Structured Review

Roche ncoi
The N-terminus of Lsm11 (GST-mLsm11 N136 ) binds to the C2H2 zinc finger repeats of ZFP100. ( A ) Structure of ZFP100. Dark grey box labelled ‘K’, KRAB domain; light grey boxes, C2H2 zinc finger repeats; imperfect repeats are delineated by stippled lines. ( B ) GST pull-down assays with ZFP 1–855 , ZFP 169–855 and ZFP 1–169 encoded by subcloned <t>NcoI</t> and <t>NcoI/XhoI</t> restriction fragments as indicated in (A). ( C ) GST pull-down assays performed with ZFP100 truncations obtained by PCR (see Materials and Methods). The numbers indicate the ranges of amino acids of FL ZFP100 that are present in the various truncations. ( D ) GST pull-down assay performed with the C2H2 zinc finger protein Kid-1, a renal transcription factor from rat that is not related to histone RNA processing. All templates were linearized and subjected to coupled in vitro transcription/translation in the presence of [ 35 S]methionine. The translation products were incubated with GST-mLsm11 N136 or GST (negative control) immobilized on glutathione sepharose beads. The beads were washed, and the bound material was analysed by SDS–PAGE and autoradiography. Input, 1/10 the amount used in the binding assays was analysed directly. Note that only ZFP 1–169 encoding the N-terminus of ZFP100 lacking zinc finger repeats but containing the KRAB domain does not bind to GST-mLsm11 N136 , whereas all fragments encoding zinc finger repeats bind efficiently.
Ncoi, supplied by Roche, used in various techniques. Bioz Stars score: 93/100, based on 28 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ncoi/product/Roche
Average 93 stars, based on 28 article reviews
Price from $9.99 to $1999.99
ncoi - by Bioz Stars, 2020-07
93/100 stars

Images

1) Product Images from "U7 snRNP-specific Lsm11 protein: dual binding contacts with the 100 kDa zinc finger processing factor (ZFP100) and a ZFP100-independent function in histone RNA 3? end processing"

Article Title: U7 snRNP-specific Lsm11 protein: dual binding contacts with the 100 kDa zinc finger processing factor (ZFP100) and a ZFP100-independent function in histone RNA 3? end processing

Journal: Nucleic Acids Research

doi: 10.1093/nar/gki516

The N-terminus of Lsm11 (GST-mLsm11 N136 ) binds to the C2H2 zinc finger repeats of ZFP100. ( A ) Structure of ZFP100. Dark grey box labelled ‘K’, KRAB domain; light grey boxes, C2H2 zinc finger repeats; imperfect repeats are delineated by stippled lines. ( B ) GST pull-down assays with ZFP 1–855 , ZFP 169–855 and ZFP 1–169 encoded by subcloned NcoI and NcoI/XhoI restriction fragments as indicated in (A). ( C ) GST pull-down assays performed with ZFP100 truncations obtained by PCR (see Materials and Methods). The numbers indicate the ranges of amino acids of FL ZFP100 that are present in the various truncations. ( D ) GST pull-down assay performed with the C2H2 zinc finger protein Kid-1, a renal transcription factor from rat that is not related to histone RNA processing. All templates were linearized and subjected to coupled in vitro transcription/translation in the presence of [ 35 S]methionine. The translation products were incubated with GST-mLsm11 N136 or GST (negative control) immobilized on glutathione sepharose beads. The beads were washed, and the bound material was analysed by SDS–PAGE and autoradiography. Input, 1/10 the amount used in the binding assays was analysed directly. Note that only ZFP 1–169 encoding the N-terminus of ZFP100 lacking zinc finger repeats but containing the KRAB domain does not bind to GST-mLsm11 N136 , whereas all fragments encoding zinc finger repeats bind efficiently.
Figure Legend Snippet: The N-terminus of Lsm11 (GST-mLsm11 N136 ) binds to the C2H2 zinc finger repeats of ZFP100. ( A ) Structure of ZFP100. Dark grey box labelled ‘K’, KRAB domain; light grey boxes, C2H2 zinc finger repeats; imperfect repeats are delineated by stippled lines. ( B ) GST pull-down assays with ZFP 1–855 , ZFP 169–855 and ZFP 1–169 encoded by subcloned NcoI and NcoI/XhoI restriction fragments as indicated in (A). ( C ) GST pull-down assays performed with ZFP100 truncations obtained by PCR (see Materials and Methods). The numbers indicate the ranges of amino acids of FL ZFP100 that are present in the various truncations. ( D ) GST pull-down assay performed with the C2H2 zinc finger protein Kid-1, a renal transcription factor from rat that is not related to histone RNA processing. All templates were linearized and subjected to coupled in vitro transcription/translation in the presence of [ 35 S]methionine. The translation products were incubated with GST-mLsm11 N136 or GST (negative control) immobilized on glutathione sepharose beads. The beads were washed, and the bound material was analysed by SDS–PAGE and autoradiography. Input, 1/10 the amount used in the binding assays was analysed directly. Note that only ZFP 1–169 encoding the N-terminus of ZFP100 lacking zinc finger repeats but containing the KRAB domain does not bind to GST-mLsm11 N136 , whereas all fragments encoding zinc finger repeats bind efficiently.

Techniques Used: Polymerase Chain Reaction, Pull Down Assay, In Vitro, Incubation, Negative Control, SDS Page, Autoradiography, Binding Assay

2) Product Images from "Gamma-Herpesvirus Latency Requires T Cell Evasion during Episome MaintenanceHow a Latent Virus Eludes Immune Defenses"

Article Title: Gamma-Herpesvirus Latency Requires T Cell Evasion during Episome MaintenanceHow a Latent Virus Eludes Immune Defenses

Journal: PLoS Biology

doi: 10.1371/journal.pbio.0030120

Modification of the MHV-68 Genome to Overcome cis- Acting Immune Evasion by ORF73 (A) An IRES element was inserted just downstream of ORF73, between its stop codon and that of M11. This allowed either three tandem CD8 + T cell epitopes (EPI) or GFP to be translated from the ORF73 mRNA. (B) DNA from BAC-cloned viral genomes (BAC) or virus-infected cells (VIR) was digested with NcoI, electrophoresed, transferred to nylon membranes, and blotted with a probe corresponding to the BamHI-G genomic fragment shown in (A). The predicted bands for WT virus were 1,021 bp, 3,121 bp, and 4,630 bp. The IRES-GFP insert introduced an NcoI site such that the WT 3,121-bp band was cut into 2,975-bp and 1,466-bp fragments. The NcoI site was lost from the IRES-EPI insert, such that the WT 3,121-bp band became a 3,861-bp band. (C) BHK-21 cells were infected (0.01 PFU/cell) with WT, GFP, or EPI viruses as indicated. Plaque titres of cell cultures are shown with time after infection. (D) H2 b MEF-1 cells or L929-K b cells were left uninfected (UI) or infected for 2 h with MHV-68 expressing either OVA under a strong lytic promoter (OVA) or the SIINFEKL epitope of OVA as part of the ORF73-IRES-EPI construct (EPI). B3Z cells were then added, and 18 h later their beta-galactosidase response was assayed using chlorophenol-red-beta- D -galactoside substrate. Mean ± SD values of triplicate cultures are shown. The data are from one or two equivalent experiments. (E) A20-syndecan-1 cells were infected (20 PFU/cell) with GFP − WT virus, WT virus with an HCMV IE1 promoter-driven GFP expression cassette (HCMV IE1-GFP), or with the ORF73-IRES-GFP virus. The numbers indicate the percentage of total cells in the gated region (GFP + ). Expression from the HCMV IE1 promoter is probably limited to lytic infection, whereas ORF73 is expressed in latency.
Figure Legend Snippet: Modification of the MHV-68 Genome to Overcome cis- Acting Immune Evasion by ORF73 (A) An IRES element was inserted just downstream of ORF73, between its stop codon and that of M11. This allowed either three tandem CD8 + T cell epitopes (EPI) or GFP to be translated from the ORF73 mRNA. (B) DNA from BAC-cloned viral genomes (BAC) or virus-infected cells (VIR) was digested with NcoI, electrophoresed, transferred to nylon membranes, and blotted with a probe corresponding to the BamHI-G genomic fragment shown in (A). The predicted bands for WT virus were 1,021 bp, 3,121 bp, and 4,630 bp. The IRES-GFP insert introduced an NcoI site such that the WT 3,121-bp band was cut into 2,975-bp and 1,466-bp fragments. The NcoI site was lost from the IRES-EPI insert, such that the WT 3,121-bp band became a 3,861-bp band. (C) BHK-21 cells were infected (0.01 PFU/cell) with WT, GFP, or EPI viruses as indicated. Plaque titres of cell cultures are shown with time after infection. (D) H2 b MEF-1 cells or L929-K b cells were left uninfected (UI) or infected for 2 h with MHV-68 expressing either OVA under a strong lytic promoter (OVA) or the SIINFEKL epitope of OVA as part of the ORF73-IRES-EPI construct (EPI). B3Z cells were then added, and 18 h later their beta-galactosidase response was assayed using chlorophenol-red-beta- D -galactoside substrate. Mean ± SD values of triplicate cultures are shown. The data are from one or two equivalent experiments. (E) A20-syndecan-1 cells were infected (20 PFU/cell) with GFP − WT virus, WT virus with an HCMV IE1 promoter-driven GFP expression cassette (HCMV IE1-GFP), or with the ORF73-IRES-GFP virus. The numbers indicate the percentage of total cells in the gated region (GFP + ). Expression from the HCMV IE1 promoter is probably limited to lytic infection, whereas ORF73 is expressed in latency.

Techniques Used: Modification, BAC Assay, Clone Assay, Infection, Expressing, Construct

Related Articles

Clone Assay:

Article Title: Lactobacillus reuteri 2?-Deoxyribosyltransferase, a Novel Biocatalyst for Tailoring of Nucleosides ▿ 2?-Deoxyribosyltransferase, a Novel Biocatalyst for Tailoring of Nucleosides ▿ † 2?-Deoxyribosyltransferase, a Novel Biocatalyst for Tailoring of Nucleosides ▿ † ‡
Article Snippet: .. The ndt gene was then rescued as an NcoI and BamHI fragment and cloned into the BamHI-NcoI site of pET28a(+), giving pT28 ndt , which was purified with the High Pure isolation kit (Roche, Switzerland), sequenced, and used to transform competent E. coli BL21(DE3) cells, producing the recombinant E. coli CECT 7435. ..

Article Title: U7 snRNP-specific Lsm11 protein: dual binding contacts with the 100 kDa zinc finger processing factor (ZFP100) and a ZFP100-independent function in histone RNA 3? end processing
Article Snippet: .. Human ZFP100 clones A pSP64 plasmid encoding human ZFP100 ( ) (a gift from Z. Dominski, UNC Chapel Hill) was digested with NcoI or NcoI/XhoI, and appropriate restriction fragments were cloned in the pIVEX2.4d vector (Roche) for in vitro translation. .. Additional ZFP100 fragments to be used for in vitro transcription/translation were generated by PCR with Pfu DNA polymerase and cloned into the pCRII-TOPO vector (Invitrogen).

Article Title: The FOXG1/FOXO/SMAD network balances proliferation and differentiation of cortical progenitors and activates Kcnh3 expression in mature neurons
Article Snippet: .. The cloning product was linearized through digestion with NcoI (sense probe) or SacI (antisense probe) and transcribed with SP6- or T7-RNA polymerases (Roche), respectively. .. Forebrain slices were hybridized with digoxigenin-labelled riboprobes in hybridization buffer (12.7 mM Tris base, 184.4 mM NaCl, 5.9 mM NaH2 PO4 , 6.27 mM Na2 HPO4 , 5 mM EDTA pH 8.0, 0.5x Denhardt's solution, 1 mg/ml Yeast RNA, 10% Dextran sulfate, 50% v/v Formamide) at 68°C overnight.

Agarose Gel Electrophoresis:

Article Title: Gamma-Herpesvirus Latency Requires T Cell Evasion during Episome MaintenanceHow a Latent Virus Eludes Immune Defenses
Article Snippet: .. Southern blotting Viral DNA was isolated from infected BHK-21 cells by alkaline lysis [ ], digested with NcoI, electrophoresed on a 0.8% agarose gel, and transferred to positively charged nylon membranes (Roche Diagnostics). .. A 32 P-dCTP-labelled probe (APBiotech, Amersham, United Kingdom) was generated from the BamHI-G genomic fragment by random primer extension (Nonaprimer kit, Qbiogene, Bingham, United Kingdom) according to the manufacturer's instructions.

In Vitro:

Article Title: flam piRNA precursors channel from the nucleus to the cytoplasm in a temporally regulated manner along Drosophila oogenesis
Article Snippet: .. Riboprobe was synthesized by digestion of pGEMT easy plasmids with NcoI or SpeI enzyme, followed by in vitro transcription using Sp6 or T7 polymerase and digoxygenin labeled UTP (Roche), DNAse I treatment and purification. .. RNA FISH on ovaries was performed as previously described [ ].

Article Title: "Dot COM", a Nuclear Transit Center for the Primary piRNA Pathway in Drosophila
Article Snippet: .. In Situ Hybridization Riboprobes were synthesized by digestion of pGEMT easy plasmids with NcoI or SpeI enzyme, followed by in vitro transcription using Sp6 or T7 polymerase and digoxygenin or fluorescein labeled UTP (Roche), DNAse I treatment and purification. .. DIG labeled Het-A probes are made with following primer sets with the PCR DIG probe synthesis kit from Roche: ACTACTGCAAGCACTTGTG and GTCTGCTCGTCGGATACTCA ; AGCTCAGCAATCCTGAGCA and AGACGTTAGGGTTGAGTGTT ; CAACAGACCACAGCCATCAT and TTTAACTTTGCTGGTGGAGGTAC .

Article Title: U7 snRNP-specific Lsm11 protein: dual binding contacts with the 100 kDa zinc finger processing factor (ZFP100) and a ZFP100-independent function in histone RNA 3? end processing
Article Snippet: .. Human ZFP100 clones A pSP64 plasmid encoding human ZFP100 ( ) (a gift from Z. Dominski, UNC Chapel Hill) was digested with NcoI or NcoI/XhoI, and appropriate restriction fragments were cloned in the pIVEX2.4d vector (Roche) for in vitro translation. .. Additional ZFP100 fragments to be used for in vitro transcription/translation were generated by PCR with Pfu DNA polymerase and cloned into the pCRII-TOPO vector (Invitrogen).

Southern Blot:

Article Title: Gamma-Herpesvirus Latency Requires T Cell Evasion during Episome MaintenanceHow a Latent Virus Eludes Immune Defenses
Article Snippet: .. Southern blotting Viral DNA was isolated from infected BHK-21 cells by alkaline lysis [ ], digested with NcoI, electrophoresed on a 0.8% agarose gel, and transferred to positively charged nylon membranes (Roche Diagnostics). .. A 32 P-dCTP-labelled probe (APBiotech, Amersham, United Kingdom) was generated from the BamHI-G genomic fragment by random primer extension (Nonaprimer kit, Qbiogene, Bingham, United Kingdom) according to the manufacturer's instructions.

Synthesized:

Article Title: flam piRNA precursors channel from the nucleus to the cytoplasm in a temporally regulated manner along Drosophila oogenesis
Article Snippet: .. Riboprobe was synthesized by digestion of pGEMT easy plasmids with NcoI or SpeI enzyme, followed by in vitro transcription using Sp6 or T7 polymerase and digoxygenin labeled UTP (Roche), DNAse I treatment and purification. .. RNA FISH on ovaries was performed as previously described [ ].

Article Title: "Dot COM", a Nuclear Transit Center for the Primary piRNA Pathway in Drosophila
Article Snippet: .. In Situ Hybridization Riboprobes were synthesized by digestion of pGEMT easy plasmids with NcoI or SpeI enzyme, followed by in vitro transcription using Sp6 or T7 polymerase and digoxygenin or fluorescein labeled UTP (Roche), DNAse I treatment and purification. .. DIG labeled Het-A probes are made with following primer sets with the PCR DIG probe synthesis kit from Roche: ACTACTGCAAGCACTTGTG and GTCTGCTCGTCGGATACTCA ; AGCTCAGCAATCCTGAGCA and AGACGTTAGGGTTGAGTGTT ; CAACAGACCACAGCCATCAT and TTTAACTTTGCTGGTGGAGGTAC .

Isolation:

Article Title: Gamma-Herpesvirus Latency Requires T Cell Evasion during Episome MaintenanceHow a Latent Virus Eludes Immune Defenses
Article Snippet: .. Southern blotting Viral DNA was isolated from infected BHK-21 cells by alkaline lysis [ ], digested with NcoI, electrophoresed on a 0.8% agarose gel, and transferred to positively charged nylon membranes (Roche Diagnostics). .. A 32 P-dCTP-labelled probe (APBiotech, Amersham, United Kingdom) was generated from the BamHI-G genomic fragment by random primer extension (Nonaprimer kit, Qbiogene, Bingham, United Kingdom) according to the manufacturer's instructions.

Article Title: Lactobacillus reuteri 2?-Deoxyribosyltransferase, a Novel Biocatalyst for Tailoring of Nucleosides ▿ 2?-Deoxyribosyltransferase, a Novel Biocatalyst for Tailoring of Nucleosides ▿ † 2?-Deoxyribosyltransferase, a Novel Biocatalyst for Tailoring of Nucleosides ▿ † ‡
Article Snippet: .. The ndt gene was then rescued as an NcoI and BamHI fragment and cloned into the BamHI-NcoI site of pET28a(+), giving pT28 ndt , which was purified with the High Pure isolation kit (Roche, Switzerland), sequenced, and used to transform competent E. coli BL21(DE3) cells, producing the recombinant E. coli CECT 7435. ..

Infection:

Article Title: Gamma-Herpesvirus Latency Requires T Cell Evasion during Episome MaintenanceHow a Latent Virus Eludes Immune Defenses
Article Snippet: .. Southern blotting Viral DNA was isolated from infected BHK-21 cells by alkaline lysis [ ], digested with NcoI, electrophoresed on a 0.8% agarose gel, and transferred to positively charged nylon membranes (Roche Diagnostics). .. A 32 P-dCTP-labelled probe (APBiotech, Amersham, United Kingdom) was generated from the BamHI-G genomic fragment by random primer extension (Nonaprimer kit, Qbiogene, Bingham, United Kingdom) according to the manufacturer's instructions.

Purification:

Article Title: Lactobacillus reuteri 2?-Deoxyribosyltransferase, a Novel Biocatalyst for Tailoring of Nucleosides ▿ 2?-Deoxyribosyltransferase, a Novel Biocatalyst for Tailoring of Nucleosides ▿ † 2?-Deoxyribosyltransferase, a Novel Biocatalyst for Tailoring of Nucleosides ▿ † ‡
Article Snippet: .. The ndt gene was then rescued as an NcoI and BamHI fragment and cloned into the BamHI-NcoI site of pET28a(+), giving pT28 ndt , which was purified with the High Pure isolation kit (Roche, Switzerland), sequenced, and used to transform competent E. coli BL21(DE3) cells, producing the recombinant E. coli CECT 7435. ..

Article Title: flam piRNA precursors channel from the nucleus to the cytoplasm in a temporally regulated manner along Drosophila oogenesis
Article Snippet: .. Riboprobe was synthesized by digestion of pGEMT easy plasmids with NcoI or SpeI enzyme, followed by in vitro transcription using Sp6 or T7 polymerase and digoxygenin labeled UTP (Roche), DNAse I treatment and purification. .. RNA FISH on ovaries was performed as previously described [ ].

Article Title: "Dot COM", a Nuclear Transit Center for the Primary piRNA Pathway in Drosophila
Article Snippet: .. In Situ Hybridization Riboprobes were synthesized by digestion of pGEMT easy plasmids with NcoI or SpeI enzyme, followed by in vitro transcription using Sp6 or T7 polymerase and digoxygenin or fluorescein labeled UTP (Roche), DNAse I treatment and purification. .. DIG labeled Het-A probes are made with following primer sets with the PCR DIG probe synthesis kit from Roche: ACTACTGCAAGCACTTGTG and GTCTGCTCGTCGGATACTCA ; AGCTCAGCAATCCTGAGCA and AGACGTTAGGGTTGAGTGTT ; CAACAGACCACAGCCATCAT and TTTAACTTTGCTGGTGGAGGTAC .

Alkaline Lysis:

Article Title: Gamma-Herpesvirus Latency Requires T Cell Evasion during Episome MaintenanceHow a Latent Virus Eludes Immune Defenses
Article Snippet: .. Southern blotting Viral DNA was isolated from infected BHK-21 cells by alkaline lysis [ ], digested with NcoI, electrophoresed on a 0.8% agarose gel, and transferred to positively charged nylon membranes (Roche Diagnostics). .. A 32 P-dCTP-labelled probe (APBiotech, Amersham, United Kingdom) was generated from the BamHI-G genomic fragment by random primer extension (Nonaprimer kit, Qbiogene, Bingham, United Kingdom) according to the manufacturer's instructions.

Labeling:

Article Title: flam piRNA precursors channel from the nucleus to the cytoplasm in a temporally regulated manner along Drosophila oogenesis
Article Snippet: .. Riboprobe was synthesized by digestion of pGEMT easy plasmids with NcoI or SpeI enzyme, followed by in vitro transcription using Sp6 or T7 polymerase and digoxygenin labeled UTP (Roche), DNAse I treatment and purification. .. RNA FISH on ovaries was performed as previously described [ ].

Article Title: "Dot COM", a Nuclear Transit Center for the Primary piRNA Pathway in Drosophila
Article Snippet: .. In Situ Hybridization Riboprobes were synthesized by digestion of pGEMT easy plasmids with NcoI or SpeI enzyme, followed by in vitro transcription using Sp6 or T7 polymerase and digoxygenin or fluorescein labeled UTP (Roche), DNAse I treatment and purification. .. DIG labeled Het-A probes are made with following primer sets with the PCR DIG probe synthesis kit from Roche: ACTACTGCAAGCACTTGTG and GTCTGCTCGTCGGATACTCA ; AGCTCAGCAATCCTGAGCA and AGACGTTAGGGTTGAGTGTT ; CAACAGACCACAGCCATCAT and TTTAACTTTGCTGGTGGAGGTAC .

Expressing:

Article Title: Ebola virus glycoprotein Fc fusion protein confers protection against lethal challenge in vaccinated mice
Article Snippet: .. The GP region was excised from pVR-1012-ZEBOV-GP using NcoI and Asp718 (Roche Applied Science) restriction enzymes, filled in with DNA polymerase Klenow (New England Biolabs) enzyme to create blunt ends and subsequently cloned into the EcoRV site of the mammalian expression plasmid pEF1/Myc-His-B (Invitrogen). .. The resulting plasmid was termed pEF1-EBOV-GP.

Recombinant:

Article Title: Lactobacillus reuteri 2?-Deoxyribosyltransferase, a Novel Biocatalyst for Tailoring of Nucleosides ▿ 2?-Deoxyribosyltransferase, a Novel Biocatalyst for Tailoring of Nucleosides ▿ † 2?-Deoxyribosyltransferase, a Novel Biocatalyst for Tailoring of Nucleosides ▿ † ‡
Article Snippet: .. The ndt gene was then rescued as an NcoI and BamHI fragment and cloned into the BamHI-NcoI site of pET28a(+), giving pT28 ndt , which was purified with the High Pure isolation kit (Roche, Switzerland), sequenced, and used to transform competent E. coli BL21(DE3) cells, producing the recombinant E. coli CECT 7435. ..

In Situ Hybridization:

Article Title: "Dot COM", a Nuclear Transit Center for the Primary piRNA Pathway in Drosophila
Article Snippet: .. In Situ Hybridization Riboprobes were synthesized by digestion of pGEMT easy plasmids with NcoI or SpeI enzyme, followed by in vitro transcription using Sp6 or T7 polymerase and digoxygenin or fluorescein labeled UTP (Roche), DNAse I treatment and purification. .. DIG labeled Het-A probes are made with following primer sets with the PCR DIG probe synthesis kit from Roche: ACTACTGCAAGCACTTGTG and GTCTGCTCGTCGGATACTCA ; AGCTCAGCAATCCTGAGCA and AGACGTTAGGGTTGAGTGTT ; CAACAGACCACAGCCATCAT and TTTAACTTTGCTGGTGGAGGTAC .

Plasmid Preparation:

Article Title: Preparation of Group I Introns for Biochemical Studies and Crystallization Assays by Native Affinity Purification
Article Snippet: .. The pRAV12 vector had been previously digested using the EcoRI and NcoI or NgoMIV restriction enzymes and dephosphorylated using 1.0 U calf intestine alkaline phosphatase (Roche #713023) for 30 min at 37°C followed by 20 min at 70°C. .. 1.0 µL of the ligation reaction mix was used to transform 10 µL of Solopack Gold Supercompetent cells (Stratagene #230350).

Article Title: U7 snRNP-specific Lsm11 protein: dual binding contacts with the 100 kDa zinc finger processing factor (ZFP100) and a ZFP100-independent function in histone RNA 3? end processing
Article Snippet: .. Human ZFP100 clones A pSP64 plasmid encoding human ZFP100 ( ) (a gift from Z. Dominski, UNC Chapel Hill) was digested with NcoI or NcoI/XhoI, and appropriate restriction fragments were cloned in the pIVEX2.4d vector (Roche) for in vitro translation. .. Additional ZFP100 fragments to be used for in vitro transcription/translation were generated by PCR with Pfu DNA polymerase and cloned into the pCRII-TOPO vector (Invitrogen).

Article Title: Ebola virus glycoprotein Fc fusion protein confers protection against lethal challenge in vaccinated mice
Article Snippet: .. The GP region was excised from pVR-1012-ZEBOV-GP using NcoI and Asp718 (Roche Applied Science) restriction enzymes, filled in with DNA polymerase Klenow (New England Biolabs) enzyme to create blunt ends and subsequently cloned into the EcoRV site of the mammalian expression plasmid pEF1/Myc-His-B (Invitrogen). .. The resulting plasmid was termed pEF1-EBOV-GP.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 89
    Roche ncoi xhoi
    The N-terminus of Lsm11 (GST-mLsm11 N136 ) binds to the C2H2 zinc finger repeats of ZFP100. ( A ) Structure of ZFP100. Dark grey box labelled ‘K’, KRAB domain; light grey boxes, C2H2 zinc finger repeats; imperfect repeats are delineated by stippled lines. ( B ) GST pull-down assays with ZFP 1–855 , ZFP 169–855 and ZFP 1–169 encoded by subcloned <t>NcoI</t> and <t>NcoI/XhoI</t> restriction fragments as indicated in (A). ( C ) GST pull-down assays performed with ZFP100 truncations obtained by PCR (see Materials and Methods). The numbers indicate the ranges of amino acids of FL ZFP100 that are present in the various truncations. ( D ) GST pull-down assay performed with the C2H2 zinc finger protein Kid-1, a renal transcription factor from rat that is not related to histone RNA processing. All templates were linearized and subjected to coupled in vitro transcription/translation in the presence of [ 35 S]methionine. The translation products were incubated with GST-mLsm11 N136 or GST (negative control) immobilized on glutathione sepharose beads. The beads were washed, and the bound material was analysed by SDS–PAGE and autoradiography. Input, 1/10 the amount used in the binding assays was analysed directly. Note that only ZFP 1–169 encoding the N-terminus of ZFP100 lacking zinc finger repeats but containing the KRAB domain does not bind to GST-mLsm11 N136 , whereas all fragments encoding zinc finger repeats bind efficiently.
    Ncoi Xhoi, supplied by Roche, used in various techniques. Bioz Stars score: 89/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ncoi xhoi/product/Roche
    Average 89 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    ncoi xhoi - by Bioz Stars, 2020-07
    89/100 stars
      Buy from Supplier

    ncoi  (Roche)
    93
    Roche ncoi
    The N-terminus of Lsm11 (GST-mLsm11 N136 ) binds to the C2H2 zinc finger repeats of ZFP100. ( A ) Structure of ZFP100. Dark grey box labelled ‘K’, KRAB domain; light grey boxes, C2H2 zinc finger repeats; imperfect repeats are delineated by stippled lines. ( B ) GST pull-down assays with ZFP 1–855 , ZFP 169–855 and ZFP 1–169 encoded by subcloned <t>NcoI</t> and <t>NcoI/XhoI</t> restriction fragments as indicated in (A). ( C ) GST pull-down assays performed with ZFP100 truncations obtained by PCR (see Materials and Methods). The numbers indicate the ranges of amino acids of FL ZFP100 that are present in the various truncations. ( D ) GST pull-down assay performed with the C2H2 zinc finger protein Kid-1, a renal transcription factor from rat that is not related to histone RNA processing. All templates were linearized and subjected to coupled in vitro transcription/translation in the presence of [ 35 S]methionine. The translation products were incubated with GST-mLsm11 N136 or GST (negative control) immobilized on glutathione sepharose beads. The beads were washed, and the bound material was analysed by SDS–PAGE and autoradiography. Input, 1/10 the amount used in the binding assays was analysed directly. Note that only ZFP 1–169 encoding the N-terminus of ZFP100 lacking zinc finger repeats but containing the KRAB domain does not bind to GST-mLsm11 N136 , whereas all fragments encoding zinc finger repeats bind efficiently.
    Ncoi, supplied by Roche, used in various techniques. Bioz Stars score: 93/100, based on 28 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ncoi/product/Roche
    Average 93 stars, based on 28 article reviews
    Price from $9.99 to $1999.99
    ncoi - by Bioz Stars, 2020-07
    93/100 stars
      Buy from Supplier

    Image Search Results


    The N-terminus of Lsm11 (GST-mLsm11 N136 ) binds to the C2H2 zinc finger repeats of ZFP100. ( A ) Structure of ZFP100. Dark grey box labelled ‘K’, KRAB domain; light grey boxes, C2H2 zinc finger repeats; imperfect repeats are delineated by stippled lines. ( B ) GST pull-down assays with ZFP 1–855 , ZFP 169–855 and ZFP 1–169 encoded by subcloned NcoI and NcoI/XhoI restriction fragments as indicated in (A). ( C ) GST pull-down assays performed with ZFP100 truncations obtained by PCR (see Materials and Methods). The numbers indicate the ranges of amino acids of FL ZFP100 that are present in the various truncations. ( D ) GST pull-down assay performed with the C2H2 zinc finger protein Kid-1, a renal transcription factor from rat that is not related to histone RNA processing. All templates were linearized and subjected to coupled in vitro transcription/translation in the presence of [ 35 S]methionine. The translation products were incubated with GST-mLsm11 N136 or GST (negative control) immobilized on glutathione sepharose beads. The beads were washed, and the bound material was analysed by SDS–PAGE and autoradiography. Input, 1/10 the amount used in the binding assays was analysed directly. Note that only ZFP 1–169 encoding the N-terminus of ZFP100 lacking zinc finger repeats but containing the KRAB domain does not bind to GST-mLsm11 N136 , whereas all fragments encoding zinc finger repeats bind efficiently.

    Journal: Nucleic Acids Research

    Article Title: U7 snRNP-specific Lsm11 protein: dual binding contacts with the 100 kDa zinc finger processing factor (ZFP100) and a ZFP100-independent function in histone RNA 3? end processing

    doi: 10.1093/nar/gki516

    Figure Lengend Snippet: The N-terminus of Lsm11 (GST-mLsm11 N136 ) binds to the C2H2 zinc finger repeats of ZFP100. ( A ) Structure of ZFP100. Dark grey box labelled ‘K’, KRAB domain; light grey boxes, C2H2 zinc finger repeats; imperfect repeats are delineated by stippled lines. ( B ) GST pull-down assays with ZFP 1–855 , ZFP 169–855 and ZFP 1–169 encoded by subcloned NcoI and NcoI/XhoI restriction fragments as indicated in (A). ( C ) GST pull-down assays performed with ZFP100 truncations obtained by PCR (see Materials and Methods). The numbers indicate the ranges of amino acids of FL ZFP100 that are present in the various truncations. ( D ) GST pull-down assay performed with the C2H2 zinc finger protein Kid-1, a renal transcription factor from rat that is not related to histone RNA processing. All templates were linearized and subjected to coupled in vitro transcription/translation in the presence of [ 35 S]methionine. The translation products were incubated with GST-mLsm11 N136 or GST (negative control) immobilized on glutathione sepharose beads. The beads were washed, and the bound material was analysed by SDS–PAGE and autoradiography. Input, 1/10 the amount used in the binding assays was analysed directly. Note that only ZFP 1–169 encoding the N-terminus of ZFP100 lacking zinc finger repeats but containing the KRAB domain does not bind to GST-mLsm11 N136 , whereas all fragments encoding zinc finger repeats bind efficiently.

    Article Snippet: Human ZFP100 clones A pSP64 plasmid encoding human ZFP100 ( ) (a gift from Z. Dominski, UNC Chapel Hill) was digested with NcoI or NcoI/XhoI, and appropriate restriction fragments were cloned in the pIVEX2.4d vector (Roche) for in vitro translation.

    Techniques: Polymerase Chain Reaction, Pull Down Assay, In Vitro, Incubation, Negative Control, SDS Page, Autoradiography, Binding Assay

    The N-terminus of Lsm11 (GST-mLsm11 N136 ) binds to the C2H2 zinc finger repeats of ZFP100. ( A ) Structure of ZFP100. Dark grey box labelled ‘K’, KRAB domain; light grey boxes, C2H2 zinc finger repeats; imperfect repeats are delineated by stippled lines. ( B ) GST pull-down assays with ZFP 1–855 , ZFP 169–855 and ZFP 1–169 encoded by subcloned NcoI and NcoI/XhoI restriction fragments as indicated in (A). ( C ) GST pull-down assays performed with ZFP100 truncations obtained by PCR (see Materials and Methods). The numbers indicate the ranges of amino acids of FL ZFP100 that are present in the various truncations. ( D ) GST pull-down assay performed with the C2H2 zinc finger protein Kid-1, a renal transcription factor from rat that is not related to histone RNA processing. All templates were linearized and subjected to coupled in vitro transcription/translation in the presence of [ 35 S]methionine. The translation products were incubated with GST-mLsm11 N136 or GST (negative control) immobilized on glutathione sepharose beads. The beads were washed, and the bound material was analysed by SDS–PAGE and autoradiography. Input, 1/10 the amount used in the binding assays was analysed directly. Note that only ZFP 1–169 encoding the N-terminus of ZFP100 lacking zinc finger repeats but containing the KRAB domain does not bind to GST-mLsm11 N136 , whereas all fragments encoding zinc finger repeats bind efficiently.

    Journal: Nucleic Acids Research

    Article Title: U7 snRNP-specific Lsm11 protein: dual binding contacts with the 100 kDa zinc finger processing factor (ZFP100) and a ZFP100-independent function in histone RNA 3? end processing

    doi: 10.1093/nar/gki516

    Figure Lengend Snippet: The N-terminus of Lsm11 (GST-mLsm11 N136 ) binds to the C2H2 zinc finger repeats of ZFP100. ( A ) Structure of ZFP100. Dark grey box labelled ‘K’, KRAB domain; light grey boxes, C2H2 zinc finger repeats; imperfect repeats are delineated by stippled lines. ( B ) GST pull-down assays with ZFP 1–855 , ZFP 169–855 and ZFP 1–169 encoded by subcloned NcoI and NcoI/XhoI restriction fragments as indicated in (A). ( C ) GST pull-down assays performed with ZFP100 truncations obtained by PCR (see Materials and Methods). The numbers indicate the ranges of amino acids of FL ZFP100 that are present in the various truncations. ( D ) GST pull-down assay performed with the C2H2 zinc finger protein Kid-1, a renal transcription factor from rat that is not related to histone RNA processing. All templates were linearized and subjected to coupled in vitro transcription/translation in the presence of [ 35 S]methionine. The translation products were incubated with GST-mLsm11 N136 or GST (negative control) immobilized on glutathione sepharose beads. The beads were washed, and the bound material was analysed by SDS–PAGE and autoradiography. Input, 1/10 the amount used in the binding assays was analysed directly. Note that only ZFP 1–169 encoding the N-terminus of ZFP100 lacking zinc finger repeats but containing the KRAB domain does not bind to GST-mLsm11 N136 , whereas all fragments encoding zinc finger repeats bind efficiently.

    Article Snippet: Human ZFP100 clones A pSP64 plasmid encoding human ZFP100 ( ) (a gift from Z. Dominski, UNC Chapel Hill) was digested with NcoI or NcoI/XhoI, and appropriate restriction fragments were cloned in the pIVEX2.4d vector (Roche) for in vitro translation.

    Techniques: Polymerase Chain Reaction, Pull Down Assay, In Vitro, Incubation, Negative Control, SDS Page, Autoradiography, Binding Assay

    Modification of the MHV-68 Genome to Overcome cis- Acting Immune Evasion by ORF73 (A) An IRES element was inserted just downstream of ORF73, between its stop codon and that of M11. This allowed either three tandem CD8 + T cell epitopes (EPI) or GFP to be translated from the ORF73 mRNA. (B) DNA from BAC-cloned viral genomes (BAC) or virus-infected cells (VIR) was digested with NcoI, electrophoresed, transferred to nylon membranes, and blotted with a probe corresponding to the BamHI-G genomic fragment shown in (A). The predicted bands for WT virus were 1,021 bp, 3,121 bp, and 4,630 bp. The IRES-GFP insert introduced an NcoI site such that the WT 3,121-bp band was cut into 2,975-bp and 1,466-bp fragments. The NcoI site was lost from the IRES-EPI insert, such that the WT 3,121-bp band became a 3,861-bp band. (C) BHK-21 cells were infected (0.01 PFU/cell) with WT, GFP, or EPI viruses as indicated. Plaque titres of cell cultures are shown with time after infection. (D) H2 b MEF-1 cells or L929-K b cells were left uninfected (UI) or infected for 2 h with MHV-68 expressing either OVA under a strong lytic promoter (OVA) or the SIINFEKL epitope of OVA as part of the ORF73-IRES-EPI construct (EPI). B3Z cells were then added, and 18 h later their beta-galactosidase response was assayed using chlorophenol-red-beta- D -galactoside substrate. Mean ± SD values of triplicate cultures are shown. The data are from one or two equivalent experiments. (E) A20-syndecan-1 cells were infected (20 PFU/cell) with GFP − WT virus, WT virus with an HCMV IE1 promoter-driven GFP expression cassette (HCMV IE1-GFP), or with the ORF73-IRES-GFP virus. The numbers indicate the percentage of total cells in the gated region (GFP + ). Expression from the HCMV IE1 promoter is probably limited to lytic infection, whereas ORF73 is expressed in latency.

    Journal: PLoS Biology

    Article Title: Gamma-Herpesvirus Latency Requires T Cell Evasion during Episome MaintenanceHow a Latent Virus Eludes Immune Defenses

    doi: 10.1371/journal.pbio.0030120

    Figure Lengend Snippet: Modification of the MHV-68 Genome to Overcome cis- Acting Immune Evasion by ORF73 (A) An IRES element was inserted just downstream of ORF73, between its stop codon and that of M11. This allowed either three tandem CD8 + T cell epitopes (EPI) or GFP to be translated from the ORF73 mRNA. (B) DNA from BAC-cloned viral genomes (BAC) or virus-infected cells (VIR) was digested with NcoI, electrophoresed, transferred to nylon membranes, and blotted with a probe corresponding to the BamHI-G genomic fragment shown in (A). The predicted bands for WT virus were 1,021 bp, 3,121 bp, and 4,630 bp. The IRES-GFP insert introduced an NcoI site such that the WT 3,121-bp band was cut into 2,975-bp and 1,466-bp fragments. The NcoI site was lost from the IRES-EPI insert, such that the WT 3,121-bp band became a 3,861-bp band. (C) BHK-21 cells were infected (0.01 PFU/cell) with WT, GFP, or EPI viruses as indicated. Plaque titres of cell cultures are shown with time after infection. (D) H2 b MEF-1 cells or L929-K b cells were left uninfected (UI) or infected for 2 h with MHV-68 expressing either OVA under a strong lytic promoter (OVA) or the SIINFEKL epitope of OVA as part of the ORF73-IRES-EPI construct (EPI). B3Z cells were then added, and 18 h later their beta-galactosidase response was assayed using chlorophenol-red-beta- D -galactoside substrate. Mean ± SD values of triplicate cultures are shown. The data are from one or two equivalent experiments. (E) A20-syndecan-1 cells were infected (20 PFU/cell) with GFP − WT virus, WT virus with an HCMV IE1 promoter-driven GFP expression cassette (HCMV IE1-GFP), or with the ORF73-IRES-GFP virus. The numbers indicate the percentage of total cells in the gated region (GFP + ). Expression from the HCMV IE1 promoter is probably limited to lytic infection, whereas ORF73 is expressed in latency.

    Article Snippet: Southern blotting Viral DNA was isolated from infected BHK-21 cells by alkaline lysis [ ], digested with NcoI, electrophoresed on a 0.8% agarose gel, and transferred to positively charged nylon membranes (Roche Diagnostics).

    Techniques: Modification, BAC Assay, Clone Assay, Infection, Expressing, Construct