murine rnase inhibitor  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    RNase Inhibitor Murine
    Description:
    RNase Inhibitor Murine 15 000 units
    Catalog Number:
    M0314L
    Price:
    280
    Size:
    15 000 units
    Category:
    Enzyme Inhibitors
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs murine rnase inhibitor
    RNase Inhibitor Murine
    RNase Inhibitor Murine 15 000 units
    https://www.bioz.com/result/murine rnase inhibitor/product/New England Biolabs
    Average 99 stars, based on 74 article reviews
    Price from $9.99 to $1999.99
    murine rnase inhibitor - by Bioz Stars, 2019-10
    99/100 stars

    Images

    1) Product Images from "eIF3d is an mRNA cap-binding protein required for specialized translation initiation"

    Article Title: eIF3d is an mRNA cap-binding protein required for specialized translation initiation

    Journal: Nature

    doi: 10.1038/nature18954

    eIF3d cap-binding activity is required for efficient 48S initiation complex formation on specific mRNAs a , Phosphorimage of SDS gel resolving RNase-protected 32 P-cap-labeled c-Jun 5′ UTR RNA crosslinked to eIF3 in the presence of competitor ligands. b , Electrostatic surface view of the eIF3d cap-binding domain colored by charge, with a zoomed view of single stranded RNA (ssRNA) and cap analog modeled according to their positions bound to DXO 15 . Positive charge is colored blue and negative charge is in red, and the RNA gate is removed for clarity. c , Phosphorimage of SDS gel resolving RNase-protected 32 P-cap-labeled c-Jun 5′ UTR RNA crosslinked to wild type or helix α5 or helix α11-mutant eIF3. eIF3d-helix α5 mutant (D249Q/V262I/Y263A), helix α11 mutant (T317E/N320E/H321A). WT, wild type. d , Incorporation of c-Jun and ACTB mRNA into initiation complexes by wild type, helix α5, or helix α11-mutant eIF3d as measured by quantitative RT-PCR. mRNA-ribosome association is expressed as the ratio between the quantity of mRNA transcripts to 18S rRNA and normalized to the wild type sample. The results are representative of three independent experiments and given as the mean ± s.d. from a representative quantitative RT-PCR experiment performed in duplicate.
    Figure Legend Snippet: eIF3d cap-binding activity is required for efficient 48S initiation complex formation on specific mRNAs a , Phosphorimage of SDS gel resolving RNase-protected 32 P-cap-labeled c-Jun 5′ UTR RNA crosslinked to eIF3 in the presence of competitor ligands. b , Electrostatic surface view of the eIF3d cap-binding domain colored by charge, with a zoomed view of single stranded RNA (ssRNA) and cap analog modeled according to their positions bound to DXO 15 . Positive charge is colored blue and negative charge is in red, and the RNA gate is removed for clarity. c , Phosphorimage of SDS gel resolving RNase-protected 32 P-cap-labeled c-Jun 5′ UTR RNA crosslinked to wild type or helix α5 or helix α11-mutant eIF3. eIF3d-helix α5 mutant (D249Q/V262I/Y263A), helix α11 mutant (T317E/N320E/H321A). WT, wild type. d , Incorporation of c-Jun and ACTB mRNA into initiation complexes by wild type, helix α5, or helix α11-mutant eIF3d as measured by quantitative RT-PCR. mRNA-ribosome association is expressed as the ratio between the quantity of mRNA transcripts to 18S rRNA and normalized to the wild type sample. The results are representative of three independent experiments and given as the mean ± s.d. from a representative quantitative RT-PCR experiment performed in duplicate.

    Techniques Used: Binding Assay, Activity Assay, SDS-Gel, Labeling, Mutagenesis, Quantitative RT-PCR

    eIF4E recognizes the 5′ end of the c-Jun mRNA less efficiently than ACTB mRNA a , Coomassie blue stained SDS gel of recombinant human eIF4E expressed in E. coli. b , Phosphorimage of SDS gel resolving RNase-protected 32 P-cap-labeled ACTB or c-Jun 5′ UTR RNA crosslinked to eIF4E. The result is representative of three independent experiments. For gel source data, see Supplementary Figure 1 .
    Figure Legend Snippet: eIF4E recognizes the 5′ end of the c-Jun mRNA less efficiently than ACTB mRNA a , Coomassie blue stained SDS gel of recombinant human eIF4E expressed in E. coli. b , Phosphorimage of SDS gel resolving RNase-protected 32 P-cap-labeled ACTB or c-Jun 5′ UTR RNA crosslinked to eIF4E. The result is representative of three independent experiments. For gel source data, see Supplementary Figure 1 .

    Techniques Used: Staining, SDS-Gel, Recombinant, Labeling

    5' end recognition of c-Jun mRNA is eIF4F-independent a , Distribution of c-Jun or ACTB mRNA-containing initiation complexes in programmed 293T cell in vitro translation extracts. The mRNA abundance (black line) is expressed as the fraction of total recovered transcripts. The results are given as the mean ± standard deviation (s.d.) of a representative quantitative RT-PCR experiment performed in duplicate. The polysome profile (gray line) is plotted as relative absorbance at 254 nm versus elution fractions. b , Western blot analysis of initiation factors in 48S translation complexes formed on c-Jun and ACTB mRNAs. 293T, total protein from 293T in vitro translation extracts. For gel source data, see Supplementary Figure 1 . c , Phosphorimage of SDS gel resolving RNase-protected 32 P-internal or 32 P-cap-labeled c-Jun 5' UTR RNA crosslinked to eIF3 subunits. Recombinant eIF3a migrates at ~100 kDa due to a C-terminal truncation 26 . The results of a - c are representative of three independent experiments.
    Figure Legend Snippet: 5' end recognition of c-Jun mRNA is eIF4F-independent a , Distribution of c-Jun or ACTB mRNA-containing initiation complexes in programmed 293T cell in vitro translation extracts. The mRNA abundance (black line) is expressed as the fraction of total recovered transcripts. The results are given as the mean ± standard deviation (s.d.) of a representative quantitative RT-PCR experiment performed in duplicate. The polysome profile (gray line) is plotted as relative absorbance at 254 nm versus elution fractions. b , Western blot analysis of initiation factors in 48S translation complexes formed on c-Jun and ACTB mRNAs. 293T, total protein from 293T in vitro translation extracts. For gel source data, see Supplementary Figure 1 . c , Phosphorimage of SDS gel resolving RNase-protected 32 P-internal or 32 P-cap-labeled c-Jun 5' UTR RNA crosslinked to eIF3 subunits. Recombinant eIF3a migrates at ~100 kDa due to a C-terminal truncation 26 . The results of a - c are representative of three independent experiments.

    Techniques Used: In Vitro, Standard Deviation, Quantitative RT-PCR, Western Blot, SDS-Gel, Labeling, Recombinant

    2) Product Images from "RNA binding to CBP stimulates histone acetylation and transcription"

    Article Title: RNA binding to CBP stimulates histone acetylation and transcription

    Journal:

    doi: 10.1016/j.cell.2016.12.020

    CBP interacts with RNA in vivo A) Native RNA-IP of CBP. Top, RNA immunprecipitated with CBP. Bottom, CBP western blot. B) PAR-CLIP protocol. 4-Thiouridine (4-SU). C) CBP PAR-CLIP required 4-SU: top, autoradiography; bottom, CBP western blot.. D) Quantification of CBP PAR-CLIP. Error bars represent mean +/− s.e.m; n=4. E) CBP PAR-CLIP signal was sensitive to RNAse. 1× RNAse cocktail contained: RNAse A (0.01mU/ul) + RNase T1 (0.4mU/ul). F) Quantification of RNase titration. Error bars represent mean +/− s.e.m; n=4; P -values from two-tailed Student’s t-test: *P < 0.05; **P < 0.01; ***P < 0.001.
    Figure Legend Snippet: CBP interacts with RNA in vivo A) Native RNA-IP of CBP. Top, RNA immunprecipitated with CBP. Bottom, CBP western blot. B) PAR-CLIP protocol. 4-Thiouridine (4-SU). C) CBP PAR-CLIP required 4-SU: top, autoradiography; bottom, CBP western blot.. D) Quantification of CBP PAR-CLIP. Error bars represent mean +/− s.e.m; n=4. E) CBP PAR-CLIP signal was sensitive to RNAse. 1× RNAse cocktail contained: RNAse A (0.01mU/ul) + RNase T1 (0.4mU/ul). F) Quantification of RNase titration. Error bars represent mean +/− s.e.m; n=4; P -values from two-tailed Student’s t-test: *P < 0.05; **P < 0.01; ***P < 0.001.

    Techniques Used: In Vivo, Western Blot, Cross-linking Immunoprecipitation, Autoradiography, Titration, Two Tailed Test

    3) Product Images from "Transcriptome-Wide Analyses of 5?-Ends in RNase J Mutants of a Gram-Positive Pathogen Reveal a Role in RNA Maturation, Regulation and Degradation"

    Article Title: Transcriptome-Wide Analyses of 5?-Ends in RNase J Mutants of a Gram-Positive Pathogen Reveal a Role in RNA Maturation, Regulation and Degradation

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1004207

    Both maturation and inactivation of RNase P RNA is carried out by RNase J. A) Histogram showing the percentage of reads mapping to a given position, out of the total number of reads mapping to the putative SA1279- rnpB operon in each strain (shown in parentheses). Only positions of interest are included, but the full data-set can be found in Table S6 . +1: The putative transcription start site of SA1279. +452 to +477: The RNase J mutants accumulate RNA with 5′-ends in this region. +485: The putative transcription start site of rnpB , a major detected RNA species in the WT, ΔY and ΔcshA, but very reduced in the RNase J mutants. +499: A major detected RNA species in the WT, ΔY and ΔcshA, however it is absent from the RNase J1 mutants and reduced in the ΔJ2 strain. B) The layout of the region around SA1279 and rnpB . DNA is represented as a wavy line, and RNA transcripts as straight black lines. (PP)P indicates a mix of tri- and mono-phosphorylated RNA, generated by pyrophosphohydrolases. Small blue arrows indicate the PCR-primers used to amplify circularised RnpB and SA1279-RnpB for mapping the 5′ and 3′-ends. R1 indicates the probe used for the Northern blot shown in Figure S2 . C) A blow-up of the region from +420 to +540, showing the proposed model for converting the +1 transcript into mature RnpB. P indicates mono-phosphorylation. D) Predicted secondary structures of RnpB, generated using mfold with default settings [30] , and based on the crystal structures of RNase P RNA [27] , [31] . Within the RNase P structure, the thin dotted arrows indicate the path of the RNA through the secondary and tertiary structure of RNase P, the RBS and start codon of SA1278 are in bold, and the region where the anti-sense RNA can hybridise is indicated with a thick black line. E) The difference in average length of RnpB in WT, ΔJ1, and ΔJ1ΔJ2 strains, revealed by the length of the PCR-product generated across the 5′/3′ junction. Results of the cloned and sequenced PCR-products are shown in Table 6 . M: Marker.
    Figure Legend Snippet: Both maturation and inactivation of RNase P RNA is carried out by RNase J. A) Histogram showing the percentage of reads mapping to a given position, out of the total number of reads mapping to the putative SA1279- rnpB operon in each strain (shown in parentheses). Only positions of interest are included, but the full data-set can be found in Table S6 . +1: The putative transcription start site of SA1279. +452 to +477: The RNase J mutants accumulate RNA with 5′-ends in this region. +485: The putative transcription start site of rnpB , a major detected RNA species in the WT, ΔY and ΔcshA, but very reduced in the RNase J mutants. +499: A major detected RNA species in the WT, ΔY and ΔcshA, however it is absent from the RNase J1 mutants and reduced in the ΔJ2 strain. B) The layout of the region around SA1279 and rnpB . DNA is represented as a wavy line, and RNA transcripts as straight black lines. (PP)P indicates a mix of tri- and mono-phosphorylated RNA, generated by pyrophosphohydrolases. Small blue arrows indicate the PCR-primers used to amplify circularised RnpB and SA1279-RnpB for mapping the 5′ and 3′-ends. R1 indicates the probe used for the Northern blot shown in Figure S2 . C) A blow-up of the region from +420 to +540, showing the proposed model for converting the +1 transcript into mature RnpB. P indicates mono-phosphorylation. D) Predicted secondary structures of RnpB, generated using mfold with default settings [30] , and based on the crystal structures of RNase P RNA [27] , [31] . Within the RNase P structure, the thin dotted arrows indicate the path of the RNA through the secondary and tertiary structure of RNase P, the RBS and start codon of SA1278 are in bold, and the region where the anti-sense RNA can hybridise is indicated with a thick black line. E) The difference in average length of RnpB in WT, ΔJ1, and ΔJ1ΔJ2 strains, revealed by the length of the PCR-product generated across the 5′/3′ junction. Results of the cloned and sequenced PCR-products are shown in Table 6 . M: Marker.

    Techniques Used: Generated, Polymerase Chain Reaction, Northern Blot, Clone Assay, Marker

    SA1075 mRNA inactivation by RNase J competes with translation initiation. A) Histogram showing the percentage of reads mapping to a given position, out of the total number of reads mapping to the SA1075 transcript in each strain (shown in parentheses). Only positions of interest are included, but the full data-set can be found in Table S8 . +1: The putative transcription start site. +16: The major detected RNA species in the WT, ΔY and ΔcshA. +45: Position where ΔJ1ΔJ2 differs from ΔJ1, ΔJ2 and J1 AGA , and appears similar to WT. B) Important positions indicated on the SA1075 gene. +1: Transcription Start Site. RBS: Ribosome Binding Site. R2 indicates the probe used for the Northern blot in panel D. C) Hairpin structure predicted by the mfold algorithm, which sequesters the RBS and start-codon (shown in bold). No secondary structure was predicted for the 50 nucleotides downstream of position +45. D) Northern blot of the SA1075 transcript, using probe R2. The +1 and +16 RNA species are not resolved, and can be seen as a single band, however the +45 species is clearly visible in the ΔJ1, ΔJ2, and J1 AGA strains. The marker was stained with methylene blue and photographed. As a loading control, the Northern blot was stripped and re-probed to detect the 5S rRNA. E) The proposed model for determining the fate of SA1075 mRNA via competition between RNase J, ribosomes and the nuclease that cleaves at position +16. (PP)P indicates a mix of tri- and mono-phosphorylated RNA, generated by pyrophosphohydrolases. Nascent SA1075 mRNA can either be occupied by ribosomes, binding to the RBS, or form Hairpin I which sequesters the RBS. Ribosomes will shield position +45 from RNase J, but the hairpin will not. If cleavage at position +16 occurs before RNase J has cleaved at position +45, then the RBS will be liberated from Hairpin I, and ribosomes can initiate translation. If ever the +45 cut is made by RNase J, then the mRNA, which no longer has RBS or start-codon, is immediately degraded (possibly by the RNase J1+J2 complex). Either RNase J1 or RNase J2 can perform a cleavage at position +45. The loss of both RNases prevents the +45 RNA species from being generated, thus explaining why the WT and the ΔJ1ΔJ2 strains appear similar in panel A (see discussion for details and other potential explanations).
    Figure Legend Snippet: SA1075 mRNA inactivation by RNase J competes with translation initiation. A) Histogram showing the percentage of reads mapping to a given position, out of the total number of reads mapping to the SA1075 transcript in each strain (shown in parentheses). Only positions of interest are included, but the full data-set can be found in Table S8 . +1: The putative transcription start site. +16: The major detected RNA species in the WT, ΔY and ΔcshA. +45: Position where ΔJ1ΔJ2 differs from ΔJ1, ΔJ2 and J1 AGA , and appears similar to WT. B) Important positions indicated on the SA1075 gene. +1: Transcription Start Site. RBS: Ribosome Binding Site. R2 indicates the probe used for the Northern blot in panel D. C) Hairpin structure predicted by the mfold algorithm, which sequesters the RBS and start-codon (shown in bold). No secondary structure was predicted for the 50 nucleotides downstream of position +45. D) Northern blot of the SA1075 transcript, using probe R2. The +1 and +16 RNA species are not resolved, and can be seen as a single band, however the +45 species is clearly visible in the ΔJ1, ΔJ2, and J1 AGA strains. The marker was stained with methylene blue and photographed. As a loading control, the Northern blot was stripped and re-probed to detect the 5S rRNA. E) The proposed model for determining the fate of SA1075 mRNA via competition between RNase J, ribosomes and the nuclease that cleaves at position +16. (PP)P indicates a mix of tri- and mono-phosphorylated RNA, generated by pyrophosphohydrolases. Nascent SA1075 mRNA can either be occupied by ribosomes, binding to the RBS, or form Hairpin I which sequesters the RBS. Ribosomes will shield position +45 from RNase J, but the hairpin will not. If cleavage at position +16 occurs before RNase J has cleaved at position +45, then the RBS will be liberated from Hairpin I, and ribosomes can initiate translation. If ever the +45 cut is made by RNase J, then the mRNA, which no longer has RBS or start-codon, is immediately degraded (possibly by the RNase J1+J2 complex). Either RNase J1 or RNase J2 can perform a cleavage at position +45. The loss of both RNases prevents the +45 RNA species from being generated, thus explaining why the WT and the ΔJ1ΔJ2 strains appear similar in panel A (see discussion for details and other potential explanations).

    Techniques Used: Binding Assay, Northern Blot, Marker, Staining, Generated

    mRNA maturation by RNase J reveals a potential regulation of translation. A) Histogram showing the percentage of reads mapping to a given position, out of the total number of reads mapping to the SA2322 transcript in each strain (shown in parentheses). Only positions of interest are included, but the full data-set can be found in Table S7 . +1 and +2: The putative transcription start sites. +52: A major detected RNA species in the WT, ΔY and ΔcshA, however it is absent from the RNase J1 mutants and strongly reduced in the ΔJ2 strain. B) The SA2322 locus with important positions indicated. C) A schematic view of the fate of SA2322 transcripts. A newly formed transcript can form a secondary structure, shown in panel D, which partially sequesters the ribosome binding site (RBS). RNase J can shorten the transcript by 51 nt, and is presumably blocked from further exonucleolytic digestion by ribosomes binding to the RBS. (PP)P indicates a mix of tri- and mono-phosphorylated RNA, generated by pyrophosphohydrolases. D) Predicted secondary structure at the 5′-end of the SA2322 transcript. ΔG values predicted by the mfold algorithm are in kcal/mol. RBS and start codon are indicated in bold.
    Figure Legend Snippet: mRNA maturation by RNase J reveals a potential regulation of translation. A) Histogram showing the percentage of reads mapping to a given position, out of the total number of reads mapping to the SA2322 transcript in each strain (shown in parentheses). Only positions of interest are included, but the full data-set can be found in Table S7 . +1 and +2: The putative transcription start sites. +52: A major detected RNA species in the WT, ΔY and ΔcshA, however it is absent from the RNase J1 mutants and strongly reduced in the ΔJ2 strain. B) The SA2322 locus with important positions indicated. C) A schematic view of the fate of SA2322 transcripts. A newly formed transcript can form a secondary structure, shown in panel D, which partially sequesters the ribosome binding site (RBS). RNase J can shorten the transcript by 51 nt, and is presumably blocked from further exonucleolytic digestion by ribosomes binding to the RBS. (PP)P indicates a mix of tri- and mono-phosphorylated RNA, generated by pyrophosphohydrolases. D) Predicted secondary structure at the 5′-end of the SA2322 transcript. ΔG values predicted by the mfold algorithm are in kcal/mol. RBS and start codon are indicated in bold.

    Techniques Used: Binding Assay, Generated

    4) Product Images from "Polyvinylsulfonic acid: A Low-cost RNase inhibitor for enhanced RNA preservation and cell-free protein translation"

    Article Title: Polyvinylsulfonic acid: A Low-cost RNase inhibitor for enhanced RNA preservation and cell-free protein translation

    Journal: Bioengineered

    doi: 10.1080/21655979.2017.1313648

    Inhibition of RNase Activity with PVSA. The relative RNase Activity of both RNase A and E. coli lysate was measured at varying concentrations of PVSA using RNaseAlert® (Ambion). The amount of PVSA required for 50% inhibition (IC 50 , inset) was determined from normalized data fit to a reciprocal semi-log response curve (n = 3, error bars represent 1 standard deviation).
    Figure Legend Snippet: Inhibition of RNase Activity with PVSA. The relative RNase Activity of both RNase A and E. coli lysate was measured at varying concentrations of PVSA using RNaseAlert® (Ambion). The amount of PVSA required for 50% inhibition (IC 50 , inset) was determined from normalized data fit to a reciprocal semi-log response curve (n = 3, error bars represent 1 standard deviation).

    Techniques Used: Inhibition, Activity Assay, Standard Deviation

    5) Product Images from "RNA targeting with CRISPR-Cas13a"

    Article Title: RNA targeting with CRISPR-Cas13a

    Journal:

    doi: 10.1038/nature24049

    Biochemical characterization of LwaCas13a RNA cleavage activity a, LwaCas13a has more active RNAse activity than LshCas13a. b, Gel electrophoresis of ssRNA1 after incubation with LwaCas13a and with and without crRNA 1 for varying amounts of times. c, Gel electrophoresis of ssRNA1 after incubation with varying amounts of LwaCas13a-crRNA complex. d, Sequence and structure of ssRNA 4 and ssRNA 5. crRNA spacer sequence is highlighted in blue. e, Gel electrophoresis of ssRNA 4 and ssRNA 5 after incubation with LwaCas13a and crRNA 1. f, Sequence and structure of ssRNA 4 with sites of poly-x modifications highlighted in red. crRNA spacer sequence is highlighted in blue. g, Gel electrophoresis of ssRNA 4 with each of 4 possible poly-x modifications incubated with LwaCas13a and crRNA 1. h, LwaCas13a can process pre-crRNA from the L. wadei CRISPR-Cas locus. i, Cleavage efficiency of ssRNA 1 for crRNA spacer truncations after incubation with LwaCas13a.
    Figure Legend Snippet: Biochemical characterization of LwaCas13a RNA cleavage activity a, LwaCas13a has more active RNAse activity than LshCas13a. b, Gel electrophoresis of ssRNA1 after incubation with LwaCas13a and with and without crRNA 1 for varying amounts of times. c, Gel electrophoresis of ssRNA1 after incubation with varying amounts of LwaCas13a-crRNA complex. d, Sequence and structure of ssRNA 4 and ssRNA 5. crRNA spacer sequence is highlighted in blue. e, Gel electrophoresis of ssRNA 4 and ssRNA 5 after incubation with LwaCas13a and crRNA 1. f, Sequence and structure of ssRNA 4 with sites of poly-x modifications highlighted in red. crRNA spacer sequence is highlighted in blue. g, Gel electrophoresis of ssRNA 4 with each of 4 possible poly-x modifications incubated with LwaCas13a and crRNA 1. h, LwaCas13a can process pre-crRNA from the L. wadei CRISPR-Cas locus. i, Cleavage efficiency of ssRNA 1 for crRNA spacer truncations after incubation with LwaCas13a.

    Techniques Used: Activity Assay, Nucleic Acid Electrophoresis, Incubation, Sequencing, CRISPR

    6) Product Images from "RNA binding to CBP stimulates histone acetylation and transcription"

    Article Title: RNA binding to CBP stimulates histone acetylation and transcription

    Journal:

    doi: 10.1016/j.cell.2016.12.020

    CBP interacts with RNA in vivo A) Native RNA-IP of CBP. Top, RNA immunprecipitated with CBP. Bottom, CBP western blot. B) PAR-CLIP protocol. 4-Thiouridine (4-SU). C) CBP PAR-CLIP required 4-SU: top, autoradiography; bottom, CBP western blot.. D) Quantification of CBP PAR-CLIP. Error bars represent mean +/− s.e.m; n=4. E) CBP PAR-CLIP signal was sensitive to RNAse. 1× RNAse cocktail contained: RNAse A (0.01mU/ul) + RNase T1 (0.4mU/ul). F) Quantification of RNase titration. Error bars represent mean +/− s.e.m; n=4; P -values from two-tailed Student’s t-test: *P < 0.05; **P < 0.01; ***P < 0.001.
    Figure Legend Snippet: CBP interacts with RNA in vivo A) Native RNA-IP of CBP. Top, RNA immunprecipitated with CBP. Bottom, CBP western blot. B) PAR-CLIP protocol. 4-Thiouridine (4-SU). C) CBP PAR-CLIP required 4-SU: top, autoradiography; bottom, CBP western blot.. D) Quantification of CBP PAR-CLIP. Error bars represent mean +/− s.e.m; n=4. E) CBP PAR-CLIP signal was sensitive to RNAse. 1× RNAse cocktail contained: RNAse A (0.01mU/ul) + RNase T1 (0.4mU/ul). F) Quantification of RNase titration. Error bars represent mean +/− s.e.m; n=4; P -values from two-tailed Student’s t-test: *P < 0.05; **P < 0.01; ***P < 0.001.

    Techniques Used: In Vivo, Western Blot, Cross-linking Immunoprecipitation, Autoradiography, Titration, Two Tailed Test

    Related Articles

    Centrifugation:

    Article Title: A long non-coding RNA is required for targeting centromeric protein A to the human centromere
    Article Snippet: The pellet was washed with 75% ethanol (diluted from 100% ethanol, #61509-0010, Acros Organics, Pittsburgh, PA) and resuspended in water complemented with DNase I buffer, DNase I (#M0303; New England Biolabs–NEB, Ipswich, MA), and RNase inhibitor (#M0314, NEB) to avoid genomic DNA contamination. .. The pellet was washed with 75% ethanol (diluted from 100% ethanol, #61509-0010, Acros Organics, Pittsburgh, PA) and resuspended in water complemented with DNase I buffer, DNase I (#M0303; New England Biolabs–NEB, Ipswich, MA), and RNase inhibitor (#M0314, NEB) to avoid genomic DNA contamination.

    Amplification:

    Article Title: A long non-coding RNA is required for targeting centromeric protein A to the human centromere
    Article Snippet: The pellet was washed with 75% ethanol (diluted from 100% ethanol, #61509-0010, Acros Organics, Pittsburgh, PA) and resuspended in water complemented with DNase I buffer, DNase I (#M0303; New England Biolabs–NEB, Ipswich, MA), and RNase inhibitor (#M0314, NEB) to avoid genomic DNA contamination. .. The pellet was washed with 75% ethanol (diluted from 100% ethanol, #61509-0010, Acros Organics, Pittsburgh, PA) and resuspended in water complemented with DNase I buffer, DNase I (#M0303; New England Biolabs–NEB, Ipswich, MA), and RNase inhibitor (#M0314, NEB) to avoid genomic DNA contamination.

    Article Title: Evolution of the SPATULA/ALCATRAZ gene lineage and expression analyses in the basal eudicot, Bocconia frutescens L. (Papaveraceae)
    Article Snippet: DNA templates for RNA probe synthesis were obtained by PCR amplification of 312–412 bp fragments. .. Digoxigenin labeled RNA probes were prepared using T7 polymerase (Roche, Switzerland), murine RNAse inhibitor (New England Biolabs, Ipswich, MA, USA), and RNA labeling-mix (Roche, Switzerland) according to each manufacturers protocol.

    Article Title: Precardiac organoids form two heart fields via Bmp/Wnt signaling
    Article Snippet: GFP+ and RFP+ cells were isolated using a SH800 cell sorter (Sony Biotechnologies) into 96 plates containing water (2.4 mL) with RNase-free DNase I (0.2 mL; NEB) and RNase inhibitor (0.25 mL; NEB). .. GFP+ and RFP+ cells were isolated using a SH800 cell sorter (Sony Biotechnologies) into 96 plates containing water (2.4 mL) with RNase-free DNase I (0.2 mL; NEB) and RNase inhibitor (0.25 mL; NEB).

    Synthesized:

    Article Title: Mitochondrial m.1584A 12S m62A rRNA methylation in families with m.1555A > G associated hearing loss
    Article Snippet: Unmethylated and methylated model RNA oligonucleotides were synthesized (Thermo Scientific) to replicate each of the reported native RNA conditions ( , ). .. One microliter of 10–20 nm RNA oligonucleotide was incubated with 1 µl of 50–100 nm 5′-Ned-labelled primer and 20 units of RNAse Inhibitor (NEB) at 55°C for 20 min. Twenty units of Avian Myeloblastosis Virus (AMV) Reverse Transcriptase (NEB), ×10 reaction buffer, 20 units of RNase Inhibitor (NEB) and 1 µl 500 nm dNTP stock (containing ddGTP in place of dGTP) were added, and the reaction mixture was incubated overnight at 42°C in a final volume of 10 µl.

    Article Title: JMJD8 is a positive regulator of TNF-induced NF-κB signaling
    Article Snippet: Total RNA was prepared with the Thermo Scientific GeneJET RNA Purification Kit according to the manufacturer’s protocol. .. The cDNA was synthesized from 0.5–1 μg of RNA (DNase I-treated, Thermoscientific) using random hexamer (Invitrogen), dNTPs (Thermoscientific), RNase inhibitor and Moloney Murine Leukemia Virus (M-MuLV, MMLV) Reverse Transcriptase (NEB) according to the manufacturer’s recommendation. .. Generated cDNA was used for subsequent RT-qPCR assays.

    Article Title: Soybean cyst nematode culture collections and field populations from North Carolina and Missouri reveal high incidences of infection by viruses
    Article Snippet: Total RNA concentrations were analyzed via Nanodrop 1000 (Thermo Fisher Scientific, Waltham, MA). cDNA was synthesized by incubating approximately 1 μg RNA with 0.06 μg random primers (Invitrogen) for 10 minutes at 70°C followed by rapid cooling on ice. .. Next, 4 μl GeneAmp® 10X PCR Buffer II (Applied Biosystems, Foster City, CA), 5.5 mM MgCl2 , 0.5 μM deoxynucleotide solution mix, 32 U Murine RNase Inhibitor (New England BioLabs, Ipswich, MA), and 50 U Multiscribe™ Reverse Transcriptase (Applied Biosystems) were added before additional incubations of 42°C and 70°C for 15 minutes each.

    Quantitative RT-PCR:

    Article Title: Inducible and coupled expression of the polyomavirus middle T antigen and Cre recombinase in transgenic mice: an in vivo model for synthetic viability in mammary tumour progression
    Article Snippet: Paragraph title: qRT-PCR ... Total RNA was extracted from flash frozen mammary tumours and lung lesions using a Qiagen AllPrep DNA/RNA Mini Kit (Qiagen Inc., Toronto, ON, Canada; #80204). cDNA was prepared by reverse transcribing the isolated RNA using M-Mulv Reverse Transcriptase (#M0253S), Oligo-dT(23VN) (#S1327S) and a murine RNase inhibitor (#M0314S) (all purchased from New England Biolabs).

    Article Title: JMJD8 is a positive regulator of TNF-induced NF-κB signaling
    Article Snippet: The cDNA was synthesized from 0.5–1 μg of RNA (DNase I-treated, Thermoscientific) using random hexamer (Invitrogen), dNTPs (Thermoscientific), RNase inhibitor and Moloney Murine Leukemia Virus (M-MuLV, MMLV) Reverse Transcriptase (NEB) according to the manufacturer’s recommendation. .. Generated cDNA was used for subsequent RT-qPCR assays.

    Article Title: nc886 is induced by TGF-β and suppresses the microRNA pathway in ovarian cancer
    Article Snippet: The binding assays were done at 4 °C for 10 min in the same reaction mixture as the in vitro Dicer processing assay, except that 0.001% Nonidet P-40, 3.2 mM Ribonucleoside-Vanadyl Complex (New England Biolabs), and 0.24 unit µl−1 of RNase Inhibitor (New England Biolabs) were included, but ATP, creatine phosphate, and creatine kinase were excluded. .. The binding assays were done at 4 °C for 10 min in the same reaction mixture as the in vitro Dicer processing assay, except that 0.001% Nonidet P-40, 3.2 mM Ribonucleoside-Vanadyl Complex (New England Biolabs), and 0.24 unit µl−1 of RNase Inhibitor (New England Biolabs) were included, but ATP, creatine phosphate, and creatine kinase were excluded.

    Article Title: Groucho related gene 5 (GRG5) is involved in embryonic and neural stem cell state decisions
    Article Snippet: Paragraph title: Quantitative RT-PCR ... 2 μg RNA was reversely transcribed to cDNA by M-MuLV Reverse Transcriptase (NEBiolabs) supplemented with RNase inhibitor (NEBiolabs) according to the manufacturer’s instructions.

    Real-time Polymerase Chain Reaction:

    Article Title: Cell-Type Specific Features of Circular RNA Expression
    Article Snippet: 2 micrograms of total RNA was treated in a 10 microliter reaction with 0 units (mock treatment) or 20 units of RNase R (Epicentre) in 1× RNase R buffer, 1 unit/microliter murine Ribonuclease Inhibitor (New England Biolabs), and incubated at 37DEGC for 1 hr. .. 4 microliters 5× buffer (250 mM Tris-HCl pH 8, 125 mM KCl, 15 mM MgCl_2), 1 microliter murine Ribonuclease Inhibitor (40 units/microliter), and 1 microliter Superscript III (LIfe Technologies) were added; this cDNA reaction was incubated at 25 deg C 10 min, 50 deg C 50 min, 55 deg C 10 min, 85 deg C 5 min, 4 deg C hold.

    Article Title: Production of para-aminobenzoic acid from different carbon-sources in engineered Saccharomyces cerevisiae
    Article Snippet: Samples (1–2 mL) from exponential phase (OD660 = 1) were centrifuged to pellet cells; cell pellets were resuspended in 1 mL TRIzol® (Ambion) and stored at −80 °C until extraction (no longer than 10 days). .. RNA was extracted using the PureLink® RNA Mini Kit (Ambion) in combination with RQ1 RNase-Free DNase (Promega) for on column DNAse treatment. mRNA (100–1000 ng) was reverse transcribed using Oligo d(T)18 primers and SuperScript® III reverse transcriptase (Invitrogen) in combination with RNase Inhibitor, Murine (NEB) according to the manufacturer’s instructions. qPCR reactions were carried out in a CFX96 Touch™ Real-Time PCR Detection System, using the SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad) outgoing from 10 to 100 ng RNA equivalent. .. Primers for mRNAs were unified to amplify regions homologous among the different ABZ1 and ABZ2 genes respectively, the sequences are listed in Table .

    Article Title: JMJD8 is a positive regulator of TNF-induced NF-κB signaling
    Article Snippet: Paragraph title: RNA isolation and qPCR ... The cDNA was synthesized from 0.5–1 μg of RNA (DNase I-treated, Thermoscientific) using random hexamer (Invitrogen), dNTPs (Thermoscientific), RNase inhibitor and Moloney Murine Leukemia Virus (M-MuLV, MMLV) Reverse Transcriptase (NEB) according to the manufacturer’s recommendation.

    Article Title: Endothelial cell activation by antiphospholipid antibodies is modulated by Kr?ppel-like transcription factors
    Article Snippet: DNAse I and all quantitative PCR primers were obtained from Invitrogen. .. Reverse transcriptase buffer, RNAse inhibitor, and Moloney murine leukemia virus reverse transcriptase were obtained from New England Biolabs.

    Random Hexamer Labeling:

    Article Title: A long non-coding RNA is required for targeting centromeric protein A to the human centromere
    Article Snippet: The pellet was washed with 75% ethanol (diluted from 100% ethanol, #61509-0010, Acros Organics, Pittsburgh, PA) and resuspended in water complemented with DNase I buffer, DNase I (#M0303; New England Biolabs–NEB, Ipswich, MA), and RNase inhibitor (#M0314, NEB) to avoid genomic DNA contamination. .. The pellet was washed with 75% ethanol (diluted from 100% ethanol, #61509-0010, Acros Organics, Pittsburgh, PA) and resuspended in water complemented with DNase I buffer, DNase I (#M0303; New England Biolabs–NEB, Ipswich, MA), and RNase inhibitor (#M0314, NEB) to avoid genomic DNA contamination.

    Article Title: JMJD8 is a positive regulator of TNF-induced NF-κB signaling
    Article Snippet: Total RNA was prepared with the Thermo Scientific GeneJET RNA Purification Kit according to the manufacturer’s protocol. .. The cDNA was synthesized from 0.5–1 μg of RNA (DNase I-treated, Thermoscientific) using random hexamer (Invitrogen), dNTPs (Thermoscientific), RNase inhibitor and Moloney Murine Leukemia Virus (M-MuLV, MMLV) Reverse Transcriptase (NEB) according to the manufacturer’s recommendation. .. Generated cDNA was used for subsequent RT-qPCR assays.

    Expressing:

    Article Title: Production of para-aminobenzoic acid from different carbon-sources in engineered Saccharomyces cerevisiae
    Article Snippet: RNA was extracted using the PureLink® RNA Mini Kit (Ambion) in combination with RQ1 RNase-Free DNase (Promega) for on column DNAse treatment. mRNA (100–1000 ng) was reverse transcribed using Oligo d(T)18 primers and SuperScript® III reverse transcriptase (Invitrogen) in combination with RNase Inhibitor, Murine (NEB) according to the manufacturer’s instructions. qPCR reactions were carried out in a CFX96 Touch™ Real-Time PCR Detection System, using the SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad) outgoing from 10 to 100 ng RNA equivalent. .. RNA was extracted using the PureLink® RNA Mini Kit (Ambion) in combination with RQ1 RNase-Free DNase (Promega) for on column DNAse treatment. mRNA (100–1000 ng) was reverse transcribed using Oligo d(T)18 primers and SuperScript® III reverse transcriptase (Invitrogen) in combination with RNase Inhibitor, Murine (NEB) according to the manufacturer’s instructions. qPCR reactions were carried out in a CFX96 Touch™ Real-Time PCR Detection System, using the SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad) outgoing from 10 to 100 ng RNA equivalent.

    Article Title: Evolution of the SPATULA/ALCATRAZ gene lineage and expression analyses in the basal eudicot, Bocconia frutescens L. (Papaveraceae)
    Article Snippet: Paragraph title: Expression analyses by In Situ Hybridization ... Digoxigenin labeled RNA probes were prepared using T7 polymerase (Roche, Switzerland), murine RNAse inhibitor (New England Biolabs, Ipswich, MA, USA), and RNA labeling-mix (Roche, Switzerland) according to each manufacturers protocol.

    Modification:

    Article Title: Soybean cyst nematode culture collections and field populations from North Carolina and Missouri reveal high incidences of infection by viruses
    Article Snippet: Next, 4 μl GeneAmp® 10X PCR Buffer II (Applied Biosystems, Foster City, CA), 5.5 mM MgCl2 , 0.5 μM deoxynucleotide solution mix, 32 U Murine RNase Inhibitor (New England BioLabs, Ipswich, MA), and 50 U Multiscribe™ Reverse Transcriptase (Applied Biosystems) were added before additional incubations of 42°C and 70°C for 15 minutes each. .. Next, 4 μl GeneAmp® 10X PCR Buffer II (Applied Biosystems, Foster City, CA), 5.5 mM MgCl2 , 0.5 μM deoxynucleotide solution mix, 32 U Murine RNase Inhibitor (New England BioLabs, Ipswich, MA), and 50 U Multiscribe™ Reverse Transcriptase (Applied Biosystems) were added before additional incubations of 42°C and 70°C for 15 minutes each.

    Article Title: Multiplexed imaging of high-density libraries of RNAs with MERFISH and expansion microscopy
    Article Snippet: Then 30 μL of ∼300 μM encoding probes and 3.3 μM of poly(dT) LNA anchor probe (a 20-nt sequence of alternating dT and thymidine-locked nucleic acid (dT+) with a 20-nt reverse complement of a readout sequence and a 5′-acrydite modification (Integrated DNA Technologies)) in encoding hybridization buffer was added to the surface of Parafilm (Bemis) and was covered with a cell-containing coverslip. .. Encoding hybridization buffer was composed of encoding wash buffer supplemented with 0.1% (wt/vol) yeast tRNA (Life Technologies), 1% (vol/vol) murine RNase inhibitor (New England Biolabs), and 10% (wt/vol) dextran sulfate (Sigma).

    Hybridization:

    Article Title: Multiplexed imaging of high-density libraries of RNAs with MERFISH and expansion microscopy
    Article Snippet: Then 30 μL of ∼300 μM encoding probes and 3.3 μM of poly(dT) LNA anchor probe (a 20-nt sequence of alternating dT and thymidine-locked nucleic acid (dT+) with a 20-nt reverse complement of a readout sequence and a 5′-acrydite modification (Integrated DNA Technologies)) in encoding hybridization buffer was added to the surface of Parafilm (Bemis) and was covered with a cell-containing coverslip. .. Encoding hybridization buffer was composed of encoding wash buffer supplemented with 0.1% (wt/vol) yeast tRNA (Life Technologies), 1% (vol/vol) murine RNase inhibitor (New England Biolabs), and 10% (wt/vol) dextran sulfate (Sigma). .. Samples were incubated in a humid chamber inside a hybridization oven at 37 °C for 40 h. Cells then were washed with encoding wash buffer and incubated at 47 °C for 30 min; this washing step was repeated once.

    High Performance Liquid Chromatography:

    Article Title: Mitochondrial m.1584A 12S m62A rRNA methylation in families with m.1555A > G associated hearing loss
    Article Snippet: One microliter of 10–20 nm RNA oligonucleotide was incubated with 1 µl of 50–100 nm 5′-Ned-labelled primer and 20 units of RNAse Inhibitor (NEB) at 55°C for 20 min. Twenty units of Avian Myeloblastosis Virus (AMV) Reverse Transcriptase (NEB), ×10 reaction buffer, 20 units of RNase Inhibitor (NEB) and 1 µl 500 nm dNTP stock (containing ddGTP in place of dGTP) were added, and the reaction mixture was incubated overnight at 42°C in a final volume of 10 µl. .. One microliter of 10–20 nm RNA oligonucleotide was incubated with 1 µl of 50–100 nm 5′-Ned-labelled primer and 20 units of RNAse Inhibitor (NEB) at 55°C for 20 min. Twenty units of Avian Myeloblastosis Virus (AMV) Reverse Transcriptase (NEB), ×10 reaction buffer, 20 units of RNase Inhibitor (NEB) and 1 µl 500 nm dNTP stock (containing ddGTP in place of dGTP) were added, and the reaction mixture was incubated overnight at 42°C in a final volume of 10 µl.

    Transfection:

    Article Title: Association of Potent Human Antiviral Cytidine Deaminases with 7SL RNA and Viral RNP in HIV-1 Virions
    Article Snippet: To identify A3G-binding RNA, A3G and mutants were transfected into 293T cells. .. At 48 h after transfection, the cells were harvested and washed twice with cold PBS and then lysed with lysis buffer (PBS containing 1% Triton X-100, complete protease inhibitor cocktail [Roche], and RNase inhibitor [New England BioLabs]) at 4°C for 30 min. .. Cell lysates were clarified by centrifugation at 10,000 × g for 30 min at 4°C.

    Gas Chromatography:

    Article Title: Production of para-aminobenzoic acid from different carbon-sources in engineered Saccharomyces cerevisiae
    Article Snippet: To determine the relative mRNA levels of the different over-expressed ABZ1 and ABZ2 genes, PABA strains were cultivated in shake-flask experiments on CDM + GLC, as described earlier. .. RNA was extracted using the PureLink® RNA Mini Kit (Ambion) in combination with RQ1 RNase-Free DNase (Promega) for on column DNAse treatment. mRNA (100–1000 ng) was reverse transcribed using Oligo d(T)18 primers and SuperScript® III reverse transcriptase (Invitrogen) in combination with RNase Inhibitor, Murine (NEB) according to the manufacturer’s instructions. qPCR reactions were carried out in a CFX96 Touch™ Real-Time PCR Detection System, using the SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad) outgoing from 10 to 100 ng RNA equivalent.

    Ligation:

    Article Title: In vitro nanobody discovery for integral membrane protein targets
    Article Snippet: Paragraph title: mRNA-puromycin linker ligation ... Following annealing, 1 mM ATP, 1 µL murine RNase inhibitor (New England Biolabs, NEB), 3 µL T4 ssRNA Ligase were added and the reaction was incubated at room temperature overnight.

    Article Title: TSS-EMOTE, a refined protocol for a more complete and less biased global mapping of transcription start sites in bacterial pathogens
    Article Snippet: Paragraph title: Ligation step ... The “-RppH mix” consisted of 3.5 μl water, 2 μl RNA ligase buffer, 2 μl 10 mM ATP, 1 μl Murine RNase inhibitor (New England Biolabs), and 2 μl RNA ligase 1 (New England Biolabs).

    Protease Inhibitor:

    Article Title: Bacopa monniera (CDRI-08) Upregulates the Expression of Neuronal and Glial Plasticity Markers in the Brain of Scopolamine Induced Amnesic Mice
    Article Snippet: Thereafter, molecular investigations were performed by examining the effect of CDRI-08 on the mRNA and protein expression of BDNF, Arc, and GFAP in the cerebrum of scopolamine injected amnesic mice. .. Random hexanucleotides, dNTPs, enhanced chemiluminescence (ECL) reagents, Taq polymerase, RNase inhibitor, and reverse-transcriptase enzymes were obtained from the New England Biolabs (USA); DTNB, acetyl thiocholine iodide, TRI reagent, monoclonal anti-β -actin-peroxidase (A3854) and rabbit polyclonal GFAP antibody (G4546), and mini protease inhibitor cocktail were purchased from Sigma-Aldrich (USA). .. Mouse monoclonal Arc antibody (sc-17839) and goat polyclonal BDNF antibody (sc-33904) were purchased from Santa Cruz Biotechnology, USA.

    Article Title: Association of Potent Human Antiviral Cytidine Deaminases with 7SL RNA and Viral RNP in HIV-1 Virions
    Article Snippet: To identify A3G-binding RNA, A3G and mutants were transfected into 293T cells. .. At 48 h after transfection, the cells were harvested and washed twice with cold PBS and then lysed with lysis buffer (PBS containing 1% Triton X-100, complete protease inhibitor cocktail [Roche], and RNase inhibitor [New England BioLabs]) at 4°C for 30 min. .. Cell lysates were clarified by centrifugation at 10,000 × g for 30 min at 4°C.

    Northern Blot:

    Article Title: Dicer cleaves 5′-extended microRNA precursors originating from RNA polymerase II transcription start sites
    Article Snippet: Each 25 μl reaction containing 40 mM Tris–HCl pH 8.0, 25 mM NaCl, 2 mM Spermidine(HCl)3 , 8 mM MgCl2 , 1 mM ATP, 1 mM UTP, 1 mM GTP, 1 mM CTP, 20 U Murine RNase Inhibitor (NEB, M0314), 10 mM DTT and 5 U T7 RNA polymerase was incubated at 37°C for 8 h. To synthesize m7 G-capped or 5′ monophosphate pre-miRNAs, 1 mM GTP was substituted with 100 μM GTP and 1 mM m7 G cap analog (NEB, S1404) or 1 mM GMP. .. In cleavage assays, approximately 100 ng purified Dicer was incubated with 1 pmol pre-miRNA in 10 μl dicing buffer (20 mM Tris–HCl pH 6.5, 25 mM NaCl, 1% glycerol, 1.5 mM MgCl2 and 1 mM DTT) for 30 min to 1 h at 37°C as previously described ( ).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Characterization of Wnt/?-catenin and BMP/Smad signaling pathways in an in vitro model of amyotrophic lateral sclerosis
    Article Snippet: Total RNA from NSC34 cells was obtained using Trizol reagent (Invitrogen). .. For reverse transcription-polymerase chain reaction (RT-PCR), 1 μg of RNA was pretreated with DNase I (Fermentas, ON, Canada) and further incubated in a buffer containing 10 μM oligo dT, reverse transcription buffer (0.5 M Tris–HCl, pH 8.3, 0.75 M KCl, 0.03 M MgCl2), 20 U RNase inhibitor (NEB, Ipswich, MA, USA) and 1 mM dNTPs (Invitrogen) at 37°C for 5 min. Stratascript reverse transcriptase (Stratagene, Baltimore, MD, USA) was added (160 U) and the mix was further incubated at 42°C for 1 h. Parallel reactions were performed in the absence of reverse transcriptase to control for the presence of contaminant DNA. .. For amplification, a cDNA aliquot in a volume of 12.5 μl containing 20 mM Tris buffer pH 8.4, 50 mM KCl, 1.6 mM MgCl2, 0.4 mM dNTPs, and 0.04 U Taq polymerase (Kapabiosystems, Boston, MA, US) was incubated 95°C for 5 min, 95°C for 30 s, 50°C for 30 s, and 72°C for 30 s for 35 cycles.

    other:

    Article Title: Characterization of human plasma-derived exosomal RNAs by deep sequencing
    Article Snippet: The RNase A digestion was terminated by adding 150 units/mL of murine RNase inhibitor.

    Polymerase Chain Reaction:

    Article Title: Characterization of Wnt/?-catenin and BMP/Smad signaling pathways in an in vitro model of amyotrophic lateral sclerosis
    Article Snippet: For reverse transcription-polymerase chain reaction (RT-PCR), 1 μg of RNA was pretreated with DNase I (Fermentas, ON, Canada) and further incubated in a buffer containing 10 μM oligo dT, reverse transcription buffer (0.5 M Tris–HCl, pH 8.3, 0.75 M KCl, 0.03 M MgCl2), 20 U RNase inhibitor (NEB, Ipswich, MA, USA) and 1 mM dNTPs (Invitrogen) at 37°C for 5 min. Stratascript reverse transcriptase (Stratagene, Baltimore, MD, USA) was added (160 U) and the mix was further incubated at 42°C for 1 h. Parallel reactions were performed in the absence of reverse transcriptase to control for the presence of contaminant DNA. .. For reverse transcription-polymerase chain reaction (RT-PCR), 1 μg of RNA was pretreated with DNase I (Fermentas, ON, Canada) and further incubated in a buffer containing 10 μM oligo dT, reverse transcription buffer (0.5 M Tris–HCl, pH 8.3, 0.75 M KCl, 0.03 M MgCl2), 20 U RNase inhibitor (NEB, Ipswich, MA, USA) and 1 mM dNTPs (Invitrogen) at 37°C for 5 min. Stratascript reverse transcriptase (Stratagene, Baltimore, MD, USA) was added (160 U) and the mix was further incubated at 42°C for 1 h. Parallel reactions were performed in the absence of reverse transcriptase to control for the presence of contaminant DNA.

    Article Title: A long non-coding RNA is required for targeting centromeric protein A to the human centromere
    Article Snippet: Paragraph title: RNA extraction, retro-transcription and polymerase chain reaction (PCR) ... The pellet was washed with 75% ethanol (diluted from 100% ethanol, #61509-0010, Acros Organics, Pittsburgh, PA) and resuspended in water complemented with DNase I buffer, DNase I (#M0303; New England Biolabs–NEB, Ipswich, MA), and RNase inhibitor (#M0314, NEB) to avoid genomic DNA contamination.

    Article Title: Soybean cyst nematode culture collections and field populations from North Carolina and Missouri reveal high incidences of infection by viruses
    Article Snippet: Total RNA concentrations were analyzed via Nanodrop 1000 (Thermo Fisher Scientific, Waltham, MA). cDNA was synthesized by incubating approximately 1 μg RNA with 0.06 μg random primers (Invitrogen) for 10 minutes at 70°C followed by rapid cooling on ice. .. Next, 4 μl GeneAmp® 10X PCR Buffer II (Applied Biosystems, Foster City, CA), 5.5 mM MgCl2 , 0.5 μM deoxynucleotide solution mix, 32 U Murine RNase Inhibitor (New England BioLabs, Ipswich, MA), and 50 U Multiscribe™ Reverse Transcriptase (Applied Biosystems) were added before additional incubations of 42°C and 70°C for 15 minutes each. .. NCBI GenBank accession numbers for SCN viral sequences are HM849038 (ScNV), HM849039 (ScRV), HM849040 (ScPV), HM849041 (ScTV) and KF726084 (SbCNV-5).

    Article Title: Evolution of the SPATULA/ALCATRAZ gene lineage and expression analyses in the basal eudicot, Bocconia frutescens L. (Papaveraceae)
    Article Snippet: Fragments were cleaned using QIAquick PCR purification Kit (Qiagen, Valencia, CA, USA). .. Digoxigenin labeled RNA probes were prepared using T7 polymerase (Roche, Switzerland), murine RNAse inhibitor (New England Biolabs, Ipswich, MA, USA), and RNA labeling-mix (Roche, Switzerland) according to each manufacturers protocol.

    Article Title: Dicer cleaves 5′-extended microRNA precursors originating from RNA polymerase II transcription start sites
    Article Snippet: To synthesize RNAs, PCR templates containing a T7 promoter sequence upstream of the RNA coding sequences were used in T7 run-off transcription reactions. .. Each 25 μl reaction containing 40 mM Tris–HCl pH 8.0, 25 mM NaCl, 2 mM Spermidine(HCl)3 , 8 mM MgCl2 , 1 mM ATP, 1 mM UTP, 1 mM GTP, 1 mM CTP, 20 U Murine RNase Inhibitor (NEB, M0314), 10 mM DTT and 5 U T7 RNA polymerase was incubated at 37°C for 8 h. To synthesize m7 G-capped or 5′ monophosphate pre-miRNAs, 1 mM GTP was substituted with 100 μM GTP and 1 mM m7 G cap analog (NEB, S1404) or 1 mM GMP.

    Article Title: Precardiac organoids form two heart fields via Bmp/Wnt signaling
    Article Snippet: GFP+ and RFP+ cells were isolated using a SH800 cell sorter (Sony Biotechnologies) into 96 plates containing water (2.4 mL) with RNase-free DNase I (0.2 mL; NEB) and RNase inhibitor (0.25 mL; NEB). .. GFP+ and RFP+ cells were isolated using a SH800 cell sorter (Sony Biotechnologies) into 96 plates containing water (2.4 mL) with RNase-free DNase I (0.2 mL; NEB) and RNase inhibitor (0.25 mL; NEB).

    Affinity Purification:

    Article Title: Endothelial cell activation by antiphospholipid antibodies is modulated by Kr?ppel-like transcription factors
    Article Snippet: Reverse transcriptase buffer, RNAse inhibitor, and Moloney murine leukemia virus reverse transcriptase were obtained from New England Biolabs. .. Reverse transcriptase buffer, RNAse inhibitor, and Moloney murine leukemia virus reverse transcriptase were obtained from New England Biolabs.

    Binding Assay:

    Article Title: nc886 is induced by TGF-β and suppresses the microRNA pathway in ovarian cancer
    Article Snippet: The reaction products were resolved in a 15% denaturing polyacrylamide gel and subjected to northern hybridization using probes for each precursor (for probe sequences, see Supplementary Data File ). .. The binding assays were done at 4 °C for 10 min in the same reaction mixture as the in vitro Dicer processing assay, except that 0.001% Nonidet P-40, 3.2 mM Ribonucleoside-Vanadyl Complex (New England Biolabs), and 0.24 unit µl−1 of RNase Inhibitor (New England Biolabs) were included, but ATP, creatine phosphate, and creatine kinase were excluded. .. After washing with buffer D (5 times), the bound RNA was eluted into RNase-free H2 O by heating the reaction at 75 °C for 5 min.

    Methylation:

    Article Title: Mitochondrial m.1584A 12S m62A rRNA methylation in families with m.1555A > G associated hearing loss
    Article Snippet: Unmethylated and methylated model RNA oligonucleotides were synthesized (Thermo Scientific) to replicate each of the reported native RNA conditions ( , ). .. One microliter of 10–20 nm RNA oligonucleotide was incubated with 1 µl of 50–100 nm 5′-Ned-labelled primer and 20 units of RNAse Inhibitor (NEB) at 55°C for 20 min. Twenty units of Avian Myeloblastosis Virus (AMV) Reverse Transcriptase (NEB), ×10 reaction buffer, 20 units of RNase Inhibitor (NEB) and 1 µl 500 nm dNTP stock (containing ddGTP in place of dGTP) were added, and the reaction mixture was incubated overnight at 42°C in a final volume of 10 µl.

    Isolation:

    Article Title: Cell-Type Specific Features of Circular RNA Expression
    Article Snippet: HeLa total RNA was isolated by TRIZOL lysis followed by PureLink purification of the aqueous phase (Life Technologies). .. 2 micrograms of total RNA was treated in a 10 microliter reaction with 0 units (mock treatment) or 20 units of RNase R (Epicentre) in 1× RNase R buffer, 1 unit/microliter murine Ribonuclease Inhibitor (New England Biolabs), and incubated at 37DEGC for 1 hr.

    Article Title: Inducible and coupled expression of the polyomavirus middle T antigen and Cre recombinase in transgenic mice: an in vivo model for synthetic viability in mammary tumour progression
    Article Snippet: OCT-embedded sections of mammary tumours were processed and stained with X-gal as described previously [ ]. .. Total RNA was extracted from flash frozen mammary tumours and lung lesions using a Qiagen AllPrep DNA/RNA Mini Kit (Qiagen Inc., Toronto, ON, Canada; #80204). cDNA was prepared by reverse transcribing the isolated RNA using M-Mulv Reverse Transcriptase (#M0253S), Oligo-dT(23VN) (#S1327S) and a murine RNase inhibitor (#M0314S) (all purchased from New England Biolabs). .. Real-time quantitative PCR was performed on the cDNA using LightCycler 480 SYBR Green I Master (Roche, Missisauga, ON, Canada; #04707516001) and run on a Roche LightCycler 480 instrument.

    Article Title: JMJD8 is a positive regulator of TNF-induced NF-κB signaling
    Article Snippet: Paragraph title: RNA isolation and qPCR ... The cDNA was synthesized from 0.5–1 μg of RNA (DNase I-treated, Thermoscientific) using random hexamer (Invitrogen), dNTPs (Thermoscientific), RNase inhibitor and Moloney Murine Leukemia Virus (M-MuLV, MMLV) Reverse Transcriptase (NEB) according to the manufacturer’s recommendation.

    Article Title: Precardiac organoids form two heart fields via Bmp/Wnt signaling
    Article Snippet: All samples were also analyzed for gapdh to exclude false-positive results. .. GFP+ and RFP+ cells were isolated using a SH800 cell sorter (Sony Biotechnologies) into 96 plates containing water (2.4 mL) with RNase-free DNase I (0.2 mL; NEB) and RNase inhibitor (0.25 mL; NEB). .. DNase I was inactivated by increasing the temperature (72 °C for 3 min), and samples were then stored on ice.

    Labeling:

    Article Title: Evolution of the SPATULA/ALCATRAZ gene lineage and expression analyses in the basal eudicot, Bocconia frutescens L. (Papaveraceae)
    Article Snippet: Fragments were cleaned using QIAquick PCR purification Kit (Qiagen, Valencia, CA, USA). .. Digoxigenin labeled RNA probes were prepared using T7 polymerase (Roche, Switzerland), murine RNAse inhibitor (New England Biolabs, Ipswich, MA, USA), and RNA labeling-mix (Roche, Switzerland) according to each manufacturers protocol. .. RNA in situ hybridization was performed according to Ambrose et al. [ ] and Ferrándiz et al. [ ], optimized to hybridize overnight at 55 °C.

    Purification:

    Article Title: Cell-Type Specific Features of Circular RNA Expression
    Article Snippet: HeLa total RNA was isolated by TRIZOL lysis followed by PureLink purification of the aqueous phase (Life Technologies). .. 2 micrograms of total RNA was treated in a 10 microliter reaction with 0 units (mock treatment) or 20 units of RNase R (Epicentre) in 1× RNase R buffer, 1 unit/microliter murine Ribonuclease Inhibitor (New England Biolabs), and incubated at 37DEGC for 1 hr.

    Article Title: In vitro nanobody discovery for integral membrane protein targets
    Article Snippet: Purified mRNA was ligated to the puromycin linker, Nb_Disp_Puro using a DNA splint, Nb-GFP_Disp_Splint or HuSdL_Disp_Splint ( ). .. Following annealing, 1 mM ATP, 1 µL murine RNase inhibitor (New England Biolabs, NEB), 3 µL T4 ssRNA Ligase were added and the reaction was incubated at room temperature overnight.

    Article Title: JMJD8 is a positive regulator of TNF-induced NF-κB signaling
    Article Snippet: Total RNA was prepared with the Thermo Scientific GeneJET RNA Purification Kit according to the manufacturer’s protocol. .. The cDNA was synthesized from 0.5–1 μg of RNA (DNase I-treated, Thermoscientific) using random hexamer (Invitrogen), dNTPs (Thermoscientific), RNase inhibitor and Moloney Murine Leukemia Virus (M-MuLV, MMLV) Reverse Transcriptase (NEB) according to the manufacturer’s recommendation.

    Article Title: Evolution of the SPATULA/ALCATRAZ gene lineage and expression analyses in the basal eudicot, Bocconia frutescens L. (Papaveraceae)
    Article Snippet: Fragments were cleaned using QIAquick PCR purification Kit (Qiagen, Valencia, CA, USA). .. Digoxigenin labeled RNA probes were prepared using T7 polymerase (Roche, Switzerland), murine RNAse inhibitor (New England Biolabs, Ipswich, MA, USA), and RNA labeling-mix (Roche, Switzerland) according to each manufacturers protocol.

    Article Title: Dicer cleaves 5′-extended microRNA precursors originating from RNA polymerase II transcription start sites
    Article Snippet: Each 25 μl reaction containing 40 mM Tris–HCl pH 8.0, 25 mM NaCl, 2 mM Spermidine(HCl)3 , 8 mM MgCl2 , 1 mM ATP, 1 mM UTP, 1 mM GTP, 1 mM CTP, 20 U Murine RNase Inhibitor (NEB, M0314), 10 mM DTT and 5 U T7 RNA polymerase was incubated at 37°C for 8 h. To synthesize m7 G-capped or 5′ monophosphate pre-miRNAs, 1 mM GTP was substituted with 100 μM GTP and 1 mM m7 G cap analog (NEB, S1404) or 1 mM GMP. .. To test Dicer cleavage in vitro , various recombinant human Dicers were expressed in HEK 293T cells and purified by α-Flag antibodies.

    Article Title: Precardiac organoids form two heart fields via Bmp/Wnt signaling
    Article Snippet: GFP+ and RFP+ cells were isolated using a SH800 cell sorter (Sony Biotechnologies) into 96 plates containing water (2.4 mL) with RNase-free DNase I (0.2 mL; NEB) and RNase inhibitor (0.25 mL; NEB). .. A mixture of 1 mL of SMARTscribe reverse transcriptase (Clontech Laboratories), 1 mL of custom-designed TS oligo (12 mM, Integrated DNA Technologies , 0.3 mL of MgCl2 (200 mM, Sigma), 0.5 mL of RNase inhibitor (Neb), 1 mL of dNTP (10 mM each, Thermo), and 0.25 mL DTT (100 mM, Invitrogen) were incubated at 42 °C for 90 min, which was followed by enzyme inactivation at 70 °C for 10 min. A mixture of 29 mL of water, 5 mL of Advantage2 taq polymerase buffer, 2 mL of dNTP (10 mM each, Thermo), 2 mL of custom-designed PCR primer (12 mM, Integrated DNA Technologies , and 2 mL of Advantage2 taq polymerase was directly added to the reverse transcription product, and the amplification was performed for 19 cycles.

    Article Title: Endothelial cell activation by antiphospholipid antibodies is modulated by Kr?ppel-like transcription factors
    Article Snippet: Reverse transcriptase buffer, RNAse inhibitor, and Moloney murine leukemia virus reverse transcriptase were obtained from New England Biolabs. .. Reverse transcriptase buffer, RNAse inhibitor, and Moloney murine leukemia virus reverse transcriptase were obtained from New England Biolabs.

    Sequencing:

    Article Title: Mitochondrial m.1584A 12S m62A rRNA methylation in families with m.1555A > G associated hearing loss
    Article Snippet: One microliter of 10–20 nm RNA oligonucleotide was incubated with 1 µl of 50–100 nm 5′-Ned-labelled primer and 20 units of RNAse Inhibitor (NEB) at 55°C for 20 min. Twenty units of Avian Myeloblastosis Virus (AMV) Reverse Transcriptase (NEB), ×10 reaction buffer, 20 units of RNase Inhibitor (NEB) and 1 µl 500 nm dNTP stock (containing ddGTP in place of dGTP) were added, and the reaction mixture was incubated overnight at 42°C in a final volume of 10 µl. .. The 38-bp, HPLC-purified, 5′ Ned-labelled DNA primer used was 5′ ACATCATCATCATCATCATCATTCGGTTCGTCCAAGTG 3′.

    Article Title: Evolution of the SPATULA/ALCATRAZ gene lineage and expression analyses in the basal eudicot, Bocconia frutescens L. (Papaveraceae)
    Article Snippet: To ensure specificity, the probe templates were designed to amplify the 3′ sequence flanking the bHLH domain (Additional file : Figure S1; Additional file : Table S2). .. Digoxigenin labeled RNA probes were prepared using T7 polymerase (Roche, Switzerland), murine RNAse inhibitor (New England Biolabs, Ipswich, MA, USA), and RNA labeling-mix (Roche, Switzerland) according to each manufacturers protocol.

    Article Title: Multiplexed imaging of high-density libraries of RNAs with MERFISH and expansion microscopy
    Article Snippet: Then 30 μL of ∼300 μM encoding probes and 3.3 μM of poly(dT) LNA anchor probe (a 20-nt sequence of alternating dT and thymidine-locked nucleic acid (dT+) with a 20-nt reverse complement of a readout sequence and a 5′-acrydite modification (Integrated DNA Technologies)) in encoding hybridization buffer was added to the surface of Parafilm (Bemis) and was covered with a cell-containing coverslip. .. Encoding hybridization buffer was composed of encoding wash buffer supplemented with 0.1% (wt/vol) yeast tRNA (Life Technologies), 1% (vol/vol) murine RNase inhibitor (New England Biolabs), and 10% (wt/vol) dextran sulfate (Sigma).

    Article Title: Dicer cleaves 5′-extended microRNA precursors originating from RNA polymerase II transcription start sites
    Article Snippet: To synthesize RNAs, PCR templates containing a T7 promoter sequence upstream of the RNA coding sequences were used in T7 run-off transcription reactions. .. Each 25 μl reaction containing 40 mM Tris–HCl pH 8.0, 25 mM NaCl, 2 mM Spermidine(HCl)3 , 8 mM MgCl2 , 1 mM ATP, 1 mM UTP, 1 mM GTP, 1 mM CTP, 20 U Murine RNase Inhibitor (NEB, M0314), 10 mM DTT and 5 U T7 RNA polymerase was incubated at 37°C for 8 h. To synthesize m7 G-capped or 5′ monophosphate pre-miRNAs, 1 mM GTP was substituted with 100 μM GTP and 1 mM m7 G cap analog (NEB, S1404) or 1 mM GMP.

    Article Title: Precardiac organoids form two heart fields via Bmp/Wnt signaling
    Article Snippet: Paragraph title: Library preparation and sequencing ... GFP+ and RFP+ cells were isolated using a SH800 cell sorter (Sony Biotechnologies) into 96 plates containing water (2.4 mL) with RNase-free DNase I (0.2 mL; NEB) and RNase inhibitor (0.25 mL; NEB).

    Microscopy:

    Article Title: Evolution of the SPATULA/ALCATRAZ gene lineage and expression analyses in the basal eudicot, Bocconia frutescens L. (Papaveraceae)
    Article Snippet: Digoxigenin labeled RNA probes were prepared using T7 polymerase (Roche, Switzerland), murine RNAse inhibitor (New England Biolabs, Ipswich, MA, USA), and RNA labeling-mix (Roche, Switzerland) according to each manufacturers protocol. .. In situ hybridized sections were subsequently dehydrated and permanently mounted in Permount (Fisher, Waltham, MA, USA).

    Lysis:

    Article Title: Cell-Type Specific Features of Circular RNA Expression
    Article Snippet: HeLa total RNA was isolated by TRIZOL lysis followed by PureLink purification of the aqueous phase (Life Technologies). .. 2 micrograms of total RNA was treated in a 10 microliter reaction with 0 units (mock treatment) or 20 units of RNase R (Epicentre) in 1× RNase R buffer, 1 unit/microliter murine Ribonuclease Inhibitor (New England Biolabs), and incubated at 37DEGC for 1 hr.

    Article Title: Association of Potent Human Antiviral Cytidine Deaminases with 7SL RNA and Viral RNP in HIV-1 Virions
    Article Snippet: To identify A3G-binding RNA, A3G and mutants were transfected into 293T cells. .. At 48 h after transfection, the cells were harvested and washed twice with cold PBS and then lysed with lysis buffer (PBS containing 1% Triton X-100, complete protease inhibitor cocktail [Roche], and RNase inhibitor [New England BioLabs]) at 4°C for 30 min. .. Cell lysates were clarified by centrifugation at 10,000 × g for 30 min at 4°C.

    In Situ Hybridization:

    Article Title: Evolution of the SPATULA/ALCATRAZ gene lineage and expression analyses in the basal eudicot, Bocconia frutescens L. (Papaveraceae)
    Article Snippet: Paragraph title: Expression analyses by In Situ Hybridization ... Digoxigenin labeled RNA probes were prepared using T7 polymerase (Roche, Switzerland), murine RNAse inhibitor (New England Biolabs, Ipswich, MA, USA), and RNA labeling-mix (Roche, Switzerland) according to each manufacturers protocol.

    Software:

    Article Title: Mitochondrial m.1584A 12S m62A rRNA methylation in families with m.1555A > G associated hearing loss
    Article Snippet: One microliter of 10–20 nm RNA oligonucleotide was incubated with 1 µl of 50–100 nm 5′-Ned-labelled primer and 20 units of RNAse Inhibitor (NEB) at 55°C for 20 min. Twenty units of Avian Myeloblastosis Virus (AMV) Reverse Transcriptase (NEB), ×10 reaction buffer, 20 units of RNase Inhibitor (NEB) and 1 µl 500 nm dNTP stock (containing ddGTP in place of dGTP) were added, and the reaction mixture was incubated overnight at 42°C in a final volume of 10 µl. .. One microliter of 10–20 nm RNA oligonucleotide was incubated with 1 µl of 50–100 nm 5′-Ned-labelled primer and 20 units of RNAse Inhibitor (NEB) at 55°C for 20 min. Twenty units of Avian Myeloblastosis Virus (AMV) Reverse Transcriptase (NEB), ×10 reaction buffer, 20 units of RNase Inhibitor (NEB) and 1 µl 500 nm dNTP stock (containing ddGTP in place of dGTP) were added, and the reaction mixture was incubated overnight at 42°C in a final volume of 10 µl.

    SYBR Green Assay:

    Article Title: Production of para-aminobenzoic acid from different carbon-sources in engineered Saccharomyces cerevisiae
    Article Snippet: Samples (1–2 mL) from exponential phase (OD660 = 1) were centrifuged to pellet cells; cell pellets were resuspended in 1 mL TRIzol® (Ambion) and stored at −80 °C until extraction (no longer than 10 days). .. RNA was extracted using the PureLink® RNA Mini Kit (Ambion) in combination with RQ1 RNase-Free DNase (Promega) for on column DNAse treatment. mRNA (100–1000 ng) was reverse transcribed using Oligo d(T)18 primers and SuperScript® III reverse transcriptase (Invitrogen) in combination with RNase Inhibitor, Murine (NEB) according to the manufacturer’s instructions. qPCR reactions were carried out in a CFX96 Touch™ Real-Time PCR Detection System, using the SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad) outgoing from 10 to 100 ng RNA equivalent. .. Primers for mRNAs were unified to amplify regions homologous among the different ABZ1 and ABZ2 genes respectively, the sequences are listed in Table .

    RNA Extraction:

    Article Title: A long non-coding RNA is required for targeting centromeric protein A to the human centromere
    Article Snippet: Paragraph title: RNA extraction, retro-transcription and polymerase chain reaction (PCR) ... The pellet was washed with 75% ethanol (diluted from 100% ethanol, #61509-0010, Acros Organics, Pittsburgh, PA) and resuspended in water complemented with DNase I buffer, DNase I (#M0303; New England Biolabs–NEB, Ipswich, MA), and RNase inhibitor (#M0314, NEB) to avoid genomic DNA contamination.

    Article Title: Soybean cyst nematode culture collections and field populations from North Carolina and Missouri reveal high incidences of infection by viruses
    Article Snippet: Paragraph title: RNA extraction and cDNA synthesis ... Next, 4 μl GeneAmp® 10X PCR Buffer II (Applied Biosystems, Foster City, CA), 5.5 mM MgCl2 , 0.5 μM deoxynucleotide solution mix, 32 U Murine RNase Inhibitor (New England BioLabs, Ipswich, MA), and 50 U Multiscribe™ Reverse Transcriptase (Applied Biosystems) were added before additional incubations of 42°C and 70°C for 15 minutes each.

    Agarose Gel Electrophoresis:

    Article Title: Characterization of Wnt/?-catenin and BMP/Smad signaling pathways in an in vitro model of amyotrophic lateral sclerosis
    Article Snippet: For reverse transcription-polymerase chain reaction (RT-PCR), 1 μg of RNA was pretreated with DNase I (Fermentas, ON, Canada) and further incubated in a buffer containing 10 μM oligo dT, reverse transcription buffer (0.5 M Tris–HCl, pH 8.3, 0.75 M KCl, 0.03 M MgCl2), 20 U RNase inhibitor (NEB, Ipswich, MA, USA) and 1 mM dNTPs (Invitrogen) at 37°C for 5 min. Stratascript reverse transcriptase (Stratagene, Baltimore, MD, USA) was added (160 U) and the mix was further incubated at 42°C for 1 h. Parallel reactions were performed in the absence of reverse transcriptase to control for the presence of contaminant DNA. .. For reverse transcription-polymerase chain reaction (RT-PCR), 1 μg of RNA was pretreated with DNase I (Fermentas, ON, Canada) and further incubated in a buffer containing 10 μM oligo dT, reverse transcription buffer (0.5 M Tris–HCl, pH 8.3, 0.75 M KCl, 0.03 M MgCl2), 20 U RNase inhibitor (NEB, Ipswich, MA, USA) and 1 mM dNTPs (Invitrogen) at 37°C for 5 min. Stratascript reverse transcriptase (Stratagene, Baltimore, MD, USA) was added (160 U) and the mix was further incubated at 42°C for 1 h. Parallel reactions were performed in the absence of reverse transcriptase to control for the presence of contaminant DNA.

    Article Title: A long non-coding RNA is required for targeting centromeric protein A to the human centromere
    Article Snippet: The pellet was washed with 75% ethanol (diluted from 100% ethanol, #61509-0010, Acros Organics, Pittsburgh, PA) and resuspended in water complemented with DNase I buffer, DNase I (#M0303; New England Biolabs–NEB, Ipswich, MA), and RNase inhibitor (#M0314, NEB) to avoid genomic DNA contamination. .. The pellet was washed with 75% ethanol (diluted from 100% ethanol, #61509-0010, Acros Organics, Pittsburgh, PA) and resuspended in water complemented with DNase I buffer, DNase I (#M0303; New England Biolabs–NEB, Ipswich, MA), and RNase inhibitor (#M0314, NEB) to avoid genomic DNA contamination.

    In Vitro:

    Article Title: nc886 is induced by TGF-β and suppresses the microRNA pathway in ovarian cancer
    Article Snippet: The reaction products were resolved in a 15% denaturing polyacrylamide gel and subjected to northern hybridization using probes for each precursor (for probe sequences, see Supplementary Data File ). .. The binding assays were done at 4 °C for 10 min in the same reaction mixture as the in vitro Dicer processing assay, except that 0.001% Nonidet P-40, 3.2 mM Ribonucleoside-Vanadyl Complex (New England Biolabs), and 0.24 unit µl−1 of RNase Inhibitor (New England Biolabs) were included, but ATP, creatine phosphate, and creatine kinase were excluded. .. After washing with buffer D (5 times), the bound RNA was eluted into RNase-free H2 O by heating the reaction at 75 °C for 5 min.

    Article Title: Dicer cleaves 5′-extended microRNA precursors originating from RNA polymerase II transcription start sites
    Article Snippet: Paragraph title: In vitro synthesis of RNAs and Dicer cleavage assays ... Each 25 μl reaction containing 40 mM Tris–HCl pH 8.0, 25 mM NaCl, 2 mM Spermidine(HCl)3 , 8 mM MgCl2 , 1 mM ATP, 1 mM UTP, 1 mM GTP, 1 mM CTP, 20 U Murine RNase Inhibitor (NEB, M0314), 10 mM DTT and 5 U T7 RNA polymerase was incubated at 37°C for 8 h. To synthesize m7 G-capped or 5′ monophosphate pre-miRNAs, 1 mM GTP was substituted with 100 μM GTP and 1 mM m7 G cap analog (NEB, S1404) or 1 mM GMP.

    Electrophoresis:

    Article Title: Characterization of Wnt/?-catenin and BMP/Smad signaling pathways in an in vitro model of amyotrophic lateral sclerosis
    Article Snippet: For reverse transcription-polymerase chain reaction (RT-PCR), 1 μg of RNA was pretreated with DNase I (Fermentas, ON, Canada) and further incubated in a buffer containing 10 μM oligo dT, reverse transcription buffer (0.5 M Tris–HCl, pH 8.3, 0.75 M KCl, 0.03 M MgCl2), 20 U RNase inhibitor (NEB, Ipswich, MA, USA) and 1 mM dNTPs (Invitrogen) at 37°C for 5 min. Stratascript reverse transcriptase (Stratagene, Baltimore, MD, USA) was added (160 U) and the mix was further incubated at 42°C for 1 h. Parallel reactions were performed in the absence of reverse transcriptase to control for the presence of contaminant DNA. .. For reverse transcription-polymerase chain reaction (RT-PCR), 1 μg of RNA was pretreated with DNase I (Fermentas, ON, Canada) and further incubated in a buffer containing 10 μM oligo dT, reverse transcription buffer (0.5 M Tris–HCl, pH 8.3, 0.75 M KCl, 0.03 M MgCl2), 20 U RNase inhibitor (NEB, Ipswich, MA, USA) and 1 mM dNTPs (Invitrogen) at 37°C for 5 min. Stratascript reverse transcriptase (Stratagene, Baltimore, MD, USA) was added (160 U) and the mix was further incubated at 42°C for 1 h. Parallel reactions were performed in the absence of reverse transcriptase to control for the presence of contaminant DNA.

    Homogenization:

    Article Title: Soybean cyst nematode culture collections and field populations from North Carolina and Missouri reveal high incidences of infection by viruses
    Article Snippet: Samples were prepared for total RNA extraction by homogenization with three 3-mm glass beads in a 1.5 ml tube on a Silamat S6 (Ivoclar Vivadent, Amherst, NY). .. Next, 4 μl GeneAmp® 10X PCR Buffer II (Applied Biosystems, Foster City, CA), 5.5 mM MgCl2 , 0.5 μM deoxynucleotide solution mix, 32 U Murine RNase Inhibitor (New England BioLabs, Ipswich, MA), and 50 U Multiscribe™ Reverse Transcriptase (Applied Biosystems) were added before additional incubations of 42°C and 70°C for 15 minutes each.

    Incubation:

    Article Title: Characterization of Wnt/?-catenin and BMP/Smad signaling pathways in an in vitro model of amyotrophic lateral sclerosis
    Article Snippet: Total RNA from NSC34 cells was obtained using Trizol reagent (Invitrogen). .. For reverse transcription-polymerase chain reaction (RT-PCR), 1 μg of RNA was pretreated with DNase I (Fermentas, ON, Canada) and further incubated in a buffer containing 10 μM oligo dT, reverse transcription buffer (0.5 M Tris–HCl, pH 8.3, 0.75 M KCl, 0.03 M MgCl2), 20 U RNase inhibitor (NEB, Ipswich, MA, USA) and 1 mM dNTPs (Invitrogen) at 37°C for 5 min. Stratascript reverse transcriptase (Stratagene, Baltimore, MD, USA) was added (160 U) and the mix was further incubated at 42°C for 1 h. Parallel reactions were performed in the absence of reverse transcriptase to control for the presence of contaminant DNA. .. For amplification, a cDNA aliquot in a volume of 12.5 μl containing 20 mM Tris buffer pH 8.4, 50 mM KCl, 1.6 mM MgCl2, 0.4 mM dNTPs, and 0.04 U Taq polymerase (Kapabiosystems, Boston, MA, US) was incubated 95°C for 5 min, 95°C for 30 s, 50°C for 30 s, and 72°C for 30 s for 35 cycles.

    Article Title: Cell-Type Specific Features of Circular RNA Expression
    Article Snippet: HeLa total RNA was isolated by TRIZOL lysis followed by PureLink purification of the aqueous phase (Life Technologies). .. 2 micrograms of total RNA was treated in a 10 microliter reaction with 0 units (mock treatment) or 20 units of RNase R (Epicentre) in 1× RNase R buffer, 1 unit/microliter murine Ribonuclease Inhibitor (New England Biolabs), and incubated at 37DEGC for 1 hr. .. 1 microliter 1 mM EDTA, 1 microliter 10 mM each dNTP, and 1 microliter 100 microM random hexamer were added and the RNA denatured at 65DEGC for 5 min and placed on ice.

    Article Title: A long non-coding RNA is required for targeting centromeric protein A to the human centromere
    Article Snippet: Briefly, cells we re resuspended in Trizol, and following 5-min incubation at room temperature (RT), 200 μl of chloroform (#BP1145-1, Fisher Scientific, Pittsburgh, PA) was added. .. The pellet was washed with 75% ethanol (diluted from 100% ethanol, #61509-0010, Acros Organics, Pittsburgh, PA) and resuspended in water complemented with DNase I buffer, DNase I (#M0303; New England Biolabs–NEB, Ipswich, MA), and RNase inhibitor (#M0314, NEB) to avoid genomic DNA contamination.

    Article Title: In vitro nanobody discovery for integral membrane protein targets
    Article Snippet: For each 60 µL reaction, 5 µg mRNA was first annealed to 2.67 µM splint and 2.67 µM puromycin linker in the presence of 1× T4 ssRNA ligase buffer. .. Following annealing, 1 mM ATP, 1 µL murine RNase inhibitor (New England Biolabs, NEB), 3 µL T4 ssRNA Ligase were added and the reaction was incubated at room temperature overnight. .. Unligated linker and splint were cleaved using 5 µL lambda exonuclease (NEB) in a total volume of 240 µL, containing 24 µL of lambda exonuclease buffer, and subsequent incubation at 37°C for 45 mins.

    Article Title: Mitochondrial m.1584A 12S m62A rRNA methylation in families with m.1555A > G associated hearing loss
    Article Snippet: Unmethylated and methylated model RNA oligonucleotides were synthesized (Thermo Scientific) to replicate each of the reported native RNA conditions ( , ). .. One microliter of 10–20 nm RNA oligonucleotide was incubated with 1 µl of 50–100 nm 5′-Ned-labelled primer and 20 units of RNAse Inhibitor (NEB) at 55°C for 20 min. Twenty units of Avian Myeloblastosis Virus (AMV) Reverse Transcriptase (NEB), ×10 reaction buffer, 20 units of RNase Inhibitor (NEB) and 1 µl 500 nm dNTP stock (containing ddGTP in place of dGTP) were added, and the reaction mixture was incubated overnight at 42°C in a final volume of 10 µl. .. One microliter was mixed with 8.95 µl Hi-Di Formamide (Applied Biosystems) and 0.05 µl GeneScan Rox size standard (Applied Biosystems) and run on an ABI3130 Genetic Analyser (Applied Biosystems).

    Article Title: TSS-EMOTE, a refined protocol for a more complete and less biased global mapping of transcription start sites in bacterial pathogens
    Article Snippet: To each tube was added 10 μl of either “-RppH mix” or “+RppH mix”, which were then incubated at 37 °C. .. The “-RppH mix” consisted of 3.5 μl water, 2 μl RNA ligase buffer, 2 μl 10 mM ATP, 1 μl Murine RNase inhibitor (New England Biolabs), and 2 μl RNA ligase 1 (New England Biolabs).

    Article Title: Multiplexed imaging of high-density libraries of RNAs with MERFISH and expansion microscopy
    Article Snippet: Permeabilized cells were incubated for 5 min in encoding wash buffer comprising 2× saline-sodium citrate (SSC) (Ambion) and 30% (vol/vol) formamide (Ambion). .. Encoding hybridization buffer was composed of encoding wash buffer supplemented with 0.1% (wt/vol) yeast tRNA (Life Technologies), 1% (vol/vol) murine RNase inhibitor (New England Biolabs), and 10% (wt/vol) dextran sulfate (Sigma).

    Article Title: Dicer cleaves 5′-extended microRNA precursors originating from RNA polymerase II transcription start sites
    Article Snippet: To synthesize RNAs, PCR templates containing a T7 promoter sequence upstream of the RNA coding sequences were used in T7 run-off transcription reactions. .. Each 25 μl reaction containing 40 mM Tris–HCl pH 8.0, 25 mM NaCl, 2 mM Spermidine(HCl)3 , 8 mM MgCl2 , 1 mM ATP, 1 mM UTP, 1 mM GTP, 1 mM CTP, 20 U Murine RNase Inhibitor (NEB, M0314), 10 mM DTT and 5 U T7 RNA polymerase was incubated at 37°C for 8 h. To synthesize m7 G-capped or 5′ monophosphate pre-miRNAs, 1 mM GTP was substituted with 100 μM GTP and 1 mM m7 G cap analog (NEB, S1404) or 1 mM GMP. .. To test Dicer cleavage in vitro , various recombinant human Dicers were expressed in HEK 293T cells and purified by α-Flag antibodies.

    Article Title: Precardiac organoids form two heart fields via Bmp/Wnt signaling
    Article Snippet: GFP+ and RFP+ cells were isolated using a SH800 cell sorter (Sony Biotechnologies) into 96 plates containing water (2.4 mL) with RNase-free DNase I (0.2 mL; NEB) and RNase inhibitor (0.25 mL; NEB). .. GFP+ and RFP+ cells were isolated using a SH800 cell sorter (Sony Biotechnologies) into 96 plates containing water (2.4 mL) with RNase-free DNase I (0.2 mL; NEB) and RNase inhibitor (0.25 mL; NEB).

    Article Title: Association of Potent Human Antiviral Cytidine Deaminases with 7SL RNA and Viral RNP in HIV-1 Virions
    Article Snippet: At 48 h after transfection, the cells were harvested and washed twice with cold PBS and then lysed with lysis buffer (PBS containing 1% Triton X-100, complete protease inhibitor cocktail [Roche], and RNase inhibitor [New England BioLabs]) at 4°C for 30 min. .. Cell lysates were clarified by centrifugation at 10,000 × g for 30 min at 4°C.

    Sampling:

    Article Title: Production of para-aminobenzoic acid from different carbon-sources in engineered Saccharomyces cerevisiae
    Article Snippet: RNA was extracted using the PureLink® RNA Mini Kit (Ambion) in combination with RQ1 RNase-Free DNase (Promega) for on column DNAse treatment. mRNA (100–1000 ng) was reverse transcribed using Oligo d(T)18 primers and SuperScript® III reverse transcriptase (Invitrogen) in combination with RNase Inhibitor, Murine (NEB) according to the manufacturer’s instructions. qPCR reactions were carried out in a CFX96 Touch™ Real-Time PCR Detection System, using the SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad) outgoing from 10 to 100 ng RNA equivalent. .. RNA was extracted using the PureLink® RNA Mini Kit (Ambion) in combination with RQ1 RNase-Free DNase (Promega) for on column DNAse treatment. mRNA (100–1000 ng) was reverse transcribed using Oligo d(T)18 primers and SuperScript® III reverse transcriptase (Invitrogen) in combination with RNase Inhibitor, Murine (NEB) according to the manufacturer’s instructions. qPCR reactions were carried out in a CFX96 Touch™ Real-Time PCR Detection System, using the SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad) outgoing from 10 to 100 ng RNA equivalent.

    Immunoprecipitation:

    Article Title: Association of Potent Human Antiviral Cytidine Deaminases with 7SL RNA and Viral RNP in HIV-1 Virions
    Article Snippet: Paragraph title: Immunoprecipitation. ... At 48 h after transfection, the cells were harvested and washed twice with cold PBS and then lysed with lysis buffer (PBS containing 1% Triton X-100, complete protease inhibitor cocktail [Roche], and RNase inhibitor [New England BioLabs]) at 4°C for 30 min.

    In Situ:

    Article Title: Evolution of the SPATULA/ALCATRAZ gene lineage and expression analyses in the basal eudicot, Bocconia frutescens L. (Papaveraceae)
    Article Snippet: Digoxigenin labeled RNA probes were prepared using T7 polymerase (Roche, Switzerland), murine RNAse inhibitor (New England Biolabs, Ipswich, MA, USA), and RNA labeling-mix (Roche, Switzerland) according to each manufacturers protocol. .. RNA in situ hybridization was performed according to Ambrose et al. [ ] and Ferrándiz et al. [ ], optimized to hybridize overnight at 55 °C.

    Standard Deviation:

    Article Title: Production of para-aminobenzoic acid from different carbon-sources in engineered Saccharomyces cerevisiae
    Article Snippet: RNA was extracted using the PureLink® RNA Mini Kit (Ambion) in combination with RQ1 RNase-Free DNase (Promega) for on column DNAse treatment. mRNA (100–1000 ng) was reverse transcribed using Oligo d(T)18 primers and SuperScript® III reverse transcriptase (Invitrogen) in combination with RNase Inhibitor, Murine (NEB) according to the manufacturer’s instructions. qPCR reactions were carried out in a CFX96 Touch™ Real-Time PCR Detection System, using the SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad) outgoing from 10 to 100 ng RNA equivalent. .. RNA was extracted using the PureLink® RNA Mini Kit (Ambion) in combination with RQ1 RNase-Free DNase (Promega) for on column DNAse treatment. mRNA (100–1000 ng) was reverse transcribed using Oligo d(T)18 primers and SuperScript® III reverse transcriptase (Invitrogen) in combination with RNase Inhibitor, Murine (NEB) according to the manufacturer’s instructions. qPCR reactions were carried out in a CFX96 Touch™ Real-Time PCR Detection System, using the SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad) outgoing from 10 to 100 ng RNA equivalent.

    Staining:

    Article Title: Characterization of Wnt/?-catenin and BMP/Smad signaling pathways in an in vitro model of amyotrophic lateral sclerosis
    Article Snippet: For reverse transcription-polymerase chain reaction (RT-PCR), 1 μg of RNA was pretreated with DNase I (Fermentas, ON, Canada) and further incubated in a buffer containing 10 μM oligo dT, reverse transcription buffer (0.5 M Tris–HCl, pH 8.3, 0.75 M KCl, 0.03 M MgCl2), 20 U RNase inhibitor (NEB, Ipswich, MA, USA) and 1 mM dNTPs (Invitrogen) at 37°C for 5 min. Stratascript reverse transcriptase (Stratagene, Baltimore, MD, USA) was added (160 U) and the mix was further incubated at 42°C for 1 h. Parallel reactions were performed in the absence of reverse transcriptase to control for the presence of contaminant DNA. .. For reverse transcription-polymerase chain reaction (RT-PCR), 1 μg of RNA was pretreated with DNase I (Fermentas, ON, Canada) and further incubated in a buffer containing 10 μM oligo dT, reverse transcription buffer (0.5 M Tris–HCl, pH 8.3, 0.75 M KCl, 0.03 M MgCl2), 20 U RNase inhibitor (NEB, Ipswich, MA, USA) and 1 mM dNTPs (Invitrogen) at 37°C for 5 min. Stratascript reverse transcriptase (Stratagene, Baltimore, MD, USA) was added (160 U) and the mix was further incubated at 42°C for 1 h. Parallel reactions were performed in the absence of reverse transcriptase to control for the presence of contaminant DNA.

    Article Title: Multiplexed imaging of high-density libraries of RNAs with MERFISH and expansion microscopy
    Article Snippet: Paragraph title: Encoding probe staining ... Encoding hybridization buffer was composed of encoding wash buffer supplemented with 0.1% (wt/vol) yeast tRNA (Life Technologies), 1% (vol/vol) murine RNase inhibitor (New England Biolabs), and 10% (wt/vol) dextran sulfate (Sigma).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs rnase inhibitor
    In vitro template-primed cDNA synthesis. ( A ) Bordetella bacteriophage DGR diversification of Mtd. mtd contains a variable region ( VR ), which encodes the receptor-binding site of the Mtd protein. Downstream of VR is the template region ( TR ). Adenines in TR (‘A’) are frequently replaced by another base in VR (‘N’). TR is transcribed to produce TR- RNA, which is then reverse transcribed to TR- cDNA. During this process, adenines in TR are mutagenized, as depicted by ‘X’ in TR -cDNA. Adenine-mutagenized TR- cDNA homes to and replaces VR , resulting in diversification of Mtd. bRT is the DGR reverse transcriptase, and avd the DGR accessory variability determinant. ( B ) Sequence elements of the 580 nt DGR RNA template used for reverse transcription reactions. ( C ) bRT-Avd, bRT, or Avd was incubated with the 580 nt DGR RNA and dNTPs, including [α- 32 P]dCTP, for 2h. Products resulting from the incubation were untreated (U), or treated with <t>RNase</t> (+R), DNase (+D), or both RNase and DNase (+R+D), and resolved by 8% denaturing polyacrylamide gel electrophoresis (PAGE). Lane T corresponds to internally-labeled 580 nt DGR RNA as a marker for the size of the template. The positions of the 580 nt band, and 120 and 90 nt cDNA bands are indicated. Nuclease-treated samples were loaded at twice the amount as untreated samples, here and throughout unless otherwise indicated. Lane M here and throughout corresponds to radiolabeled, single-stranded <t>DNA</t> molecular mass markers (nt units). ( D ) DGR RNA templates containing internal truncations in TR . ( E ) Radiolabeled cDNA products resulting from bRT-Avd activity for 2 h with intact (WT) or internally truncated 580 nt DGR RNA as template. Samples were treated with RNase and resolved by denaturing PAGE. The positions of the 120 and 90 nt cDNAs produced from intact template are indicated by red and yellow circles, respectively, as are positions of the correspondingly shorter cDNAs produced from truncated RNA templates. ( F ) Radiolabeled products resulting from bRT-Avd activity for 2 h with the 580 nt DGR RNA as template. Prior to reverse transcription, the RNA template was mock-treated (–Per) or treated with periodate (+Per). Products of the reaction were untreated (U) or treated with RNase (+R), and resolved by 4% (top) or 8% (bottom) denaturing PAGE. In the top gel, the red arrowhead indicates the ∼580 nt species, and the green arrowheads the several ∼540 nt species. In the bottom gel, the black arrowheads indicate the 120 and 90 nt cDNA products. The black vertical line within the gel indicates irrelevant lanes that were removed for display purposes. A 2-fold higher quantity was loaded for +Per samples than –Per samples.
    Rnase Inhibitor, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 74 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnase inhibitor/product/New England Biolabs
    Average 99 stars, based on 74 article reviews
    Price from $9.99 to $1999.99
    rnase inhibitor - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    Image Search Results


    In vitro template-primed cDNA synthesis. ( A ) Bordetella bacteriophage DGR diversification of Mtd. mtd contains a variable region ( VR ), which encodes the receptor-binding site of the Mtd protein. Downstream of VR is the template region ( TR ). Adenines in TR (‘A’) are frequently replaced by another base in VR (‘N’). TR is transcribed to produce TR- RNA, which is then reverse transcribed to TR- cDNA. During this process, adenines in TR are mutagenized, as depicted by ‘X’ in TR -cDNA. Adenine-mutagenized TR- cDNA homes to and replaces VR , resulting in diversification of Mtd. bRT is the DGR reverse transcriptase, and avd the DGR accessory variability determinant. ( B ) Sequence elements of the 580 nt DGR RNA template used for reverse transcription reactions. ( C ) bRT-Avd, bRT, or Avd was incubated with the 580 nt DGR RNA and dNTPs, including [α- 32 P]dCTP, for 2h. Products resulting from the incubation were untreated (U), or treated with RNase (+R), DNase (+D), or both RNase and DNase (+R+D), and resolved by 8% denaturing polyacrylamide gel electrophoresis (PAGE). Lane T corresponds to internally-labeled 580 nt DGR RNA as a marker for the size of the template. The positions of the 580 nt band, and 120 and 90 nt cDNA bands are indicated. Nuclease-treated samples were loaded at twice the amount as untreated samples, here and throughout unless otherwise indicated. Lane M here and throughout corresponds to radiolabeled, single-stranded DNA molecular mass markers (nt units). ( D ) DGR RNA templates containing internal truncations in TR . ( E ) Radiolabeled cDNA products resulting from bRT-Avd activity for 2 h with intact (WT) or internally truncated 580 nt DGR RNA as template. Samples were treated with RNase and resolved by denaturing PAGE. The positions of the 120 and 90 nt cDNAs produced from intact template are indicated by red and yellow circles, respectively, as are positions of the correspondingly shorter cDNAs produced from truncated RNA templates. ( F ) Radiolabeled products resulting from bRT-Avd activity for 2 h with the 580 nt DGR RNA as template. Prior to reverse transcription, the RNA template was mock-treated (–Per) or treated with periodate (+Per). Products of the reaction were untreated (U) or treated with RNase (+R), and resolved by 4% (top) or 8% (bottom) denaturing PAGE. In the top gel, the red arrowhead indicates the ∼580 nt species, and the green arrowheads the several ∼540 nt species. In the bottom gel, the black arrowheads indicate the 120 and 90 nt cDNA products. The black vertical line within the gel indicates irrelevant lanes that were removed for display purposes. A 2-fold higher quantity was loaded for +Per samples than –Per samples.

    Journal: Nucleic Acids Research

    Article Title: Template-assisted synthesis of adenine-mutagenized cDNA by a retroelement protein complex

    doi: 10.1093/nar/gky620

    Figure Lengend Snippet: In vitro template-primed cDNA synthesis. ( A ) Bordetella bacteriophage DGR diversification of Mtd. mtd contains a variable region ( VR ), which encodes the receptor-binding site of the Mtd protein. Downstream of VR is the template region ( TR ). Adenines in TR (‘A’) are frequently replaced by another base in VR (‘N’). TR is transcribed to produce TR- RNA, which is then reverse transcribed to TR- cDNA. During this process, adenines in TR are mutagenized, as depicted by ‘X’ in TR -cDNA. Adenine-mutagenized TR- cDNA homes to and replaces VR , resulting in diversification of Mtd. bRT is the DGR reverse transcriptase, and avd the DGR accessory variability determinant. ( B ) Sequence elements of the 580 nt DGR RNA template used for reverse transcription reactions. ( C ) bRT-Avd, bRT, or Avd was incubated with the 580 nt DGR RNA and dNTPs, including [α- 32 P]dCTP, for 2h. Products resulting from the incubation were untreated (U), or treated with RNase (+R), DNase (+D), or both RNase and DNase (+R+D), and resolved by 8% denaturing polyacrylamide gel electrophoresis (PAGE). Lane T corresponds to internally-labeled 580 nt DGR RNA as a marker for the size of the template. The positions of the 580 nt band, and 120 and 90 nt cDNA bands are indicated. Nuclease-treated samples were loaded at twice the amount as untreated samples, here and throughout unless otherwise indicated. Lane M here and throughout corresponds to radiolabeled, single-stranded DNA molecular mass markers (nt units). ( D ) DGR RNA templates containing internal truncations in TR . ( E ) Radiolabeled cDNA products resulting from bRT-Avd activity for 2 h with intact (WT) or internally truncated 580 nt DGR RNA as template. Samples were treated with RNase and resolved by denaturing PAGE. The positions of the 120 and 90 nt cDNAs produced from intact template are indicated by red and yellow circles, respectively, as are positions of the correspondingly shorter cDNAs produced from truncated RNA templates. ( F ) Radiolabeled products resulting from bRT-Avd activity for 2 h with the 580 nt DGR RNA as template. Prior to reverse transcription, the RNA template was mock-treated (–Per) or treated with periodate (+Per). Products of the reaction were untreated (U) or treated with RNase (+R), and resolved by 4% (top) or 8% (bottom) denaturing PAGE. In the top gel, the red arrowhead indicates the ∼580 nt species, and the green arrowheads the several ∼540 nt species. In the bottom gel, the black arrowheads indicate the 120 and 90 nt cDNA products. The black vertical line within the gel indicates irrelevant lanes that were removed for display purposes. A 2-fold higher quantity was loaded for +Per samples than –Per samples.

    Article Snippet: RNA was synthesized in vitro through runoff transcription reactions performed overnight at 37°C using 40 ng/μl DNA template, 4 mM NTPs (Promega), 0.5 units/μl RNase inhibitor (NEB), and 0.6 mg/mL T7 RNA polymerase in T7 buffer (3 mM MgCl2 , 5 mM DTT, 2 mM spermidine, 40 mM Tris, pH 7.5).

    Techniques: In Vitro, Binding Assay, Sequencing, Incubation, Polyacrylamide Gel Electrophoresis, Labeling, Marker, Activity Assay, Produced

    Branched RNA–cDNA. ( A ) The 580 nt DGR RNA was biotinylated at its 3′ end and used as a template for reverse-transcription by bRT-Avd, after which biotinylated RNA was captured with streptavidin beads, and the presence of TR- cDNA was detected by PCR using the indicated primers. ( B ) The 580 nt DGR RNA was biotinylated at its 3′ end (RNA-Bio), and either reacted with no protein or used as a template for reverse transcription with bRT-Avd. The 580 nt DGR RNA in its unbiotinylated form (RNA) was also used as a template for reverse transcription with bRT-Avd. Samples were then purified using streptavidin beads, and the presence of TR -cDNA in the purified samples was assessed by PCR. Products from the PCR reaction were resolved on an agarose gel. ( C ) Hybrid dA56 580 nt DGR RNA containing deoxyadenosine at Sp 56 (indicated with H at 2′ position) and hybrid d56 580 nt DGR RNA containing adenosine at Sp 56 (indicated with OH at 2′). Both molecules terminate at Sp 140 and have a dideoxynucleotide at the 3′ end (indicated with H at 3′). ( D ) Radiolabeled products resulting from bRT-Avd activity for 12 h with 580 nt DGR RNA, hybrid 580 nt dA56, or hybrid 580 nt A56 DGR RNA as template. Products were untreated (U) or RNase-treated (+R), and resolved by denaturing PAGE. Separate samples of dA56 and A56 were 5′ 32 P-labeled for visualization of input templates (I). The positions of the 120 and 90 nt cDNAs are indicated.

    Journal: Nucleic Acids Research

    Article Title: Template-assisted synthesis of adenine-mutagenized cDNA by a retroelement protein complex

    doi: 10.1093/nar/gky620

    Figure Lengend Snippet: Branched RNA–cDNA. ( A ) The 580 nt DGR RNA was biotinylated at its 3′ end and used as a template for reverse-transcription by bRT-Avd, after which biotinylated RNA was captured with streptavidin beads, and the presence of TR- cDNA was detected by PCR using the indicated primers. ( B ) The 580 nt DGR RNA was biotinylated at its 3′ end (RNA-Bio), and either reacted with no protein or used as a template for reverse transcription with bRT-Avd. The 580 nt DGR RNA in its unbiotinylated form (RNA) was also used as a template for reverse transcription with bRT-Avd. Samples were then purified using streptavidin beads, and the presence of TR -cDNA in the purified samples was assessed by PCR. Products from the PCR reaction were resolved on an agarose gel. ( C ) Hybrid dA56 580 nt DGR RNA containing deoxyadenosine at Sp 56 (indicated with H at 2′ position) and hybrid d56 580 nt DGR RNA containing adenosine at Sp 56 (indicated with OH at 2′). Both molecules terminate at Sp 140 and have a dideoxynucleotide at the 3′ end (indicated with H at 3′). ( D ) Radiolabeled products resulting from bRT-Avd activity for 12 h with 580 nt DGR RNA, hybrid 580 nt dA56, or hybrid 580 nt A56 DGR RNA as template. Products were untreated (U) or RNase-treated (+R), and resolved by denaturing PAGE. Separate samples of dA56 and A56 were 5′ 32 P-labeled for visualization of input templates (I). The positions of the 120 and 90 nt cDNAs are indicated.

    Article Snippet: RNA was synthesized in vitro through runoff transcription reactions performed overnight at 37°C using 40 ng/μl DNA template, 4 mM NTPs (Promega), 0.5 units/μl RNase inhibitor (NEB), and 0.6 mg/mL T7 RNA polymerase in T7 buffer (3 mM MgCl2 , 5 mM DTT, 2 mM spermidine, 40 mM Tris, pH 7.5).

    Techniques: Polymerase Chain Reaction, Purification, Agarose Gel Electrophoresis, Activity Assay, Polyacrylamide Gel Electrophoresis, Labeling

    Core DGR RNA. ( A ) Schematic of core DGR RNA. ( B ) Radiolabeled products resulting from bRT-Avd activity for 2 h with the core DGR RNA as template. Prior to the reverse transcription reaction, the RNA template was untreated (-Per) or treated with periodate (+Per). Products from the reaction were untreated (U) or treated with RNase (+R), and resolved by 6% denaturing PAGE. Lane T corresponds to internally-labeled core DGR RNA as a marker for the size of the template. Red arrowheads indicate radiolabeled product bands that migrate at the same position or slower than the core DGR RNA, and green arrowheads ones that migrate faster. The positions of the 120 and 90 nt cDNA bands are indicated. The two panels are from the same gel, with the black line indicating that intermediate lanes were removed. ( C ) Internally-labeled core DGR RNA was not incubated (–), or incubated with bRT-Avd alone or bRT-Avd with 100 μM standard dNTPs (+dNTP), 100 μM dCTP (+CTP), 100 μM dNTPs excluding dCTP (+d(A,T,G)TP), or 100 μM nonhydrolyzeable analog of dCTP (+N-dCTP) for 2 h. Incubation products were resolved by denaturing PAGE. The band corresponding to the 5′ fragment of the cleaved core RNA containing either a deoxycytidine alone (5′+dC) or cDNA (5′+cDNA), and the band corresponding to the 3′ fragment of the RNA are indicated. ( D ) The core DGR RNA was biotinylated at its 3′ end (RNA-Bio), and either reacted with no protein or used as a template for reverse transcription with bRT-Avd. The core DGR RNA in its unbiotinylated form (RNA) was also used as a template for reverse transcription with bRT-Avd. Samples were then purified using streptavidin beads, and the presence of TR -cDNA in the purified samples was assessed by PCR. Products from the PCR reaction were resolved on an agarose gel. ( E ) Radiolabeled products resulting from bRT-Avd activity for 12 h with core, hybrid core dA56, or hybrid core A56 DGR RNA as template. Products were untreated (U) or treated with RNase (+R), and resolved by denaturing PAGE. Separate samples of core dA56 and A56 were 5′ 32 P-labeled for visualization of inputs (I). The positions of the 120 and 90 nt cDNAs are indicated.

    Journal: Nucleic Acids Research

    Article Title: Template-assisted synthesis of adenine-mutagenized cDNA by a retroelement protein complex

    doi: 10.1093/nar/gky620

    Figure Lengend Snippet: Core DGR RNA. ( A ) Schematic of core DGR RNA. ( B ) Radiolabeled products resulting from bRT-Avd activity for 2 h with the core DGR RNA as template. Prior to the reverse transcription reaction, the RNA template was untreated (-Per) or treated with periodate (+Per). Products from the reaction were untreated (U) or treated with RNase (+R), and resolved by 6% denaturing PAGE. Lane T corresponds to internally-labeled core DGR RNA as a marker for the size of the template. Red arrowheads indicate radiolabeled product bands that migrate at the same position or slower than the core DGR RNA, and green arrowheads ones that migrate faster. The positions of the 120 and 90 nt cDNA bands are indicated. The two panels are from the same gel, with the black line indicating that intermediate lanes were removed. ( C ) Internally-labeled core DGR RNA was not incubated (–), or incubated with bRT-Avd alone or bRT-Avd with 100 μM standard dNTPs (+dNTP), 100 μM dCTP (+CTP), 100 μM dNTPs excluding dCTP (+d(A,T,G)TP), or 100 μM nonhydrolyzeable analog of dCTP (+N-dCTP) for 2 h. Incubation products were resolved by denaturing PAGE. The band corresponding to the 5′ fragment of the cleaved core RNA containing either a deoxycytidine alone (5′+dC) or cDNA (5′+cDNA), and the band corresponding to the 3′ fragment of the RNA are indicated. ( D ) The core DGR RNA was biotinylated at its 3′ end (RNA-Bio), and either reacted with no protein or used as a template for reverse transcription with bRT-Avd. The core DGR RNA in its unbiotinylated form (RNA) was also used as a template for reverse transcription with bRT-Avd. Samples were then purified using streptavidin beads, and the presence of TR -cDNA in the purified samples was assessed by PCR. Products from the PCR reaction were resolved on an agarose gel. ( E ) Radiolabeled products resulting from bRT-Avd activity for 12 h with core, hybrid core dA56, or hybrid core A56 DGR RNA as template. Products were untreated (U) or treated with RNase (+R), and resolved by denaturing PAGE. Separate samples of core dA56 and A56 were 5′ 32 P-labeled for visualization of inputs (I). The positions of the 120 and 90 nt cDNAs are indicated.

    Article Snippet: RNA was synthesized in vitro through runoff transcription reactions performed overnight at 37°C using 40 ng/μl DNA template, 4 mM NTPs (Promega), 0.5 units/μl RNase inhibitor (NEB), and 0.6 mg/mL T7 RNA polymerase in T7 buffer (3 mM MgCl2 , 5 mM DTT, 2 mM spermidine, 40 mM Tris, pH 7.5).

    Techniques: Activity Assay, Polyacrylamide Gel Electrophoresis, Labeling, Marker, Incubation, Purification, Polymerase Chain Reaction, Agarose Gel Electrophoresis

    TR -Sp interactions. ( A ) Complementarity between TR (blue) and Sp (purple) segments. Potential basepairs are numbered (wobble in red). ( B ) Radiolabeled 120 and 90 nt cDNA products, indicated by arrowheads, resulting from bRT-Avd activity for 2h with the WT or mutated 580 nt DGR RNA as template. Products were treated with RNase, and resolved by denaturing PAGE. Numbers over lane labels correspond to the basepair tested by the mutation, with ‘R’ referring to restoration of the basepair. Sp Mut4 corresponds to Sp 55-CAGC substituted with 55-GUCG.

    Journal: Nucleic Acids Research

    Article Title: Template-assisted synthesis of adenine-mutagenized cDNA by a retroelement protein complex

    doi: 10.1093/nar/gky620

    Figure Lengend Snippet: TR -Sp interactions. ( A ) Complementarity between TR (blue) and Sp (purple) segments. Potential basepairs are numbered (wobble in red). ( B ) Radiolabeled 120 and 90 nt cDNA products, indicated by arrowheads, resulting from bRT-Avd activity for 2h with the WT or mutated 580 nt DGR RNA as template. Products were treated with RNase, and resolved by denaturing PAGE. Numbers over lane labels correspond to the basepair tested by the mutation, with ‘R’ referring to restoration of the basepair. Sp Mut4 corresponds to Sp 55-CAGC substituted with 55-GUCG.

    Article Snippet: RNA was synthesized in vitro through runoff transcription reactions performed overnight at 37°C using 40 ng/μl DNA template, 4 mM NTPs (Promega), 0.5 units/μl RNase inhibitor (NEB), and 0.6 mg/mL T7 RNA polymerase in T7 buffer (3 mM MgCl2 , 5 mM DTT, 2 mM spermidine, 40 mM Tris, pH 7.5).

    Techniques: Activity Assay, Polyacrylamide Gel Electrophoresis, Mutagenesis

    Adenine mutagenesis and template-priming. ( A ) Covalently-linked RNA–cDNA molecule. The linkage is to Sp A56 of the RNA, and the first nucleotide reverse transcribed is TR G117. The RT-PCR product resulting from primers 1 and 2 (blue arrows) is indicated by the dashed red line. ( B ) RT-PCR amplicons from 580 nt DGR RNA reacted with no protein (–), bRT, Avd, or bRT-Avd, separated on a 2% agarose gel and ethidium bromide-stained. The specific amplicon produced from reaction with bRT-Avd shown by the red arrowhead. ( C ) Percentage of substitutions in TR -cDNA determined by sequencing. ( D ) Radiolabeled 120 and 90 nt cDNA products, indicated by arrowheads, resulting from bRT-Avd activity with the 580 nt DGR RNA as template for 2 h (left) or 12 h (right). Either standard dNTPs (dATP, dGTP, dCTP, TTP), as indicated by ‘+’,were present in the reaction, or standard dNTPs excluding dATP (-A), dGTP (–G), or TTP (-T) were present. Products were treated with RNase, and resolved by denaturing PAGE. ( E ) Radiolabeled 120 and 90 nt cDNA products, indicated by arrowheads, resulting from bRT-Avd activity for 2 h with the 580 nt DGR RNA as template with varying TTP (top) or dUTP (bottom) concentrations. Products were treated with RNase, and resolved by denaturing PAGE. ( F ) Radiolabeled 120 and 90 nt cDNA products, indicated by arrowheads, resulting from bRT-Avd activity for 2 h with the 580 nt DGR RNA as template with varying dUTP concentrations. Products were either RNase-treated (top), or both RNase- and UDG-treated (bottom), and resolved by denaturing PAGE.

    Journal: Nucleic Acids Research

    Article Title: Template-assisted synthesis of adenine-mutagenized cDNA by a retroelement protein complex

    doi: 10.1093/nar/gky620

    Figure Lengend Snippet: Adenine mutagenesis and template-priming. ( A ) Covalently-linked RNA–cDNA molecule. The linkage is to Sp A56 of the RNA, and the first nucleotide reverse transcribed is TR G117. The RT-PCR product resulting from primers 1 and 2 (blue arrows) is indicated by the dashed red line. ( B ) RT-PCR amplicons from 580 nt DGR RNA reacted with no protein (–), bRT, Avd, or bRT-Avd, separated on a 2% agarose gel and ethidium bromide-stained. The specific amplicon produced from reaction with bRT-Avd shown by the red arrowhead. ( C ) Percentage of substitutions in TR -cDNA determined by sequencing. ( D ) Radiolabeled 120 and 90 nt cDNA products, indicated by arrowheads, resulting from bRT-Avd activity with the 580 nt DGR RNA as template for 2 h (left) or 12 h (right). Either standard dNTPs (dATP, dGTP, dCTP, TTP), as indicated by ‘+’,were present in the reaction, or standard dNTPs excluding dATP (-A), dGTP (–G), or TTP (-T) were present. Products were treated with RNase, and resolved by denaturing PAGE. ( E ) Radiolabeled 120 and 90 nt cDNA products, indicated by arrowheads, resulting from bRT-Avd activity for 2 h with the 580 nt DGR RNA as template with varying TTP (top) or dUTP (bottom) concentrations. Products were treated with RNase, and resolved by denaturing PAGE. ( F ) Radiolabeled 120 and 90 nt cDNA products, indicated by arrowheads, resulting from bRT-Avd activity for 2 h with the 580 nt DGR RNA as template with varying dUTP concentrations. Products were either RNase-treated (top), or both RNase- and UDG-treated (bottom), and resolved by denaturing PAGE.

    Article Snippet: RNA was synthesized in vitro through runoff transcription reactions performed overnight at 37°C using 40 ng/μl DNA template, 4 mM NTPs (Promega), 0.5 units/μl RNase inhibitor (NEB), and 0.6 mg/mL T7 RNA polymerase in T7 buffer (3 mM MgCl2 , 5 mM DTT, 2 mM spermidine, 40 mM Tris, pH 7.5).

    Techniques: Mutagenesis, Reverse Transcription Polymerase Chain Reaction, Agarose Gel Electrophoresis, Staining, Amplification, Produced, Sequencing, Activity Assay, Polyacrylamide Gel Electrophoresis

    Specificity to DGR RNA. ( A ) Top, schematic of DGR RNA template and primer P G117 . Bottom, radiolabeled products resulting from bRT-Avd activity for 2 h with intact 580 nt DGR RNA or DGR RNA truncated at Sp A56 as template. Reverse transcription reactions were carried out in the absence (-P) or presence of primer P G117 . Reaction products were untreated (U), treated with RNase (+R), or treated with DNase (+D), and resolved by denaturing PAGE. The blue line indicates ODN-primed cDNA products. The red dot indicates ODN-primed 120 nt cDNA (cDNA + 20 nt primer for a 140 nt band). ( B ) Protection of internally-labeled 580 nt DGR RNA from RNase by bRT, Avd, or bRT-Avd, with products resolved by 15% denaturing PAGE. The protected band (P) is indicated. ( C ) RNase protection by Avd, as in panel B, carried out on internally-labeled wild-type 580 nt DGR RNA or 580 nt DGR RNA with scrambled (Sc) Sp sequences, with the first lane in each pair untreated and the second RNase-treated. Products were resolved by denaturing PAGE. The protected band (P) is indicated. ( D ) Radiolabeled products resulting from bRT-Avd activity for 2 h with the WT 580 nt DGR RNA or DGR RNA containing scrambled (Sc) Sp sequences as template. The last lane shows the activity of Avd alone for 2 h with the WT 580 nt DGR RNA as template. Products were treated with RNase, and resolved by denaturing PAGE. The positions of the 120 and 90 nt cDNAs indicated. ( E ) Model of processive polymerization of adenine-mutagenized cDNA by bRT-Avd/RNA ribonucleoprotein particle. The 2′-OH of Sp 56 serves as the priming site and forms a 2′-5′ phosphodiester bond with the cDNA. The first nucleotide reverse transcribed is TR 117. Adenines in TR are unfaithfully reverse transcribed by bRT-Avd (represented by ‘N’). The RNP promotes processive polymerization, which terminates at one of two stops in the DGR RNA.

    Journal: Nucleic Acids Research

    Article Title: Template-assisted synthesis of adenine-mutagenized cDNA by a retroelement protein complex

    doi: 10.1093/nar/gky620

    Figure Lengend Snippet: Specificity to DGR RNA. ( A ) Top, schematic of DGR RNA template and primer P G117 . Bottom, radiolabeled products resulting from bRT-Avd activity for 2 h with intact 580 nt DGR RNA or DGR RNA truncated at Sp A56 as template. Reverse transcription reactions were carried out in the absence (-P) or presence of primer P G117 . Reaction products were untreated (U), treated with RNase (+R), or treated with DNase (+D), and resolved by denaturing PAGE. The blue line indicates ODN-primed cDNA products. The red dot indicates ODN-primed 120 nt cDNA (cDNA + 20 nt primer for a 140 nt band). ( B ) Protection of internally-labeled 580 nt DGR RNA from RNase by bRT, Avd, or bRT-Avd, with products resolved by 15% denaturing PAGE. The protected band (P) is indicated. ( C ) RNase protection by Avd, as in panel B, carried out on internally-labeled wild-type 580 nt DGR RNA or 580 nt DGR RNA with scrambled (Sc) Sp sequences, with the first lane in each pair untreated and the second RNase-treated. Products were resolved by denaturing PAGE. The protected band (P) is indicated. ( D ) Radiolabeled products resulting from bRT-Avd activity for 2 h with the WT 580 nt DGR RNA or DGR RNA containing scrambled (Sc) Sp sequences as template. The last lane shows the activity of Avd alone for 2 h with the WT 580 nt DGR RNA as template. Products were treated with RNase, and resolved by denaturing PAGE. The positions of the 120 and 90 nt cDNAs indicated. ( E ) Model of processive polymerization of adenine-mutagenized cDNA by bRT-Avd/RNA ribonucleoprotein particle. The 2′-OH of Sp 56 serves as the priming site and forms a 2′-5′ phosphodiester bond with the cDNA. The first nucleotide reverse transcribed is TR 117. Adenines in TR are unfaithfully reverse transcribed by bRT-Avd (represented by ‘N’). The RNP promotes processive polymerization, which terminates at one of two stops in the DGR RNA.

    Article Snippet: RNA was synthesized in vitro through runoff transcription reactions performed overnight at 37°C using 40 ng/μl DNA template, 4 mM NTPs (Promega), 0.5 units/μl RNase inhibitor (NEB), and 0.6 mg/mL T7 RNA polymerase in T7 buffer (3 mM MgCl2 , 5 mM DTT, 2 mM spermidine, 40 mM Tris, pH 7.5).

    Techniques: Activity Assay, Polyacrylamide Gel Electrophoresis, Labeling

    eIF3d cap-binding activity is required for efficient 48S initiation complex formation on specific mRNAs a , Phosphorimage of SDS gel resolving RNase-protected 32 P-cap-labeled c-Jun 5′ UTR RNA crosslinked to eIF3 in the presence of competitor ligands. b , Electrostatic surface view of the eIF3d cap-binding domain colored by charge, with a zoomed view of single stranded RNA (ssRNA) and cap analog modeled according to their positions bound to DXO 15 . Positive charge is colored blue and negative charge is in red, and the RNA gate is removed for clarity. c , Phosphorimage of SDS gel resolving RNase-protected 32 P-cap-labeled c-Jun 5′ UTR RNA crosslinked to wild type or helix α5 or helix α11-mutant eIF3. eIF3d-helix α5 mutant (D249Q/V262I/Y263A), helix α11 mutant (T317E/N320E/H321A). WT, wild type. d , Incorporation of c-Jun and ACTB mRNA into initiation complexes by wild type, helix α5, or helix α11-mutant eIF3d as measured by quantitative RT-PCR. mRNA-ribosome association is expressed as the ratio between the quantity of mRNA transcripts to 18S rRNA and normalized to the wild type sample. The results are representative of three independent experiments and given as the mean ± s.d. from a representative quantitative RT-PCR experiment performed in duplicate.

    Journal: Nature

    Article Title: eIF3d is an mRNA cap-binding protein required for specialized translation initiation

    doi: 10.1038/nature18954

    Figure Lengend Snippet: eIF3d cap-binding activity is required for efficient 48S initiation complex formation on specific mRNAs a , Phosphorimage of SDS gel resolving RNase-protected 32 P-cap-labeled c-Jun 5′ UTR RNA crosslinked to eIF3 in the presence of competitor ligands. b , Electrostatic surface view of the eIF3d cap-binding domain colored by charge, with a zoomed view of single stranded RNA (ssRNA) and cap analog modeled according to their positions bound to DXO 15 . Positive charge is colored blue and negative charge is in red, and the RNA gate is removed for clarity. c , Phosphorimage of SDS gel resolving RNase-protected 32 P-cap-labeled c-Jun 5′ UTR RNA crosslinked to wild type or helix α5 or helix α11-mutant eIF3. eIF3d-helix α5 mutant (D249Q/V262I/Y263A), helix α11 mutant (T317E/N320E/H321A). WT, wild type. d , Incorporation of c-Jun and ACTB mRNA into initiation complexes by wild type, helix α5, or helix α11-mutant eIF3d as measured by quantitative RT-PCR. mRNA-ribosome association is expressed as the ratio between the quantity of mRNA transcripts to 18S rRNA and normalized to the wild type sample. The results are representative of three independent experiments and given as the mean ± s.d. from a representative quantitative RT-PCR experiment performed in duplicate.

    Article Snippet: Each translation reaction contained 50% in vitro translation lysate and buffer to make the final reaction with 0.84 mM ATP, 0.21 mM GTP, 21 mM creatine phosphate (Roche), 45 U ml-1 creatine phosphokinase (Roche), 10 mM HEPES-KOH pH 7.6, 2 mM DTT, 8 mM amino acids (Promega), 255 mM spermidine, 1 U ml-1 murine RNase inhibitor (NEB), and mRNA-specific concentrations of Mg(OAc)2 and KOAc.

    Techniques: Binding Assay, Activity Assay, SDS-Gel, Labeling, Mutagenesis, Quantitative RT-PCR

    eIF4E recognizes the 5′ end of the c-Jun mRNA less efficiently than ACTB mRNA a , Coomassie blue stained SDS gel of recombinant human eIF4E expressed in E. coli. b , Phosphorimage of SDS gel resolving RNase-protected 32 P-cap-labeled ACTB or c-Jun 5′ UTR RNA crosslinked to eIF4E. The result is representative of three independent experiments. For gel source data, see Supplementary Figure 1 .

    Journal: Nature

    Article Title: eIF3d is an mRNA cap-binding protein required for specialized translation initiation

    doi: 10.1038/nature18954

    Figure Lengend Snippet: eIF4E recognizes the 5′ end of the c-Jun mRNA less efficiently than ACTB mRNA a , Coomassie blue stained SDS gel of recombinant human eIF4E expressed in E. coli. b , Phosphorimage of SDS gel resolving RNase-protected 32 P-cap-labeled ACTB or c-Jun 5′ UTR RNA crosslinked to eIF4E. The result is representative of three independent experiments. For gel source data, see Supplementary Figure 1 .

    Article Snippet: Each translation reaction contained 50% in vitro translation lysate and buffer to make the final reaction with 0.84 mM ATP, 0.21 mM GTP, 21 mM creatine phosphate (Roche), 45 U ml-1 creatine phosphokinase (Roche), 10 mM HEPES-KOH pH 7.6, 2 mM DTT, 8 mM amino acids (Promega), 255 mM spermidine, 1 U ml-1 murine RNase inhibitor (NEB), and mRNA-specific concentrations of Mg(OAc)2 and KOAc.

    Techniques: Staining, SDS-Gel, Recombinant, Labeling

    5' end recognition of c-Jun mRNA is eIF4F-independent a , Distribution of c-Jun or ACTB mRNA-containing initiation complexes in programmed 293T cell in vitro translation extracts. The mRNA abundance (black line) is expressed as the fraction of total recovered transcripts. The results are given as the mean ± standard deviation (s.d.) of a representative quantitative RT-PCR experiment performed in duplicate. The polysome profile (gray line) is plotted as relative absorbance at 254 nm versus elution fractions. b , Western blot analysis of initiation factors in 48S translation complexes formed on c-Jun and ACTB mRNAs. 293T, total protein from 293T in vitro translation extracts. For gel source data, see Supplementary Figure 1 . c , Phosphorimage of SDS gel resolving RNase-protected 32 P-internal or 32 P-cap-labeled c-Jun 5' UTR RNA crosslinked to eIF3 subunits. Recombinant eIF3a migrates at ~100 kDa due to a C-terminal truncation 26 . The results of a - c are representative of three independent experiments.

    Journal: Nature

    Article Title: eIF3d is an mRNA cap-binding protein required for specialized translation initiation

    doi: 10.1038/nature18954

    Figure Lengend Snippet: 5' end recognition of c-Jun mRNA is eIF4F-independent a , Distribution of c-Jun or ACTB mRNA-containing initiation complexes in programmed 293T cell in vitro translation extracts. The mRNA abundance (black line) is expressed as the fraction of total recovered transcripts. The results are given as the mean ± standard deviation (s.d.) of a representative quantitative RT-PCR experiment performed in duplicate. The polysome profile (gray line) is plotted as relative absorbance at 254 nm versus elution fractions. b , Western blot analysis of initiation factors in 48S translation complexes formed on c-Jun and ACTB mRNAs. 293T, total protein from 293T in vitro translation extracts. For gel source data, see Supplementary Figure 1 . c , Phosphorimage of SDS gel resolving RNase-protected 32 P-internal or 32 P-cap-labeled c-Jun 5' UTR RNA crosslinked to eIF3 subunits. Recombinant eIF3a migrates at ~100 kDa due to a C-terminal truncation 26 . The results of a - c are representative of three independent experiments.

    Article Snippet: Each translation reaction contained 50% in vitro translation lysate and buffer to make the final reaction with 0.84 mM ATP, 0.21 mM GTP, 21 mM creatine phosphate (Roche), 45 U ml-1 creatine phosphokinase (Roche), 10 mM HEPES-KOH pH 7.6, 2 mM DTT, 8 mM amino acids (Promega), 255 mM spermidine, 1 U ml-1 murine RNase inhibitor (NEB), and mRNA-specific concentrations of Mg(OAc)2 and KOAc.

    Techniques: In Vitro, Standard Deviation, Quantitative RT-PCR, Western Blot, SDS-Gel, Labeling, Recombinant

    Both maturation and inactivation of RNase P RNA is carried out by RNase J. A) Histogram showing the percentage of reads mapping to a given position, out of the total number of reads mapping to the putative SA1279- rnpB operon in each strain (shown in parentheses). Only positions of interest are included, but the full data-set can be found in Table S6 . +1: The putative transcription start site of SA1279. +452 to +477: The RNase J mutants accumulate RNA with 5′-ends in this region. +485: The putative transcription start site of rnpB , a major detected RNA species in the WT, ΔY and ΔcshA, but very reduced in the RNase J mutants. +499: A major detected RNA species in the WT, ΔY and ΔcshA, however it is absent from the RNase J1 mutants and reduced in the ΔJ2 strain. B) The layout of the region around SA1279 and rnpB . DNA is represented as a wavy line, and RNA transcripts as straight black lines. (PP)P indicates a mix of tri- and mono-phosphorylated RNA, generated by pyrophosphohydrolases. Small blue arrows indicate the PCR-primers used to amplify circularised RnpB and SA1279-RnpB for mapping the 5′ and 3′-ends. R1 indicates the probe used for the Northern blot shown in Figure S2 . C) A blow-up of the region from +420 to +540, showing the proposed model for converting the +1 transcript into mature RnpB. P indicates mono-phosphorylation. D) Predicted secondary structures of RnpB, generated using mfold with default settings [30] , and based on the crystal structures of RNase P RNA [27] , [31] . Within the RNase P structure, the thin dotted arrows indicate the path of the RNA through the secondary and tertiary structure of RNase P, the RBS and start codon of SA1278 are in bold, and the region where the anti-sense RNA can hybridise is indicated with a thick black line. E) The difference in average length of RnpB in WT, ΔJ1, and ΔJ1ΔJ2 strains, revealed by the length of the PCR-product generated across the 5′/3′ junction. Results of the cloned and sequenced PCR-products are shown in Table 6 . M: Marker.

    Journal: PLoS Genetics

    Article Title: Transcriptome-Wide Analyses of 5?-Ends in RNase J Mutants of a Gram-Positive Pathogen Reveal a Role in RNA Maturation, Regulation and Degradation

    doi: 10.1371/journal.pgen.1004207

    Figure Lengend Snippet: Both maturation and inactivation of RNase P RNA is carried out by RNase J. A) Histogram showing the percentage of reads mapping to a given position, out of the total number of reads mapping to the putative SA1279- rnpB operon in each strain (shown in parentheses). Only positions of interest are included, but the full data-set can be found in Table S6 . +1: The putative transcription start site of SA1279. +452 to +477: The RNase J mutants accumulate RNA with 5′-ends in this region. +485: The putative transcription start site of rnpB , a major detected RNA species in the WT, ΔY and ΔcshA, but very reduced in the RNase J mutants. +499: A major detected RNA species in the WT, ΔY and ΔcshA, however it is absent from the RNase J1 mutants and reduced in the ΔJ2 strain. B) The layout of the region around SA1279 and rnpB . DNA is represented as a wavy line, and RNA transcripts as straight black lines. (PP)P indicates a mix of tri- and mono-phosphorylated RNA, generated by pyrophosphohydrolases. Small blue arrows indicate the PCR-primers used to amplify circularised RnpB and SA1279-RnpB for mapping the 5′ and 3′-ends. R1 indicates the probe used for the Northern blot shown in Figure S2 . C) A blow-up of the region from +420 to +540, showing the proposed model for converting the +1 transcript into mature RnpB. P indicates mono-phosphorylation. D) Predicted secondary structures of RnpB, generated using mfold with default settings [30] , and based on the crystal structures of RNase P RNA [27] , [31] . Within the RNase P structure, the thin dotted arrows indicate the path of the RNA through the secondary and tertiary structure of RNase P, the RBS and start codon of SA1278 are in bold, and the region where the anti-sense RNA can hybridise is indicated with a thick black line. E) The difference in average length of RnpB in WT, ΔJ1, and ΔJ1ΔJ2 strains, revealed by the length of the PCR-product generated across the 5′/3′ junction. Results of the cloned and sequenced PCR-products are shown in Table 6 . M: Marker.

    Article Snippet: A premix of 10 µl 10× T4 RNA ligase buffer, 10 µl 10 mM ATP, 30 U T4 RNA ligase 1, 1 µl Murine RNase inhibitor (all from New England Biolabs), and 21 µl water was added to each tube of denatured RNA, and incubated for 3 hours at 37°C.

    Techniques: Generated, Polymerase Chain Reaction, Northern Blot, Clone Assay, Marker

    SA1075 mRNA inactivation by RNase J competes with translation initiation. A) Histogram showing the percentage of reads mapping to a given position, out of the total number of reads mapping to the SA1075 transcript in each strain (shown in parentheses). Only positions of interest are included, but the full data-set can be found in Table S8 . +1: The putative transcription start site. +16: The major detected RNA species in the WT, ΔY and ΔcshA. +45: Position where ΔJ1ΔJ2 differs from ΔJ1, ΔJ2 and J1 AGA , and appears similar to WT. B) Important positions indicated on the SA1075 gene. +1: Transcription Start Site. RBS: Ribosome Binding Site. R2 indicates the probe used for the Northern blot in panel D. C) Hairpin structure predicted by the mfold algorithm, which sequesters the RBS and start-codon (shown in bold). No secondary structure was predicted for the 50 nucleotides downstream of position +45. D) Northern blot of the SA1075 transcript, using probe R2. The +1 and +16 RNA species are not resolved, and can be seen as a single band, however the +45 species is clearly visible in the ΔJ1, ΔJ2, and J1 AGA strains. The marker was stained with methylene blue and photographed. As a loading control, the Northern blot was stripped and re-probed to detect the 5S rRNA. E) The proposed model for determining the fate of SA1075 mRNA via competition between RNase J, ribosomes and the nuclease that cleaves at position +16. (PP)P indicates a mix of tri- and mono-phosphorylated RNA, generated by pyrophosphohydrolases. Nascent SA1075 mRNA can either be occupied by ribosomes, binding to the RBS, or form Hairpin I which sequesters the RBS. Ribosomes will shield position +45 from RNase J, but the hairpin will not. If cleavage at position +16 occurs before RNase J has cleaved at position +45, then the RBS will be liberated from Hairpin I, and ribosomes can initiate translation. If ever the +45 cut is made by RNase J, then the mRNA, which no longer has RBS or start-codon, is immediately degraded (possibly by the RNase J1+J2 complex). Either RNase J1 or RNase J2 can perform a cleavage at position +45. The loss of both RNases prevents the +45 RNA species from being generated, thus explaining why the WT and the ΔJ1ΔJ2 strains appear similar in panel A (see discussion for details and other potential explanations).

    Journal: PLoS Genetics

    Article Title: Transcriptome-Wide Analyses of 5?-Ends in RNase J Mutants of a Gram-Positive Pathogen Reveal a Role in RNA Maturation, Regulation and Degradation

    doi: 10.1371/journal.pgen.1004207

    Figure Lengend Snippet: SA1075 mRNA inactivation by RNase J competes with translation initiation. A) Histogram showing the percentage of reads mapping to a given position, out of the total number of reads mapping to the SA1075 transcript in each strain (shown in parentheses). Only positions of interest are included, but the full data-set can be found in Table S8 . +1: The putative transcription start site. +16: The major detected RNA species in the WT, ΔY and ΔcshA. +45: Position where ΔJ1ΔJ2 differs from ΔJ1, ΔJ2 and J1 AGA , and appears similar to WT. B) Important positions indicated on the SA1075 gene. +1: Transcription Start Site. RBS: Ribosome Binding Site. R2 indicates the probe used for the Northern blot in panel D. C) Hairpin structure predicted by the mfold algorithm, which sequesters the RBS and start-codon (shown in bold). No secondary structure was predicted for the 50 nucleotides downstream of position +45. D) Northern blot of the SA1075 transcript, using probe R2. The +1 and +16 RNA species are not resolved, and can be seen as a single band, however the +45 species is clearly visible in the ΔJ1, ΔJ2, and J1 AGA strains. The marker was stained with methylene blue and photographed. As a loading control, the Northern blot was stripped and re-probed to detect the 5S rRNA. E) The proposed model for determining the fate of SA1075 mRNA via competition between RNase J, ribosomes and the nuclease that cleaves at position +16. (PP)P indicates a mix of tri- and mono-phosphorylated RNA, generated by pyrophosphohydrolases. Nascent SA1075 mRNA can either be occupied by ribosomes, binding to the RBS, or form Hairpin I which sequesters the RBS. Ribosomes will shield position +45 from RNase J, but the hairpin will not. If cleavage at position +16 occurs before RNase J has cleaved at position +45, then the RBS will be liberated from Hairpin I, and ribosomes can initiate translation. If ever the +45 cut is made by RNase J, then the mRNA, which no longer has RBS or start-codon, is immediately degraded (possibly by the RNase J1+J2 complex). Either RNase J1 or RNase J2 can perform a cleavage at position +45. The loss of both RNases prevents the +45 RNA species from being generated, thus explaining why the WT and the ΔJ1ΔJ2 strains appear similar in panel A (see discussion for details and other potential explanations).

    Article Snippet: A premix of 10 µl 10× T4 RNA ligase buffer, 10 µl 10 mM ATP, 30 U T4 RNA ligase 1, 1 µl Murine RNase inhibitor (all from New England Biolabs), and 21 µl water was added to each tube of denatured RNA, and incubated for 3 hours at 37°C.

    Techniques: Binding Assay, Northern Blot, Marker, Staining, Generated

    mRNA maturation by RNase J reveals a potential regulation of translation. A) Histogram showing the percentage of reads mapping to a given position, out of the total number of reads mapping to the SA2322 transcript in each strain (shown in parentheses). Only positions of interest are included, but the full data-set can be found in Table S7 . +1 and +2: The putative transcription start sites. +52: A major detected RNA species in the WT, ΔY and ΔcshA, however it is absent from the RNase J1 mutants and strongly reduced in the ΔJ2 strain. B) The SA2322 locus with important positions indicated. C) A schematic view of the fate of SA2322 transcripts. A newly formed transcript can form a secondary structure, shown in panel D, which partially sequesters the ribosome binding site (RBS). RNase J can shorten the transcript by 51 nt, and is presumably blocked from further exonucleolytic digestion by ribosomes binding to the RBS. (PP)P indicates a mix of tri- and mono-phosphorylated RNA, generated by pyrophosphohydrolases. D) Predicted secondary structure at the 5′-end of the SA2322 transcript. ΔG values predicted by the mfold algorithm are in kcal/mol. RBS and start codon are indicated in bold.

    Journal: PLoS Genetics

    Article Title: Transcriptome-Wide Analyses of 5?-Ends in RNase J Mutants of a Gram-Positive Pathogen Reveal a Role in RNA Maturation, Regulation and Degradation

    doi: 10.1371/journal.pgen.1004207

    Figure Lengend Snippet: mRNA maturation by RNase J reveals a potential regulation of translation. A) Histogram showing the percentage of reads mapping to a given position, out of the total number of reads mapping to the SA2322 transcript in each strain (shown in parentheses). Only positions of interest are included, but the full data-set can be found in Table S7 . +1 and +2: The putative transcription start sites. +52: A major detected RNA species in the WT, ΔY and ΔcshA, however it is absent from the RNase J1 mutants and strongly reduced in the ΔJ2 strain. B) The SA2322 locus with important positions indicated. C) A schematic view of the fate of SA2322 transcripts. A newly formed transcript can form a secondary structure, shown in panel D, which partially sequesters the ribosome binding site (RBS). RNase J can shorten the transcript by 51 nt, and is presumably blocked from further exonucleolytic digestion by ribosomes binding to the RBS. (PP)P indicates a mix of tri- and mono-phosphorylated RNA, generated by pyrophosphohydrolases. D) Predicted secondary structure at the 5′-end of the SA2322 transcript. ΔG values predicted by the mfold algorithm are in kcal/mol. RBS and start codon are indicated in bold.

    Article Snippet: A premix of 10 µl 10× T4 RNA ligase buffer, 10 µl 10 mM ATP, 30 U T4 RNA ligase 1, 1 µl Murine RNase inhibitor (all from New England Biolabs), and 21 µl water was added to each tube of denatured RNA, and incubated for 3 hours at 37°C.

    Techniques: Binding Assay, Generated