mutational analysis dna  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Name:
    3500xL Genetic Analyzer for Resequencing Fragment Analysis
    Description:
    The 3500xL 24 capillary platform can run a wide variety of applications including de novo sequencing and resequencing mutational profiling as well as microsatellite analysis MLPA LOH MLST AFLP and SNP validation or screening The majority of applications can be run on a single polymer and capillary array This package includes a 24 capillary instrument 3500 Series Data Collection Software a Dell Workstation and monitor as well as reagent kits for system qualification and secondary analysis software The 3500 Series Data Collection Software supports sequencing and fragment analysis and integrates seamlessly with downstream software for secondary analysis of genetic data This package includes such secondary software GeneMapper software for fragment analysis and software for resequencing applications Features include • An 8 capillary system that can easily be upgraded to a 24 capillary system when you re ready • Single line 505 nm solid state long life laser that utilizes a standard power supply and requires no heat removal ducting • Powerful integrated data collection and primary analysis software provides real time assessment of data quality • Radio frequency identification RFID technology tracks key consumables data and records administrative information • Advanced multiplexing capabilities for DNA fragment analysis with up to six unique dyes • Unrivaled application flexibility one array and one polymer are used for most applications • Simple setup operation and maintenanceAccurate Reliable Data QualityThe 3500 series systems significantly improves signal uniformity from instrument to instrument run to run and capillary to capillary With a combination of intelligent hardware powerful new algorithm and reagent combinations these methods provide major reduction in the range of signal peak heights obtained across multiple 3500 series instruments see figure Improved Sizing PrecisionNew thermal sub system design gives enhanced performance in demanding fragment applications enabling improved sizing precision versus previous generations of capillary electrophoresis platforms Ready to Use Consumables With RFID TagsThe 3500 series introduces ready to use consumables with pre packaged polymer pouches cathode and anode buffer containers and easy to install capillary arrays Each of these consumables is integrated with RFID tags that enable viewing tracking and reporting of critical information about reagents and consumables including usage lot number part number expiry date and on instrument lifetime within the 3500 Series Data Collection Software Easy to Use Data Collection Software3500 Series Data Collection software breaks new ground in user friendly navigation with an intuitive dashboard design highly visible buttons for common operations easy to read graphical displays to monitor the state of consumables and handy maintenance scheduling calendar functionality New functionality includes simplified plate set up and built in primary analysis with quality control so you can make decisions about the quality of data as it is produced on the instrument without the need to transfer output files into secondary analysis software packages
    Catalog Number:
    4440463
    Price:
    None
    Category:
    Instruments and Equipment
    Applications:
    Amplified Fragment Length Polymorphism-AFLP®|DNA Sequencing|Fragment Analysis|Genotyping & Genomic Profiling|HiCep (High-Coverage Expression Profiling)|Microsatellite Marker Analysis|RNA Sequencing|Resequencing|SNP Genotyping by Fragment-Analysis|Sanger Sequencing|Sanger Sequencing Technology & Accessories|Sequencing|Microsatellite STR Analysis|Restriction Fragment Length Polymorphisms (RFLP) Analysis|Single-Strand Conformation Polymorphism (SSCP) Analysis|Gene Expression Analysis & Genotyping|Gene Expression Profiling by Sequencing|Genotyping Instruments, Software & Calibration
    Buy from Supplier


    Structured Review

    Thermo Fisher mutational analysis dna
    p53 immunohistochemistry of the two remaining discordant cases after consensus. NA, not applicable. For the first case (upper panel), consensus was reached on a mid‐epithelial p53 immunohistochemistry (IHC) expression pattern with basal sparing (indicated by arrow), while the tumour showed a pathogenic TP53 mutation with a high variant allele frequency (VAF). An additional p16–IHC could prevent misinterpretation of the final p53 IHC class due to the absence of ‘block‐type’ p16 expression. Because of suboptimal staining, an alternative block of the same case was stained for p53 and a diffuse expression of p53 was observed. Moreover, after revising all haematoxylin and eosin (H E) staining of this tumour revealed the presence of differentiated type, vulvar intra‐epithelial neoplasia (dVIN) as a precursor lesion, which increases the probability of harbouring TP53 mutations. The second case (lower panel) was also human papillomavirus (HPV)‐unrelated, and scored scattered by both observers. We cannot explain the discordancy between the final p53 IHC class and <t>mutational</t> <t>analysis</t> of this case, although the VAF was low but reliable. Scale bar 20 µm.
    The 3500xL 24 capillary platform can run a wide variety of applications including de novo sequencing and resequencing mutational profiling as well as microsatellite analysis MLPA LOH MLST AFLP and SNP validation or screening The majority of applications can be run on a single polymer and capillary array This package includes a 24 capillary instrument 3500 Series Data Collection Software a Dell Workstation and monitor as well as reagent kits for system qualification and secondary analysis software The 3500 Series Data Collection Software supports sequencing and fragment analysis and integrates seamlessly with downstream software for secondary analysis of genetic data This package includes such secondary software GeneMapper software for fragment analysis and software for resequencing applications Features include • An 8 capillary system that can easily be upgraded to a 24 capillary system when you re ready • Single line 505 nm solid state long life laser that utilizes a standard power supply and requires no heat removal ducting • Powerful integrated data collection and primary analysis software provides real time assessment of data quality • Radio frequency identification RFID technology tracks key consumables data and records administrative information • Advanced multiplexing capabilities for DNA fragment analysis with up to six unique dyes • Unrivaled application flexibility one array and one polymer are used for most applications • Simple setup operation and maintenanceAccurate Reliable Data QualityThe 3500 series systems significantly improves signal uniformity from instrument to instrument run to run and capillary to capillary With a combination of intelligent hardware powerful new algorithm and reagent combinations these methods provide major reduction in the range of signal peak heights obtained across multiple 3500 series instruments see figure Improved Sizing PrecisionNew thermal sub system design gives enhanced performance in demanding fragment applications enabling improved sizing precision versus previous generations of capillary electrophoresis platforms Ready to Use Consumables With RFID TagsThe 3500 series introduces ready to use consumables with pre packaged polymer pouches cathode and anode buffer containers and easy to install capillary arrays Each of these consumables is integrated with RFID tags that enable viewing tracking and reporting of critical information about reagents and consumables including usage lot number part number expiry date and on instrument lifetime within the 3500 Series Data Collection Software Easy to Use Data Collection Software3500 Series Data Collection software breaks new ground in user friendly navigation with an intuitive dashboard design highly visible buttons for common operations easy to read graphical displays to monitor the state of consumables and handy maintenance scheduling calendar functionality New functionality includes simplified plate set up and built in primary analysis with quality control so you can make decisions about the quality of data as it is produced on the instrument without the need to transfer output files into secondary analysis software packages
    https://www.bioz.com/result/mutational analysis dna/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mutational analysis dna - by Bioz Stars, 2021-04
    86/100 stars

    Images

    1) Product Images from "Performance of the pattern‐based interpretation of p53 immunohistochemistry as a surrogate for TP53 mutations in vulvar squamous cell carcinomaPerformance of the pattern‐based interpretation of p53 immunohistochemistry as a surrogate for TP53 mutations in vulvar squamous cell carcinoma"

    Article Title: Performance of the pattern‐based interpretation of p53 immunohistochemistry as a surrogate for TP53 mutations in vulvar squamous cell carcinomaPerformance of the pattern‐based interpretation of p53 immunohistochemistry as a surrogate for TP53 mutations in vulvar squamous cell carcinoma

    Journal: Histopathology

    doi: 10.1111/his.14109

    p53 immunohistochemistry of the two remaining discordant cases after consensus. NA, not applicable. For the first case (upper panel), consensus was reached on a mid‐epithelial p53 immunohistochemistry (IHC) expression pattern with basal sparing (indicated by arrow), while the tumour showed a pathogenic TP53 mutation with a high variant allele frequency (VAF). An additional p16–IHC could prevent misinterpretation of the final p53 IHC class due to the absence of ‘block‐type’ p16 expression. Because of suboptimal staining, an alternative block of the same case was stained for p53 and a diffuse expression of p53 was observed. Moreover, after revising all haematoxylin and eosin (H E) staining of this tumour revealed the presence of differentiated type, vulvar intra‐epithelial neoplasia (dVIN) as a precursor lesion, which increases the probability of harbouring TP53 mutations. The second case (lower panel) was also human papillomavirus (HPV)‐unrelated, and scored scattered by both observers. We cannot explain the discordancy between the final p53 IHC class and mutational analysis of this case, although the VAF was low but reliable. Scale bar 20 µm.
    Figure Legend Snippet: p53 immunohistochemistry of the two remaining discordant cases after consensus. NA, not applicable. For the first case (upper panel), consensus was reached on a mid‐epithelial p53 immunohistochemistry (IHC) expression pattern with basal sparing (indicated by arrow), while the tumour showed a pathogenic TP53 mutation with a high variant allele frequency (VAF). An additional p16–IHC could prevent misinterpretation of the final p53 IHC class due to the absence of ‘block‐type’ p16 expression. Because of suboptimal staining, an alternative block of the same case was stained for p53 and a diffuse expression of p53 was observed. Moreover, after revising all haematoxylin and eosin (H E) staining of this tumour revealed the presence of differentiated type, vulvar intra‐epithelial neoplasia (dVIN) as a precursor lesion, which increases the probability of harbouring TP53 mutations. The second case (lower panel) was also human papillomavirus (HPV)‐unrelated, and scored scattered by both observers. We cannot explain the discordancy between the final p53 IHC class and mutational analysis of this case, although the VAF was low but reliable. Scale bar 20 µm.

    Techniques Used: Immunohistochemistry, Expressing, Mutagenesis, Variant Assay, Blocking Assay, Staining

    Related Articles

    Concentration Assay:

    Article Title: The LL-100 panel: 100 cell lines for blood cancer studies
    Article Snippet: .. The GATC pipeline included the production of strand-specific (fr-first strand) mRNA libraries, quality control via Applied Biosystems Fragment Analyzer and Nanodrop, concentration measurement via Qubit fluorometer. .. The libraries were sequenced on Illumina HiSeq2500 (2 × 151 cycles, paired end run, 8 bp dual indices) with > 29 million reads per sample and deposited at ENA (PRJEB30312).

    Sequencing:

    Article Title: Patient-derived xenografts recapitulate molecular features of human uveal melanomas
    Article Snippet: Finally, the BRAF V600 mutation (substitution of a glutamic acid for a valine at codon 600 in exon 15) was also assessed by PCR (primers shown in S Supplementary data). .. Sequencing of BRAF amplicons was performed on both strands on samples and a positive control (rhabdomyosarcoma cell line A673) using a BigDye Terminator v3.1 cycle sequencing kit and 3130xL or 3500xL analyzers (Life Technologies). .. Genomic DNA was purified using a phenol/chloroform method and controlled on 0.5% agarose gel.

    Article Title: Identification and functional characterization of isocitrate dehydrogenase 1 (IDH1) mutations in thyroid cancer
    Article Snippet: The amplification of exon 4 of IDH2 was performed using the forward primer IDH2-4F 5′- TGCACTCTAGACTCTACTGCC -3′ and reverse primer IDH2-4R 5′- ACAAAGTCTGTGGCCTTGTAC -3′ with the annealing temperature at 60ºC. .. The PCR amplified products were directly sequenced using a Big Dye terminator v3.1 cycle sequencing ready reaction kit (Applied Biosystems) and ABI PRISM 3730 automated next generation genetic analyzer (Applied Biosystems). ..

    Article Title: Influence of inflammasome NLRP3, and IL1B and IL2 gene polymorphisms in periodontitis susceptibility
    Article Snippet: The quality of genotyping was controlled using internal control for SNP variant in the reactions and by direct sequencing. .. SBT was performed using two samples for each variant, sequencing with the BigDye ™ terminator v3.1 cycle sequencing kit (Applied Biosystems, Thermo Fisher Scientific, USA) according to manufacturer´s instructions on an automatic analyzer (Applied Biosystems 3500xL). ..

    Positive Control:

    Article Title: Patient-derived xenografts recapitulate molecular features of human uveal melanomas
    Article Snippet: Finally, the BRAF V600 mutation (substitution of a glutamic acid for a valine at codon 600 in exon 15) was also assessed by PCR (primers shown in S Supplementary data). .. Sequencing of BRAF amplicons was performed on both strands on samples and a positive control (rhabdomyosarcoma cell line A673) using a BigDye Terminator v3.1 cycle sequencing kit and 3130xL or 3500xL analyzers (Life Technologies). .. Genomic DNA was purified using a phenol/chloroform method and controlled on 0.5% agarose gel.

    Software:

    Article Title: A novel and cost-effective ex vivo orthotopic model for the study of human breast cancer in mouse mammary gland organ culture
    Article Snippet: Briefly, 17 short tandem repeat (STR) loci plus the gender-determining locus, Amelogenin, were amplified using the commercially available PowerPlex® 18D Kit (Promega). .. Samples were processed using the ABI Prism® 3500 xL Genetic Analyzer and analyzed using GeneMapper® ID-X v1.2 software (Applied Biosystems). .. Cell lines were authenticated using STR analysis as described in 2012 in ANSI Standard (ASN-0002) by the ATCC Standards Development Organization (SDO) and as previously described ( ).

    Polymerase Chain Reaction:

    Article Title: Identification and functional characterization of isocitrate dehydrogenase 1 (IDH1) mutations in thyroid cancer
    Article Snippet: The amplification of exon 4 of IDH2 was performed using the forward primer IDH2-4F 5′- TGCACTCTAGACTCTACTGCC -3′ and reverse primer IDH2-4R 5′- ACAAAGTCTGTGGCCTTGTAC -3′ with the annealing temperature at 60ºC. .. The PCR amplified products were directly sequenced using a Big Dye terminator v3.1 cycle sequencing ready reaction kit (Applied Biosystems) and ABI PRISM 3730 automated next generation genetic analyzer (Applied Biosystems). ..

    Amplification:

    Article Title: Identification and functional characterization of isocitrate dehydrogenase 1 (IDH1) mutations in thyroid cancer
    Article Snippet: The amplification of exon 4 of IDH2 was performed using the forward primer IDH2-4F 5′- TGCACTCTAGACTCTACTGCC -3′ and reverse primer IDH2-4R 5′- ACAAAGTCTGTGGCCTTGTAC -3′ with the annealing temperature at 60ºC. .. The PCR amplified products were directly sequenced using a Big Dye terminator v3.1 cycle sequencing ready reaction kit (Applied Biosystems) and ABI PRISM 3730 automated next generation genetic analyzer (Applied Biosystems). ..

    Variant Assay:

    Article Title: Influence of inflammasome NLRP3, and IL1B and IL2 gene polymorphisms in periodontitis susceptibility
    Article Snippet: The quality of genotyping was controlled using internal control for SNP variant in the reactions and by direct sequencing. .. SBT was performed using two samples for each variant, sequencing with the BigDye ™ terminator v3.1 cycle sequencing kit (Applied Biosystems, Thermo Fisher Scientific, USA) according to manufacturer´s instructions on an automatic analyzer (Applied Biosystems 3500xL). ..

    Isolation:

    Article Title: Performance of the pattern‐based interpretation of p53 immunohistochemistry as a surrogate for TP53 mutations in vulvar squamous cell carcinomaPerformance of the pattern‐based interpretation of p53 immunohistochemistry as a surrogate for TP53 mutations in vulvar squamous cell carcinoma
    Article Snippet: Finally, cases with discordant interpretation of p53 IHC pattern were discussed between both observers in a consensus meeting, where both observers remained blinded to the NGS results (Supporting information, Figure ). .. MUTATIONAL ANALYSIS DNA was isolated locally from each case using different techniques. .. At the pathology department of LUMC, an area with > 70% tumour cells was annotated for microdissection.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Thermo Fisher reverse transcriptase rt pcr analysis rna
    A Ras to c-Raf pathway induces the Blimp1 promoter and AP-1 activity. (A) A549 cells were transfected with 5 µg of a plasmid expressing dominant negative Ras S186 or EV DNA. After 48 h, WCE and <t>RNA</t> were prepared. Samples (30 µg) of WCE were subjected to immunoblot analysis for Blimp1, Ras and α-tubulin. The bands were quantified using NIH Image J software and Blimp1 expression normalized to β-actin expression. The average values for normalized Blimp1 levels from two independent experiments are given relative to EV DNA (set to 1.0). (B) RNA was isolated from the A549 cells treated as in part A, and subjected to <t>Q-PCR</t> for BLIMP1 mRNA and normalized to GAPDH . The values represent an average of two independent experiments. (C) A549 cells were transfected, in triplicate, with 0.16 µg of Ras S186 plasmid or EV DNA, 0.33 µg of a MSV- β-gal expression vector and 0.16 µg of the 7-kB Blimp1 promoter Blimp1 -Luc, in a 12-well plate. After 48 h, cell lysates were subjected to measurements for luciferase and β-gal activities and normalized Blimp1 promoter activity values are presented as the mean ± SEM from two experiments (EV DNA set to 1.0). (D) Two-hundred pmol of an siRNA against K-Ras or a negative control siRNA (Ctrl) was incubated in the presence of 25 µl of Lipofectamine RNAiMAX in 2 ml of optiMEM in P100 plates. A549 cells (6.4×10 5 ) were seeded at a final siRNA concentration of 20 nM for 48 h. WCE were subjected to immunoblotting for K-Ras, Blimp1, c-Jun, phospho-ERK (p-ERK), Fra-1, Fra-2, and α-tubulin. Average normalized levels of Blimp1, c-Jun, Fra-1, Fra-2 and K-Ras from two independent experiments are given relative to the control (set to 1.0). Immunoblots from one of two independent experiments with similar results are presented. (E) Two-hundred pmol of an siRNA against c- RAF or a negative control siRNA was incubated in the presence of 25 µl of Lipofectamine RNAiMAX in 2 ml of optiMEM in P100 plates. A549 cells (6.4×10 5 ) were seeded at a final siRNA concentration of 20 nM for 48 h. WCE were subjected to immunoblotting for c-Raf, Blimp1, Fra-1, Fra-2, c-Jun, and α-tubulin. Average normalized levels of c-Raf, Blimp1, Fra-1, Fra-2 and c-Jun from two independent experiments are given relative to the control (set to 1.0). Immunoblots from one of two independent experiments with similar results are presented. (F) A549 cells were transiently transfected, in triplicate, with si-c-RAF or negative control siRNA at a final concentration of 20 nM in a 12-well plate. Eight h later, Blimp1 -luc promoter construct (0.16 µg) and an MSV- β-gal expression vector (0.33 µg) were transfected into these siRNA-treated A549 cells for an additional 40 h. Relative (Rel.) Blimp1 promoter activity values are presented as the mean ± SEM from two experiments (EV DNA set to 1.0).
    Reverse Transcriptase Rt Pcr Analysis Rna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/reverse transcriptase rt pcr analysis rna/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    reverse transcriptase rt pcr analysis rna - by Bioz Stars, 2021-04
    97/100 stars
      Buy from Supplier

    95
    Thermo Fisher mutational analysis dna
    p53 immunohistochemistry of the two remaining discordant cases after consensus. NA, not applicable. For the first case (upper panel), consensus was reached on a mid‐epithelial p53 immunohistochemistry (IHC) expression pattern with basal sparing (indicated by arrow), while the tumour showed a pathogenic TP53 mutation with a high variant allele frequency (VAF). An additional p16–IHC could prevent misinterpretation of the final p53 IHC class due to the absence of ‘block‐type’ p16 expression. Because of suboptimal staining, an alternative block of the same case was stained for p53 and a diffuse expression of p53 was observed. Moreover, after revising all haematoxylin and eosin (H E) staining of this tumour revealed the presence of differentiated type, vulvar intra‐epithelial neoplasia (dVIN) as a precursor lesion, which increases the probability of harbouring TP53 mutations. The second case (lower panel) was also human papillomavirus (HPV)‐unrelated, and scored scattered by both observers. We cannot explain the discordancy between the final p53 IHC class and <t>mutational</t> <t>analysis</t> of this case, although the VAF was low but reliable. Scale bar 20 µm.
    Mutational Analysis Dna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mutational analysis dna/product/Thermo Fisher
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mutational analysis dna - by Bioz Stars, 2021-04
    95/100 stars
      Buy from Supplier

    99
    Thermo Fisher endonuclease activity assays commercial eco ri restriction enzyme
    Determination of influence of ionic strength in different reaction buffers on the Lra I <t>restriction</t> <t>enzyme</t> <t>activity.</t> <t>Commercial</t> <t>Eco</t> <t>RI</t> restriction enzyme was used in control reactions. L: ladder (GeneRuler DNA Ladder Mix, Thermo Fisher Scientific). Black arrows present fragment obtained by Lra I ∗ activity; white arrows present undigested plasmid DNA in Eco RI (Thermo Fisher Scientific) digestion.
    Endonuclease Activity Assays Commercial Eco Ri Restriction Enzyme, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/endonuclease activity assays commercial eco ri restriction enzyme/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    endonuclease activity assays commercial eco ri restriction enzyme - by Bioz Stars, 2021-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    A Ras to c-Raf pathway induces the Blimp1 promoter and AP-1 activity. (A) A549 cells were transfected with 5 µg of a plasmid expressing dominant negative Ras S186 or EV DNA. After 48 h, WCE and RNA were prepared. Samples (30 µg) of WCE were subjected to immunoblot analysis for Blimp1, Ras and α-tubulin. The bands were quantified using NIH Image J software and Blimp1 expression normalized to β-actin expression. The average values for normalized Blimp1 levels from two independent experiments are given relative to EV DNA (set to 1.0). (B) RNA was isolated from the A549 cells treated as in part A, and subjected to Q-PCR for BLIMP1 mRNA and normalized to GAPDH . The values represent an average of two independent experiments. (C) A549 cells were transfected, in triplicate, with 0.16 µg of Ras S186 plasmid or EV DNA, 0.33 µg of a MSV- β-gal expression vector and 0.16 µg of the 7-kB Blimp1 promoter Blimp1 -Luc, in a 12-well plate. After 48 h, cell lysates were subjected to measurements for luciferase and β-gal activities and normalized Blimp1 promoter activity values are presented as the mean ± SEM from two experiments (EV DNA set to 1.0). (D) Two-hundred pmol of an siRNA against K-Ras or a negative control siRNA (Ctrl) was incubated in the presence of 25 µl of Lipofectamine RNAiMAX in 2 ml of optiMEM in P100 plates. A549 cells (6.4×10 5 ) were seeded at a final siRNA concentration of 20 nM for 48 h. WCE were subjected to immunoblotting for K-Ras, Blimp1, c-Jun, phospho-ERK (p-ERK), Fra-1, Fra-2, and α-tubulin. Average normalized levels of Blimp1, c-Jun, Fra-1, Fra-2 and K-Ras from two independent experiments are given relative to the control (set to 1.0). Immunoblots from one of two independent experiments with similar results are presented. (E) Two-hundred pmol of an siRNA against c- RAF or a negative control siRNA was incubated in the presence of 25 µl of Lipofectamine RNAiMAX in 2 ml of optiMEM in P100 plates. A549 cells (6.4×10 5 ) were seeded at a final siRNA concentration of 20 nM for 48 h. WCE were subjected to immunoblotting for c-Raf, Blimp1, Fra-1, Fra-2, c-Jun, and α-tubulin. Average normalized levels of c-Raf, Blimp1, Fra-1, Fra-2 and c-Jun from two independent experiments are given relative to the control (set to 1.0). Immunoblots from one of two independent experiments with similar results are presented. (F) A549 cells were transiently transfected, in triplicate, with si-c-RAF or negative control siRNA at a final concentration of 20 nM in a 12-well plate. Eight h later, Blimp1 -luc promoter construct (0.16 µg) and an MSV- β-gal expression vector (0.33 µg) were transfected into these siRNA-treated A549 cells for an additional 40 h. Relative (Rel.) Blimp1 promoter activity values are presented as the mean ± SEM from two experiments (EV DNA set to 1.0).

    Journal: PLoS ONE

    Article Title: Blimp1 Activation by AP-1 in Human Lung Cancer Cells Promotes a Migratory Phenotype and Is Inhibited by the Lysyl Oxidase Propeptide

    doi: 10.1371/journal.pone.0033287

    Figure Lengend Snippet: A Ras to c-Raf pathway induces the Blimp1 promoter and AP-1 activity. (A) A549 cells were transfected with 5 µg of a plasmid expressing dominant negative Ras S186 or EV DNA. After 48 h, WCE and RNA were prepared. Samples (30 µg) of WCE were subjected to immunoblot analysis for Blimp1, Ras and α-tubulin. The bands were quantified using NIH Image J software and Blimp1 expression normalized to β-actin expression. The average values for normalized Blimp1 levels from two independent experiments are given relative to EV DNA (set to 1.0). (B) RNA was isolated from the A549 cells treated as in part A, and subjected to Q-PCR for BLIMP1 mRNA and normalized to GAPDH . The values represent an average of two independent experiments. (C) A549 cells were transfected, in triplicate, with 0.16 µg of Ras S186 plasmid or EV DNA, 0.33 µg of a MSV- β-gal expression vector and 0.16 µg of the 7-kB Blimp1 promoter Blimp1 -Luc, in a 12-well plate. After 48 h, cell lysates were subjected to measurements for luciferase and β-gal activities and normalized Blimp1 promoter activity values are presented as the mean ± SEM from two experiments (EV DNA set to 1.0). (D) Two-hundred pmol of an siRNA against K-Ras or a negative control siRNA (Ctrl) was incubated in the presence of 25 µl of Lipofectamine RNAiMAX in 2 ml of optiMEM in P100 plates. A549 cells (6.4×10 5 ) were seeded at a final siRNA concentration of 20 nM for 48 h. WCE were subjected to immunoblotting for K-Ras, Blimp1, c-Jun, phospho-ERK (p-ERK), Fra-1, Fra-2, and α-tubulin. Average normalized levels of Blimp1, c-Jun, Fra-1, Fra-2 and K-Ras from two independent experiments are given relative to the control (set to 1.0). Immunoblots from one of two independent experiments with similar results are presented. (E) Two-hundred pmol of an siRNA against c- RAF or a negative control siRNA was incubated in the presence of 25 µl of Lipofectamine RNAiMAX in 2 ml of optiMEM in P100 plates. A549 cells (6.4×10 5 ) were seeded at a final siRNA concentration of 20 nM for 48 h. WCE were subjected to immunoblotting for c-Raf, Blimp1, Fra-1, Fra-2, c-Jun, and α-tubulin. Average normalized levels of c-Raf, Blimp1, Fra-1, Fra-2 and c-Jun from two independent experiments are given relative to the control (set to 1.0). Immunoblots from one of two independent experiments with similar results are presented. (F) A549 cells were transiently transfected, in triplicate, with si-c-RAF or negative control siRNA at a final concentration of 20 nM in a 12-well plate. Eight h later, Blimp1 -luc promoter construct (0.16 µg) and an MSV- β-gal expression vector (0.33 µg) were transfected into these siRNA-treated A549 cells for an additional 40 h. Relative (Rel.) Blimp1 promoter activity values are presented as the mean ± SEM from two experiments (EV DNA set to 1.0).

    Article Snippet: Reverse Transcriptase (RT)-PCR analysis RNA was isolated using RNeasy Mini Kit (Invitrogen), and samples with A260 /A280 ratios between 1.8 and 2.0 were treated with RQ1 RNase-free DNase (Promega).

    Techniques: Activity Assay, Transfection, Plasmid Preparation, Expressing, Dominant Negative Mutation, Software, Isolation, Polymerase Chain Reaction, Luciferase, Negative Control, Incubation, Concentration Assay, Western Blot, Construct

    AP-1 subunits bind to the BLIMP1 promoter. (A) Schematic of the localization of the two TRE sites on the human BLIMP1 promoter. Two primer sets encompassing these sites are shown: 1F/1R amplifies the −1647 bp TRE and 2F/2R amplifies the −1813 bp TRE. (B) H441 cells at 90% confluence in P100 plates were transfected with 4 µg of c-Jun expression vector, and after 48 h subjected to a ChIP assay using a control IgG or c-Jun antibody, as described in the Materials and Methods . Input, 1% of the WCE. Positive (Pos.) control: a genomic region of the JUN promoter containing two TREs (−1 and −120 bp). Negative (Neg.) control: region upstream of BLIMP1 transcription start site (∼−5.4 kB) that does not contain any known TRE sites. (C) A549 lung cancer cells were incubated in serum free DMEM for 48 h. FBS was added back to 10%. Samples were harvested at 0, 15, 30 minutes or 1, 2, 4 h and RNA and WCE prepared. Upper panel: RNA was subjected to Q-PCR, in triplicate, and values for BLIMP1 normalized to GAPDH RNA levels presented relative to the 0 time point which was set to 1.0. Data for the mean ± SD from three independent experiments are presented. Lower panels: WCE (25 µg) were subjected to immunoblot analysis for phospho-c-Jun (p-c-Jun), c-Jun, Fra-1, Fra-2, c-Fos AP-1 subunits, and α-tubulin, which confirmed essentially equal loading control. Data shown is a representative of two independent experiments with similar results. (D) A549 cells were incubated in serum free DMEM for 48 h, and stimulated with addition of FBS (final 10%) for 30 min. Whole cell lysates were subjected to ChIP analysis using antibodies against c-Jun, Fra-1, Fra-2 or normal rabbit IgG, as described in part B. Data shown is a representative of two independent experiments with similar results.

    Journal: PLoS ONE

    Article Title: Blimp1 Activation by AP-1 in Human Lung Cancer Cells Promotes a Migratory Phenotype and Is Inhibited by the Lysyl Oxidase Propeptide

    doi: 10.1371/journal.pone.0033287

    Figure Lengend Snippet: AP-1 subunits bind to the BLIMP1 promoter. (A) Schematic of the localization of the two TRE sites on the human BLIMP1 promoter. Two primer sets encompassing these sites are shown: 1F/1R amplifies the −1647 bp TRE and 2F/2R amplifies the −1813 bp TRE. (B) H441 cells at 90% confluence in P100 plates were transfected with 4 µg of c-Jun expression vector, and after 48 h subjected to a ChIP assay using a control IgG or c-Jun antibody, as described in the Materials and Methods . Input, 1% of the WCE. Positive (Pos.) control: a genomic region of the JUN promoter containing two TREs (−1 and −120 bp). Negative (Neg.) control: region upstream of BLIMP1 transcription start site (∼−5.4 kB) that does not contain any known TRE sites. (C) A549 lung cancer cells were incubated in serum free DMEM for 48 h. FBS was added back to 10%. Samples were harvested at 0, 15, 30 minutes or 1, 2, 4 h and RNA and WCE prepared. Upper panel: RNA was subjected to Q-PCR, in triplicate, and values for BLIMP1 normalized to GAPDH RNA levels presented relative to the 0 time point which was set to 1.0. Data for the mean ± SD from three independent experiments are presented. Lower panels: WCE (25 µg) were subjected to immunoblot analysis for phospho-c-Jun (p-c-Jun), c-Jun, Fra-1, Fra-2, c-Fos AP-1 subunits, and α-tubulin, which confirmed essentially equal loading control. Data shown is a representative of two independent experiments with similar results. (D) A549 cells were incubated in serum free DMEM for 48 h, and stimulated with addition of FBS (final 10%) for 30 min. Whole cell lysates were subjected to ChIP analysis using antibodies against c-Jun, Fra-1, Fra-2 or normal rabbit IgG, as described in part B. Data shown is a representative of two independent experiments with similar results.

    Article Snippet: Reverse Transcriptase (RT)-PCR analysis RNA was isolated using RNeasy Mini Kit (Invitrogen), and samples with A260 /A280 ratios between 1.8 and 2.0 were treated with RQ1 RNase-free DNase (Promega).

    Techniques: Transfection, Expressing, Plasmid Preparation, Chromatin Immunoprecipitation, Incubation, Polymerase Chain Reaction

    Ectopic LOX-PP reduces Blimp1 expression in lung cancer cells. (A) H1299-EV cells, and H1299-LOX-PP4 (PP4) and H1299-LOX-PP7 (PP7) clones, isolated as described previously [25] , were treated in triplicate with 2 µg/ml dox for 48 h. RNA from two independent experiments was subjected to Q-PCR and normalized values for BLIMP1 mRNA relative to GAPDH levels are presented as the mean ± SEM (EV DNA set to 1.0). (B) A549-EV, A549-hLOX-PP, A549-mLOX-PP dox-inducible stable populations were treated with 2 µg/ml dox for 48 h in DMEM supplemented with 0.5% FBS. FBS was added back to 10% and cells incubated overnight. RNA from two independent experiments was subjected to Q-PCR and normalized values for BLIMP1 mRNA relative to GAPDH levels are presented as the mean ± SEM (EV DNA set to 1.0). Samples of medium (5 ml) were subjected to immunoprecipitation followed by immunoblotting using V5 antibody for LOX-PP expression. (C) A549 and H1299 cells were transiently transfected with human LOX-PP cDNA or EV DNA. After 48 h, media and WCE were prepared. Samples of media (50 µl) were subjected to immunoblotting for V5. Samples of WCE (25 µg) were probed for Blimp1 and β-actin, and average normalized Blimp1 values from two independent experiments presented relative to EV DNA, set to 1.0. (D) A549 and H441 cells were treated with purified recombinant LOX-PP protein at a final concentration of 4 or 1 µg/ml, respectively, or the same volume of vehicle (water) in medium with 0.5% FBS. Twenty-four h later, FBS was added back to 10% and cultures incubated overnight. WCE were subjected to immunoblotting for Blimp1, phospho-c-Jun (p-c-Jun), total c-Jun, Fra-1 and Fra-2 and α-tubulin, as a loading control. Normalized Blimp1 and AP-1 subunit values from two independent experiments are presented relative to EV DNA, set to 1.0.

    Journal: PLoS ONE

    Article Title: Blimp1 Activation by AP-1 in Human Lung Cancer Cells Promotes a Migratory Phenotype and Is Inhibited by the Lysyl Oxidase Propeptide

    doi: 10.1371/journal.pone.0033287

    Figure Lengend Snippet: Ectopic LOX-PP reduces Blimp1 expression in lung cancer cells. (A) H1299-EV cells, and H1299-LOX-PP4 (PP4) and H1299-LOX-PP7 (PP7) clones, isolated as described previously [25] , were treated in triplicate with 2 µg/ml dox for 48 h. RNA from two independent experiments was subjected to Q-PCR and normalized values for BLIMP1 mRNA relative to GAPDH levels are presented as the mean ± SEM (EV DNA set to 1.0). (B) A549-EV, A549-hLOX-PP, A549-mLOX-PP dox-inducible stable populations were treated with 2 µg/ml dox for 48 h in DMEM supplemented with 0.5% FBS. FBS was added back to 10% and cells incubated overnight. RNA from two independent experiments was subjected to Q-PCR and normalized values for BLIMP1 mRNA relative to GAPDH levels are presented as the mean ± SEM (EV DNA set to 1.0). Samples of medium (5 ml) were subjected to immunoprecipitation followed by immunoblotting using V5 antibody for LOX-PP expression. (C) A549 and H1299 cells were transiently transfected with human LOX-PP cDNA or EV DNA. After 48 h, media and WCE were prepared. Samples of media (50 µl) were subjected to immunoblotting for V5. Samples of WCE (25 µg) were probed for Blimp1 and β-actin, and average normalized Blimp1 values from two independent experiments presented relative to EV DNA, set to 1.0. (D) A549 and H441 cells were treated with purified recombinant LOX-PP protein at a final concentration of 4 or 1 µg/ml, respectively, or the same volume of vehicle (water) in medium with 0.5% FBS. Twenty-four h later, FBS was added back to 10% and cultures incubated overnight. WCE were subjected to immunoblotting for Blimp1, phospho-c-Jun (p-c-Jun), total c-Jun, Fra-1 and Fra-2 and α-tubulin, as a loading control. Normalized Blimp1 and AP-1 subunit values from two independent experiments are presented relative to EV DNA, set to 1.0.

    Article Snippet: Reverse Transcriptase (RT)-PCR analysis RNA was isolated using RNeasy Mini Kit (Invitrogen), and samples with A260 /A280 ratios between 1.8 and 2.0 were treated with RQ1 RNase-free DNase (Promega).

    Techniques: Expressing, Isolation, Polymerase Chain Reaction, Incubation, Immunoprecipitation, Transfection, Purification, Recombinant, Concentration Assay

    Ectopic AP-1 subunits induce Blimp1 expression. (A) H441 cells, growing in 6-well plates, were transfected with 1 µg of vectors expressing the indicated AP-1 subunits or EV DNA (see bottom) to make a 2 µg total. Upper panel. After 48 h, RNA was isolated and subjected to Q-PCR. The levels of BLIMP1 mRNA normalized to GAPDH mRNA are presented as mean ± SD of three independent experiments. Middle and lower panels. WCE were isolated and subjected to immunoblotting (IB) for Blimp1 (Middle panels), and for c-Jun, Fra-1, Fra-2, c-Fos and β-actin (Lower panels). (L exp., longer exposure; S exp., shorter exposure). Blimp1 levels, normalized to β-actin, were determined as in Fig. 1C and average values from two independent experiments presented relative to EV DNA, set to 1.0. (B) H441 cells were transiently transfected, in triplicate, with 0.3 µg of Blimp1 -Luc, 0.3 µg of MSV-β-gal, and vectors expressing the indicated AP-1 subunits (0.15 µg each) and EV DNA to a total of 1.0 µg DNA. Normalized values of Blimp1 promoter activity are presented as the mean ± SEM from two experiments (EV DNA set to 1.0).

    Journal: PLoS ONE

    Article Title: Blimp1 Activation by AP-1 in Human Lung Cancer Cells Promotes a Migratory Phenotype and Is Inhibited by the Lysyl Oxidase Propeptide

    doi: 10.1371/journal.pone.0033287

    Figure Lengend Snippet: Ectopic AP-1 subunits induce Blimp1 expression. (A) H441 cells, growing in 6-well plates, were transfected with 1 µg of vectors expressing the indicated AP-1 subunits or EV DNA (see bottom) to make a 2 µg total. Upper panel. After 48 h, RNA was isolated and subjected to Q-PCR. The levels of BLIMP1 mRNA normalized to GAPDH mRNA are presented as mean ± SD of three independent experiments. Middle and lower panels. WCE were isolated and subjected to immunoblotting (IB) for Blimp1 (Middle panels), and for c-Jun, Fra-1, Fra-2, c-Fos and β-actin (Lower panels). (L exp., longer exposure; S exp., shorter exposure). Blimp1 levels, normalized to β-actin, were determined as in Fig. 1C and average values from two independent experiments presented relative to EV DNA, set to 1.0. (B) H441 cells were transiently transfected, in triplicate, with 0.3 µg of Blimp1 -Luc, 0.3 µg of MSV-β-gal, and vectors expressing the indicated AP-1 subunits (0.15 µg each) and EV DNA to a total of 1.0 µg DNA. Normalized values of Blimp1 promoter activity are presented as the mean ± SEM from two experiments (EV DNA set to 1.0).

    Article Snippet: Reverse Transcriptase (RT)-PCR analysis RNA was isolated using RNeasy Mini Kit (Invitrogen), and samples with A260 /A280 ratios between 1.8 and 2.0 were treated with RQ1 RNase-free DNase (Promega).

    Techniques: Expressing, Transfection, Isolation, Polymerase Chain Reaction, Activity Assay

    p53 immunohistochemistry of the two remaining discordant cases after consensus. NA, not applicable. For the first case (upper panel), consensus was reached on a mid‐epithelial p53 immunohistochemistry (IHC) expression pattern with basal sparing (indicated by arrow), while the tumour showed a pathogenic TP53 mutation with a high variant allele frequency (VAF). An additional p16–IHC could prevent misinterpretation of the final p53 IHC class due to the absence of ‘block‐type’ p16 expression. Because of suboptimal staining, an alternative block of the same case was stained for p53 and a diffuse expression of p53 was observed. Moreover, after revising all haematoxylin and eosin (H E) staining of this tumour revealed the presence of differentiated type, vulvar intra‐epithelial neoplasia (dVIN) as a precursor lesion, which increases the probability of harbouring TP53 mutations. The second case (lower panel) was also human papillomavirus (HPV)‐unrelated, and scored scattered by both observers. We cannot explain the discordancy between the final p53 IHC class and mutational analysis of this case, although the VAF was low but reliable. Scale bar 20 µm.

    Journal: Histopathology

    Article Title: Performance of the pattern‐based interpretation of p53 immunohistochemistry as a surrogate for TP53 mutations in vulvar squamous cell carcinomaPerformance of the pattern‐based interpretation of p53 immunohistochemistry as a surrogate for TP53 mutations in vulvar squamous cell carcinoma

    doi: 10.1111/his.14109

    Figure Lengend Snippet: p53 immunohistochemistry of the two remaining discordant cases after consensus. NA, not applicable. For the first case (upper panel), consensus was reached on a mid‐epithelial p53 immunohistochemistry (IHC) expression pattern with basal sparing (indicated by arrow), while the tumour showed a pathogenic TP53 mutation with a high variant allele frequency (VAF). An additional p16–IHC could prevent misinterpretation of the final p53 IHC class due to the absence of ‘block‐type’ p16 expression. Because of suboptimal staining, an alternative block of the same case was stained for p53 and a diffuse expression of p53 was observed. Moreover, after revising all haematoxylin and eosin (H E) staining of this tumour revealed the presence of differentiated type, vulvar intra‐epithelial neoplasia (dVIN) as a precursor lesion, which increases the probability of harbouring TP53 mutations. The second case (lower panel) was also human papillomavirus (HPV)‐unrelated, and scored scattered by both observers. We cannot explain the discordancy between the final p53 IHC class and mutational analysis of this case, although the VAF was low but reliable. Scale bar 20 µm.

    Article Snippet: MUTATIONAL ANALYSIS DNA was isolated locally from each case using different techniques.

    Techniques: Immunohistochemistry, Expressing, Mutagenesis, Variant Assay, Blocking Assay, Staining

    Determination of influence of ionic strength in different reaction buffers on the Lra I restriction enzyme activity. Commercial Eco RI restriction enzyme was used in control reactions. L: ladder (GeneRuler DNA Ladder Mix, Thermo Fisher Scientific). Black arrows present fragment obtained by Lra I ∗ activity; white arrows present undigested plasmid DNA in Eco RI (Thermo Fisher Scientific) digestion.

    Journal: BioMed Research International

    Article Title: LraI from Lactococcus raffinolactis BGTRK10-1, an Isoschizomer of EcoRI, Exhibits Ion Concentration-Dependent Specific Star Activity

    doi: 10.1155/2018/5657085

    Figure Lengend Snippet: Determination of influence of ionic strength in different reaction buffers on the Lra I restriction enzyme activity. Commercial Eco RI restriction enzyme was used in control reactions. L: ladder (GeneRuler DNA Ladder Mix, Thermo Fisher Scientific). Black arrows present fragment obtained by Lra I ∗ activity; white arrows present undigested plasmid DNA in Eco RI (Thermo Fisher Scientific) digestion.

    Article Snippet: In all endonuclease activity assays commercial Eco RI restriction enzyme (Thermo Fisher Scientific) was used as control.

    Techniques: Activity Assay, Plasmid Preparation

    Determination of temperature optimum of the purified Lra I restriction enzyme activity. Commercial Eco RI restriction enzyme was used in control reactions.

    Journal: BioMed Research International

    Article Title: LraI from Lactococcus raffinolactis BGTRK10-1, an Isoschizomer of EcoRI, Exhibits Ion Concentration-Dependent Specific Star Activity

    doi: 10.1155/2018/5657085

    Figure Lengend Snippet: Determination of temperature optimum of the purified Lra I restriction enzyme activity. Commercial Eco RI restriction enzyme was used in control reactions.

    Article Snippet: In all endonuclease activity assays commercial Eco RI restriction enzyme (Thermo Fisher Scientific) was used as control.

    Techniques: Purification, Activity Assay

    General experimental workflow. (A) Polymorphonucleated cells (PMNs) were isolated from three independent human whole blood samples by density centrifugation and (B) treated with 25 nM PMA for 2 h to induce neutrophil extracellular traps (NETs). PMNs were left untreated or supplemented with 1 µM thrombin or plasmin and incubated for another 2 h. (C) After gently washing the wells, they were further treated with 20 U/ml DNase I or with Rose Park Memorial Institute only for 1 h at 37°C to digest the DNA scaffold. The proteins extracted were then processed for (D) LC-MS/MS or (E) in some cases, subjected to validation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)/western blotting.

    Journal: Frontiers in Immunology

    Article Title: Thrombin and Plasmin Alter the Proteome of Neutrophil Extracellular Traps

    doi: 10.3389/fimmu.2018.01554

    Figure Lengend Snippet: General experimental workflow. (A) Polymorphonucleated cells (PMNs) were isolated from three independent human whole blood samples by density centrifugation and (B) treated with 25 nM PMA for 2 h to induce neutrophil extracellular traps (NETs). PMNs were left untreated or supplemented with 1 µM thrombin or plasmin and incubated for another 2 h. (C) After gently washing the wells, they were further treated with 20 U/ml DNase I or with Rose Park Memorial Institute only for 1 h at 37°C to digest the DNA scaffold. The proteins extracted were then processed for (D) LC-MS/MS or (E) in some cases, subjected to validation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)/western blotting.

    Article Snippet: Rose Park Memorial Institute (RPMI)-1640 cell culture medium without phenol red, the live-dead stain 4′,6-diamidino-2-phenylindole (DAPI), DNA endonuclease I (DNase I), Pierce Protease Inhibitor Mini Tablets, Pierce Silver Stain Kit, Pierce BCA (bicinchionic acid) Protein Assay Kit, Supersignal West Dura Extended Duration Substrate, Supersignal West Femto Maximum Sensitivity Substrate, and SYBR Safe were from Thermo Fisher Scientific, USA.

    Techniques: Isolation, Centrifugation, Incubation, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, Polyacrylamide Gel Electrophoresis, SDS Page, Western Blot