-HindIII-dead- ccdB vector and OTG-derived PPY-extract to assemble pT7-GFP antisense analogous to the assemblies shown in Fig. 5 . The percentage of GFP + colonies drops from nearly 100% for pT7- Hin dIII- ccdB to 57% for pT7- Hin dIII-dead- ccdB . ( d ) Image of the mixture of GFP + and GFP − resulting from the assembly (100 µl outgrowth medium spread). The red arrow points at a cluster of GFP − colonies representing un-digested vector that would have to be screened for in a non-model assembly.

    Techniques Used: Purification, Plasmid Preparation, Sequencing, Clone Assay, Derivative Assay

    Related Articles

    Clone Assay:

    Article Title: Systematic Dissection of Sequence Elements Controlling σ70 Promoters Using a Genomically-Encoded Multiplexed Reporter Assay in E. coli
    Article Snippet: .. The digested library was ligated into pLibacceptorV2 using T7 DNA Ligase (NEB #M0318S), cloned into 5-alpha Electrocompetent E. coli (NEB #C2989K), and plated on LB + kanamycin (25 ug/mL) yielding approximately 1.1 million colonies estimated by plating concomitant dilution plates. ..

    Article Title: Dense sgRNA Library Construction Using a Molecular Chipper Approach
    Article Snippet: .. Pipette tips (prefer ones with filters to minimize contamination, such as those from Denville Scientific) Tubes (Denville Scientific, catalog number: C2170) Petri dishes (Corning, Falcon® , catalog number: 351029) NEB 5-alpha Electrocompetent E. coli (New England Biolabs, catalog number: C2989K) Retroviral vector pSUPER-CRISPR that contains and a puromycin selection marker and a U6 promoter to drive expression of sgRNA that is cloned at Bam HI- Hin dIII sites (for details, see ). .. T4 DNA ligase at 2000,000 U/ml (New England Biolabs, catalog number: M0202T).

    Article Title: A transcomplementing gene drive provides a flexible platform for laboratory investigation and potential field deployment
    Article Snippet: After assembly, plasmids were transformed into NEB 5-alpha Electrocompetent Competent E. coli (New England Biolabs, Cat. # C2989). .. Correct clones were subsequently confirmed by restriction analysis and Sanger sequencing.

    Article Title: A tiling1deletion based genetic screen for cis-regulatory element identification in mammalian cells
    Article Snippet: Paragraph title: Oligo synthesis and library cloning ... The end product was electro-transformed into 5-alpha Electrocompetent E. coli (NEB, Cat#C2989K) and grown on Agar plates.

    Article Title: A high-throughput mutational scan of an intrinsically disordered acidic transcriptional activation domain
    Article Snippet: We cloned the TF library similarly to previous work in our group ( ). .. Following electroporation into DH5a cells (NEB C2989K), we recovered ~54,000 colonies.

    Article Title: High-throughput creation and functional profiling of DNA sequence variant libraries using CRISPR/Cas9 in yeast
    Article Snippet: .. After PCR purification (Zymo Research), the amplicon is cloned into the BsmBI-containing library vector (XG128) using a standard Golden Gate protocol with BsmBI (NEB R0580S) and T4 ligase (NEB M0202S) then electroporated into 5-alpha Electrocompetent E.coli cells (NEB C2989). ..

    Article Title: Heterologous expression of cytotoxic sesquiterpenoids from the medicinal mushroom Lignosus rhinocerotis in yeast
    Article Snippet: Paragraph title: Gene cloning and plasmid construction ... Plasmid DNA was isolated from positive transformants using a Zymoprep™ Yeast Plasmid Miniprep II Kit (Zymo Research) and used to transform NEB 5-alpha Electrocompetent E. coli (New England Biolabs) by electroporation.

    Article Title: Genome-wide CRISPR Screens in T Helper Cells Reveal Pervasive Crosstalk between Activation and Differentiation
    Article Snippet: Paragraph title: Cloning ... 6 tubes of 5-alpha Electrocompetent E. coli (NEB #C2989K) were transformed using electroporation and the final library obtained by combining 4 maxipreps.

    Article Title: High-throughput creation and functional profiling of DNA sequence variant libraries using CRISPR/Cas9 in yeast
    Article Snippet: .. After PCR purification (Zymo Research), the amplicon is cloned into the BsmBI-containing library vector (XG128) using a standard Golden Gate protocol with BsmBI (NEB R0580S) and T4 ligase (NEB M0202S) then electroporated into 5-alpha Electrocompetent E.coli cells (NEB C2989). ..

    Article Title: Mutant APH(2?)-IIa Enzymes with Increased Activity against Amikacin and Isepamicin ▿
    Article Snippet: Purified DNA fragments were digested with the NdeI and HindIII restriction endonucleases, repurified with Wizard SV Gel and the PCR Clean-Up system, and cloned between the NdeI and HindIII sites of the pHF022 vector. .. Purified plasmid DNA of the pHF022 vector containing the mutagenized gene for APH(2″)-IIa was used to transform electrocompetent E. coli NEB 5-alpha cells (NEB catalog no. C2989K).

    Amplification:

    Article Title: Systematic Dissection of Sequence Elements Controlling σ70 Promoters Using a Genomically-Encoded Multiplexed Reporter Assay in E. coli
    Article Snippet: For barcoding, 1 ng of this eluate was amplified for 10 cycles using primers GU72 and GU73. .. The digested library was ligated into pLibacceptorV2 using T7 DNA Ligase (NEB #M0318S), cloned into 5-alpha Electrocompetent E. coli (NEB #C2989K), and plated on LB + kanamycin (25 ug/mL) yielding approximately 1.1 million colonies estimated by plating concomitant dilution plates.

    Article Title: Integration of growth factor gene delivery with collagen‐triggered wound repair cascades using collagen‐mimetic peptides
    Article Snippet: .. 2.1 Materials Type I bovine collagen was purchased from Advanced BioMatrix (San Diego, CA) and pCMV‐PDGF‐BB plasmid was purchased from Origene Technologies, Inc. (Rockville, MD). pDNA was amplified in NEB 5‐α electrocompetent E. coli purchased from New England Biolabs and purified from bacterial culture using a Qiagen Megaprep Kit (Valencia, CA), following the manufacturer's protocols. .. The Mouse/Rat PDGF‐BB Quantikine enzyme‐linked immunosorbent assay (ELISA) kit was purchased from R & D Systems (Minneapolis, MN).

    Article Title: A tiling1deletion based genetic screen for cis-regulatory element identification in mammalian cells
    Article Snippet: Oligo synthesis and library cloning The CREST-seq oligo library with sequences shown in was amplified with the following primers: Forward primer: CTTGTGGAAAGGACGAAAC Reverse primer: TTTTAACTTGCTATTTCTAGCTCTAAAAC The PCR product was size selected and gel-purified with NucleoSpin Gel and PCR Clean-Up Kit (Clontech, Cat# 740609), and then inserted into BsmbI digested lentiCRISPRv2 plasmid by Gilbson Assembly (Addgene plasmid #52961). .. The end product was electro-transformed into 5-alpha Electrocompetent E. coli (NEB, Cat#C2989K) and grown on Agar plates.

    Article Title: High-throughput creation and functional profiling of DNA sequence variant libraries using CRISPR/Cas9 in yeast
    Article Snippet: .. After PCR purification (Zymo Research), the amplicon is cloned into the BsmBI-containing library vector (XG128) using a standard Golden Gate protocol with BsmBI (NEB R0580S) and T4 ligase (NEB M0202S) then electroporated into 5-alpha Electrocompetent E.coli cells (NEB C2989). ..

    Article Title: Heterologous expression of cytotoxic sesquiterpenoids from the medicinal mushroom Lignosus rhinocerotis in yeast
    Article Snippet: Individual exons of the STS genes were amplified by PCR with 35–40 bp overhangs that overlap with neighbouring exons or plasmid backbone and stitched together to form the respective ‘intronless’ cDNA genes by yeast-mediated in vivo DNA recombination. .. Plasmid DNA was isolated from positive transformants using a Zymoprep™ Yeast Plasmid Miniprep II Kit (Zymo Research) and used to transform NEB 5-alpha Electrocompetent E. coli (New England Biolabs) by electroporation.

    Article Title: High-throughput creation and functional profiling of DNA sequence variant libraries using CRISPR/Cas9 in yeast
    Article Snippet: .. After PCR purification (Zymo Research), the amplicon is cloned into the BsmBI-containing library vector (XG128) using a standard Golden Gate protocol with BsmBI (NEB R0580S) and T4 ligase (NEB M0202S) then electroporated into 5-alpha Electrocompetent E.coli cells (NEB C2989). ..

    Article Title: ECM turnover-stimulated gene delivery through collagen-mimetic peptide-plasmid integration in collagen
    Article Snippet: .. DNA gel loading dye and Alexa Fluor 350 NHS ester were purchased from Thermo Fisher Scientific (Waltham, MA). pCMV-GLuc plasmid was purchased from New England Biolabs (Ipswich, MA) and pCMV-MetLuc-mem plasmid was purchased from Clontech (Mountain View, CA), and both plasmids were amplified in NEB 5-α electrocompetent E. coli purchased from New England Biolabs. .. The plasmids were purified from bacterial culture using a Qiagen Megaprep Kit (Valencia, CA), following the manufacturer's protocols.

    Article Title: Loss of a doublecortin (DCX)-domain protein causes structural defects in a tubulin-based organelle of Toxoplasma gondii and impairs host-cell invasion
    Article Snippet: Plasmid construction After construction, plasmids were used to transform chemically competent TOP10 cells by heat shock or electrocompetent DH5α cells (NEB C2989) by electroporation. .. YFP was swapped with EGFP via the Bgl II and Afl II restriction sites and a coding sequence of EGFP PCR amplified using primers S21 and AS21.

    Article Title: Mutant APH(2?)-IIa Enzymes with Increased Activity against Amikacin and Isepamicin ▿
    Article Snippet: Briefly, the gene for APH(2″)-IIa in the pHF022 vector was amplified by PCR using Mutazyme II DNA polymerase and two oligonucleotide primers, IIaPCR-D and IIaPCR-R (Table ). .. Purified plasmid DNA of the pHF022 vector containing the mutagenized gene for APH(2″)-IIa was used to transform electrocompetent E. coli NEB 5-alpha cells (NEB catalog no. C2989K).

    Polymerase Chain Reaction:

    Article Title: Systematic Dissection of Sequence Elements Controlling σ70 Promoters Using a Genomically-Encoded Multiplexed Reporter Assay in E. coli
    Article Snippet: The digested library was ligated into pLibacceptorV2 using T7 DNA Ligase (NEB #M0318S), cloned into 5-alpha Electrocompetent E. coli (NEB #C2989K), and plated on LB + kanamycin (25 ug/mL) yielding approximately 1.1 million colonies estimated by plating concomitant dilution plates. .. Unless stated otherwise, all plasmids were isolated using a Qiagen Plasmid Plus Maxiprep Kit (#12963) and concentrated using a Promega Wizard SV Gel and PCR Clean-up System (#A9281).

    Article Title: Dense sgRNA Library Construction Using a Molecular Chipper Approach
    Article Snippet: Pipette tips (prefer ones with filters to minimize contamination, such as those from Denville Scientific) Tubes (Denville Scientific, catalog number: C2170) Petri dishes (Corning, Falcon® , catalog number: 351029) NEB 5-alpha Electrocompetent E. coli (New England Biolabs, catalog number: C2989K) Retroviral vector pSUPER-CRISPR that contains and a puromycin selection marker and a U6 promoter to drive expression of sgRNA that is cloned at Bam HI- Hin dIII sites (for details, see ). .. Use in ligations where T4 DNA ligase is required in excess within a small volume, such as that described in step 2 T4 DNA ligase at 400,000 U/ml (New England Biolabs, catalog number: M0202S) T4 polynucleotide kinase (New England Biolabs, catalog number: M0201S) Distilled water (AmericanBio, catalog number: AB02123-00500) QIAquick PCR Purification Kit (QIAGEN, catalog number: 28104) Agarose (AmericanBio, catalog number: AB00972) Ethidium bromide, 10 mg/ml (Sigma-Aldrich, catalog number: E1510) 3 M sodium acetate, pH 5.2 100% ethanol (AmericanBio, catalog number: AB00515-00500) 70% ethanol (AmericanBio, catalog number: AB04010-00500) 1 kb plus DNA standard (Thermo Fisher Scientific, Invitrogen™, catalog number: 10787018) Agarose, low melting point (AmericanBio, catalog number: AB00981) 10 bp DNA standard (Thermo Fisher Scientific, Invitrogen™, catalog number: 10821015) NEBNext End Repair Module (New England Biolabs, catalog number: E6050S) 10,000× SYBR Safe DNA Gel Stain (Thermo Fisher Scientific, Invitrogen™, catalog number: ) QIAEX II Gel Extraction Kit (QIAGEN, catalog number: 20021) QIAquick Gel Extraction Kit (QIAGEN, catalog number: 28704) Eco P15I-adaptor oligonucleotide pair: sense aaaactcgag cagcag t ggatcc G and anti-sense /5phos/C ggatcc a ctgctg ctcgag (Integrated DNA Technologies; 25 nmole DNA oligo scale; Standard desalting purification).

    Article Title: A transcomplementing gene drive provides a flexible platform for laboratory investigation and potential field deployment
    Article Snippet: Tables listing the PCR template and a pair of oligos used to amplify each DNA fragment used to build plasmids generated in this work can be found in the “Supplementary Methods” section in the Supplementary Information file. .. After assembly, plasmids were transformed into NEB 5-alpha Electrocompetent Competent E. coli (New England Biolabs, Cat. # C2989).

    Article Title: A tiling1deletion based genetic screen for cis-regulatory element identification in mammalian cells
    Article Snippet: Oligo synthesis and library cloning The CREST-seq oligo library with sequences shown in was amplified with the following primers: Forward primer: CTTGTGGAAAGGACGAAAC Reverse primer: TTTTAACTTGCTATTTCTAGCTCTAAAAC The PCR product was size selected and gel-purified with NucleoSpin Gel and PCR Clean-Up Kit (Clontech, Cat# 740609), and then inserted into BsmbI digested lentiCRISPRv2 plasmid by Gilbson Assembly (Addgene plasmid #52961). .. The end product was electro-transformed into 5-alpha Electrocompetent E. coli (NEB, Cat#C2989K) and grown on Agar plates.

    Article Title: A high-throughput mutational scan of an intrinsically disordered acidic transcriptional activation domain
    Article Snippet: Specifically, we used 0.5 picomoles of template and 4 rounds of PCR in 8 parallel 50 ul reactions (NEB Phusion Tm=55C with 4% DMSO and the primers noted above), followed by PAGE on an 8% acrylamide gel. .. Following electroporation into DH5a cells (NEB C2989K), we recovered ~54,000 colonies.

    Article Title: High-throughput creation and functional profiling of DNA sequence variant libraries using CRISPR/Cas9 in yeast
    Article Snippet: .. After PCR purification (Zymo Research), the amplicon is cloned into the BsmBI-containing library vector (XG128) using a standard Golden Gate protocol with BsmBI (NEB R0580S) and T4 ligase (NEB M0202S) then electroporated into 5-alpha Electrocompetent E.coli cells (NEB C2989). ..

    Article Title: Heterologous expression of cytotoxic sesquiterpenoids from the medicinal mushroom Lignosus rhinocerotis in yeast
    Article Snippet: Yeast transformants grown on synthetic dropout agar plate lacking uracil were screened by PCR. .. Plasmid DNA was isolated from positive transformants using a Zymoprep™ Yeast Plasmid Miniprep II Kit (Zymo Research) and used to transform NEB 5-alpha Electrocompetent E. coli (New England Biolabs) by electroporation.

    Article Title: Genome-wide CRISPR Screens in T Helper Cells Reveal Pervasive Crosstalk between Activation and Differentiation
    Article Snippet: The insert was gel purified, and then repurified/concentrated using the MinElute PCR Purification Kit (QIAGEN #28006). .. 6 tubes of 5-alpha Electrocompetent E. coli (NEB #C2989K) were transformed using electroporation and the final library obtained by combining 4 maxipreps.

    Article Title: High-throughput creation and functional profiling of DNA sequence variant libraries using CRISPR/Cas9 in yeast
    Article Snippet: .. After PCR purification (Zymo Research), the amplicon is cloned into the BsmBI-containing library vector (XG128) using a standard Golden Gate protocol with BsmBI (NEB R0580S) and T4 ligase (NEB M0202S) then electroporated into 5-alpha Electrocompetent E.coli cells (NEB C2989). ..

    Article Title: Loss of a doublecortin (DCX)-domain protein causes structural defects in a tubulin-based organelle of Toxoplasma gondii and impairs host-cell invasion
    Article Snippet: Plasmid construction After construction, plasmids were used to transform chemically competent TOP10 cells by heat shock or electrocompetent DH5α cells (NEB C2989) by electroporation. .. Converting from ptub-H2b-YFP to ptub-TgDCX-EGFP entailed removing the H2b sequence between the Nhe I and Bgl II sites and replacing it with the coding region of TgDCX extending from the second methionine to the amino acid before the stop codon, obtained by reverse transcription PCR (RT-PCR) using T. gondii total RNA and primer pair S5/AS5.

    Article Title: Mutant APH(2?)-IIa Enzymes with Increased Activity against Amikacin and Isepamicin ▿
    Article Snippet: Paragraph title: Random PCR mutagenesis. ... Purified plasmid DNA of the pHF022 vector containing the mutagenized gene for APH(2″)-IIa was used to transform electrocompetent E. coli NEB 5-alpha cells (NEB catalog no. C2989K).

    Construct:

    Article Title: Systematic Dissection of Sequence Elements Controlling σ70 Promoters Using a Genomically-Encoded Multiplexed Reporter Assay in E. coli
    Article Snippet: The digested library was ligated into pLibacceptorV2 using T7 DNA Ligase (NEB #M0318S), cloned into 5-alpha Electrocompetent E. coli (NEB #C2989K), and plated on LB + kanamycin (25 ug/mL) yielding approximately 1.1 million colonies estimated by plating concomitant dilution plates. .. In order to clone the RiboJ::sfGFP reporter construct, the library was digested using NEB’s BsaI-HF and NheI-HF with the addition of rSAP.

    Article Title: A transcomplementing gene drive provides a flexible platform for laboratory investigation and potential field deployment
    Article Snippet: Constructs were built by Gibson assembly using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs, Cat. # E2621). .. After assembly, plasmids were transformed into NEB 5-alpha Electrocompetent Competent E. coli (New England Biolabs, Cat. # C2989).

    Article Title: Generation and analysis of a barcode-tagged insertion mutant library in the fission yeast Schizosaccharomyces pombe
    Article Snippet: Strains and media The E. coli electrocompetent cell NEB 5-alpha (Cat# C2989K, NEB) was used for the construction of the bacterial barcode-tagged insertion DNA library. .. The auxotrophic fission yeast wild type strain KRP1 [ ] (originally designated as CHP429 from C. Hoffman [ ]) was used to construct the fission yeast insertion mutant library.

    Enzyme-linked Immunosorbent Assay:

    Article Title: Integration of growth factor gene delivery with collagen‐triggered wound repair cascades using collagen‐mimetic peptides
    Article Snippet: 2.1 Materials Type I bovine collagen was purchased from Advanced BioMatrix (San Diego, CA) and pCMV‐PDGF‐BB plasmid was purchased from Origene Technologies, Inc. (Rockville, MD). pDNA was amplified in NEB 5‐α electrocompetent E. coli purchased from New England Biolabs and purified from bacterial culture using a Qiagen Megaprep Kit (Valencia, CA), following the manufacturer's protocols. .. The Mouse/Rat PDGF‐BB Quantikine enzyme‐linked immunosorbent assay (ELISA) kit was purchased from R & D Systems (Minneapolis, MN).

    Acrylamide Gel Assay:

    Article Title: A high-throughput mutational scan of an intrinsically disordered acidic transcriptional activation domain
    Article Snippet: Specifically, we used 0.5 picomoles of template and 4 rounds of PCR in 8 parallel 50 ul reactions (NEB Phusion Tm=55C with 4% DMSO and the primers noted above), followed by PAGE on an 8% acrylamide gel. .. Following electroporation into DH5a cells (NEB C2989K), we recovered ~54,000 colonies.

    Incubation:

    Article Title: Mutant APH(2?)-IIa Enzymes with Increased Activity against Amikacin and Isepamicin ▿
    Article Snippet: Purified plasmid DNA of the pHF022 vector containing the mutagenized gene for APH(2″)-IIa was used to transform electrocompetent E. coli NEB 5-alpha cells (NEB catalog no. C2989K). .. After overnight incubation in LB broth supplemented with 100 μg/ml of ampicillin (selection marker for the pHF022 vector), the bacterial culture was diluted 500-fold into fresh LB broth supplemented with amikacin or isepamicin at various concentrations.

    Expressing:

    Article Title: Dense sgRNA Library Construction Using a Molecular Chipper Approach
    Article Snippet: .. Pipette tips (prefer ones with filters to minimize contamination, such as those from Denville Scientific) Tubes (Denville Scientific, catalog number: C2170) Petri dishes (Corning, Falcon® , catalog number: 351029) NEB 5-alpha Electrocompetent E. coli (New England Biolabs, catalog number: C2989K) Retroviral vector pSUPER-CRISPR that contains and a puromycin selection marker and a U6 promoter to drive expression of sgRNA that is cloned at Bam HI- Hin dIII sites (for details, see ). .. T4 DNA ligase at 2000,000 U/ml (New England Biolabs, catalog number: M0202T).

    Modification:

    Article Title: Dense sgRNA Library Construction Using a Molecular Chipper Approach
    Article Snippet: Pipette tips (prefer ones with filters to minimize contamination, such as those from Denville Scientific) Tubes (Denville Scientific, catalog number: C2170) Petri dishes (Corning, Falcon® , catalog number: 351029) NEB 5-alpha Electrocompetent E. coli (New England Biolabs, catalog number: C2989K) Retroviral vector pSUPER-CRISPR that contains and a puromycin selection marker and a U6 promoter to drive expression of sgRNA that is cloned at Bam HI- Hin dIII sites (for details, see ). .. The anti-sense oligo has a 5′-phosphase modification 100 bp DNA standard (New England Biolabs, catalog number: N3231S) Eco P15I enzyme (New England Biolabs, catalog number: R0646L) PCI: Phenol:Chloroform:Isoamyl Alcohol 25:24:1, saturated with TE (10 mM Tris, pH 8.0, 1 mM EDTA) (Sigma-Aldrich, catalog number: P2069-100ML) Phenol, saturated with Tris, pH 7.5 (Thermo Fisher Scientific, Thermo Scientific™, catalog number: 17914) Chloroform (AmericanBio, catalog number: AB00350-00500) PCI (Phenol:chloroform:isoamyl alcohol 25:24:1), Tris saturated (Roche Diagnostics, catalog number: 03117944001) 3′ sgRNA backbone adaptor oligo nucleotide pair: sense /5phos/nngttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttttaagctttat and anti-sense ataaagcttaaaaaaagcaccgactcggtgccactttttcaagttgataacggactagccttattttaacttgctatttctagctctaaaac (Integrated DNA Technologies, 100 nmole DNA oligo scale, Standard desalting purification).

    Article Title: High-throughput creation and functional profiling of DNA sequence variant libraries using CRISPR/Cas9 in yeast
    Article Snippet: Primers used for oligo library amplification were further modified to contain the necessary overlaps to enable the library to be inserted into our vector backbone via Golden Gate cloning. .. After PCR purification (Zymo Research), the amplicon is cloned into the BsmBI-containing library vector (XG128) using a standard Golden Gate protocol with BsmBI (NEB R0580S) and T4 ligase (NEB M0202S) then electroporated into 5-alpha Electrocompetent E.coli cells (NEB C2989).

    Article Title: High-throughput creation and functional profiling of DNA sequence variant libraries using CRISPR/Cas9 in yeast
    Article Snippet: Primers used for oligo library amplification were further modified to contain the necessary overlaps to enable the library to be inserted into our vector backbone via Golden Gate cloning. .. After PCR purification (Zymo Research), the amplicon is cloned into the BsmBI-containing library vector (XG128) using a standard Golden Gate protocol with BsmBI (NEB R0580S) and T4 ligase (NEB M0202S) then electroporated into 5-alpha Electrocompetent E.coli cells (NEB C2989).

    Article Title: ECM turnover-stimulated gene delivery through collagen-mimetic peptide-plasmid integration in collagen
    Article Snippet: High performance liquid chromatography (HPLC)-grade N,N-dimethyl formamide (DMF), acetonitrile, trifluoroacetic acid (TFA), Lipofectamine® RNAiMAX Reagent, and cell culture reagents, including Dulbecco's modified Eagle's medium (DMEM), Opti-MEM® I Reduced Serum Media (Opti-MEM), Dulbecco's phosphate buffered saline (PBS), and trypsin were purchased from Fisher Scientific (Fairlawn, NJ). .. DNA gel loading dye and Alexa Fluor 350 NHS ester were purchased from Thermo Fisher Scientific (Waltham, MA). pCMV-GLuc plasmid was purchased from New England Biolabs (Ipswich, MA) and pCMV-MetLuc-mem plasmid was purchased from Clontech (Mountain View, CA), and both plasmids were amplified in NEB 5-α electrocompetent E. coli purchased from New England Biolabs.

    Transformation Assay:

    Article Title: A transcomplementing gene drive provides a flexible platform for laboratory investigation and potential field deployment
    Article Snippet: .. After assembly, plasmids were transformed into NEB 5-alpha Electrocompetent Competent E. coli (New England Biolabs, Cat. # C2989). .. Correct clones were subsequently confirmed by restriction analysis and Sanger sequencing.

    Article Title: Heterologous expression of cytotoxic sesquiterpenoids from the medicinal mushroom Lignosus rhinocerotis in yeast
    Article Snippet: In vivo yeast recombination cloning was carried out using a Frozen-EZ Yeast Transformation II Kit™ (Zymo Research) where competent S. cerevisiae BJ5464 [ ] was transformed with the DNA fragments (PCR products) of the respective genes and linearized plasmid backbone derived from YEplac-ADH2p [ , ]. .. Plasmid DNA was isolated from positive transformants using a Zymoprep™ Yeast Plasmid Miniprep II Kit (Zymo Research) and used to transform NEB 5-alpha Electrocompetent E. coli (New England Biolabs) by electroporation.

    Article Title: Genome-wide CRISPR Screens in T Helper Cells Reveal Pervasive Crosstalk between Activation and Differentiation
    Article Snippet: .. 6 tubes of 5-alpha Electrocompetent E. coli (NEB #C2989K) were transformed using electroporation and the final library obtained by combining 4 maxipreps. ..

    Derivative Assay:

    Article Title: Heterologous expression of cytotoxic sesquiterpenoids from the medicinal mushroom Lignosus rhinocerotis in yeast
    Article Snippet: In vivo yeast recombination cloning was carried out using a Frozen-EZ Yeast Transformation II Kit™ (Zymo Research) where competent S. cerevisiae BJ5464 [ ] was transformed with the DNA fragments (PCR products) of the respective genes and linearized plasmid backbone derived from YEplac-ADH2p [ , ]. .. Plasmid DNA was isolated from positive transformants using a Zymoprep™ Yeast Plasmid Miniprep II Kit (Zymo Research) and used to transform NEB 5-alpha Electrocompetent E. coli (New England Biolabs) by electroporation.

    Article Title: Genome-wide CRISPR Screens in T Helper Cells Reveal Pervasive Crosstalk between Activation and Differentiation
    Article Snippet: 6 tubes of 5-alpha Electrocompetent E. coli (NEB #C2989K) were transformed using electroporation and the final library obtained by combining 4 maxipreps. .. Two Cas9 control viruses were also derived from pKLV2(W-)U6sgRNA5(BbsI)-PGKpuroBFP and pKLV2(gfp)U6sgRNA5(BbsI)-PGKpuroBFP.

    High Performance Liquid Chromatography:

    Article Title: ECM turnover-stimulated gene delivery through collagen-mimetic peptide-plasmid integration in collagen
    Article Snippet: High performance liquid chromatography (HPLC)-grade N,N-dimethyl formamide (DMF), acetonitrile, trifluoroacetic acid (TFA), Lipofectamine® RNAiMAX Reagent, and cell culture reagents, including Dulbecco's modified Eagle's medium (DMEM), Opti-MEM® I Reduced Serum Media (Opti-MEM), Dulbecco's phosphate buffered saline (PBS), and trypsin were purchased from Fisher Scientific (Fairlawn, NJ). .. DNA gel loading dye and Alexa Fluor 350 NHS ester were purchased from Thermo Fisher Scientific (Waltham, MA). pCMV-GLuc plasmid was purchased from New England Biolabs (Ipswich, MA) and pCMV-MetLuc-mem plasmid was purchased from Clontech (Mountain View, CA), and both plasmids were amplified in NEB 5-α electrocompetent E. coli purchased from New England Biolabs.

    Electroporation:

    Article Title: A high-throughput mutational scan of an intrinsically disordered acidic transcriptional activation domain
    Article Snippet: .. Following electroporation into DH5a cells (NEB C2989K), we recovered ~54,000 colonies. .. To ensure only one construct per cell, we integrated our library at the URA3 locus of FY4.

    Article Title: Heterologous expression of cytotoxic sesquiterpenoids from the medicinal mushroom Lignosus rhinocerotis in yeast
    Article Snippet: .. Plasmid DNA was isolated from positive transformants using a Zymoprep™ Yeast Plasmid Miniprep II Kit (Zymo Research) and used to transform NEB 5-alpha Electrocompetent E. coli (New England Biolabs) by electroporation. .. Plasmid DNA was isolated from the positive clones grown on LB-ampicillin using the alkaline lysis method and further verified by DNA sequencing.

    Article Title: Genome-wide CRISPR Screens in T Helper Cells Reveal Pervasive Crosstalk between Activation and Differentiation
    Article Snippet: .. 6 tubes of 5-alpha Electrocompetent E. coli (NEB #C2989K) were transformed using electroporation and the final library obtained by combining 4 maxipreps. ..

    Article Title: Loss of a doublecortin (DCX)-domain protein causes structural defects in a tubulin-based organelle of Toxoplasma gondii and impairs host-cell invasion
    Article Snippet: .. Plasmid construction After construction, plasmids were used to transform chemically competent TOP10 cells by heat shock or electrocompetent DH5α cells (NEB C2989) by electroporation. .. Plasmid DNA was isolated by standard procedures, and the constructions were verified by DNA sequencing. ptub-TgDCX-EGFP is a derivative of the plasmid ptub-H2b–yellow fluorescent protein (YFP; ).

    Activation Assay:

    Article Title: A high-throughput mutational scan of an intrinsically disordered acidic transcriptional activation domain
    Article Snippet: The activation domain variants were inserted into NheI and AscI sites of the TF chassis plasmid (pMVS142). .. Following electroporation into DH5a cells (NEB C2989K), we recovered ~54,000 colonies.

    Transferring:

    Article Title: Dense sgRNA Library Construction Using a Molecular Chipper Approach
    Article Snippet: .. Pipette tips (prefer ones with filters to minimize contamination, such as those from Denville Scientific) Tubes (Denville Scientific, catalog number: C2170) Petri dishes (Corning, Falcon® , catalog number: 351029) NEB 5-alpha Electrocompetent E. coli (New England Biolabs, catalog number: C2989K) Retroviral vector pSUPER-CRISPR that contains and a puromycin selection marker and a U6 promoter to drive expression of sgRNA that is cloned at Bam HI- Hin dIII sites (for details, see ). .. T4 DNA ligase at 2000,000 U/ml (New England Biolabs, catalog number: M0202T).

    Cell Culture:

    Article Title: ECM turnover-stimulated gene delivery through collagen-mimetic peptide-plasmid integration in collagen
    Article Snippet: High performance liquid chromatography (HPLC)-grade N,N-dimethyl formamide (DMF), acetonitrile, trifluoroacetic acid (TFA), Lipofectamine® RNAiMAX Reagent, and cell culture reagents, including Dulbecco's modified Eagle's medium (DMEM), Opti-MEM® I Reduced Serum Media (Opti-MEM), Dulbecco's phosphate buffered saline (PBS), and trypsin were purchased from Fisher Scientific (Fairlawn, NJ). .. DNA gel loading dye and Alexa Fluor 350 NHS ester were purchased from Thermo Fisher Scientific (Waltham, MA). pCMV-GLuc plasmid was purchased from New England Biolabs (Ipswich, MA) and pCMV-MetLuc-mem plasmid was purchased from Clontech (Mountain View, CA), and both plasmids were amplified in NEB 5-α electrocompetent E. coli purchased from New England Biolabs.

    Generated:

    Article Title: A transcomplementing gene drive provides a flexible platform for laboratory investigation and potential field deployment
    Article Snippet: Tables listing the PCR template and a pair of oligos used to amplify each DNA fragment used to build plasmids generated in this work can be found in the “Supplementary Methods” section in the Supplementary Information file. .. After assembly, plasmids were transformed into NEB 5-alpha Electrocompetent Competent E. coli (New England Biolabs, Cat. # C2989).

    Article Title: Mutant APH(2?)-IIa Enzymes with Increased Activity against Amikacin and Isepamicin ▿
    Article Snippet: Following this, the PCR products in the three tubes were combined and fragments generated by PCR were separated on a 1% agarose gel and purified with Wizard SV Gel and the PCR Clean-Up system (Promega). .. Purified plasmid DNA of the pHF022 vector containing the mutagenized gene for APH(2″)-IIa was used to transform electrocompetent E. coli NEB 5-alpha cells (NEB catalog no. C2989K).

    DNA Sequencing:

    Article Title: Heterologous expression of cytotoxic sesquiterpenoids from the medicinal mushroom Lignosus rhinocerotis in yeast
    Article Snippet: Plasmid DNA was isolated from positive transformants using a Zymoprep™ Yeast Plasmid Miniprep II Kit (Zymo Research) and used to transform NEB 5-alpha Electrocompetent E. coli (New England Biolabs) by electroporation. .. Plasmid DNA was isolated from the positive clones grown on LB-ampicillin using the alkaline lysis method and further verified by DNA sequencing.

    Article Title: Loss of a doublecortin (DCX)-domain protein causes structural defects in a tubulin-based organelle of Toxoplasma gondii and impairs host-cell invasion
    Article Snippet: Plasmid construction After construction, plasmids were used to transform chemically competent TOP10 cells by heat shock or electrocompetent DH5α cells (NEB C2989) by electroporation. .. Plasmid DNA was isolated by standard procedures, and the constructions were verified by DNA sequencing. ptub-TgDCX-EGFP is a derivative of the plasmid ptub-H2b–yellow fluorescent protein (YFP; ).

    Sequencing:

    Article Title: A transcomplementing gene drive provides a flexible platform for laboratory investigation and potential field deployment
    Article Snippet: After assembly, plasmids were transformed into NEB 5-alpha Electrocompetent Competent E. coli (New England Biolabs, Cat. # C2989). .. Correct clones were subsequently confirmed by restriction analysis and Sanger sequencing.

    Article Title: A tiling1deletion based genetic screen for cis-regulatory element identification in mammalian cells
    Article Snippet: The end product was electro-transformed into 5-alpha Electrocompetent E. coli (NEB, Cat#C2989K) and grown on Agar plates. .. The resulting plasmid DNA was linearized by BsmbI digestion, gel purified and ligated with a DNA fragment (see complete IDT gBlocks sequence in ) containing tracRNA(E/F) and the mouse U6 promoter (mU6).

    Article Title: Loss of a doublecortin (DCX)-domain protein causes structural defects in a tubulin-based organelle of Toxoplasma gondii and impairs host-cell invasion
    Article Snippet: Plasmid construction After construction, plasmids were used to transform chemically competent TOP10 cells by heat shock or electrocompetent DH5α cells (NEB C2989) by electroporation. .. Converting from ptub-H2b-YFP to ptub-TgDCX-EGFP entailed removing the H2b sequence between the Nhe I and Bgl II sites and replacing it with the coding region of TgDCX extending from the second methionine to the amino acid before the stop codon, obtained by reverse transcription PCR (RT-PCR) using T. gondii total RNA and primer pair S5/AS5.

    In Vivo:

    Article Title: Heterologous expression of cytotoxic sesquiterpenoids from the medicinal mushroom Lignosus rhinocerotis in yeast
    Article Snippet: In vivo yeast recombination cloning was carried out using a Frozen-EZ Yeast Transformation II Kit™ (Zymo Research) where competent S. cerevisiae BJ5464 [ ] was transformed with the DNA fragments (PCR products) of the respective genes and linearized plasmid backbone derived from YEplac-ADH2p [ , ]. .. Plasmid DNA was isolated from positive transformants using a Zymoprep™ Yeast Plasmid Miniprep II Kit (Zymo Research) and used to transform NEB 5-alpha Electrocompetent E. coli (New England Biolabs) by electroporation.

    Mutagenesis:

    Article Title: Generation and analysis of a barcode-tagged insertion mutant library in the fission yeast Schizosaccharomyces pombe
    Article Snippet: Strains and media The E. coli electrocompetent cell NEB 5-alpha (Cat# C2989K, NEB) was used for the construction of the bacterial barcode-tagged insertion DNA library. .. The auxotrophic fission yeast wild type strain KRP1 [ ] (originally designated as CHP429 from C. Hoffman [ ]) was used to construct the fission yeast insertion mutant library.

    Article Title: Mutant APH(2?)-IIa Enzymes with Increased Activity against Amikacin and Isepamicin ▿
    Article Snippet: Paragraph title: Random PCR mutagenesis. ... Purified plasmid DNA of the pHF022 vector containing the mutagenized gene for APH(2″)-IIa was used to transform electrocompetent E. coli NEB 5-alpha cells (NEB catalog no. C2989K).

    Isolation:

    Article Title: Systematic Dissection of Sequence Elements Controlling σ70 Promoters Using a Genomically-Encoded Multiplexed Reporter Assay in E. coli
    Article Snippet: The digested library was ligated into pLibacceptorV2 using T7 DNA Ligase (NEB #M0318S), cloned into 5-alpha Electrocompetent E. coli (NEB #C2989K), and plated on LB + kanamycin (25 ug/mL) yielding approximately 1.1 million colonies estimated by plating concomitant dilution plates. .. Unless stated otherwise, all plasmids were isolated using a Qiagen Plasmid Plus Maxiprep Kit (#12963) and concentrated using a Promega Wizard SV Gel and PCR Clean-up System (#A9281).

    Article Title: Heterologous expression of cytotoxic sesquiterpenoids from the medicinal mushroom Lignosus rhinocerotis in yeast
    Article Snippet: .. Plasmid DNA was isolated from positive transformants using a Zymoprep™ Yeast Plasmid Miniprep II Kit (Zymo Research) and used to transform NEB 5-alpha Electrocompetent E. coli (New England Biolabs) by electroporation. .. Plasmid DNA was isolated from the positive clones grown on LB-ampicillin using the alkaline lysis method and further verified by DNA sequencing.

    Article Title: Loss of a doublecortin (DCX)-domain protein causes structural defects in a tubulin-based organelle of Toxoplasma gondii and impairs host-cell invasion
    Article Snippet: Plasmid construction After construction, plasmids were used to transform chemically competent TOP10 cells by heat shock or electrocompetent DH5α cells (NEB C2989) by electroporation. .. Plasmid DNA was isolated by standard procedures, and the constructions were verified by DNA sequencing. ptub-TgDCX-EGFP is a derivative of the plasmid ptub-H2b–yellow fluorescent protein (YFP; ).

    Article Title: Mutant APH(2?)-IIa Enzymes with Increased Activity against Amikacin and Isepamicin ▿
    Article Snippet: Purified plasmid DNA of the pHF022 vector containing the mutagenized gene for APH(2″)-IIa was used to transform electrocompetent E. coli NEB 5-alpha cells (NEB catalog no. C2989K). .. Bacteria were incubated overnight at 37°C, and plasmid DNA was isolated from bacterial cultures that had grown at the highest concentration of each antibiotic.

    Purification:

    Article Title: Integration of growth factor gene delivery with collagen‐triggered wound repair cascades using collagen‐mimetic peptides
    Article Snippet: .. 2.1 Materials Type I bovine collagen was purchased from Advanced BioMatrix (San Diego, CA) and pCMV‐PDGF‐BB plasmid was purchased from Origene Technologies, Inc. (Rockville, MD). pDNA was amplified in NEB 5‐α electrocompetent E. coli purchased from New England Biolabs and purified from bacterial culture using a Qiagen Megaprep Kit (Valencia, CA), following the manufacturer's protocols. .. The Mouse/Rat PDGF‐BB Quantikine enzyme‐linked immunosorbent assay (ELISA) kit was purchased from R & D Systems (Minneapolis, MN).

    Article Title: Dense sgRNA Library Construction Using a Molecular Chipper Approach
    Article Snippet: Pipette tips (prefer ones with filters to minimize contamination, such as those from Denville Scientific) Tubes (Denville Scientific, catalog number: C2170) Petri dishes (Corning, Falcon® , catalog number: 351029) NEB 5-alpha Electrocompetent E. coli (New England Biolabs, catalog number: C2989K) Retroviral vector pSUPER-CRISPR that contains and a puromycin selection marker and a U6 promoter to drive expression of sgRNA that is cloned at Bam HI- Hin dIII sites (for details, see ). .. Use in ligations where T4 DNA ligase is required in excess within a small volume, such as that described in step 2 T4 DNA ligase at 400,000 U/ml (New England Biolabs, catalog number: M0202S) T4 polynucleotide kinase (New England Biolabs, catalog number: M0201S) Distilled water (AmericanBio, catalog number: AB02123-00500) QIAquick PCR Purification Kit (QIAGEN, catalog number: 28104) Agarose (AmericanBio, catalog number: AB00972) Ethidium bromide, 10 mg/ml (Sigma-Aldrich, catalog number: E1510) 3 M sodium acetate, pH 5.2 100% ethanol (AmericanBio, catalog number: AB00515-00500) 70% ethanol (AmericanBio, catalog number: AB04010-00500) 1 kb plus DNA standard (Thermo Fisher Scientific, Invitrogen™, catalog number: 10787018) Agarose, low melting point (AmericanBio, catalog number: AB00981) 10 bp DNA standard (Thermo Fisher Scientific, Invitrogen™, catalog number: 10821015) NEBNext End Repair Module (New England Biolabs, catalog number: E6050S) 10,000× SYBR Safe DNA Gel Stain (Thermo Fisher Scientific, Invitrogen™, catalog number: ) QIAEX II Gel Extraction Kit (QIAGEN, catalog number: 20021) QIAquick Gel Extraction Kit (QIAGEN, catalog number: 28704) Eco P15I-adaptor oligonucleotide pair: sense aaaactcgag cagcag t ggatcc G and anti-sense /5phos/C ggatcc a ctgctg ctcgag (Integrated DNA Technologies; 25 nmole DNA oligo scale; Standard desalting purification).

    Article Title: A tiling1deletion based genetic screen for cis-regulatory element identification in mammalian cells
    Article Snippet: The end product was electro-transformed into 5-alpha Electrocompetent E. coli (NEB, Cat#C2989K) and grown on Agar plates. .. The resulting plasmid DNA was linearized by BsmbI digestion, gel purified and ligated with a DNA fragment (see complete IDT gBlocks sequence in ) containing tracRNA(E/F) and the mouse U6 promoter (mU6).

    Article Title: A high-throughput mutational scan of an intrinsically disordered acidic transcriptional activation domain
    Article Snippet: DNA was extracted from the acrylamide with dialysis cartridges (Thermo #87717) and purified by ethanol precipitation. .. Following electroporation into DH5a cells (NEB C2989K), we recovered ~54,000 colonies.

    Article Title: High-throughput creation and functional profiling of DNA sequence variant libraries using CRISPR/Cas9 in yeast
    Article Snippet: .. After PCR purification (Zymo Research), the amplicon is cloned into the BsmBI-containing library vector (XG128) using a standard Golden Gate protocol with BsmBI (NEB R0580S) and T4 ligase (NEB M0202S) then electroporated into 5-alpha Electrocompetent E.coli cells (NEB C2989). ..

    Article Title: An engineered high affinity Fbs1 carbohydrate binding protein for selective capture of N-glycans and N-glycopeptides
    Article Snippet: .. The purified plasmid DNA was electroporated into NEB 5-alpha electrocompetent E. coli cells (NEB) for the next cycle of selection. .. Preparation of tryptic peptides from human serum HSA-depleted or IgG-depleted human serum was prepared by incubating human serum with Affi-Gel Blue beads (Bio-Rad) or Protein A beads (Thermo Fisher Scientific) according to the manufacturer's protocols, respectively.

    Article Title: Genome-wide CRISPR Screens in T Helper Cells Reveal Pervasive Crosstalk between Activation and Differentiation
    Article Snippet: The insert was gel purified, and then repurified/concentrated using the MinElute PCR Purification Kit (QIAGEN #28006). .. 6 tubes of 5-alpha Electrocompetent E. coli (NEB #C2989K) were transformed using electroporation and the final library obtained by combining 4 maxipreps.

    Article Title: High-throughput creation and functional profiling of DNA sequence variant libraries using CRISPR/Cas9 in yeast
    Article Snippet: .. After PCR purification (Zymo Research), the amplicon is cloned into the BsmBI-containing library vector (XG128) using a standard Golden Gate protocol with BsmBI (NEB R0580S) and T4 ligase (NEB M0202S) then electroporated into 5-alpha Electrocompetent E.coli cells (NEB C2989). ..

    Article Title: ECM turnover-stimulated gene delivery through collagen-mimetic peptide-plasmid integration in collagen
    Article Snippet: DNA gel loading dye and Alexa Fluor 350 NHS ester were purchased from Thermo Fisher Scientific (Waltham, MA). pCMV-GLuc plasmid was purchased from New England Biolabs (Ipswich, MA) and pCMV-MetLuc-mem plasmid was purchased from Clontech (Mountain View, CA), and both plasmids were amplified in NEB 5-α electrocompetent E. coli purchased from New England Biolabs. .. The plasmids were purified from bacterial culture using a Qiagen Megaprep Kit (Valencia, CA), following the manufacturer's protocols.

    Article Title: Mutant APH(2?)-IIa Enzymes with Increased Activity against Amikacin and Isepamicin ▿
    Article Snippet: .. Purified plasmid DNA of the pHF022 vector containing the mutagenized gene for APH(2″)-IIa was used to transform electrocompetent E. coli NEB 5-alpha cells (NEB catalog no. C2989K). .. After overnight incubation in LB broth supplemented with 100 μg/ml of ampicillin (selection marker for the pHF022 vector), the bacterial culture was diluted 500-fold into fresh LB broth supplemented with amikacin or isepamicin at various concentrations.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Loss of a doublecortin (DCX)-domain protein causes structural defects in a tubulin-based organelle of Toxoplasma gondii and impairs host-cell invasion
    Article Snippet: Plasmid construction After construction, plasmids were used to transform chemically competent TOP10 cells by heat shock or electrocompetent DH5α cells (NEB C2989) by electroporation. .. Converting from ptub-H2b-YFP to ptub-TgDCX-EGFP entailed removing the H2b sequence between the Nhe I and Bgl II sites and replacing it with the coding region of TgDCX extending from the second methionine to the amino acid before the stop codon, obtained by reverse transcription PCR (RT-PCR) using T. gondii total RNA and primer pair S5/AS5.

    Polyacrylamide Gel Electrophoresis:

    Article Title: A high-throughput mutational scan of an intrinsically disordered acidic transcriptional activation domain
    Article Snippet: Specifically, we used 0.5 picomoles of template and 4 rounds of PCR in 8 parallel 50 ul reactions (NEB Phusion Tm=55C with 4% DMSO and the primers noted above), followed by PAGE on an 8% acrylamide gel. .. Following electroporation into DH5a cells (NEB C2989K), we recovered ~54,000 colonies.

    Gel Extraction:

    Article Title: Dense sgRNA Library Construction Using a Molecular Chipper Approach
    Article Snippet: Pipette tips (prefer ones with filters to minimize contamination, such as those from Denville Scientific) Tubes (Denville Scientific, catalog number: C2170) Petri dishes (Corning, Falcon® , catalog number: 351029) NEB 5-alpha Electrocompetent E. coli (New England Biolabs, catalog number: C2989K) Retroviral vector pSUPER-CRISPR that contains and a puromycin selection marker and a U6 promoter to drive expression of sgRNA that is cloned at Bam HI- Hin dIII sites (for details, see ). .. Use in ligations where T4 DNA ligase is required in excess within a small volume, such as that described in step 2 T4 DNA ligase at 400,000 U/ml (New England Biolabs, catalog number: M0202S) T4 polynucleotide kinase (New England Biolabs, catalog number: M0201S) Distilled water (AmericanBio, catalog number: AB02123-00500) QIAquick PCR Purification Kit (QIAGEN, catalog number: 28104) Agarose (AmericanBio, catalog number: AB00972) Ethidium bromide, 10 mg/ml (Sigma-Aldrich, catalog number: E1510) 3 M sodium acetate, pH 5.2 100% ethanol (AmericanBio, catalog number: AB00515-00500) 70% ethanol (AmericanBio, catalog number: AB04010-00500) 1 kb plus DNA standard (Thermo Fisher Scientific, Invitrogen™, catalog number: 10787018) Agarose, low melting point (AmericanBio, catalog number: AB00981) 10 bp DNA standard (Thermo Fisher Scientific, Invitrogen™, catalog number: 10821015) NEBNext End Repair Module (New England Biolabs, catalog number: E6050S) 10,000× SYBR Safe DNA Gel Stain (Thermo Fisher Scientific, Invitrogen™, catalog number: ) QIAEX II Gel Extraction Kit (QIAGEN, catalog number: 20021) QIAquick Gel Extraction Kit (QIAGEN, catalog number: 28704) Eco P15I-adaptor oligonucleotide pair: sense aaaactcgag cagcag t ggatcc G and anti-sense /5phos/C ggatcc a ctgctg ctcgag (Integrated DNA Technologies; 25 nmole DNA oligo scale; Standard desalting purification).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: A tiling1deletion based genetic screen for cis-regulatory element identification in mammalian cells
    Article Snippet: .. The end product was electro-transformed into 5-alpha Electrocompetent E. coli (NEB, CatC2989K) and grown on Agar plates. .. About 20 million independent bacterial colonies were collected and the plasmids were extracted with QIAGEN Plasmid Giga Kit (Cat#12191).

    Oligo Synthesis:

    Article Title: A tiling1deletion based genetic screen for cis-regulatory element identification in mammalian cells
    Article Snippet: Paragraph title: Oligo synthesis and library cloning ... The end product was electro-transformed into 5-alpha Electrocompetent E. coli (NEB, Cat#C2989K) and grown on Agar plates.

    Plasmid Preparation:

    Article Title: Systematic Dissection of Sequence Elements Controlling σ70 Promoters Using a Genomically-Encoded Multiplexed Reporter Assay in E. coli
    Article Snippet: The plasmid backbone, pLibacceptorV2 was digested using SbfI-HF and SalI-HF with the addition of rSAP (NEB #M0371S). .. The digested library was ligated into pLibacceptorV2 using T7 DNA Ligase (NEB #M0318S), cloned into 5-alpha Electrocompetent E. coli (NEB #C2989K), and plated on LB + kanamycin (25 ug/mL) yielding approximately 1.1 million colonies estimated by plating concomitant dilution plates.

    Article Title: Integration of growth factor gene delivery with collagen‐triggered wound repair cascades using collagen‐mimetic peptides
    Article Snippet: .. 2.1 Materials Type I bovine collagen was purchased from Advanced BioMatrix (San Diego, CA) and pCMV‐PDGF‐BB plasmid was purchased from Origene Technologies, Inc. (Rockville, MD). pDNA was amplified in NEB 5‐α electrocompetent E. coli purchased from New England Biolabs and purified from bacterial culture using a Qiagen Megaprep Kit (Valencia, CA), following the manufacturer's protocols. .. The Mouse/Rat PDGF‐BB Quantikine enzyme‐linked immunosorbent assay (ELISA) kit was purchased from R & D Systems (Minneapolis, MN).

    Article Title: Dense sgRNA Library Construction Using a Molecular Chipper Approach
    Article Snippet: .. Pipette tips (prefer ones with filters to minimize contamination, such as those from Denville Scientific) Tubes (Denville Scientific, catalog number: C2170) Petri dishes (Corning, Falcon® , catalog number: 351029) NEB 5-alpha Electrocompetent E. coli (New England Biolabs, catalog number: C2989K) Retroviral vector pSUPER-CRISPR that contains and a puromycin selection marker and a U6 promoter to drive expression of sgRNA that is cloned at Bam HI- Hin dIII sites (for details, see ). .. T4 DNA ligase at 2000,000 U/ml (New England Biolabs, catalog number: M0202T).

    Article Title: A transcomplementing gene drive provides a flexible platform for laboratory investigation and potential field deployment
    Article Snippet: Paragraph title: Plasmid construction ... After assembly, plasmids were transformed into NEB 5-alpha Electrocompetent Competent E. coli (New England Biolabs, Cat. # C2989).

    Article Title: A tiling1deletion based genetic screen for cis-regulatory element identification in mammalian cells
    Article Snippet: Oligo synthesis and library cloning The CREST-seq oligo library with sequences shown in was amplified with the following primers: Forward primer: CTTGTGGAAAGGACGAAAC Reverse primer: TTTTAACTTGCTATTTCTAGCTCTAAAAC The PCR product was size selected and gel-purified with NucleoSpin Gel and PCR Clean-Up Kit (Clontech, Cat# 740609), and then inserted into BsmbI digested lentiCRISPRv2 plasmid by Gilbson Assembly (Addgene plasmid #52961). .. The end product was electro-transformed into 5-alpha Electrocompetent E. coli (NEB, Cat#C2989K) and grown on Agar plates.

    Article Title: A high-throughput mutational scan of an intrinsically disordered acidic transcriptional activation domain
    Article Snippet: Paragraph title: Plasmid Library construction ... Following electroporation into DH5a cells (NEB C2989K), we recovered ~54,000 colonies.

    Article Title: High-throughput creation and functional profiling of DNA sequence variant libraries using CRISPR/Cas9 in yeast
    Article Snippet: .. After PCR purification (Zymo Research), the amplicon is cloned into the BsmBI-containing library vector (XG128) using a standard Golden Gate protocol with BsmBI (NEB R0580S) and T4 ligase (NEB M0202S) then electroporated into 5-alpha Electrocompetent E.coli cells (NEB C2989). ..

    Article Title: An engineered high affinity Fbs1 carbohydrate binding protein for selective capture of N-glycans and N-glycopeptides
    Article Snippet: .. The purified plasmid DNA was electroporated into NEB 5-alpha electrocompetent E. coli cells (NEB) for the next cycle of selection. .. Preparation of tryptic peptides from human serum HSA-depleted or IgG-depleted human serum was prepared by incubating human serum with Affi-Gel Blue beads (Bio-Rad) or Protein A beads (Thermo Fisher Scientific) according to the manufacturer's protocols, respectively.

    Article Title: Heterologous expression of cytotoxic sesquiterpenoids from the medicinal mushroom Lignosus rhinocerotis in yeast
    Article Snippet: .. Plasmid DNA was isolated from positive transformants using a Zymoprep™ Yeast Plasmid Miniprep II Kit (Zymo Research) and used to transform NEB 5-alpha Electrocompetent E. coli (New England Biolabs) by electroporation. .. Plasmid DNA was isolated from the positive clones grown on LB-ampicillin using the alkaline lysis method and further verified by DNA sequencing.

    Article Title: Genome-wide CRISPR Screens in T Helper Cells Reveal Pervasive Crosstalk between Activation and Differentiation
    Article Snippet: The resulting plasmid that can be used to target individual genes was named pMSCV-U6sgRNA(BbsI)-PGKpuro2ABFP (Addgene #102796). .. 6 tubes of 5-alpha Electrocompetent E. coli (NEB #C2989K) were transformed using electroporation and the final library obtained by combining 4 maxipreps.

    Article Title: High-throughput creation and functional profiling of DNA sequence variant libraries using CRISPR/Cas9 in yeast
    Article Snippet: .. After PCR purification (Zymo Research), the amplicon is cloned into the BsmBI-containing library vector (XG128) using a standard Golden Gate protocol with BsmBI (NEB R0580S) and T4 ligase (NEB M0202S) then electroporated into 5-alpha Electrocompetent E.coli cells (NEB C2989). ..

    Article Title: ECM turnover-stimulated gene delivery through collagen-mimetic peptide-plasmid integration in collagen
    Article Snippet: .. DNA gel loading dye and Alexa Fluor 350 NHS ester were purchased from Thermo Fisher Scientific (Waltham, MA). pCMV-GLuc plasmid was purchased from New England Biolabs (Ipswich, MA) and pCMV-MetLuc-mem plasmid was purchased from Clontech (Mountain View, CA), and both plasmids were amplified in NEB 5-α electrocompetent E. coli purchased from New England Biolabs. .. The plasmids were purified from bacterial culture using a Qiagen Megaprep Kit (Valencia, CA), following the manufacturer's protocols.

    Article Title: Loss of a doublecortin (DCX)-domain protein causes structural defects in a tubulin-based organelle of Toxoplasma gondii and impairs host-cell invasion
    Article Snippet: .. Plasmid construction After construction, plasmids were used to transform chemically competent TOP10 cells by heat shock or electrocompetent DH5α cells (NEB C2989) by electroporation. .. Plasmid DNA was isolated by standard procedures, and the constructions were verified by DNA sequencing. ptub-TgDCX-EGFP is a derivative of the plasmid ptub-H2b–yellow fluorescent protein (YFP; ).

    Article Title: Mutant APH(2?)-IIa Enzymes with Increased Activity against Amikacin and Isepamicin ▿
    Article Snippet: .. Purified plasmid DNA of the pHF022 vector containing the mutagenized gene for APH(2″)-IIa was used to transform electrocompetent E. coli NEB 5-alpha cells (NEB catalog no. C2989K). .. After overnight incubation in LB broth supplemented with 100 μg/ml of ampicillin (selection marker for the pHF022 vector), the bacterial culture was diluted 500-fold into fresh LB broth supplemented with amikacin or isepamicin at various concentrations.

    Real-time Polymerase Chain Reaction:

    Article Title: High-throughput creation and functional profiling of DNA sequence variant libraries using CRISPR/Cas9 in yeast
    Article Snippet: The CustomArray-synthesized oligo library was diluted to 1 ng/μl and 1μl of the library was amplified with Kapa SYBR FAST qPCR Kit Master Mix (Kapa Biosystems) using unique primer pairs specific to each desired library (e.g. SGS1 tiling deletion, smORF library, etc.). .. After PCR purification (Zymo Research), the amplicon is cloned into the BsmBI-containing library vector (XG128) using a standard Golden Gate protocol with BsmBI (NEB R0580S) and T4 ligase (NEB M0202S) then electroporated into 5-alpha Electrocompetent E.coli cells (NEB C2989).

    Article Title: High-throughput creation and functional profiling of DNA sequence variant libraries using CRISPR/Cas9 in yeast
    Article Snippet: Cloning of the library The CustomArray-synthesized oligo library was diluted to 1 ng/μl and 1μl of the library was amplified with Kapa SYBR FAST qPCR Kit Master Mix (Kapa Biosystems) using unique primer pairs specific to each desired library (e.g. SGS1 tiling deletion, smORF library, etc.). .. After PCR purification (Zymo Research), the amplicon is cloned into the BsmBI-containing library vector (XG128) using a standard Golden Gate protocol with BsmBI (NEB R0580S) and T4 ligase (NEB M0202S) then electroporated into 5-alpha Electrocompetent E.coli cells (NEB C2989).

    Functional Assay:

    Article Title: High-throughput creation and functional profiling of DNA sequence variant libraries using CRISPR/Cas9 in yeast
    Article Snippet: After PCR purification (Zymo Research), the amplicon is cloned into the BsmBI-containing library vector (XG128) using a standard Golden Gate protocol with BsmBI (NEB R0580S) and T4 ligase (NEB M0202S) then electroporated into 5-alpha Electrocompetent E.coli cells (NEB C2989). .. To clone in the additional functional components between the guide and donor, we amplified and cloned in the sgtail and terminator sequences following the same Golden Gate cloning method as described above, but this time using SapI (NEB R0569S) and T4 ligase.

    Article Title: High-throughput creation and functional profiling of DNA sequence variant libraries using CRISPR/Cas9 in yeast
    Article Snippet: After PCR purification (Zymo Research), the amplicon is cloned into the BsmBI-containing library vector (XG128) using a standard Golden Gate protocol with BsmBI (NEB R0580S) and T4 ligase (NEB M0202S) then electroporated into 5-alpha Electrocompetent E.coli cells (NEB C2989). .. To clone in the additional functional components between the guide and donor, we amplified and cloned in the sgtail and terminator sequences following the same Golden Gate cloning method as described above, but this time using SapI (NEB R0569S) and T4 ligase.

    Selection:

    Article Title: Dense sgRNA Library Construction Using a Molecular Chipper Approach
    Article Snippet: .. Pipette tips (prefer ones with filters to minimize contamination, such as those from Denville Scientific) Tubes (Denville Scientific, catalog number: C2170) Petri dishes (Corning, Falcon® , catalog number: 351029) NEB 5-alpha Electrocompetent E. coli (New England Biolabs, catalog number: C2989K) Retroviral vector pSUPER-CRISPR that contains and a puromycin selection marker and a U6 promoter to drive expression of sgRNA that is cloned at Bam HI- Hin dIII sites (for details, see ). .. T4 DNA ligase at 2000,000 U/ml (New England Biolabs, catalog number: M0202T).

    Article Title: An engineered high affinity Fbs1 carbohydrate binding protein for selective capture of N-glycans and N-glycopeptides
    Article Snippet: .. The purified plasmid DNA was electroporated into NEB 5-alpha electrocompetent E. coli cells (NEB) for the next cycle of selection. .. Preparation of tryptic peptides from human serum HSA-depleted or IgG-depleted human serum was prepared by incubating human serum with Affi-Gel Blue beads (Bio-Rad) or Protein A beads (Thermo Fisher Scientific) according to the manufacturer's protocols, respectively.

    Article Title: Mutant APH(2?)-IIa Enzymes with Increased Activity against Amikacin and Isepamicin ▿
    Article Snippet: Purified plasmid DNA of the pHF022 vector containing the mutagenized gene for APH(2″)-IIa was used to transform electrocompetent E. coli NEB 5-alpha cells (NEB catalog no. C2989K). .. After overnight incubation in LB broth supplemented with 100 μg/ml of ampicillin (selection marker for the pHF022 vector), the bacterial culture was diluted 500-fold into fresh LB broth supplemented with amikacin or isepamicin at various concentrations.

    Agarose Gel Electrophoresis:

    Article Title: Systematic Dissection of Sequence Elements Controlling σ70 Promoters Using a Genomically-Encoded Multiplexed Reporter Assay in E. coli
    Article Snippet: This product was then ran on a 2% TAE agarose gel and approximately 200 bp amplicons were extracted using a Zymoclean Gel DNA Recovery Kit (#D4008). .. The digested library was ligated into pLibacceptorV2 using T7 DNA Ligase (NEB #M0318S), cloned into 5-alpha Electrocompetent E. coli (NEB #C2989K), and plated on LB + kanamycin (25 ug/mL) yielding approximately 1.1 million colonies estimated by plating concomitant dilution plates.

    Article Title: Mutant APH(2?)-IIa Enzymes with Increased Activity against Amikacin and Isepamicin ▿
    Article Snippet: Following this, the PCR products in the three tubes were combined and fragments generated by PCR were separated on a 1% agarose gel and purified with Wizard SV Gel and the PCR Clean-Up system (Promega). .. Purified plasmid DNA of the pHF022 vector containing the mutagenized gene for APH(2″)-IIa was used to transform electrocompetent E. coli NEB 5-alpha cells (NEB catalog no. C2989K).

    Ethanol Precipitation:

    Article Title: A high-throughput mutational scan of an intrinsically disordered acidic transcriptional activation domain
    Article Snippet: DNA was extracted from the acrylamide with dialysis cartridges (Thermo #87717) and purified by ethanol precipitation. .. Following electroporation into DH5a cells (NEB C2989K), we recovered ~54,000 colonies.

    Produced:

    Article Title: Genome-wide CRISPR Screens in T Helper Cells Reveal Pervasive Crosstalk between Activation and Differentiation
    Article Snippet: The final product was produced by Gibson assembly (NEB #E2611S) and combining the output of 10 reactions. .. 6 tubes of 5-alpha Electrocompetent E. coli (NEB #C2989K) were transformed using electroporation and the final library obtained by combining 4 maxipreps.

    Concentration Assay:

    Article Title: Mutant APH(2?)-IIa Enzymes with Increased Activity against Amikacin and Isepamicin ▿
    Article Snippet: Purified plasmid DNA of the pHF022 vector containing the mutagenized gene for APH(2″)-IIa was used to transform electrocompetent E. coli NEB 5-alpha cells (NEB catalog no. C2989K). .. Bacteria were incubated overnight at 37°C, and plasmid DNA was isolated from bacterial cultures that had grown at the highest concentration of each antibiotic.

    Alkaline Lysis:

    Article Title: Heterologous expression of cytotoxic sesquiterpenoids from the medicinal mushroom Lignosus rhinocerotis in yeast
    Article Snippet: Plasmid DNA was isolated from positive transformants using a Zymoprep™ Yeast Plasmid Miniprep II Kit (Zymo Research) and used to transform NEB 5-alpha Electrocompetent E. coli (New England Biolabs) by electroporation. .. Plasmid DNA was isolated from the positive clones grown on LB-ampicillin using the alkaline lysis method and further verified by DNA sequencing.

    Marker:

    Article Title: Dense sgRNA Library Construction Using a Molecular Chipper Approach
    Article Snippet: .. Pipette tips (prefer ones with filters to minimize contamination, such as those from Denville Scientific) Tubes (Denville Scientific, catalog number: C2170) Petri dishes (Corning, Falcon® , catalog number: 351029) NEB 5-alpha Electrocompetent E. coli (New England Biolabs, catalog number: C2989K) Retroviral vector pSUPER-CRISPR that contains and a puromycin selection marker and a U6 promoter to drive expression of sgRNA that is cloned at Bam HI- Hin dIII sites (for details, see ). .. T4 DNA ligase at 2000,000 U/ml (New England Biolabs, catalog number: M0202T).

    Article Title: Mutant APH(2?)-IIa Enzymes with Increased Activity against Amikacin and Isepamicin ▿
    Article Snippet: Purified plasmid DNA of the pHF022 vector containing the mutagenized gene for APH(2″)-IIa was used to transform electrocompetent E. coli NEB 5-alpha cells (NEB catalog no. C2989K). .. After overnight incubation in LB broth supplemented with 100 μg/ml of ampicillin (selection marker for the pHF022 vector), the bacterial culture was diluted 500-fold into fresh LB broth supplemented with amikacin or isepamicin at various concentrations.

    Staining:

    Article Title: Dense sgRNA Library Construction Using a Molecular Chipper Approach
    Article Snippet: Pipette tips (prefer ones with filters to minimize contamination, such as those from Denville Scientific) Tubes (Denville Scientific, catalog number: C2170) Petri dishes (Corning, Falcon® , catalog number: 351029) NEB 5-alpha Electrocompetent E. coli (New England Biolabs, catalog number: C2989K) Retroviral vector pSUPER-CRISPR that contains and a puromycin selection marker and a U6 promoter to drive expression of sgRNA that is cloned at Bam HI- Hin dIII sites (for details, see ). .. Use in ligations where T4 DNA ligase is required in excess within a small volume, such as that described in step 2 T4 DNA ligase at 400,000 U/ml (New England Biolabs, catalog number: M0202S) T4 polynucleotide kinase (New England Biolabs, catalog number: M0201S) Distilled water (AmericanBio, catalog number: AB02123-00500) QIAquick PCR Purification Kit (QIAGEN, catalog number: 28104) Agarose (AmericanBio, catalog number: AB00972) Ethidium bromide, 10 mg/ml (Sigma-Aldrich, catalog number: E1510) 3 M sodium acetate, pH 5.2 100% ethanol (AmericanBio, catalog number: AB00515-00500) 70% ethanol (AmericanBio, catalog number: AB04010-00500) 1 kb plus DNA standard (Thermo Fisher Scientific, Invitrogen™, catalog number: 10787018) Agarose, low melting point (AmericanBio, catalog number: AB00981) 10 bp DNA standard (Thermo Fisher Scientific, Invitrogen™, catalog number: 10821015) NEBNext End Repair Module (New England Biolabs, catalog number: E6050S) 10,000× SYBR Safe DNA Gel Stain (Thermo Fisher Scientific, Invitrogen™, catalog number: ) QIAEX II Gel Extraction Kit (QIAGEN, catalog number: 20021) QIAquick Gel Extraction Kit (QIAGEN, catalog number: 28704) Eco P15I-adaptor oligonucleotide pair: sense aaaactcgag cagcag t ggatcc G and anti-sense /5phos/C ggatcc a ctgctg ctcgag (Integrated DNA Technologies; 25 nmole DNA oligo scale; Standard desalting purification).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs e coli neb 5 alpha
    Imipenem and meropenem Etests for E. coli NEB <t>5-alpha</t> carrying pWH1266:: bla OXA-164 and showing imipenem and meropenem heteroresistance.
    E Coli Neb 5 Alpha, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli neb 5 alpha/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    e coli neb 5 alpha - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    94
    New England Biolabs 5 alpha jm109 cells
    Three or four fragments can efficiently be assembled with PPY-cell extracts, while iVEC/“transformation-cloning” with three fragments is markedly less efficient. ( a ) The assembly of four fragments in a single reaction reduces the number of successful assemblies by a factor of two to ten as compared to the three-fragment-assembly. Cell-extracts were prepared from autoinduced PPY cells and the assemblies were purified prior transformation. ( b ) Assembly of three fragments by iVEC/“transformation-cloning” with NEB <t>5-alpha</t> resulted in roughly 250 recombinant colonies/µg transformed DNA. A significant number of colonies harboring plasmids with defective inserts (grey bar) and PCR-template carry-over (dotted bar) were present on the plates.
    5 Alpha Jm109 Cells, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5 alpha jm109 cells/product/New England Biolabs
    Average 94 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    5 alpha jm109 cells - by Bioz Stars, 2020-02
    94/100 stars
      Buy from Supplier

    94
    New England Biolabs 5 alpha otg extract preparation assembly combination
    Three or four fragments can efficiently be assembled with PPY-cell extracts, while iVEC/“transformation-cloning” with three fragments is markedly less efficient. ( a ) The assembly of four fragments in a single reaction reduces the number of successful assemblies by a factor of two to ten as compared to the three-fragment-assembly. Cell-extracts were prepared from autoinduced PPY cells and the assemblies were purified prior transformation. ( b ) Assembly of three fragments by iVEC/“transformation-cloning” with NEB <t>5-alpha</t> resulted in roughly 250 recombinant colonies/µg transformed DNA. A significant number of colonies harboring plasmids with defective inserts (grey bar) and PCR-template carry-over (dotted bar) were present on the plates.
    5 Alpha Otg Extract Preparation Assembly Combination, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5 alpha otg extract preparation assembly combination/product/New England Biolabs
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    5 alpha otg extract preparation assembly combination - by Bioz Stars, 2020-02
    94/100 stars
      Buy from Supplier

    99
    New England Biolabs calmodulin dependent protein kinase ii
    In vitro characterization of AKAR1. ( A ) Emission spectra of the purified AKAR1 before (black) and after (red) phosphorylation by PKA (excitation 434 nm). The green curve depicts the spectrum of the reporter after digestion with trypsin to quench the energy transfer and quantify the FRET. ( B ) Phosphorylation time course for AKAR1 with the control of lacking either PKA or ATP. ( C ) Percent emission ratio change for the AKAR1 in response to in vitro phosphorylation by different kinases. Black and gray columns represent the percent change in 1 h and 24 h after addition of ATP, respectively. CaMKII, <t>calmodulin-dependent</t> protein kinase II. ( D ) Phosphorylation time course for AKAR1 and mutants S475A and K280E to validate the mechanism of intramolecular complexation.
    Calmodulin Dependent Protein Kinase Ii, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/calmodulin dependent protein kinase ii/product/New England Biolabs
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    calmodulin dependent protein kinase ii - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    Image Search Results


    Imipenem and meropenem Etests for E. coli NEB 5-alpha carrying pWH1266:: bla OXA-164 and showing imipenem and meropenem heteroresistance.

    Journal: Antimicrobial Agents and Chemotherapy

    Article Title: In Vivo Selection of a Missense Mutation in adeR and Conversion of the Novel blaOXA-164 Gene into blaOXA-58 in Carbapenem-Resistant Acinetobacter baumannii Isolates from a Hospitalized Patient ▿

    doi: 10.1128/AAC.00598-10

    Figure Lengend Snippet: Imipenem and meropenem Etests for E. coli NEB 5-alpha carrying pWH1266:: bla OXA-164 and showing imipenem and meropenem heteroresistance.

    Article Snippet: PCR products were ligated into EcoRI/BamHI double digested pWH1266 which is an Escherichia coli - Acinetobacter shuttle plasmid ( ) using the In-Fusion dry-down PCR cloning kit (Clontech, Saint-Germain-en-Laye, France) and transformed in E. coli NEB 5-alpha (New England BioLabs, Frankfurt, Germany).

    Techniques:

    Three or four fragments can efficiently be assembled with PPY-cell extracts, while iVEC/“transformation-cloning” with three fragments is markedly less efficient. ( a ) The assembly of four fragments in a single reaction reduces the number of successful assemblies by a factor of two to ten as compared to the three-fragment-assembly. Cell-extracts were prepared from autoinduced PPY cells and the assemblies were purified prior transformation. ( b ) Assembly of three fragments by iVEC/“transformation-cloning” with NEB 5-alpha resulted in roughly 250 recombinant colonies/µg transformed DNA. A significant number of colonies harboring plasmids with defective inserts (grey bar) and PCR-template carry-over (dotted bar) were present on the plates.

    Journal: Scientific Reports

    Article Title: ZeBRα a universal, multi-fragment DNA-assembly-system with minimal hands-on time requirement

    doi: 10.1038/s41598-019-39768-0

    Figure Lengend Snippet: Three or four fragments can efficiently be assembled with PPY-cell extracts, while iVEC/“transformation-cloning” with three fragments is markedly less efficient. ( a ) The assembly of four fragments in a single reaction reduces the number of successful assemblies by a factor of two to ten as compared to the three-fragment-assembly. Cell-extracts were prepared from autoinduced PPY cells and the assemblies were purified prior transformation. ( b ) Assembly of three fragments by iVEC/“transformation-cloning” with NEB 5-alpha resulted in roughly 250 recombinant colonies/µg transformed DNA. A significant number of colonies harboring plasmids with defective inserts (grey bar) and PCR-template carry-over (dotted bar) were present on the plates.

    Article Snippet: SLiCE-extract preparation with multiple detergents from JM109 and NEB 5-alpha JM109 cells were plated onto LB (all media contained 30 µg/ml nalidixic acid).

    Techniques: Clone Assay, Purification, Transformation Assay, Recombinant, Polymerase Chain Reaction

    Strategy for SLiCE optimization and evaluation. ( a ) Flow chart of the optimization process for generating a recombinogenic E. coli lysate. The PPY strain is a DH10B-derivative used to prepare the recombinogenic cell lysate and expresses the coding sequences for Redαβγ. The extracts, derived from arabinose autoinduced PPY-cells, were compared to extracts made from non-induced PPY-cells. ( b ) Structure of the examined non-ionic detergents used to prepare the recombinogenic PPY-extracts, CHAPS, Sulfo-Betain (SB-12), n-Octyl-β-D-thioglucopyranosid (OTG), n-Octyl-β-D-glucopyranosid (OG) Dodecyl-β-D-maltosid (DDM). ( c ) PPY-extracts were tested for their recombination capacity by assembling three DNA fragments with overlapping ends, to generate a recombinant plasmid constitutively expressing a blue chromoprotein. To examine the effects detergents had on the transformation, samples were split after the assembly reaction. One part was transformed into NEB 5-alpha unpurified; the other fraction was purified by silica-column chromatography prior to transformation.

    Journal: Scientific Reports

    Article Title: ZeBRα a universal, multi-fragment DNA-assembly-system with minimal hands-on time requirement

    doi: 10.1038/s41598-019-39768-0

    Figure Lengend Snippet: Strategy for SLiCE optimization and evaluation. ( a ) Flow chart of the optimization process for generating a recombinogenic E. coli lysate. The PPY strain is a DH10B-derivative used to prepare the recombinogenic cell lysate and expresses the coding sequences for Redαβγ. The extracts, derived from arabinose autoinduced PPY-cells, were compared to extracts made from non-induced PPY-cells. ( b ) Structure of the examined non-ionic detergents used to prepare the recombinogenic PPY-extracts, CHAPS, Sulfo-Betain (SB-12), n-Octyl-β-D-thioglucopyranosid (OTG), n-Octyl-β-D-glucopyranosid (OG) Dodecyl-β-D-maltosid (DDM). ( c ) PPY-extracts were tested for their recombination capacity by assembling three DNA fragments with overlapping ends, to generate a recombinant plasmid constitutively expressing a blue chromoprotein. To examine the effects detergents had on the transformation, samples were split after the assembly reaction. One part was transformed into NEB 5-alpha unpurified; the other fraction was purified by silica-column chromatography prior to transformation.

    Article Snippet: SLiCE-extract preparation with multiple detergents from JM109 and NEB 5-alpha JM109 cells were plated onto LB (all media contained 30 µg/ml nalidixic acid).

    Techniques: Flow Cytometry, Derivative Assay, Recombinant, Plasmid Preparation, Expressing, Transformation Assay, Purification, Column Chromatography

    Comparison of the influence of detergent, autoinduction, post-assembly purification and competency of used bacteria on DNA assembling efficiency. ( a ) In four of the five PPY lysis conditions induction of Redα had moderate effects. Five different detergents were tested on PPY-cells grown with either lactose (Redα un-induced) or arabinose (Redα induced). All assemblies were column-purified before transformation into NEB 5-alpha. Bars indicate standard error of three independent replicates of an assembly reaction in all following graphs. PPY recombinogenic capacity was assessed in three-fragment assemblies. ( b ) Column-purification of the three-fragment-assembly reactions led to markedly increased number of recombinant colonies for all tested detergents. In the case of CHAPS and SB-12, unpurified samples resulted in no colonies. The OTG derived PPY-extract resulted in the highest number of recombinant colonies without purification. All assemblies were arabinose-induced. ( c ) Chemical competency has profound influence on recombination efficiency. OTG prepared PPY-lysate was used in a three-fragment-assembly and transformed into commercial NEB 5-alpha competent E. coli (1 × 10 9 cfu/µg pUC DNA) or the same strain prepared by the Inoue-method 21 (2.3 × 10 6 cfu/µg DNA). ( d ) For convenient readout of the potency of the PPY-extracts PCR-fragments used for the three- and four-way assembly reactions consisted of a blue chromoprotein coding ORF, a kanamycin resistance gene an origin-of-replication (on one fragment for the three-fragment assembly) and a bacterial basal-promoter-fragment. Only successful recombinants could produce blue colonies on kanamycin plates. The PCR-fragments to be assembled had overlapping bases that summed up to about 15 bp overlapping ends.

    Journal: Scientific Reports

    Article Title: ZeBRα a universal, multi-fragment DNA-assembly-system with minimal hands-on time requirement

    doi: 10.1038/s41598-019-39768-0

    Figure Lengend Snippet: Comparison of the influence of detergent, autoinduction, post-assembly purification and competency of used bacteria on DNA assembling efficiency. ( a ) In four of the five PPY lysis conditions induction of Redα had moderate effects. Five different detergents were tested on PPY-cells grown with either lactose (Redα un-induced) or arabinose (Redα induced). All assemblies were column-purified before transformation into NEB 5-alpha. Bars indicate standard error of three independent replicates of an assembly reaction in all following graphs. PPY recombinogenic capacity was assessed in three-fragment assemblies. ( b ) Column-purification of the three-fragment-assembly reactions led to markedly increased number of recombinant colonies for all tested detergents. In the case of CHAPS and SB-12, unpurified samples resulted in no colonies. The OTG derived PPY-extract resulted in the highest number of recombinant colonies without purification. All assemblies were arabinose-induced. ( c ) Chemical competency has profound influence on recombination efficiency. OTG prepared PPY-lysate was used in a three-fragment-assembly and transformed into commercial NEB 5-alpha competent E. coli (1 × 10 9 cfu/µg pUC DNA) or the same strain prepared by the Inoue-method 21 (2.3 × 10 6 cfu/µg DNA). ( d ) For convenient readout of the potency of the PPY-extracts PCR-fragments used for the three- and four-way assembly reactions consisted of a blue chromoprotein coding ORF, a kanamycin resistance gene an origin-of-replication (on one fragment for the three-fragment assembly) and a bacterial basal-promoter-fragment. Only successful recombinants could produce blue colonies on kanamycin plates. The PCR-fragments to be assembled had overlapping bases that summed up to about 15 bp overlapping ends.

    Article Snippet: SLiCE-extract preparation with multiple detergents from JM109 and NEB 5-alpha JM109 cells were plated onto LB (all media contained 30 µg/ml nalidixic acid).

    Techniques: Purification, Lysis, Transformation Assay, Recombinant, Derivative Assay, Polymerase Chain Reaction

    The recombinogenic capacity of OTG extracts from autoinduced PPY and NEB 5-alpha extracts are equivalent or better than PPY-extracts generated by the original protocol. ( a ) Plasmid map of pT7- Hin dIII- ccdB used to assess three-fragment ZeBRα assemblies. Two Hin dIII and two Bsa I sites flank the toxic-placeholder- ccdB , allowing linearization and removal of ccdB . Unique sites are available on either side of ccdB . Chloramphenicol-acetyl-transferase coding gene ( CmR ), is part of the placeholder cassette and prevents ccdB -loss during plasmid propagation. The hatched region encompasses the fragment removed during cloning. ( b ) Map of the vector pT7-GFP antisense resulting from the three-fragment test-assembly of the pT7- Hin dIII- ccdB as recipient for a GFP-ORF and a bacterial promoter containing PCR-fragment, to evaluate the efficacy of the ZeBRα-procedure. Criss-cross lines mark the fusion-sites of the assembled fragments. ( c ) Comparison of the recombination capacity of extracts prepared with OTG or CelLyticB TM from manually induced and autoinduced (denoted as “auto” in the column) PPY-cells and NEB 5-alpha. The iVEC/“transformation-cloning” of the respective fragments is shown as last column. ( d ) Green fluorescent NEB 5-alpha colonies harboring the constitutively GFP-expressing vector pT7-GFP antisense.

    Journal: Scientific Reports

    Article Title: ZeBRα a universal, multi-fragment DNA-assembly-system with minimal hands-on time requirement

    doi: 10.1038/s41598-019-39768-0

    Figure Lengend Snippet: The recombinogenic capacity of OTG extracts from autoinduced PPY and NEB 5-alpha extracts are equivalent or better than PPY-extracts generated by the original protocol. ( a ) Plasmid map of pT7- Hin dIII- ccdB used to assess three-fragment ZeBRα assemblies. Two Hin dIII and two Bsa I sites flank the toxic-placeholder- ccdB , allowing linearization and removal of ccdB . Unique sites are available on either side of ccdB . Chloramphenicol-acetyl-transferase coding gene ( CmR ), is part of the placeholder cassette and prevents ccdB -loss during plasmid propagation. The hatched region encompasses the fragment removed during cloning. ( b ) Map of the vector pT7-GFP antisense resulting from the three-fragment test-assembly of the pT7- Hin dIII- ccdB as recipient for a GFP-ORF and a bacterial promoter containing PCR-fragment, to evaluate the efficacy of the ZeBRα-procedure. Criss-cross lines mark the fusion-sites of the assembled fragments. ( c ) Comparison of the recombination capacity of extracts prepared with OTG or CelLyticB TM from manually induced and autoinduced (denoted as “auto” in the column) PPY-cells and NEB 5-alpha. The iVEC/“transformation-cloning” of the respective fragments is shown as last column. ( d ) Green fluorescent NEB 5-alpha colonies harboring the constitutively GFP-expressing vector pT7-GFP antisense.

    Article Snippet: SLiCE-extract preparation with multiple detergents from JM109 and NEB 5-alpha JM109 cells were plated onto LB (all media contained 30 µg/ml nalidixic acid).

    Techniques: Generated, Plasmid Preparation, Chloramphenicol Acetyltransferase Assay, Clone Assay, Polymerase Chain Reaction, Expressing

    Rendering the CcdB in the placeholder non-toxic increases the number of GFP – background colonies markedly, showing that ccdB is an essential element if working with non-gel purified vector. ( a ) The pT7- Hin dIII-dead- ccdB differs by a four base-pair deletion in the ccdB -coding sequence from it’s predecessor pT7- Hin dIII- ccdB . The dotted lines encompass the region removed during cloning. ( b ) Sequence alignment of the region encompassing the small deletion in the ccdB -ORF, in pT7- Hin dIII-dead- ccdB compared to the region in pT7- Hin dIII- ccdB and the resulting frameshift rendering the ΔCcdB non-toxic for E. coli NEB 5-alpha. The numbers denote bases in the vector. ( c ) The three-fragment assembly as shown in Fig. 6c uses the pT7-HindIII-dead- ccdB vector and OTG-derived PPY-extract to assemble pT7-GFP antisense analogous to the assemblies shown in Fig. 5 . The percentage of GFP + colonies drops from nearly 100% for pT7- Hin dIII- ccdB to 57% for pT7- Hin dIII-dead- ccdB . ( d ) Image of the mixture of GFP + and GFP − resulting from the assembly (100 µl outgrowth medium spread). The red arrow points at a cluster of GFP − colonies representing un-digested vector that would have to be screened for in a non-model assembly.

    Journal: Scientific Reports

    Article Title: ZeBRα a universal, multi-fragment DNA-assembly-system with minimal hands-on time requirement

    doi: 10.1038/s41598-019-39768-0

    Figure Lengend Snippet: Rendering the CcdB in the placeholder non-toxic increases the number of GFP – background colonies markedly, showing that ccdB is an essential element if working with non-gel purified vector. ( a ) The pT7- Hin dIII-dead- ccdB differs by a four base-pair deletion in the ccdB -coding sequence from it’s predecessor pT7- Hin dIII- ccdB . The dotted lines encompass the region removed during cloning. ( b ) Sequence alignment of the region encompassing the small deletion in the ccdB -ORF, in pT7- Hin dIII-dead- ccdB compared to the region in pT7- Hin dIII- ccdB and the resulting frameshift rendering the ΔCcdB non-toxic for E. coli NEB 5-alpha. The numbers denote bases in the vector. ( c ) The three-fragment assembly as shown in Fig. 6c uses the pT7-HindIII-dead- ccdB vector and OTG-derived PPY-extract to assemble pT7-GFP antisense analogous to the assemblies shown in Fig. 5 . The percentage of GFP + colonies drops from nearly 100% for pT7- Hin dIII- ccdB to 57% for pT7- Hin dIII-dead- ccdB . ( d ) Image of the mixture of GFP + and GFP − resulting from the assembly (100 µl outgrowth medium spread). The red arrow points at a cluster of GFP − colonies representing un-digested vector that would have to be screened for in a non-model assembly.

    Article Snippet: SLiCE-extract preparation with multiple detergents from JM109 and NEB 5-alpha JM109 cells were plated onto LB (all media contained 30 µg/ml nalidixic acid).

    Techniques: Purification, Plasmid Preparation, Sequencing, Clone Assay, Derivative Assay

    Three or four fragments can efficiently be assembled with PPY-cell extracts, while iVEC/“transformation-cloning” with three fragments is markedly less efficient. ( a ) The assembly of four fragments in a single reaction reduces the number of successful assemblies by a factor of two to ten as compared to the three-fragment-assembly. Cell-extracts were prepared from autoinduced PPY cells and the assemblies were purified prior transformation. ( b ) Assembly of three fragments by iVEC/“transformation-cloning” with NEB 5-alpha resulted in roughly 250 recombinant colonies/µg transformed DNA. A significant number of colonies harboring plasmids with defective inserts (grey bar) and PCR-template carry-over (dotted bar) were present on the plates.

    Journal: Scientific Reports

    Article Title: ZeBRα a universal, multi-fragment DNA-assembly-system with minimal hands-on time requirement

    doi: 10.1038/s41598-019-39768-0

    Figure Lengend Snippet: Three or four fragments can efficiently be assembled with PPY-cell extracts, while iVEC/“transformation-cloning” with three fragments is markedly less efficient. ( a ) The assembly of four fragments in a single reaction reduces the number of successful assemblies by a factor of two to ten as compared to the three-fragment-assembly. Cell-extracts were prepared from autoinduced PPY cells and the assemblies were purified prior transformation. ( b ) Assembly of three fragments by iVEC/“transformation-cloning” with NEB 5-alpha resulted in roughly 250 recombinant colonies/µg transformed DNA. A significant number of colonies harboring plasmids with defective inserts (grey bar) and PCR-template carry-over (dotted bar) were present on the plates.

    Article Snippet: For this NEB 5-alpha OTG-extract preparation- assembly combination we measured an average of blue colonies 1.69 × 104 cfu/µg corresponding to 98% of the colonies on the plate.

    Techniques: Clone Assay, Purification, Transformation Assay, Recombinant, Polymerase Chain Reaction

    Strategy for SLiCE optimization and evaluation. ( a ) Flow chart of the optimization process for generating a recombinogenic E. coli lysate. The PPY strain is a DH10B-derivative used to prepare the recombinogenic cell lysate and expresses the coding sequences for Redαβγ. The extracts, derived from arabinose autoinduced PPY-cells, were compared to extracts made from non-induced PPY-cells. ( b ) Structure of the examined non-ionic detergents used to prepare the recombinogenic PPY-extracts, CHAPS, Sulfo-Betain (SB-12), n-Octyl-β-D-thioglucopyranosid (OTG), n-Octyl-β-D-glucopyranosid (OG) Dodecyl-β-D-maltosid (DDM). ( c ) PPY-extracts were tested for their recombination capacity by assembling three DNA fragments with overlapping ends, to generate a recombinant plasmid constitutively expressing a blue chromoprotein. To examine the effects detergents had on the transformation, samples were split after the assembly reaction. One part was transformed into NEB 5-alpha unpurified; the other fraction was purified by silica-column chromatography prior to transformation.

    Journal: Scientific Reports

    Article Title: ZeBRα a universal, multi-fragment DNA-assembly-system with minimal hands-on time requirement

    doi: 10.1038/s41598-019-39768-0

    Figure Lengend Snippet: Strategy for SLiCE optimization and evaluation. ( a ) Flow chart of the optimization process for generating a recombinogenic E. coli lysate. The PPY strain is a DH10B-derivative used to prepare the recombinogenic cell lysate and expresses the coding sequences for Redαβγ. The extracts, derived from arabinose autoinduced PPY-cells, were compared to extracts made from non-induced PPY-cells. ( b ) Structure of the examined non-ionic detergents used to prepare the recombinogenic PPY-extracts, CHAPS, Sulfo-Betain (SB-12), n-Octyl-β-D-thioglucopyranosid (OTG), n-Octyl-β-D-glucopyranosid (OG) Dodecyl-β-D-maltosid (DDM). ( c ) PPY-extracts were tested for their recombination capacity by assembling three DNA fragments with overlapping ends, to generate a recombinant plasmid constitutively expressing a blue chromoprotein. To examine the effects detergents had on the transformation, samples were split after the assembly reaction. One part was transformed into NEB 5-alpha unpurified; the other fraction was purified by silica-column chromatography prior to transformation.

    Article Snippet: For this NEB 5-alpha OTG-extract preparation- assembly combination we measured an average of blue colonies 1.69 × 104 cfu/µg corresponding to 98% of the colonies on the plate.

    Techniques: Flow Cytometry, Derivative Assay, Recombinant, Plasmid Preparation, Expressing, Transformation Assay, Purification, Column Chromatography

    Comparison of the influence of detergent, autoinduction, post-assembly purification and competency of used bacteria on DNA assembling efficiency. ( a ) In four of the five PPY lysis conditions induction of Redα had moderate effects. Five different detergents were tested on PPY-cells grown with either lactose (Redα un-induced) or arabinose (Redα induced). All assemblies were column-purified before transformation into NEB 5-alpha. Bars indicate standard error of three independent replicates of an assembly reaction in all following graphs. PPY recombinogenic capacity was assessed in three-fragment assemblies. ( b ) Column-purification of the three-fragment-assembly reactions led to markedly increased number of recombinant colonies for all tested detergents. In the case of CHAPS and SB-12, unpurified samples resulted in no colonies. The OTG derived PPY-extract resulted in the highest number of recombinant colonies without purification. All assemblies were arabinose-induced. ( c ) Chemical competency has profound influence on recombination efficiency. OTG prepared PPY-lysate was used in a three-fragment-assembly and transformed into commercial NEB 5-alpha competent E. coli (1 × 10 9 cfu/µg pUC DNA) or the same strain prepared by the Inoue-method 21 (2.3 × 10 6 cfu/µg DNA). ( d ) For convenient readout of the potency of the PPY-extracts PCR-fragments used for the three- and four-way assembly reactions consisted of a blue chromoprotein coding ORF, a kanamycin resistance gene an origin-of-replication (on one fragment for the three-fragment assembly) and a bacterial basal-promoter-fragment. Only successful recombinants could produce blue colonies on kanamycin plates. The PCR-fragments to be assembled had overlapping bases that summed up to about 15 bp overlapping ends.

    Journal: Scientific Reports

    Article Title: ZeBRα a universal, multi-fragment DNA-assembly-system with minimal hands-on time requirement

    doi: 10.1038/s41598-019-39768-0

    Figure Lengend Snippet: Comparison of the influence of detergent, autoinduction, post-assembly purification and competency of used bacteria on DNA assembling efficiency. ( a ) In four of the five PPY lysis conditions induction of Redα had moderate effects. Five different detergents were tested on PPY-cells grown with either lactose (Redα un-induced) or arabinose (Redα induced). All assemblies were column-purified before transformation into NEB 5-alpha. Bars indicate standard error of three independent replicates of an assembly reaction in all following graphs. PPY recombinogenic capacity was assessed in three-fragment assemblies. ( b ) Column-purification of the three-fragment-assembly reactions led to markedly increased number of recombinant colonies for all tested detergents. In the case of CHAPS and SB-12, unpurified samples resulted in no colonies. The OTG derived PPY-extract resulted in the highest number of recombinant colonies without purification. All assemblies were arabinose-induced. ( c ) Chemical competency has profound influence on recombination efficiency. OTG prepared PPY-lysate was used in a three-fragment-assembly and transformed into commercial NEB 5-alpha competent E. coli (1 × 10 9 cfu/µg pUC DNA) or the same strain prepared by the Inoue-method 21 (2.3 × 10 6 cfu/µg DNA). ( d ) For convenient readout of the potency of the PPY-extracts PCR-fragments used for the three- and four-way assembly reactions consisted of a blue chromoprotein coding ORF, a kanamycin resistance gene an origin-of-replication (on one fragment for the three-fragment assembly) and a bacterial basal-promoter-fragment. Only successful recombinants could produce blue colonies on kanamycin plates. The PCR-fragments to be assembled had overlapping bases that summed up to about 15 bp overlapping ends.

    Article Snippet: For this NEB 5-alpha OTG-extract preparation- assembly combination we measured an average of blue colonies 1.69 × 104 cfu/µg corresponding to 98% of the colonies on the plate.

    Techniques: Purification, Lysis, Transformation Assay, Recombinant, Derivative Assay, Polymerase Chain Reaction

    The recombinogenic capacity of OTG extracts from autoinduced PPY and NEB 5-alpha extracts are equivalent or better than PPY-extracts generated by the original protocol. ( a ) Plasmid map of pT7- Hin dIII- ccdB used to assess three-fragment ZeBRα assemblies. Two Hin dIII and two Bsa I sites flank the toxic-placeholder- ccdB , allowing linearization and removal of ccdB . Unique sites are available on either side of ccdB . Chloramphenicol-acetyl-transferase coding gene ( CmR ), is part of the placeholder cassette and prevents ccdB -loss during plasmid propagation. The hatched region encompasses the fragment removed during cloning. ( b ) Map of the vector pT7-GFP antisense resulting from the three-fragment test-assembly of the pT7- Hin dIII- ccdB as recipient for a GFP-ORF and a bacterial promoter containing PCR-fragment, to evaluate the efficacy of the ZeBRα-procedure. Criss-cross lines mark the fusion-sites of the assembled fragments. ( c ) Comparison of the recombination capacity of extracts prepared with OTG or CelLyticB TM from manually induced and autoinduced (denoted as “auto” in the column) PPY-cells and NEB 5-alpha. The iVEC/“transformation-cloning” of the respective fragments is shown as last column. ( d ) Green fluorescent NEB 5-alpha colonies harboring the constitutively GFP-expressing vector pT7-GFP antisense.

    Journal: Scientific Reports

    Article Title: ZeBRα a universal, multi-fragment DNA-assembly-system with minimal hands-on time requirement

    doi: 10.1038/s41598-019-39768-0

    Figure Lengend Snippet: The recombinogenic capacity of OTG extracts from autoinduced PPY and NEB 5-alpha extracts are equivalent or better than PPY-extracts generated by the original protocol. ( a ) Plasmid map of pT7- Hin dIII- ccdB used to assess three-fragment ZeBRα assemblies. Two Hin dIII and two Bsa I sites flank the toxic-placeholder- ccdB , allowing linearization and removal of ccdB . Unique sites are available on either side of ccdB . Chloramphenicol-acetyl-transferase coding gene ( CmR ), is part of the placeholder cassette and prevents ccdB -loss during plasmid propagation. The hatched region encompasses the fragment removed during cloning. ( b ) Map of the vector pT7-GFP antisense resulting from the three-fragment test-assembly of the pT7- Hin dIII- ccdB as recipient for a GFP-ORF and a bacterial promoter containing PCR-fragment, to evaluate the efficacy of the ZeBRα-procedure. Criss-cross lines mark the fusion-sites of the assembled fragments. ( c ) Comparison of the recombination capacity of extracts prepared with OTG or CelLyticB TM from manually induced and autoinduced (denoted as “auto” in the column) PPY-cells and NEB 5-alpha. The iVEC/“transformation-cloning” of the respective fragments is shown as last column. ( d ) Green fluorescent NEB 5-alpha colonies harboring the constitutively GFP-expressing vector pT7-GFP antisense.

    Article Snippet: For this NEB 5-alpha OTG-extract preparation- assembly combination we measured an average of blue colonies 1.69 × 104 cfu/µg corresponding to 98% of the colonies on the plate.

    Techniques: Generated, Plasmid Preparation, Chloramphenicol Acetyltransferase Assay, Clone Assay, Polymerase Chain Reaction, Expressing

    Rendering the CcdB in the placeholder non-toxic increases the number of GFP – background colonies markedly, showing that ccdB is an essential element if working with non-gel purified vector. ( a ) The pT7- Hin dIII-dead- ccdB differs by a four base-pair deletion in the ccdB -coding sequence from it’s predecessor pT7- Hin dIII- ccdB . The dotted lines encompass the region removed during cloning. ( b ) Sequence alignment of the region encompassing the small deletion in the ccdB -ORF, in pT7- Hin dIII-dead- ccdB compared to the region in pT7- Hin dIII- ccdB and the resulting frameshift rendering the ΔCcdB non-toxic for E. coli NEB 5-alpha. The numbers denote bases in the vector. ( c ) The three-fragment assembly as shown in Fig. 6c uses the pT7-HindIII-dead- ccdB vector and OTG-derived PPY-extract to assemble pT7-GFP antisense analogous to the assemblies shown in Fig. 5 . The percentage of GFP + colonies drops from nearly 100% for pT7- Hin dIII- ccdB to 57% for pT7- Hin dIII-dead- ccdB . ( d ) Image of the mixture of GFP + and GFP − resulting from the assembly (100 µl outgrowth medium spread). The red arrow points at a cluster of GFP − colonies representing un-digested vector that would have to be screened for in a non-model assembly.

    Journal: Scientific Reports

    Article Title: ZeBRα a universal, multi-fragment DNA-assembly-system with minimal hands-on time requirement

    doi: 10.1038/s41598-019-39768-0

    Figure Lengend Snippet: Rendering the CcdB in the placeholder non-toxic increases the number of GFP – background colonies markedly, showing that ccdB is an essential element if working with non-gel purified vector. ( a ) The pT7- Hin dIII-dead- ccdB differs by a four base-pair deletion in the ccdB -coding sequence from it’s predecessor pT7- Hin dIII- ccdB . The dotted lines encompass the region removed during cloning. ( b ) Sequence alignment of the region encompassing the small deletion in the ccdB -ORF, in pT7- Hin dIII-dead- ccdB compared to the region in pT7- Hin dIII- ccdB and the resulting frameshift rendering the ΔCcdB non-toxic for E. coli NEB 5-alpha. The numbers denote bases in the vector. ( c ) The three-fragment assembly as shown in Fig. 6c uses the pT7-HindIII-dead- ccdB vector and OTG-derived PPY-extract to assemble pT7-GFP antisense analogous to the assemblies shown in Fig. 5 . The percentage of GFP + colonies drops from nearly 100% for pT7- Hin dIII- ccdB to 57% for pT7- Hin dIII-dead- ccdB . ( d ) Image of the mixture of GFP + and GFP − resulting from the assembly (100 µl outgrowth medium spread). The red arrow points at a cluster of GFP − colonies representing un-digested vector that would have to be screened for in a non-model assembly.

    Article Snippet: For this NEB 5-alpha OTG-extract preparation- assembly combination we measured an average of blue colonies 1.69 × 104 cfu/µg corresponding to 98% of the colonies on the plate.

    Techniques: Purification, Plasmid Preparation, Sequencing, Clone Assay, Derivative Assay

    In vitro characterization of AKAR1. ( A ) Emission spectra of the purified AKAR1 before (black) and after (red) phosphorylation by PKA (excitation 434 nm). The green curve depicts the spectrum of the reporter after digestion with trypsin to quench the energy transfer and quantify the FRET. ( B ) Phosphorylation time course for AKAR1 with the control of lacking either PKA or ATP. ( C ) Percent emission ratio change for the AKAR1 in response to in vitro phosphorylation by different kinases. Black and gray columns represent the percent change in 1 h and 24 h after addition of ATP, respectively. CaMKII, calmodulin-dependent protein kinase II. ( D ) Phosphorylation time course for AKAR1 and mutants S475A and K280E to validate the mechanism of intramolecular complexation.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Genetically encoded reporters of protein kinase A activity reveal impact of substrate tethering

    doi: 10.1073/pnas.211566798

    Figure Lengend Snippet: In vitro characterization of AKAR1. ( A ) Emission spectra of the purified AKAR1 before (black) and after (red) phosphorylation by PKA (excitation 434 nm). The green curve depicts the spectrum of the reporter after digestion with trypsin to quench the energy transfer and quantify the FRET. ( B ) Phosphorylation time course for AKAR1 with the control of lacking either PKA or ATP. ( C ) Percent emission ratio change for the AKAR1 in response to in vitro phosphorylation by different kinases. Black and gray columns represent the percent change in 1 h and 24 h after addition of ATP, respectively. CaMKII, calmodulin-dependent protein kinase II. ( D ) Phosphorylation time course for AKAR1 and mutants S475A and K280E to validate the mechanism of intramolecular complexation.

    Article Snippet: Recombinant proteins were treated with the catalytic subunit of PKA (NEB, Beverly, MA; 2.5 units/μl), calmodulin-dependent protein kinase II (NEB; 5 units/μl), protein kinase C (PKC) βII and PKCδ (generous gifts from A. Newton, University of California, San Diego; 3 units/μl), or protein kinase G (PKG; Calbiochem, 4 units/μl) in the corresponding kinase reaction buffer at 25°C.

    Techniques: In Vitro, Purification