multiplex pcr kit  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Qiagen multiplex pcr kit
    Multiplex Pcr Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1027 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/multiplex pcr kit/product/Qiagen
    Average 99 stars, based on 1027 article reviews
    Price from $9.99 to $1999.99
    multiplex pcr kit - by Bioz Stars, 2020-04
    99/100 stars

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Molecular and immunohistochemical detection of assemblage E, Giardia duodenalis in scouring North Dakota calves.
    Article Snippet: .. Pathogen culture and other screening tests For bacteriologic culture, intestinal contents were inoculated on tryptose soy agar (TSA) II 5% sheep blood, and placed in an aerobic incubator at 35 8C for 12 h. Samples were also inoculated on Skirrow's media, and incubated in anaerobic conditions with a microaerophilic gas generating pack at 37 8C for 12 h. Escherichia coli isolates were further genotyped for six virulence factors (K99, F41, Intimin, Sta, Stx-1 and Stx-II) by a multiplex PCR assay based on the Qiagen(r) Multiplex PCR kit. .. All Salmonella isolates were sent to the National Veterinary Services Laboratories, Ames Iowa for serotyping.

    Modification:

    Article Title: Molecular and immunohistochemical detection of assemblage E, Giardia duodenalis in scouring North Dakota calves.
    Article Snippet: Pathogen culture and other screening tests For bacteriologic culture, intestinal contents were inoculated on tryptose soy agar (TSA) II 5% sheep blood, and placed in an aerobic incubator at 35 8C for 12 h. Samples were also inoculated on Skirrow's media, and incubated in anaerobic conditions with a microaerophilic gas generating pack at 37 8C for 12 h. Escherichia coli isolates were further genotyped for six virulence factors (K99, F41, Intimin, Sta, Stx-1 and Stx-II) by a multiplex PCR assay based on the Qiagen(r) Multiplex PCR kit. .. Presence of Cryptosporidium spp. was evaluated by the modified acid fast stain, and in calves aged 2 weeks old, fecal flotation was done to rule out coccidian and other parasites.

    Incubation:

    Article Title: Molecular and immunohistochemical detection of assemblage E, Giardia duodenalis in scouring North Dakota calves.
    Article Snippet: .. Pathogen culture and other screening tests For bacteriologic culture, intestinal contents were inoculated on tryptose soy agar (TSA) II 5% sheep blood, and placed in an aerobic incubator at 35 8C for 12 h. Samples were also inoculated on Skirrow's media, and incubated in anaerobic conditions with a microaerophilic gas generating pack at 37 8C for 12 h. Escherichia coli isolates were further genotyped for six virulence factors (K99, F41, Intimin, Sta, Stx-1 and Stx-II) by a multiplex PCR assay based on the Qiagen(r) Multiplex PCR kit. .. All Salmonella isolates were sent to the National Veterinary Services Laboratories, Ames Iowa for serotyping.

    Multiplex Assay:

    Article Title: Molecular and immunohistochemical detection of assemblage E, Giardia duodenalis in scouring North Dakota calves.
    Article Snippet: .. Pathogen culture and other screening tests For bacteriologic culture, intestinal contents were inoculated on tryptose soy agar (TSA) II 5% sheep blood, and placed in an aerobic incubator at 35 8C for 12 h. Samples were also inoculated on Skirrow's media, and incubated in anaerobic conditions with a microaerophilic gas generating pack at 37 8C for 12 h. Escherichia coli isolates were further genotyped for six virulence factors (K99, F41, Intimin, Sta, Stx-1 and Stx-II) by a multiplex PCR assay based on the Qiagen(r) Multiplex PCR kit. .. All Salmonella isolates were sent to the National Veterinary Services Laboratories, Ames Iowa for serotyping.

    Ziehl-Neelsen Stain:

    Article Title: Molecular and immunohistochemical detection of assemblage E, Giardia duodenalis in scouring North Dakota calves.
    Article Snippet: Pathogen culture and other screening tests For bacteriologic culture, intestinal contents were inoculated on tryptose soy agar (TSA) II 5% sheep blood, and placed in an aerobic incubator at 35 8C for 12 h. Samples were also inoculated on Skirrow's media, and incubated in anaerobic conditions with a microaerophilic gas generating pack at 37 8C for 12 h. Escherichia coli isolates were further genotyped for six virulence factors (K99, F41, Intimin, Sta, Stx-1 and Stx-II) by a multiplex PCR assay based on the Qiagen(r) Multiplex PCR kit. .. Presence of Cryptosporidium spp. was evaluated by the modified acid fast stain, and in calves aged 2 weeks old, fecal flotation was done to rule out coccidian and other parasites.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen quantitect multiplex pcr norox master mix
    Results obtained in cross-reactivity tests performed with DNA isolates from 23 animal species with 5 commercial master mixes. ( A ) <t>QuantiTect®</t> Multiplex <t>PCR</t> <t>NoROX</t> Master Mix (Qiagen), ( B ) TaqMan® Universal PCR Master Mix (Applied Biosystems), ( C ) GoTaq® Probe qPCR Master Mix (Promega), ( D ) PerfeCTa® qPCR ToughMix TM , Low ROX TM (Quanta Biosciences) and E) Takyon TM No Rox Probe MasterMix dTTP Blue (Eurogentec).
    Quantitect Multiplex Pcr Norox Master Mix, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 21 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitect multiplex pcr norox master mix/product/Qiagen
    Average 99 stars, based on 21 article reviews
    Price from $9.99 to $1999.99
    quantitect multiplex pcr norox master mix - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Qiagen multiplex pcr enzyme kit
    The relationship between the 21-3 <t>VNTR</t> allele and the BstUI cutting pattern for 10 Philippine M. leprae samples is shown in A and B, respectively. (A) BstUI-RFLP gel. (B) Agarose gel showing products of multiplex <t>PCR</t> for four VNTR loci. The 21-3 product
    Multiplex Pcr Enzyme Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1028 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/multiplex pcr enzyme kit/product/Qiagen
    Average 99 stars, based on 1028 article reviews
    Price from $9.99 to $1999.99
    multiplex pcr enzyme kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Results obtained in cross-reactivity tests performed with DNA isolates from 23 animal species with 5 commercial master mixes. ( A ) QuantiTect® Multiplex PCR NoROX Master Mix (Qiagen), ( B ) TaqMan® Universal PCR Master Mix (Applied Biosystems), ( C ) GoTaq® Probe qPCR Master Mix (Promega), ( D ) PerfeCTa® qPCR ToughMix TM , Low ROX TM (Quanta Biosciences) and E) Takyon TM No Rox Probe MasterMix dTTP Blue (Eurogentec).

    Journal: Scientific Reports

    Article Title: Sika deer (Cervus nippon)-specific real-time PCR method to detect fraudulent labelling of meat and meat products

    doi: 10.1038/s41598-018-25299-7

    Figure Lengend Snippet: Results obtained in cross-reactivity tests performed with DNA isolates from 23 animal species with 5 commercial master mixes. ( A ) QuantiTect® Multiplex PCR NoROX Master Mix (Qiagen), ( B ) TaqMan® Universal PCR Master Mix (Applied Biosystems), ( C ) GoTaq® Probe qPCR Master Mix (Promega), ( D ) PerfeCTa® qPCR ToughMix TM , Low ROX TM (Quanta Biosciences) and E) Takyon TM No Rox Probe MasterMix dTTP Blue (Eurogentec).

    Article Snippet: The other two master mixes, the QuantiTect Multiplex PCR NoROX Master Mix (Qiagen) and the TaqMan® Universal PCR Master Mix (Applied Biosystems, Foster City, CA, USA) were used by applying conventional thermal cycling programs.

    Techniques: Multiplex Assay, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction

    The relationship between the 21-3 VNTR allele and the BstUI cutting pattern for 10 Philippine M. leprae samples is shown in A and B, respectively. (A) BstUI-RFLP gel. (B) Agarose gel showing products of multiplex PCR for four VNTR loci. The 21-3 product

    Journal: Journal of Clinical Microbiology

    Article Title: Population-Based Molecular Epidemiology of Leprosy in Cebu, Philippines

    doi: 10.1128/JCM.02021-08

    Figure Lengend Snippet: The relationship between the 21-3 VNTR allele and the BstUI cutting pattern for 10 Philippine M. leprae samples is shown in A and B, respectively. (A) BstUI-RFLP gel. (B) Agarose gel showing products of multiplex PCR for four VNTR loci. The 21-3 product

    Article Snippet: A multiplex PCR protocol described previously by Kimura et al. comprising four reactions for the amplification of 15 VNTR loci was achieved using a multiplex PCR enzyme kit (Qiagen) and fluorescent 5′-labeled forward primers and reverse unlabeled primers ( ).

    Techniques: Agarose Gel Electrophoresis, Multiplex Assay, Polymerase Chain Reaction

    Detection of RLEP sequence by PCR in armadillo tissues. A) Analysis of PCR RLEP product from spleen samples from nine different armadillos. B) Analysis of RLEP from paired samples of liver (L) and spleen (S) from five different armadillos. The signal from positive samples is consistently stronger in the spleen for each individual. The positive control (+ve) reaction included purified M . leprae DNA, 2 ng, while the negative control (-ve) lacked DNA template.

    Journal: PLoS Neglected Tropical Diseases

    Article Title: Evidence of zoonotic leprosy in Pará, Brazilian Amazon, and risks associated with human contact or consumption of armadillos

    doi: 10.1371/journal.pntd.0006532

    Figure Lengend Snippet: Detection of RLEP sequence by PCR in armadillo tissues. A) Analysis of PCR RLEP product from spleen samples from nine different armadillos. B) Analysis of RLEP from paired samples of liver (L) and spleen (S) from five different armadillos. The signal from positive samples is consistently stronger in the spleen for each individual. The positive control (+ve) reaction included purified M . leprae DNA, 2 ng, while the negative control (-ve) lacked DNA template.

    Article Snippet: The M . leprae- specific repetitive sequence, RLEP, was amplified by PCR using a Qiagen Multiplex PCR Kit (Qiagen) and primers (LP1 forward primer: 5'-TGCATGTCATGGCCTTGAGG-3' and LP2 reverse primer: 5'-CACCGATACCAGCGGCAGAA-3') that amplifies a 129-base pair fragment found in the M . leprae genome.

    Techniques: Sequencing, Polymerase Chain Reaction, Positive Control, Purification, Negative Control

    H . pylori - specific PCR for DNA extracted from oral cavity. In this figure, one can see the amplification of VacA in the three cases previously identified as oral cavity positives for H. pylori (Hp positive sample #1 to #3), in comparison with other three cases that are oral cavity H. pylori negatives (Hp negative sample #1 to #3). As a positive control (Hp positive control) PCR for DNA extracted from H . pylori (strain 7354) diluted in saliva was used. Blank—PCR negative control.

    Journal: PLoS ONE

    Article Title: Oral and Gastric Helicobacter Pylori: Effects and Associations

    doi: 10.1371/journal.pone.0126923

    Figure Lengend Snippet: H . pylori - specific PCR for DNA extracted from oral cavity. In this figure, one can see the amplification of VacA in the three cases previously identified as oral cavity positives for H. pylori (Hp positive sample #1 to #3), in comparison with other three cases that are oral cavity H. pylori negatives (Hp negative sample #1 to #3). As a positive control (Hp positive control) PCR for DNA extracted from H . pylori (strain 7354) diluted in saliva was used. Blank—PCR negative control.

    Article Snippet: Next, DNA was extracted using the MagNA Pure LC DNA Isolation Kit (Bacteria, Fungi) (Roche), quantified with Nanodrop (Thermo Lifesciences), and bacterial DNA was amplified using the Multiplex PCR kit (Qiagen) with primers that recognize all H .pylori strains: VacA_Fw: ATGGAAATACAACAAACACAC and VacA_Rv: CTGCTTGAATGCGCCAAAC(21).

    Techniques: Polymerase Chain Reaction, Amplification, Positive Control, Negative Control

    Highly sensitive PCR for detection of H . pylori . In order to evaluate the sensitivity of VacA -specific PCR, 50ng of DNA from H . pylori was successively diluted (1 to 1:100000) in saliva from two random cases (#3 and #10) that were shown previously to be negative for the presence of H . pylori . The PCR allowed the amplification of the expected product for all different dilutions.

    Journal: PLoS ONE

    Article Title: Oral and Gastric Helicobacter Pylori: Effects and Associations

    doi: 10.1371/journal.pone.0126923

    Figure Lengend Snippet: Highly sensitive PCR for detection of H . pylori . In order to evaluate the sensitivity of VacA -specific PCR, 50ng of DNA from H . pylori was successively diluted (1 to 1:100000) in saliva from two random cases (#3 and #10) that were shown previously to be negative for the presence of H . pylori . The PCR allowed the amplification of the expected product for all different dilutions.

    Article Snippet: Next, DNA was extracted using the MagNA Pure LC DNA Isolation Kit (Bacteria, Fungi) (Roche), quantified with Nanodrop (Thermo Lifesciences), and bacterial DNA was amplified using the Multiplex PCR kit (Qiagen) with primers that recognize all H .pylori strains: VacA_Fw: ATGGAAATACAACAAACACAC and VacA_Rv: CTGCTTGAATGCGCCAAAC(21).

    Techniques: Polymerase Chain Reaction, Amplification