multiplex oligos  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1)
    Description:

    Catalog Number:
    E7600S
    Price:
    None
    Buy from Supplier


    Structured Review

    New England Biolabs multiplex oligos
    SIRT7 is involved in pre-rRNA processing. ( a ) Knockdown of SIRT7 impairs pre-rRNA synthesis and processing in vivo . U2OS cells transfected with control (siCtrl) or SIRT7-specific siRNAs (siSIRT7) were metabolically labelled with 3 H-uridine. <t>RNA</t> was analysed by agarose gel electrophoresis and fluorography. The bar diagram shows quantification of the processing intermediates, values from siCtrl cells being set to 1. ( b ) In vitro processing assay. Extracts from L1210 cells were incubated with 32 P-labelled RNA comprising the 5′ETS depicted in the scheme above. 32 P-labelled RNA and cleavage products were analysed by gel electrophoresis and PhosphorImaging. See also Supplementary Fig. 3a . ( c ) 5′ETS processing is inhibited by NAM. The assay contained radiolabelled RNA (+541/+1290) and extracts from L1210 cells cultured for 6 h in the absence or presence of NAM. ( d ) Processing is enhanced by NAD + . Processing assays containing radiolabelled RNA (+541/+1290) were substituted with NAD + as indicated. ( e ) The catalytic activity of SIRT7 is required for pre-rRNA cleavage. Assays were supplemented with 15 or 30 ng of purified wildtype (WT) or mutant (H187Y) Flag-SIRT7 ( Supplementary Fig. 3b ). ( f ) Depletion of SIRT7 impairs processing. SIRT7 was depleted from L1210 cells by shRNAs (shSIRT7-1, shSIRT7-2, Supplementary Fig. 3c ). Extracts from non-infected cells (−) or cells expressing control shRNA (shCtrl) served as control (left). To rescue impaired cleavage, 15 ng of wild-type Flag-SIRT7 (WT) or mutant H187Y (HY) were added to SIRT7-depleted extracts (right). ( g ) Depletion of U3 snoRNA abolishes processing. U3 snoRNA was depleted by preincubating extracts with U3-specific antisense <t>oligos</t> (ASO, 50 ng μl −1 ) and 2 U of RNase H ( Supplementary Fig. 3d ). In vitro processing was performed with undepleted (−) or depleted extracts in the absence or presence of 15 ng Flag-SIRT7. Bar diagrams in c – g show quantification of the ratio of cleaved versus uncleaved transcripts, presented as mean±s.d. from three independent experiments (* P

    https://www.bioz.com/result/multiplex oligos/product/New England Biolabs
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    multiplex oligos - by Bioz Stars, 2019-08
    99/100 stars

    Related Products / Commonly Used Together

    hiseq2000 sequencer
    bp single-end sequencing

    Images

    1) Product Images from "SIRT7-dependent deacetylation of the U3-55k protein controls pre-rRNA processing"

    Article Title: SIRT7-dependent deacetylation of the U3-55k protein controls pre-rRNA processing

    Journal: Nature Communications

    doi: 10.1038/ncomms10734

    SIRT7 is involved in pre-rRNA processing. ( a ) Knockdown of SIRT7 impairs pre-rRNA synthesis and processing in vivo . U2OS cells transfected with control (siCtrl) or SIRT7-specific siRNAs (siSIRT7) were metabolically labelled with 3 H-uridine. RNA was analysed by agarose gel electrophoresis and fluorography. The bar diagram shows quantification of the processing intermediates, values from siCtrl cells being set to 1. ( b ) In vitro processing assay. Extracts from L1210 cells were incubated with 32 P-labelled RNA comprising the 5′ETS depicted in the scheme above. 32 P-labelled RNA and cleavage products were analysed by gel electrophoresis and PhosphorImaging. See also Supplementary Fig. 3a . ( c ) 5′ETS processing is inhibited by NAM. The assay contained radiolabelled RNA (+541/+1290) and extracts from L1210 cells cultured for 6 h in the absence or presence of NAM. ( d ) Processing is enhanced by NAD + . Processing assays containing radiolabelled RNA (+541/+1290) were substituted with NAD + as indicated. ( e ) The catalytic activity of SIRT7 is required for pre-rRNA cleavage. Assays were supplemented with 15 or 30 ng of purified wildtype (WT) or mutant (H187Y) Flag-SIRT7 ( Supplementary Fig. 3b ). ( f ) Depletion of SIRT7 impairs processing. SIRT7 was depleted from L1210 cells by shRNAs (shSIRT7-1, shSIRT7-2, Supplementary Fig. 3c ). Extracts from non-infected cells (−) or cells expressing control shRNA (shCtrl) served as control (left). To rescue impaired cleavage, 15 ng of wild-type Flag-SIRT7 (WT) or mutant H187Y (HY) were added to SIRT7-depleted extracts (right). ( g ) Depletion of U3 snoRNA abolishes processing. U3 snoRNA was depleted by preincubating extracts with U3-specific antisense oligos (ASO, 50 ng μl −1 ) and 2 U of RNase H ( Supplementary Fig. 3d ). In vitro processing was performed with undepleted (−) or depleted extracts in the absence or presence of 15 ng Flag-SIRT7. Bar diagrams in c – g show quantification of the ratio of cleaved versus uncleaved transcripts, presented as mean±s.d. from three independent experiments (* P
    Figure Legend Snippet: SIRT7 is involved in pre-rRNA processing. ( a ) Knockdown of SIRT7 impairs pre-rRNA synthesis and processing in vivo . U2OS cells transfected with control (siCtrl) or SIRT7-specific siRNAs (siSIRT7) were metabolically labelled with 3 H-uridine. RNA was analysed by agarose gel electrophoresis and fluorography. The bar diagram shows quantification of the processing intermediates, values from siCtrl cells being set to 1. ( b ) In vitro processing assay. Extracts from L1210 cells were incubated with 32 P-labelled RNA comprising the 5′ETS depicted in the scheme above. 32 P-labelled RNA and cleavage products were analysed by gel electrophoresis and PhosphorImaging. See also Supplementary Fig. 3a . ( c ) 5′ETS processing is inhibited by NAM. The assay contained radiolabelled RNA (+541/+1290) and extracts from L1210 cells cultured for 6 h in the absence or presence of NAM. ( d ) Processing is enhanced by NAD + . Processing assays containing radiolabelled RNA (+541/+1290) were substituted with NAD + as indicated. ( e ) The catalytic activity of SIRT7 is required for pre-rRNA cleavage. Assays were supplemented with 15 or 30 ng of purified wildtype (WT) or mutant (H187Y) Flag-SIRT7 ( Supplementary Fig. 3b ). ( f ) Depletion of SIRT7 impairs processing. SIRT7 was depleted from L1210 cells by shRNAs (shSIRT7-1, shSIRT7-2, Supplementary Fig. 3c ). Extracts from non-infected cells (−) or cells expressing control shRNA (shCtrl) served as control (left). To rescue impaired cleavage, 15 ng of wild-type Flag-SIRT7 (WT) or mutant H187Y (HY) were added to SIRT7-depleted extracts (right). ( g ) Depletion of U3 snoRNA abolishes processing. U3 snoRNA was depleted by preincubating extracts with U3-specific antisense oligos (ASO, 50 ng μl −1 ) and 2 U of RNase H ( Supplementary Fig. 3d ). In vitro processing was performed with undepleted (−) or depleted extracts in the absence or presence of 15 ng Flag-SIRT7. Bar diagrams in c – g show quantification of the ratio of cleaved versus uncleaved transcripts, presented as mean±s.d. from three independent experiments (* P

    Techniques Used: In Vivo, Transfection, Metabolic Labelling, Agarose Gel Electrophoresis, In Vitro, Incubation, Nucleic Acid Electrophoresis, Cell Culture, Activity Assay, Purification, Mutagenesis, Infection, Expressing, shRNA, Allele-specific Oligonucleotide

    SIRT7 is associated with pre-rRNA and snoRNAs. ( a ) SIRT7 CLIP-seq reads mapped to a custom annotation file of a human rDNA repeat (middle) or the transcribed region (bottom). The region encoding 18S, 5.8S and 28S rRNA is highlighted. SIRT7 reads after subtraction of IgG reads were normalized to input reads ( y axis). ( b ) Gene ontology categories of SIRT7 CLIP-seq peaks. The most representative clusters are shown according to the ajusted P value (−log 10 ). ( c ) SIRT7-bound snoRNAs comprise C/D box, H/ACA box snoRNAs and scaRNAs. The number ( n ) and relative abundance (%) of each snoRNA class associated with SIRT7 is presented. ( d ) U3, SNORA73A and 73B snoRNAs are overrepresented among SIRT7-associated snoRNAs. SIRT7 reads mapped to corresponding snoRNAs are indicated as percentage of all snoRNAs identified by CLIP-seq. ( e ) Comparison of SIRT7-associated RNAs under native and denaturing conditions. His/V5-tagged SIRT7 expressed in HEK293T cells was affinity-purified on Ni-NTA-agarose under native or denaturing conditions, and associated RNAs were detected by RT–qPCR. Lysates from non-transfected HEK293T cells were used for control (Ctrl). Associated pre-RNA was monitored by RT–qPCR using primer H1 ( Supplementary Table 3 ). Bars represent means±s.d. from three experiments. See also Supplementary Fig. 2b,d . ( f ) ChIP assays showing association of endogenous SIRT7 (left panel) or transiently overexpressed Flag-SIRT7 (right panel) with the indicated gene loci in HEK293T cells. rDNA was amplified using primers H4 (coding) and H18 (IGS; Supplementary Table 3 ). Bars represent means±s.d. from three experiments. See also Supplementary Fig. 2d .
    Figure Legend Snippet: SIRT7 is associated with pre-rRNA and snoRNAs. ( a ) SIRT7 CLIP-seq reads mapped to a custom annotation file of a human rDNA repeat (middle) or the transcribed region (bottom). The region encoding 18S, 5.8S and 28S rRNA is highlighted. SIRT7 reads after subtraction of IgG reads were normalized to input reads ( y axis). ( b ) Gene ontology categories of SIRT7 CLIP-seq peaks. The most representative clusters are shown according to the ajusted P value (−log 10 ). ( c ) SIRT7-bound snoRNAs comprise C/D box, H/ACA box snoRNAs and scaRNAs. The number ( n ) and relative abundance (%) of each snoRNA class associated with SIRT7 is presented. ( d ) U3, SNORA73A and 73B snoRNAs are overrepresented among SIRT7-associated snoRNAs. SIRT7 reads mapped to corresponding snoRNAs are indicated as percentage of all snoRNAs identified by CLIP-seq. ( e ) Comparison of SIRT7-associated RNAs under native and denaturing conditions. His/V5-tagged SIRT7 expressed in HEK293T cells was affinity-purified on Ni-NTA-agarose under native or denaturing conditions, and associated RNAs were detected by RT–qPCR. Lysates from non-transfected HEK293T cells were used for control (Ctrl). Associated pre-RNA was monitored by RT–qPCR using primer H1 ( Supplementary Table 3 ). Bars represent means±s.d. from three experiments. See also Supplementary Fig. 2b,d . ( f ) ChIP assays showing association of endogenous SIRT7 (left panel) or transiently overexpressed Flag-SIRT7 (right panel) with the indicated gene loci in HEK293T cells. rDNA was amplified using primers H4 (coding) and H18 (IGS; Supplementary Table 3 ). Bars represent means±s.d. from three experiments. See also Supplementary Fig. 2d .

    Techniques Used: Cross-linking Immunoprecipitation, Affinity Purification, Quantitative RT-PCR, Transfection, Chromatin Immunoprecipitation, Amplification

    Pre-rRNA transcription and processing are attenuated under stress. ( a ) Northern blot of pre-rRNA and processing intermediates from HEK293T cells that were untreated, exposed to hyperosmotic stress for 90 min (hypertonic), or recovered to regular medium for 60 min (hypertonic rel.). Membranes were probed with 32 P-labelled antisense riboprobe specific to 47S pre-rRNA (5'ETS, top) or with ITS1 oligos hybridizing to pre-rRNA intermediates (middle panel). ( b ) Acetylation of U3-55k is increased on different cellular stress conditions. HEK293T cells expressing Flag-U3-55k were treated with actinomycin D (Act D, 0.1 μg ml −1 , 4 h), AICAR (0.5 mM, 12 h) or exposed to hypertonic stress. Acetylation of immunopurified Flag-U3-55k and equal loading was monitored on western blots using anti-pan-AcK and anti-Flag antibodies. ( c ) Cellular localization of SIRT7 and U3-55k on hyperosmotic stress. Images showing localization of GFP-U3-55k and SIRT7 in normal conditions and on exposure to hyperosmotic stress for 90 min. Nuclei were stained with Hoechst 33342. Scale bars, 10 μm. ( d ) Overexpression of SIRT7 alleviates processing defects on hypertonic stress. Northern blot of RNA from parental U2OS cells and from cells which stably express GFP-SIRT7 (U2OS-GFP-SIRT7) using 5′ETS and ITS1 probes as in a . ( e ) CLIP-RT–qPCR monitoring binding of Flag-U3-55k to pre-rRNA, U3 snoRNA and U2 snRNA in HEK293T cells cultured in normo-osmotic medium or exposed to hypertonic stress for 90 min. Precipitated RNA was analysed by RT–qPCR using the indicated primers. Bars represent the means±s.d. from three biological repeats (* P
    Figure Legend Snippet: Pre-rRNA transcription and processing are attenuated under stress. ( a ) Northern blot of pre-rRNA and processing intermediates from HEK293T cells that were untreated, exposed to hyperosmotic stress for 90 min (hypertonic), or recovered to regular medium for 60 min (hypertonic rel.). Membranes were probed with 32 P-labelled antisense riboprobe specific to 47S pre-rRNA (5'ETS, top) or with ITS1 oligos hybridizing to pre-rRNA intermediates (middle panel). ( b ) Acetylation of U3-55k is increased on different cellular stress conditions. HEK293T cells expressing Flag-U3-55k were treated with actinomycin D (Act D, 0.1 μg ml −1 , 4 h), AICAR (0.5 mM, 12 h) or exposed to hypertonic stress. Acetylation of immunopurified Flag-U3-55k and equal loading was monitored on western blots using anti-pan-AcK and anti-Flag antibodies. ( c ) Cellular localization of SIRT7 and U3-55k on hyperosmotic stress. Images showing localization of GFP-U3-55k and SIRT7 in normal conditions and on exposure to hyperosmotic stress for 90 min. Nuclei were stained with Hoechst 33342. Scale bars, 10 μm. ( d ) Overexpression of SIRT7 alleviates processing defects on hypertonic stress. Northern blot of RNA from parental U2OS cells and from cells which stably express GFP-SIRT7 (U2OS-GFP-SIRT7) using 5′ETS and ITS1 probes as in a . ( e ) CLIP-RT–qPCR monitoring binding of Flag-U3-55k to pre-rRNA, U3 snoRNA and U2 snRNA in HEK293T cells cultured in normo-osmotic medium or exposed to hypertonic stress for 90 min. Precipitated RNA was analysed by RT–qPCR using the indicated primers. Bars represent the means±s.d. from three biological repeats (* P

    Techniques Used: Northern Blot, Expressing, Activated Clotting Time Assay, Western Blot, Staining, Over Expression, Stable Transfection, Cross-linking Immunoprecipitation, Quantitative RT-PCR, Binding Assay, Cell Culture

    2) Product Images from "Comprehensive nucleosome mapping of the human genome in cancer progression"

    Article Title: Comprehensive nucleosome mapping of the human genome in cancer progression

    Journal: Oncotarget

    doi: 10.18632/oncotarget.6811

    The newly developed mTSS-Capture method combined with paired-end sequencing maps genome-wide nucleosome distribution in primary patient samples and identifies bona fide nucleosome characteristics, concordant with other human nucleosome mapping studies A . Work-flow of the mTSS-seq method. Following MNase digestion using a titration of MNase, populations of mononucleosomally protected DNA and subnucleosomal fragments are isolated, and prepared as libraries for Illumina sequencing. Solution-based sequence capture is performed using biotinylated oligos, enabling the enrichment of fragments within 2kb of each transcription start site in the human genome. Paired-end 50bp sequencing was then performed on each index. B . Alignment of the mTSS-seq midpoints to the human genome using the UCSC genome browser for LAC patient #4137 Normal tissue is shown for chr11, hg19 ( http://genome.ucsc.edu ). Zooming in twice at 100X allows for further visualization of the sequence capture oligos surrounding the TSS in a 500kb and a 5kb region showing the ATM locus. C . Averaged, normalized reads per million (y-axis) from mTSS-seq plotted as fragments (gray) and midpoints (black), centered on and surrounding 2kb of the TSS for ~22,000 open reading frames in hg19 (x-axis). DNase I-hypersensitivity (GSM736580; green) and RNA polymerase II from ChIP-seq (GSM935299; blue) data from A549 cells are shown. (D) LAC patient 4137 Normal nucleosomal midpoints (blue track) were plotted in the UCSC genome browser against the published human lymphocyte nucleosome distribution maps by Gaffney et. al. (green track) for the ZNF451 and CCDC97 loci. Sequence capture oligos and corresponding RefSeq gene models are shown for each locus. Correlations are shown for ZNF451 and CCDC87, respectively.
    Figure Legend Snippet: The newly developed mTSS-Capture method combined with paired-end sequencing maps genome-wide nucleosome distribution in primary patient samples and identifies bona fide nucleosome characteristics, concordant with other human nucleosome mapping studies A . Work-flow of the mTSS-seq method. Following MNase digestion using a titration of MNase, populations of mononucleosomally protected DNA and subnucleosomal fragments are isolated, and prepared as libraries for Illumina sequencing. Solution-based sequence capture is performed using biotinylated oligos, enabling the enrichment of fragments within 2kb of each transcription start site in the human genome. Paired-end 50bp sequencing was then performed on each index. B . Alignment of the mTSS-seq midpoints to the human genome using the UCSC genome browser for LAC patient #4137 Normal tissue is shown for chr11, hg19 ( http://genome.ucsc.edu ). Zooming in twice at 100X allows for further visualization of the sequence capture oligos surrounding the TSS in a 500kb and a 5kb region showing the ATM locus. C . Averaged, normalized reads per million (y-axis) from mTSS-seq plotted as fragments (gray) and midpoints (black), centered on and surrounding 2kb of the TSS for ~22,000 open reading frames in hg19 (x-axis). DNase I-hypersensitivity (GSM736580; green) and RNA polymerase II from ChIP-seq (GSM935299; blue) data from A549 cells are shown. (D) LAC patient 4137 Normal nucleosomal midpoints (blue track) were plotted in the UCSC genome browser against the published human lymphocyte nucleosome distribution maps by Gaffney et. al. (green track) for the ZNF451 and CCDC97 loci. Sequence capture oligos and corresponding RefSeq gene models are shown for each locus. Correlations are shown for ZNF451 and CCDC87, respectively.

    Techniques Used: Sequencing, Genome Wide, Flow Cytometry, Titration, Isolation, Chromatin Immunoprecipitation

    3) Product Images from "Long-adapter single-strand oligonucleotide probes for the massively multiplexed cloning of kilobase genome regions"

    Article Title: Long-adapter single-strand oligonucleotide probes for the massively multiplexed cloning of kilobase genome regions

    Journal: Nature biomedical engineering

    doi: 10.1038/s41551-017-0092

    Comparison of ORFeome capture using LASSO or MIP probe libraries (a) Schematic of workflow of ORFeome capture using LASSO or MIP probe libraries. A genomic database was used to guide the design of the probe library, which was synthesized as pre-LASSO or pre-MIP DNA oligonucleotides on a programmable array. The pre-probe pools were converted into the mature probe pools in pooled format. The libraries of probes were hybridized on target DNA. Closed DNA circles containing captured ORFs were selected by exonuclease digestion, and then PCR amplified using universal primers. (b) Median RPKM enrichment ratios of targeted ORFs versus non-targeted genetic elements for LASSO-242bp, LASSO-442bp and MIP captures. When comparing the enrichment ratios of LASSO probes to those of MIP probes, 100 bases on either end of the ORFs were omitted for computational purposes as described further in Methods. (c) Quantification of unique ORFs cloned and sequenced from MIP and LASSO-242bp capture transformations. (d) Positions of captured reads mapped across the length-normalized target ORFs for LASSO-242bp and MIP captures. All ORFs having size > than 1kb were included in the graphs.
    Figure Legend Snippet: Comparison of ORFeome capture using LASSO or MIP probe libraries (a) Schematic of workflow of ORFeome capture using LASSO or MIP probe libraries. A genomic database was used to guide the design of the probe library, which was synthesized as pre-LASSO or pre-MIP DNA oligonucleotides on a programmable array. The pre-probe pools were converted into the mature probe pools in pooled format. The libraries of probes were hybridized on target DNA. Closed DNA circles containing captured ORFs were selected by exonuclease digestion, and then PCR amplified using universal primers. (b) Median RPKM enrichment ratios of targeted ORFs versus non-targeted genetic elements for LASSO-242bp, LASSO-442bp and MIP captures. When comparing the enrichment ratios of LASSO probes to those of MIP probes, 100 bases on either end of the ORFs were omitted for computational purposes as described further in Methods. (c) Quantification of unique ORFs cloned and sequenced from MIP and LASSO-242bp capture transformations. (d) Positions of captured reads mapped across the length-normalized target ORFs for LASSO-242bp and MIP captures. All ORFs having size > than 1kb were included in the graphs.

    Techniques Used: Synthesized, Polymerase Chain Reaction, Amplification, Clone Assay

    4) Product Images from "Natural History of a Satellite DNA Family: From the Ancestral Genome Component to Species-Specific Sequences, Concerted and Non-Concerted Evolution"

    Article Title: Natural History of a Satellite DNA Family: From the Ancestral Genome Component to Species-Specific Sequences, Concerted and Non-Concerted Evolution

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms20051201

    RepeatExplorer (RE) analysis of next-generation sequencing (NGS) data in Chenopodium diploids. ( A ) Cluster 61 of C. ficifolium demonstrate layouts that are typical for tandem repeats where nodes represent the sequence reads and edges between the nodes correspond to similarity hits; ( B ) Self-to-self comparisons of the contig 25 cluster 61 displayed as dot plots (genomic similarity search tool YASS program output) where parallel lines indicate tandem repeats (the distance between the diagonals equals the lengths of the motifs ~40 bp); ( C ) Agarose gel electrophoresis of PCR products obtained with primers designed from consensus monomer sequence of C. ficifolium (Cluster 61) showing typical ladder structure of tandem array.
    Figure Legend Snippet: RepeatExplorer (RE) analysis of next-generation sequencing (NGS) data in Chenopodium diploids. ( A ) Cluster 61 of C. ficifolium demonstrate layouts that are typical for tandem repeats where nodes represent the sequence reads and edges between the nodes correspond to similarity hits; ( B ) Self-to-self comparisons of the contig 25 cluster 61 displayed as dot plots (genomic similarity search tool YASS program output) where parallel lines indicate tandem repeats (the distance between the diagonals equals the lengths of the motifs ~40 bp); ( C ) Agarose gel electrophoresis of PCR products obtained with primers designed from consensus monomer sequence of C. ficifolium (Cluster 61) showing typical ladder structure of tandem array.

    Techniques Used: Next-Generation Sequencing, Sequencing, Agarose Gel Electrophoresis, Polymerase Chain Reaction

    Agarose gel electrophoresis of PCR products obtained with primers designed from consensus monomer sequence of proposed high order repeat (HOR) units for determination of their physical counterparts. Cloned DNA fragments are shown by asterisks. The far-right line is an example of negative amplification of a computer-generated proposed HOR unit.
    Figure Legend Snippet: Agarose gel electrophoresis of PCR products obtained with primers designed from consensus monomer sequence of proposed high order repeat (HOR) units for determination of their physical counterparts. Cloned DNA fragments are shown by asterisks. The far-right line is an example of negative amplification of a computer-generated proposed HOR unit.

    Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Sequencing, Clone Assay, Amplification, Generated

    5) Product Images from "The landscape of transcription errors in eukaryotic cells"

    Article Title: The landscape of transcription errors in eukaryotic cells

    Journal: Science Advances

    doi: 10.1126/sciadv.1701484

    A visual representation of the circle-sequencing assay. The circle-sequencing protocol identifies transcription errors (orange circles) by fragmenting RNA (green strands) into short oligonucleotides, circularizing them, and reverse-transcribing the RNA circles in a rolling-circle reaction to generate linear cDNA molecules made up of tandem repeats of the original RNA fragment (blue strands). During this step, artificial mutations may arise in the cDNA (purple circles). The cDNA is then processed to generate a library, amplified, and sequenced, during which further artifacts may arise (teal circles). However, because these artifacts are only present in one copy of the tandem repeats, they can be distinguished from true transcription errors, which are present in all tandem repeats. bp, base pair.
    Figure Legend Snippet: A visual representation of the circle-sequencing assay. The circle-sequencing protocol identifies transcription errors (orange circles) by fragmenting RNA (green strands) into short oligonucleotides, circularizing them, and reverse-transcribing the RNA circles in a rolling-circle reaction to generate linear cDNA molecules made up of tandem repeats of the original RNA fragment (blue strands). During this step, artificial mutations may arise in the cDNA (purple circles). The cDNA is then processed to generate a library, amplified, and sequenced, during which further artifacts may arise (teal circles). However, because these artifacts are only present in one copy of the tandem repeats, they can be distinguished from true transcription errors, which are present in all tandem repeats. bp, base pair.

    Techniques Used: Sequencing, Amplification

    6) Product Images from "Technical adequacy of bisulfite sequencing and pyrosequencing for detection of mitochondrial DNA methylation: Sources and avoidance of false-positive detection"

    Article Title: Technical adequacy of bisulfite sequencing and pyrosequencing for detection of mitochondrial DNA methylation: Sources and avoidance of false-positive detection

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0192722

    Detection of bisulfite-resistant cytosines in purified, linearized human mtDNA by bisulfite pyrosequencing using converted template-selective (A9515) and unselective (hND1) sequencing primers. Ratios of brCs were determined by bisulfite pyrosequencing (Mean±SD, triplicated assays). (A) The A9515 sequencing primer, which was highly selective to bisulfite-converted DNA, interrogated three CpG sites (CpG #3–5) whereas non-selective sequencing primer hND1 interrogated all these CpG sites plus two additional CpG sites (CpG #1 and 2). (B) Positive control assay was performed using in vitro partially methylated NCAs templates. High CpG methylation levels at three CpG sites (CpG #3–5) were detected using A9515 sequencing primer (CpG sites #1 and #2 were out of the assay coverage using this sequencing primer). hND1 sequencing primer detected high CpG methylation at all five CpG sites (CpG #1–5).
    Figure Legend Snippet: Detection of bisulfite-resistant cytosines in purified, linearized human mtDNA by bisulfite pyrosequencing using converted template-selective (A9515) and unselective (hND1) sequencing primers. Ratios of brCs were determined by bisulfite pyrosequencing (Mean±SD, triplicated assays). (A) The A9515 sequencing primer, which was highly selective to bisulfite-converted DNA, interrogated three CpG sites (CpG #3–5) whereas non-selective sequencing primer hND1 interrogated all these CpG sites plus two additional CpG sites (CpG #1 and 2). (B) Positive control assay was performed using in vitro partially methylated NCAs templates. High CpG methylation levels at three CpG sites (CpG #3–5) were detected using A9515 sequencing primer (CpG sites #1 and #2 were out of the assay coverage using this sequencing primer). hND1 sequencing primer detected high CpG methylation at all five CpG sites (CpG #1–5).

    Techniques Used: Purification, Sequencing, Positive Control Assay, In Vitro, Methylation, CpG Methylation Assay

    Effects of unconverted DNA on false-positive detection of CpG methylation. Mixtures of bisulfite-converted and unconverted NCAs were subjected to bisulfite pyrosequencing using sequencing primers A9515 or hND1. Each bar represents mean±SD of three independent analyses.
    Figure Legend Snippet: Effects of unconverted DNA on false-positive detection of CpG methylation. Mixtures of bisulfite-converted and unconverted NCAs were subjected to bisulfite pyrosequencing using sequencing primers A9515 or hND1. Each bar represents mean±SD of three independent analyses.

    Techniques Used: CpG Methylation Assay, Sequencing

    7) Product Images from "Whole genome screen reveals a novel relationship between Wolbachia levels and Drosophila host translation"

    Article Title: Whole genome screen reveals a novel relationship between Wolbachia levels and Drosophila host translation

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1007445

    Visualization of infection dynamics in the JW18 cell line. (A) Schematic of Wolbachia detection by RNA Fluorescent In Situ Hybridization (FISH) using a sensitive and specific set of 48 5’-fluorescently-labeled oligos that bind in series to the 23s rRNA of the Wolbachia within a host cell. ( B) Wolbachia -infected JW18 cells labeled by 23s rRNA FISH probe can detect different infection levels in a highly specific manner. Scale bar 5μm. ( C) Wolbachia infection within the JW18 population is steadily maintained at 14% of the total cells in the population. Of the Wolbachia infected cells, the majority (73%) of cells have a low Wolbachia infection (1–10 bacteria per cell), 13.5% contain a medium Wolbachia infection (11–30 bacteria), and 13.5% of the infected JW18 cells have a high infection level ( > 30 bacteria) (n = 793 cells). See S1 – S3 Figs for further characterization of JW18 cells.
    Figure Legend Snippet: Visualization of infection dynamics in the JW18 cell line. (A) Schematic of Wolbachia detection by RNA Fluorescent In Situ Hybridization (FISH) using a sensitive and specific set of 48 5’-fluorescently-labeled oligos that bind in series to the 23s rRNA of the Wolbachia within a host cell. ( B) Wolbachia -infected JW18 cells labeled by 23s rRNA FISH probe can detect different infection levels in a highly specific manner. Scale bar 5μm. ( C) Wolbachia infection within the JW18 population is steadily maintained at 14% of the total cells in the population. Of the Wolbachia infected cells, the majority (73%) of cells have a low Wolbachia infection (1–10 bacteria per cell), 13.5% contain a medium Wolbachia infection (11–30 bacteria), and 13.5% of the infected JW18 cells have a high infection level ( > 30 bacteria) (n = 793 cells). See S1 – S3 Figs for further characterization of JW18 cells.

    Techniques Used: Infection, In Situ Hybridization, Fluorescence In Situ Hybridization, Labeling

    8) Product Images from "RNA Helicase DDX1 Converts RNA G-Quadruplex Structures into R-Loops to Promote IgH Class Switch Recombination"

    Article Title: RNA Helicase DDX1 Converts RNA G-Quadruplex Structures into R-Loops to Promote IgH Class Switch Recombination

    Journal: Molecular Cell

    doi: 10.1016/j.molcel.2018.04.001

    DDX1 Binds to G4 Structures in Intronic Switch RNAs (A) RNA oligonucleotides consisting of 4 tandem Sμ repeats (Sμ4G) or a G-to-C mutant (Sμ4Gmut). (B and C) RNA pull-down assays with protein extracts from (B) AID FLAG-HA or (C) AID KO CH12 cells, CIT stimulated for 48 hr. Western blots were analyzed for DDX1 and AID (FLAG tag) and RNA recovered from beads measured by dot blot. Representative results from at least 3 independent pull-downs. (D) Native electrophoretic mobility shift assays (EMSA) with 32 P-labeled Sμ4G and Sμ4Gmut RNA oligonucleotides and rDDX1 (WT) or rDDX1-K52A (ATPase mutant) proteins (1, 2, or 4 μg). Representative results from at least 3 independent assays. (E–H) CH12 cells were transfected with a pcDNA3 vector expressing GFP or N-terminal GFP-tagged human DDX1-K52A cDNA (GFP::DDX1-K52A), and cultured in UNS or CIT-stimulated conditions. (E) Percentage of GFP + cells 24 hr and 40 hr after transfection measured by flow cytometry (n = 4, mean ± SD). (F) Western blot of GFP + , fluorescence-activated cell sorted cells for DDX1 and Tubulin loading control (24 hr after transfection, 2 replicates). (G) Quantification of CSR in GFP – and GFP + -gated cell populations (40 hr after transfection; n = 4, mean ± SD). (H) DIP analyses with S9.6 antibody (IP) or no antibody control (–), 24 hr after transfection in CIT-stimulated conditions using Sα region probe 9. Values were normalized to probe 2 in each sample and probe 9 in shCtrl CIT cells in each experiment (n = 3, mean ± SD). See also Figure S4 .
    Figure Legend Snippet: DDX1 Binds to G4 Structures in Intronic Switch RNAs (A) RNA oligonucleotides consisting of 4 tandem Sμ repeats (Sμ4G) or a G-to-C mutant (Sμ4Gmut). (B and C) RNA pull-down assays with protein extracts from (B) AID FLAG-HA or (C) AID KO CH12 cells, CIT stimulated for 48 hr. Western blots were analyzed for DDX1 and AID (FLAG tag) and RNA recovered from beads measured by dot blot. Representative results from at least 3 independent pull-downs. (D) Native electrophoretic mobility shift assays (EMSA) with 32 P-labeled Sμ4G and Sμ4Gmut RNA oligonucleotides and rDDX1 (WT) or rDDX1-K52A (ATPase mutant) proteins (1, 2, or 4 μg). Representative results from at least 3 independent assays. (E–H) CH12 cells were transfected with a pcDNA3 vector expressing GFP or N-terminal GFP-tagged human DDX1-K52A cDNA (GFP::DDX1-K52A), and cultured in UNS or CIT-stimulated conditions. (E) Percentage of GFP + cells 24 hr and 40 hr after transfection measured by flow cytometry (n = 4, mean ± SD). (F) Western blot of GFP + , fluorescence-activated cell sorted cells for DDX1 and Tubulin loading control (24 hr after transfection, 2 replicates). (G) Quantification of CSR in GFP – and GFP + -gated cell populations (40 hr after transfection; n = 4, mean ± SD). (H) DIP analyses with S9.6 antibody (IP) or no antibody control (–), 24 hr after transfection in CIT-stimulated conditions using Sα region probe 9. Values were normalized to probe 2 in each sample and probe 9 in shCtrl CIT cells in each experiment (n = 3, mean ± SD). See also Figure S4 .

    Techniques Used: Mutagenesis, Hemagglutination Assay, Gene Knockout, Western Blot, FLAG-tag, Dot Blot, Electrophoretic Mobility Shift Assay, Labeling, Transfection, Plasmid Preparation, Expressing, Cell Culture, Flow Cytometry, Cytometry, Fluorescence

    9) Product Images from "Comprehensive Evaluation and Optimization of Amplicon Library Preparation Methods for High-Throughput Antibody Sequencing"

    Article Title: Comprehensive Evaluation and Optimization of Amplicon Library Preparation Methods for High-Throughput Antibody Sequencing

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0096727

    Overview of the different methods used for adapter addition to antibody variable heavy chain amplicon libraries. All methods required the reverse transcription of antibody mRNA into cDNA (step 1), which served as template for the following IgG gene-specific amplification by PCR. (A) The ligation method required a pre-amplified library as starting material, with a 3′ A-overhang added by the Taq DNA Polymerase (step 2). The stem-loop adapters containing a 5′ T-overhang were then attached in an enzymatic ligation reaction and cleaved in order to create a double-stranded form (step 3) that served as template for a final amplification step (step 4) in which the full-length Illumina TruSeq universal and index adapter sequences were incorporated into the library. (B) The direct addition method combined antibody library amplification and sequencing adapter addition into one PCR step (step 2) by attaching the Illumina adapter sequences 5′ of the gene-specific primers used for library preparation. (C) The primer extension method incorporated a GC-rich overhang into the library in PCR1 (step 2). This resulted in uniformly high amplification in a second PCR by using primers specific for the GC-rich overhang and containing the full-length Illumina sequencing adapters (step 3). UTR: untranslated region, L: leader sequence, V: variable region, C: constant region, RT: reverse transcription, fw: forward, rv: reverse, x: barcode/index allowing multiplexed sequencing runs.
    Figure Legend Snippet: Overview of the different methods used for adapter addition to antibody variable heavy chain amplicon libraries. All methods required the reverse transcription of antibody mRNA into cDNA (step 1), which served as template for the following IgG gene-specific amplification by PCR. (A) The ligation method required a pre-amplified library as starting material, with a 3′ A-overhang added by the Taq DNA Polymerase (step 2). The stem-loop adapters containing a 5′ T-overhang were then attached in an enzymatic ligation reaction and cleaved in order to create a double-stranded form (step 3) that served as template for a final amplification step (step 4) in which the full-length Illumina TruSeq universal and index adapter sequences were incorporated into the library. (B) The direct addition method combined antibody library amplification and sequencing adapter addition into one PCR step (step 2) by attaching the Illumina adapter sequences 5′ of the gene-specific primers used for library preparation. (C) The primer extension method incorporated a GC-rich overhang into the library in PCR1 (step 2). This resulted in uniformly high amplification in a second PCR by using primers specific for the GC-rich overhang and containing the full-length Illumina sequencing adapters (step 3). UTR: untranslated region, L: leader sequence, V: variable region, C: constant region, RT: reverse transcription, fw: forward, rv: reverse, x: barcode/index allowing multiplexed sequencing runs.

    Techniques Used: Amplification, Polymerase Chain Reaction, Ligation, Sequencing, Gas Chromatography

    10) Product Images from "Isolation and genome-wide characterization of cellular DNA:RNA triplex structures"

    Article Title: Isolation and genome-wide characterization of cellular DNA:RNA triplex structures

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gky1305

    NEAT1 forms triplexes at numerous genomic sites. ( A ) NEAT1 profiles in TriplexRNA-seq (DNA-IP) (red) and nuclear RNA (blue) from HeLa S3 and U2OS cells with shaded TFR1 and TFR2. Minus (-) and plus (+) strands are shown. The position and sequence of NEAT1-TFR1 and -TFR2 are shown below. ( B ) EMSAs using 10 or 100 pmol of synthetic NEAT1 versions comprising TFR1 (40 or 52 nt) or TFR2 incubated with 0.25 pmol of double–stranded 32 P-labeled oligonucleotides which harbor sequences of NEAT1 target genes predicted from CHART-seq ( Supplementary Table S2 ). Reactions marked with an asterisk (*) were treated with 0.5 U RNase H. As a control, RNA without a putative TFR was used. Potential Hoogsteen base pairing between motifs and respective TFR sequences are shown; mismatches are marked (*). ( C ) Schematic depiction of the TFR-based capture assay. Biotinylated RNA oligos covering NEAT1-TFR1 and NEAT1-TFR2 were used to capture genomic DNA. ( D ) MEME motif analysis identifying consensus motifs in DNA captured by NEAT1-TFR1 (399 of top 500 peaks) and by NEAT1-TFR2 (500 of top 500 peaks ranked by peak P -value). Potential Hoogsteen base pairing between motifs and respective TFR sequences are shown; mismatches are marked (*). ( E ) TDF analysis of the triplex-forming potential of NEAT1-TFR1 and NEAT1-TFR2 RNAs with top 500 TFR-associated and control DNA peaks (ranked by peak P -value) compared to 500 randomized regions ( N = 1000, colored grey). P -values were obtained from one-tailed Mann–Whitney test. ( F ) Scheme presenting antisense oligo (ASO)-based capture of NEAT1-associated DNA. ( G ) Consensus motif in NEAT1-associated DNA sites (314 of top 500 peaks ranked by peak P -value). ( H ) TDF analysis predicting the triplex-forming potential of NEAT1 on ASO-captured DNA regions. Significant TFRs along NEAT1 are shown in orange, the number of target sites (DBS) for each TFR in purple. For TFR- and ASO-based capture assays nucleic acids isolated from HeLa S3 chromatin were used.
    Figure Legend Snippet: NEAT1 forms triplexes at numerous genomic sites. ( A ) NEAT1 profiles in TriplexRNA-seq (DNA-IP) (red) and nuclear RNA (blue) from HeLa S3 and U2OS cells with shaded TFR1 and TFR2. Minus (-) and plus (+) strands are shown. The position and sequence of NEAT1-TFR1 and -TFR2 are shown below. ( B ) EMSAs using 10 or 100 pmol of synthetic NEAT1 versions comprising TFR1 (40 or 52 nt) or TFR2 incubated with 0.25 pmol of double–stranded 32 P-labeled oligonucleotides which harbor sequences of NEAT1 target genes predicted from CHART-seq ( Supplementary Table S2 ). Reactions marked with an asterisk (*) were treated with 0.5 U RNase H. As a control, RNA without a putative TFR was used. Potential Hoogsteen base pairing between motifs and respective TFR sequences are shown; mismatches are marked (*). ( C ) Schematic depiction of the TFR-based capture assay. Biotinylated RNA oligos covering NEAT1-TFR1 and NEAT1-TFR2 were used to capture genomic DNA. ( D ) MEME motif analysis identifying consensus motifs in DNA captured by NEAT1-TFR1 (399 of top 500 peaks) and by NEAT1-TFR2 (500 of top 500 peaks ranked by peak P -value). Potential Hoogsteen base pairing between motifs and respective TFR sequences are shown; mismatches are marked (*). ( E ) TDF analysis of the triplex-forming potential of NEAT1-TFR1 and NEAT1-TFR2 RNAs with top 500 TFR-associated and control DNA peaks (ranked by peak P -value) compared to 500 randomized regions ( N = 1000, colored grey). P -values were obtained from one-tailed Mann–Whitney test. ( F ) Scheme presenting antisense oligo (ASO)-based capture of NEAT1-associated DNA. ( G ) Consensus motif in NEAT1-associated DNA sites (314 of top 500 peaks ranked by peak P -value). ( H ) TDF analysis predicting the triplex-forming potential of NEAT1 on ASO-captured DNA regions. Significant TFRs along NEAT1 are shown in orange, the number of target sites (DBS) for each TFR in purple. For TFR- and ASO-based capture assays nucleic acids isolated from HeLa S3 chromatin were used.

    Techniques Used: Sequencing, Incubation, Labeling, One-tailed Test, MANN-WHITNEY, Allele-specific Oligonucleotide, Isolation

    11) Product Images from "Isolation and genome-wide characterization of cellular DNA:RNA triplex structures"

    Article Title: Isolation and genome-wide characterization of cellular DNA:RNA triplex structures

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gky1305

    NEAT1 forms triplexes at numerous genomic sites. ( A ) NEAT1 profiles in TriplexRNA-seq (DNA-IP) (red) and nuclear RNA (blue) from HeLa S3 and U2OS cells with shaded TFR1 and TFR2. Minus (-) and plus (+) strands are shown. The position and sequence of NEAT1-TFR1 and -TFR2 are shown below. ( B ) EMSAs using 10 or 100 pmol of synthetic NEAT1 versions comprising TFR1 (40 or 52 nt) or TFR2 incubated with 0.25 pmol of double–stranded 32 P-labeled oligonucleotides which harbor sequences of NEAT1 target genes predicted from CHART-seq ( Supplementary Table S2 ). Reactions marked with an asterisk (*) were treated with 0.5 U RNase H. As a control, RNA without a putative TFR was used. Potential Hoogsteen base pairing between motifs and respective TFR sequences are shown; mismatches are marked (*). ( C ) Schematic depiction of the TFR-based capture assay. Biotinylated RNA oligos covering NEAT1-TFR1 and NEAT1-TFR2 were used to capture genomic DNA. ( D ) MEME motif analysis identifying consensus motifs in DNA captured by NEAT1-TFR1 (399 of top 500 peaks) and by NEAT1-TFR2 (500 of top 500 peaks ranked by peak P -value). Potential Hoogsteen base pairing between motifs and respective TFR sequences are shown; mismatches are marked (*). ( E ) TDF analysis of the triplex-forming potential of NEAT1-TFR1 and NEAT1-TFR2 RNAs with top 500 TFR-associated and control DNA peaks (ranked by peak P -value) compared to 500 randomized regions ( N = 1000, colored grey). P -values were obtained from one-tailed Mann–Whitney test. ( F ) Scheme presenting antisense oligo (ASO)-based capture of NEAT1-associated DNA. ( G ) Consensus motif in NEAT1-associated DNA sites (314 of top 500 peaks ranked by peak P -value). ( H ) TDF analysis predicting the triplex-forming potential of NEAT1 on ASO-captured DNA regions. Significant TFRs along NEAT1 are shown in orange, the number of target sites (DBS) for each TFR in purple. For TFR- and ASO-based capture assays nucleic acids isolated from HeLa S3 chromatin were used.
    Figure Legend Snippet: NEAT1 forms triplexes at numerous genomic sites. ( A ) NEAT1 profiles in TriplexRNA-seq (DNA-IP) (red) and nuclear RNA (blue) from HeLa S3 and U2OS cells with shaded TFR1 and TFR2. Minus (-) and plus (+) strands are shown. The position and sequence of NEAT1-TFR1 and -TFR2 are shown below. ( B ) EMSAs using 10 or 100 pmol of synthetic NEAT1 versions comprising TFR1 (40 or 52 nt) or TFR2 incubated with 0.25 pmol of double–stranded 32 P-labeled oligonucleotides which harbor sequences of NEAT1 target genes predicted from CHART-seq ( Supplementary Table S2 ). Reactions marked with an asterisk (*) were treated with 0.5 U RNase H. As a control, RNA without a putative TFR was used. Potential Hoogsteen base pairing between motifs and respective TFR sequences are shown; mismatches are marked (*). ( C ) Schematic depiction of the TFR-based capture assay. Biotinylated RNA oligos covering NEAT1-TFR1 and NEAT1-TFR2 were used to capture genomic DNA. ( D ) MEME motif analysis identifying consensus motifs in DNA captured by NEAT1-TFR1 (399 of top 500 peaks) and by NEAT1-TFR2 (500 of top 500 peaks ranked by peak P -value). Potential Hoogsteen base pairing between motifs and respective TFR sequences are shown; mismatches are marked (*). ( E ) TDF analysis of the triplex-forming potential of NEAT1-TFR1 and NEAT1-TFR2 RNAs with top 500 TFR-associated and control DNA peaks (ranked by peak P -value) compared to 500 randomized regions ( N = 1000, colored grey). P -values were obtained from one-tailed Mann–Whitney test. ( F ) Scheme presenting antisense oligo (ASO)-based capture of NEAT1-associated DNA. ( G ) Consensus motif in NEAT1-associated DNA sites (314 of top 500 peaks ranked by peak P -value). ( H ) TDF analysis predicting the triplex-forming potential of NEAT1 on ASO-captured DNA regions. Significant TFRs along NEAT1 are shown in orange, the number of target sites (DBS) for each TFR in purple. For TFR- and ASO-based capture assays nucleic acids isolated from HeLa S3 chromatin were used.

    Techniques Used: Sequencing, Incubation, Labeling, One-tailed Test, MANN-WHITNEY, Allele-specific Oligonucleotide, Isolation

    Validation of triplex-forming RNA and DNAs. ( A ) TDF analysis predicting the potential of top 1000 enriched TriplexRNA (DNA-IP) regions (ranked by peak P -value) to bind to active promoters defined by ChromHMM. Number of TFRs in RNA (per kilobase of RNA, left) and the number of putative DBSs at promoters (per kilobase of RNA, right) are shown. Boxplot borders are defined by the 1st and 3rd quantiles of the distributions, the middle line corresponds to the median value. The top whisker denotes the maximum value within the third quartile plus 1.5 times the interquartile range (bottom whisker is defined analogously). Dark gray dots represent outliers with values higher or lower than whiskers. Further box plots are based on the same definitions. ( B ) Motif analysis of triplexes formed between TriplexRNA (DNA-IP) and active promoters. The diagram depicts the fraction of antiparallel and parallel triplexes with the respective motif and nucleotide composition of TFRs in TriplexRNA. ( C ) TDF analysis comparing the triplex-forming potential of top 2000 TriplexDNA-seq regions with top 1000 TriplexRNA (DNA-IP) (ranked by peak P -value). The number of putative DBSs (per kilobase of RNA) is shown. ( D ) Motif analysis of predicted triplexes formed between TriplexRNAs (DNA-IP) and TriplexDNA. The diagram depicts the fraction of antiparallel and parallel triplexes, with the respective motif and nucleotide composition of TFRs in TriplexRNA. ( E ) Box plot classifying triplex interactions between TriplexRNAs (DNA-IP) and TriplexDNA-seq regions as cis ( > 10 kb in the same chromosome) and trans (at different chromosomes) interactions, excluding underrepresented local interactions (within 10 kb distance). ( F ) EMSAs using 10 or 100 pmol of synthetic TriplexRNAs and 0.25 pmol of double–stranded 32 P-labeled oligonucleotides comprising target regions from TriplexDNA ( Supplementary Table S2 ). Reactions marked with an asterisk (*) were treated with 0.5 U RNase H. As a control (C), RNA without a putative TFR was used. Potential Hoogsteen base pairing between motifs and respective TFR sequences are shown; mismatches are marked (*). TriplexRNA-seq and TriplexDNA-seq data are from HeLa S3 cells. Adjusted P -values
    Figure Legend Snippet: Validation of triplex-forming RNA and DNAs. ( A ) TDF analysis predicting the potential of top 1000 enriched TriplexRNA (DNA-IP) regions (ranked by peak P -value) to bind to active promoters defined by ChromHMM. Number of TFRs in RNA (per kilobase of RNA, left) and the number of putative DBSs at promoters (per kilobase of RNA, right) are shown. Boxplot borders are defined by the 1st and 3rd quantiles of the distributions, the middle line corresponds to the median value. The top whisker denotes the maximum value within the third quartile plus 1.5 times the interquartile range (bottom whisker is defined analogously). Dark gray dots represent outliers with values higher or lower than whiskers. Further box plots are based on the same definitions. ( B ) Motif analysis of triplexes formed between TriplexRNA (DNA-IP) and active promoters. The diagram depicts the fraction of antiparallel and parallel triplexes with the respective motif and nucleotide composition of TFRs in TriplexRNA. ( C ) TDF analysis comparing the triplex-forming potential of top 2000 TriplexDNA-seq regions with top 1000 TriplexRNA (DNA-IP) (ranked by peak P -value). The number of putative DBSs (per kilobase of RNA) is shown. ( D ) Motif analysis of predicted triplexes formed between TriplexRNAs (DNA-IP) and TriplexDNA. The diagram depicts the fraction of antiparallel and parallel triplexes, with the respective motif and nucleotide composition of TFRs in TriplexRNA. ( E ) Box plot classifying triplex interactions between TriplexRNAs (DNA-IP) and TriplexDNA-seq regions as cis ( > 10 kb in the same chromosome) and trans (at different chromosomes) interactions, excluding underrepresented local interactions (within 10 kb distance). ( F ) EMSAs using 10 or 100 pmol of synthetic TriplexRNAs and 0.25 pmol of double–stranded 32 P-labeled oligonucleotides comprising target regions from TriplexDNA ( Supplementary Table S2 ). Reactions marked with an asterisk (*) were treated with 0.5 U RNase H. As a control (C), RNA without a putative TFR was used. Potential Hoogsteen base pairing between motifs and respective TFR sequences are shown; mismatches are marked (*). TriplexRNA-seq and TriplexDNA-seq data are from HeLa S3 cells. Adjusted P -values

    Techniques Used: Whisker Assay, Labeling

    Related Articles

    Amplification:

    Article Title: Targeted error-suppressed quantification of circulating tumor DNA using semi-degenerate barcoded adapters and biotinylated baits
    Article Snippet: Ligated cfDNA products were eluted in 25 µl of 10 mM Tris-HCl pH = 8.0 and mixed with 5 µl of indexed PCR primers at 10 µM each and 30 µl of NEBNext Ultra II Q5 Master Mix (New England BioLabs). .. The PCR protocol consisted of an initial denaturalization step at 98 °C during 30 sec followed by 8–9 cycles of 98 °C during 10 s and 65 °C during 1:30 min.

    Article Title: Monocyte-derived alveolar macrophages drive lung fibrosis and persist in the lung over the life span
    Article Snippet: RNA-seq libraries were prepared in 96-well plate format using NEBNext Poly(A) mRNA Magnetic Isolation Module, NEBNext Ultra RNA Library Prep kit for Illumina and NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) according to the standard protocol. .. The resulting double-stranded DNA was purified using 1.8× volume of SPRI beads (AMPure XP Beads; Beckman Coulter) or HighPrep PCR Beads (MagBio Genomics), eluted in 0.1× TE (Tris/EDTA) buffer, DNA ends were repaired using NEBNext End Prep Enzyme Mix (T4 PNK and T4 DNA polymerase) for 30 min at 20°C and 30 min and 65°C, followed by NEBNext adaptor for Illumina ligation using Blunt/TA Ligase master mix (T4 DNA ligase) for 15 min at 20°C and incubation with USER enzyme for 15 min at 37°C.

    Article Title: The Mutational Robustness of Influenza A Virus
    Article Snippet: Seven hundred fifty nanograms of the each amplified cDNA were sheared to an average size of 300 to 400 bp using a Covaris S220 focused ultrasonicator. .. Sequencing libraries were prepared using the NEBNext Ultra DNA library prep kit (NEB E7370L), Agencourt AMPure XP beads (Beckman Coulter A63881), and NEBNext multiplex oligonucleotides for Illumina (NEB E7600S).

    Article Title: Stochastic processes constrain the within and between host evolution of influenza virus
    Article Snippet: The thermocycler protocol was: 42 ˚C for 60 min then 94 ˚C for 2 min then 5 cycles of 94 ˚C for 30 s, 44 ˚C for 30 s, 68 ˚C for 3 min, then 28 cycles of 94 ˚C for 30 s, 57 ˚C for 30 s, 68 ˚C for 3 min. Amplification of all eight segments was confirmed by gel electrophoresis, and 750 ng of each cDNA mixture were sheared to an average size of 300 to 400 bp using a Covaris (Woburn, MA) S220 focused ultrasonicator. .. Sequencing libraries were prepared using the NEBNext Ultra DNA library prep kit (NEB E7370L), Agencourt AMPure XP beads (Beckman Coulter A63881, Indianapolis, IN), and NEBNext multiplex oligonucleotides for Illumina (NEB E7600S, Ipswich, MA).

    Article Title: Non-homologous DNA increases gene disruption efficiency by altering DNA repair outcomes
    Article Snippet: PCR amplicons were repaired, A-tailed, adapter ligated and amplified using the NEB (Ipswich, MA) Next Ultra kit (NEB E7370L). .. Dual indexing (NEB E7600S) was implemented to permit multiplex sequencing.

    Article Title: Effective Lethal Mutagenesis of Influenza Virus by Three Nucleoside Analogs
    Article Snippet: Seven hundred fifty nanograms of the each amplified cDNA was sheared to an average size of 300 to 400 bp using a Covaris S220 focused ultrasonicator. .. Sequencing libraries were prepared using the NEBNext Ultra DNA library prep kit (NEB E7370L), Agencourt AMPure XP beads (Beckman Coulter ), and NEBNext multiplex oligonucleotides for Illumina (NEB E7600S).

    Article Title: Vaccination has minimal impact on the intrahost diversity of H3N2 influenza viruses
    Article Snippet: The thermocycler protocol was: 42°C for 60 min then 94°C for 2 min then 5 cycles of 94°C for 30 sec, 44°C for 30 sec, 68°C for 3 min, then 28 cycles of 94°C for 30 sec, 57°C for 30 sec, 68°C for 3 min. Amplification of all 8 segments was confirmed by gel electrophoresis, and 750ng of each cDNA mixture were sheared to an average size of 300 to 400bp using a Covaris S220 focused ultrasonicator. .. Sequencing libraries were prepared using the NEBNext Ultra DNA library prep kit (NEB E7370L), Agencourt AMPure XP beads (Beckman Coulter A63881), and NEBNext multiplex oligonucleotides for Illumina (NEB E7600S).

    Article Title: A genetic risk factor for thrombophilia in a Han Chinese family
    Article Snippet: The captured fragments were amplified by ligation-mediated polymerase chain reaction (LM-PCR) and hybridized to the Nimblegen SeqCap EZ Library so that enriched, non-hybridized fragments were washed out ( ). .. The primers of LM-PCR and qPCR were obtained from Multiplex Oligos Kit (New England Biolabs Inc., Ipswich, MA, USA) and NEBNext Library Quant Kit (New England Biolabs Inc.), respectively.

    Mass Spectrometry:

    Article Title: Germinal Center B Cells Replace Their Antigen Receptors in Dark Zones and Fail Light Zone Entry when Immunoglobulin Gene Mutations are Damaging
    Article Snippet: The DNA was subsequently purified, end prep and adaptor ligation was performed using NEBNext® Ultra II DNA Library Prep Kit for Illumina® (New Enlgand Biolabs, E7645S) according to the manufacturer’s instructions and NEBNext® Multiplex Oligos for Illumina® (New England Biolabs, E7600S) were added according to the manufacturers instructions. .. The DNA was again purified, quantified using Qubit dsDNA HS Assay Kit (Invitrogen, Q32854).

    Construct:

    Article Title: The Resistance of Vibrio cholerae O1 El Tor Strains to the Typing Phage 919TP, a Member of K139 Phage Family
    Article Snippet: Following addition of an ‘A’ base to the 3′ end of the blunt phosphorylated DNA fragments, adapters (The NEBNext Multiplex Oligos for Illumina, E7600S, NEB) were ligated to the ends of the DNA fragments. .. Following addition of an ‘A’ base to the 3′ end of the blunt phosphorylated DNA fragments, adapters (The NEBNext Multiplex Oligos for Illumina, E7600S, NEB) were ligated to the ends of the DNA fragments.

    Article Title: Intrinsic retroviral reactivation in human preimplantation embryos and pluripotent cells
    Article Snippet: Sequencing datasets generated for this study are deposited under the GEO accession GSE63570, and summarized in . .. Libraries were constructed as described ,using ∼10 micrograms of total RNA followed by poly-A selection with oligo-dT beads, ligation and 10 cycles of PCR with NEBnext kit oligos, and sequenced using Illumina Hi-Seq2000 at the Stanford Sequencing Facility or ELIM Bio (Hayward, CA). .. For RNA-seq repeat analysis of data from embryo and hESC libraries (for , ), FASTQ files were aligned to repbase consensus sequences with bowtie using the command "bowtie -q -p 8 -S -n 2 -e 70 -l 28 --maxbts 800 -k 1 –best”.

    Article Title: Complete Sequence and Annotation of the Mycoplasma phocidae Strain 105T Genome
    Article Snippet: The DNA was extracted using an Easy-DNA genomic DNA purification kit (catalog number K180001; Thermo Fisher Scientific). .. Sequencing libraries were constructed using the NEBNext UltraTMII DNA library prep kit (catalog number E7645S; New England Biolabs) and dual-index NEBNext Multiplex Oligos (catalog number E7600S; New England Biolabs). .. Illumina MiSeq 2 × 300-bp paired-end sequencing yielded approximately 5 × 107 Phred quality-filtered reads with a quality score greater than 30.

    Real-time Polymerase Chain Reaction:

    Article Title: A genetic risk factor for thrombophilia in a Han Chinese family
    Article Snippet: Capture efficiency was evaluated by quantitative PCR (qPCR) using SYBR green setting on the real-time instrument (Roche Light Cycler 480, Indianapolis, IN, USA) ( ). .. The primers of LM-PCR and qPCR were obtained from Multiplex Oligos Kit (New England Biolabs Inc., Ipswich, MA, USA) and NEBNext Library Quant Kit (New England Biolabs Inc.), respectively. .. The conditions of LM-PCR and qPCR were provided in the and .

    Incubation:

    Article Title: Targeted error-suppressed quantification of circulating tumor DNA using semi-degenerate barcoded adapters and biotinylated baits
    Article Snippet: The ligation reaction was carried out in the presence of at least 100-fold excess of barcoded adapters during 15 min at 20 °C and then incubated overnight at 16 °C. .. Ligated cfDNA products were eluted in 25 µl of 10 mM Tris-HCl pH = 8.0 and mixed with 5 µl of indexed PCR primers at 10 µM each and 30 µl of NEBNext Ultra II Q5 Master Mix (New England BioLabs).

    Article Title: Monocyte-derived alveolar macrophages drive lung fibrosis and persist in the lung over the life span
    Article Snippet: RNA-seq libraries were prepared in 96-well plate format using NEBNext Poly(A) mRNA Magnetic Isolation Module, NEBNext Ultra RNA Library Prep kit for Illumina and NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) according to the standard protocol. .. Second-strand DNA was generated using NEBNext Second Strand Synthesis Enzyme module (DNA polymerase I, RNase H, Escherichia coli DNA ligase) for 60 min at 16°C.

    Article Title: Nucleosome repositioning underlies dynamic gene expression
    Article Snippet: Subsequently, 1 µL of 0.5 M EDTA was added, and the reaction was killed by incubation for 20 min at 75°C. .. Libraries were prepared with the NEBNext Multiplex kit with oligos for Illumina (E7335S).

    Article Title: Comparative RNA-seq analysis of transcriptome dynamics during petal development in Rosa chinensis
    Article Snippet: The library fragments were purified using the Agencourt AMPure XP system (Beckman Coulter, CA, USA) and 150–200 bp cDNA fragments were selected. .. The adaptor-ligated and size-selected cDNA was mixed with 3 μL USER Enzyme (New England Biosystems) and incubated at 37 °C for 15 min and then at 95 °C for 5 min. Multiplex PCR was performed using Phusion High-Fidelity DNA polymerase, universal PCR primers, and the NEBNext Index (X) Primer (New England Biosystems), and following these steps: 1) 98 °C for 10 s; 2) 98 °C for 10 s, 65 °C for 30 s, 72 °C for 30 s, repeats 15 cycles; 3) 72 °C for 5 min. An Agilent Bioanalyzer 2100 system (Agilent Technologies) was used to assess the library quality. .. Using a TruSeq PE Cluster Kit v3-cBot-HS (Illumina), the index-coded samples were clustered on a cBot Cluster Generation System (Illumina), according to the manufacturer’s instructions.

    Article Title: Genome editing reveals a role for OCT4 in human embryogenesis
    Article Snippet: Twelve microlitres of purification buffer was added to rehydrate the pellet and incubated for 2 min at room temperature. cDNA was eluted by pipetting up and down 10 times before returning the tube to the magnet. .. Dual indexing was performed by substituting the manufacturer’s provided indexing adaptors with NEBNext Multiplex Oligos for Illumina Dual Index primers set 1 (NEB; E7600S).

    Expressing:

    Article Title: Monocyte-derived alveolar macrophages drive lung fibrosis and persist in the lung over the life span
    Article Snippet: Paragraph title: Gene expression profiling (RNA-seq) and bioinformatic analysis ... RNA-seq libraries were prepared in 96-well plate format using NEBNext Poly(A) mRNA Magnetic Isolation Module, NEBNext Ultra RNA Library Prep kit for Illumina and NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) according to the standard protocol.

    Article Title: Gene regulatory network plasticity predates a switch in function of a conserved transcription regulator
    Article Snippet: For all ChIP experiments with endogenous or pTef1 promoters driving Ndt80 expression, samples were isolated from log-phase cultures grown in YPD and chromatin immunoprecipitation was performed as previously described ( ) using an anti-Myc monoclonal antibody (RRID: AB_2536303 ). .. Libraries were prepared using NEBNext Multiplex Kit for Illumina as previously described ( ) and sequenced on an Illumina HiSeq 4000.

    Hybridization:

    Article Title: Comparative RNA-seq analysis of transcriptome dynamics during petal development in Rosa chinensis
    Article Snippet: NEBNext Adaptors (New England Biolabs) were ligated to the cDNA libraries to prepare for hybridisation after the adenylation of 3′ ends of the cDNA fragments. .. The adaptor-ligated and size-selected cDNA was mixed with 3 μL USER Enzyme (New England Biosystems) and incubated at 37 °C for 15 min and then at 95 °C for 5 min. Multiplex PCR was performed using Phusion High-Fidelity DNA polymerase, universal PCR primers, and the NEBNext Index (X) Primer (New England Biosystems), and following these steps: 1) 98 °C for 10 s; 2) 98 °C for 10 s, 65 °C for 30 s, 72 °C for 30 s, repeats 15 cycles; 3) 72 °C for 5 min. An Agilent Bioanalyzer 2100 system (Agilent Technologies) was used to assess the library quality.

    RAST Test:

    Article Title: Complete Sequence and Annotation of the Mycoplasma phocidae Strain 105T Genome
    Article Snippet: Sequencing libraries were constructed using the NEBNext UltraTMII DNA library prep kit (catalog number E7645S; New England Biolabs) and dual-index NEBNext Multiplex Oligos (catalog number E7600S; New England Biolabs). .. Illumina MiSeq 2 × 300-bp paired-end sequencing yielded approximately 5 × 107 Phred quality-filtered reads with a quality score greater than 30.

    Ligation:

    Article Title: Hierarchical regulation of the genome: global changes in nucleosome organization potentiate genome response
    Article Snippet: Adaptors were ligated onto the end-repaired samples by adding NEB Blunt/TA Ligase Master Mix, NEBNext Adaptor for Illumina, and Ligation Enhancer and incubating at 20 degrees Celsius for 15 minutes. .. The universal and indexed sequences were added by PCR using 23 ul of adaptor-ligated DNA fragments, NEBNext High Fidelity 2X PCR Master Mix, index primers provided in NEBNext Multiplex (NEB #E7335, #E7500) Oligos for Illumina, and Universal PCR Primers provided in NEBNext Multiplex (NEB #E7335, #E7500) Oligos for Illumina.

    Article Title: Targeted error-suppressed quantification of circulating tumor DNA using semi-degenerate barcoded adapters and biotinylated baits
    Article Snippet: The ligation reaction was cleaned with 0.8x volumes (76 µl) of Agencourt AMPure® XP magnetic beads (Beckman Coulter). .. Ligated cfDNA products were eluted in 25 µl of 10 mM Tris-HCl pH = 8.0 and mixed with 5 µl of indexed PCR primers at 10 µM each and 30 µl of NEBNext Ultra II Q5 Master Mix (New England BioLabs).

    Article Title: Monocyte-derived alveolar macrophages drive lung fibrosis and persist in the lung over the life span
    Article Snippet: RNA-seq libraries were prepared in 96-well plate format using NEBNext Poly(A) mRNA Magnetic Isolation Module, NEBNext Ultra RNA Library Prep kit for Illumina and NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) according to the standard protocol. .. Second-strand DNA was generated using NEBNext Second Strand Synthesis Enzyme module (DNA polymerase I, RNase H, Escherichia coli DNA ligase) for 60 min at 16°C.

    Article Title: Intrinsic retroviral reactivation in human preimplantation embryos and pluripotent cells
    Article Snippet: Sequencing datasets generated for this study are deposited under the GEO accession GSE63570, and summarized in . .. Libraries were constructed as described ,using ∼10 micrograms of total RNA followed by poly-A selection with oligo-dT beads, ligation and 10 cycles of PCR with NEBnext kit oligos, and sequenced using Illumina Hi-Seq2000 at the Stanford Sequencing Facility or ELIM Bio (Hayward, CA). .. For RNA-seq repeat analysis of data from embryo and hESC libraries (for , ), FASTQ files were aligned to repbase consensus sequences with bowtie using the command "bowtie -q -p 8 -S -n 2 -e 70 -l 28 --maxbts 800 -k 1 –best”.

    Article Title: Comprehensive nucleosome mapping of the human genome in cancer progression
    Article Snippet: Following end prep and adaptor ligation, libraries were cleaned-up with AMPure® XP Beads (Beckman Coulter, Inc. #A63881) without size selection due to the original input of a size population of ~150bp. .. The NEBNext® Multiplex Oligos kit contains indices 1-12 which correspond to the identical product if using Illumina® TruSeq primers.

    Article Title: A genetic risk factor for thrombophilia in a Han Chinese family
    Article Snippet: The captured fragments were amplified by ligation-mediated polymerase chain reaction (LM-PCR) and hybridized to the Nimblegen SeqCap EZ Library so that enriched, non-hybridized fragments were washed out ( ). .. The primers of LM-PCR and qPCR were obtained from Multiplex Oligos Kit (New England Biolabs Inc., Ipswich, MA, USA) and NEBNext Library Quant Kit (New England Biolabs Inc.), respectively.

    Article Title: Germinal Center B Cells Replace Their Antigen Receptors in Dark Zones and Fail Light Zone Entry when Immunoglobulin Gene Mutations are Damaging
    Article Snippet: DNA was purified using Agencourt AMPure XP PCR purification beads (Beckman coulter), and the DNA products were sequentially cut with NsiI-HF and AFlIIII to produce a ∼435bp product. .. The DNA was subsequently purified, end prep and adaptor ligation was performed using NEBNext® Ultra II DNA Library Prep Kit for Illumina® (New Enlgand Biolabs, E7645S) according to the manufacturer’s instructions and NEBNext® Multiplex Oligos for Illumina® (New England Biolabs, E7600S) were added according to the manufacturers instructions. .. The DNA was again purified, quantified using Qubit dsDNA HS Assay Kit (Invitrogen, Q32854).

    Genomic Sequencing:

    Article Title: The Resistance of Vibrio cholerae O1 El Tor Strains to the Typing Phage 919TP, a Member of K139 Phage Family
    Article Snippet: The overhanging genomic sequences resulting from fragmentation were converted into blunt ends using T4 DNA polymerase, the Klenow fragment and T4 polynucleotide kinase. .. Following addition of an ‘A’ base to the 3′ end of the blunt phosphorylated DNA fragments, adapters (The NEBNext Multiplex Oligos for Illumina, E7600S, NEB) were ligated to the ends of the DNA fragments.

    Generated:

    Article Title: Monocyte-derived alveolar macrophages drive lung fibrosis and persist in the lung over the life span
    Article Snippet: RNA-seq libraries were prepared in 96-well plate format using NEBNext Poly(A) mRNA Magnetic Isolation Module, NEBNext Ultra RNA Library Prep kit for Illumina and NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) according to the standard protocol. .. 50 ng total RNA was enriched for poly(A) mRNA using NEBNext Poly(A) mRNA Magnetic Isolation Module, the mRNA was subjected to chemical fragmentation in the presence of divalent cations at 94°C for 15 min, and cDNA was generated using random primers and ProtoScript II reverse transcription in the presence of mouse RNase inhibitor using the following program: 10 min at 25°C, 15 min at 42°C, and 15 min and 70°C.

    DNA Sequencing:

    Article Title: Hierarchical regulation of the genome: global changes in nucleosome organization potentiate genome response
    Article Snippet: Using the NEBNext® Ultra™ DNA Library Prep Kit for Illumina® (NEB #E7370S/L), DNA sequencing libraries were prepared for the mononucleosomally-sized and subnucleosomal-sized fragments for each sample. .. The universal and indexed sequences were added by PCR using 23 ul of adaptor-ligated DNA fragments, NEBNext High Fidelity 2X PCR Master Mix, index primers provided in NEBNext Multiplex (NEB #E7335, #E7500) Oligos for Illumina, and Universal PCR Primers provided in NEBNext Multiplex (NEB #E7335, #E7500) Oligos for Illumina.

    Article Title: Nucleosome repositioning underlies dynamic gene expression
    Article Snippet: Paragraph title: Preparation of DNA sequencing libraries ... Libraries were prepared with the NEBNext Multiplex kit with oligos for Illumina (E7335S).

    Article Title: Comprehensive nucleosome mapping of the human genome in cancer progression
    Article Snippet: MNase digested DNA sequencing libraries were prepared using the NEBNext® Ultra™ DNA Library Prep Kit for Illumina® (NEB #E7370S/L), starting with thirty nanograms of input mononucleosomal DNA. .. The NEBNext® Multiplex Oligos kit contains indices 1-12 which correspond to the identical product if using Illumina® TruSeq primers.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Stochastic processes constrain the within and between host evolution of influenza virus
    Article Snippet: We amplified cDNA corresponding to all eight genomic segments from 5 μl of viral RNA using the SuperScript III One-Step RT-PCR Platinum Taq HiFi Kit (Invitrogen 12574). .. Sequencing libraries were prepared using the NEBNext Ultra DNA library prep kit (NEB E7370L), Agencourt AMPure XP beads (Beckman Coulter A63881, Indianapolis, IN), and NEBNext multiplex oligonucleotides for Illumina (NEB E7600S, Ipswich, MA).

    Article Title: Vaccination has minimal impact on the intrahost diversity of H3N2 influenza viruses
    Article Snippet: We amplified cDNA corresponding to all 8 genomic segments from 3μl of the viral RNA using the SuperScript III One-Step RT-PCR Platinum Taq HiFi Kit (Invitrogen 12574). .. Sequencing libraries were prepared using the NEBNext Ultra DNA library prep kit (NEB E7370L), Agencourt AMPure XP beads (Beckman Coulter A63881), and NEBNext multiplex oligonucleotides for Illumina (NEB E7600S).

    Binding Assay:

    Article Title: Complete Sequence and Annotation of the Mycoplasma phocidae Strain 105T Genome
    Article Snippet: Sequencing libraries were constructed using the NEBNext UltraTMII DNA library prep kit (catalog number E7645S; New England Biolabs) and dual-index NEBNext Multiplex Oligos (catalog number E7600S; New England Biolabs). .. Sequencing libraries were constructed using the NEBNext UltraTMII DNA library prep kit (catalog number E7645S; New England Biolabs) and dual-index NEBNext Multiplex Oligos (catalog number E7600S; New England Biolabs).

    ChIP-sequencing:

    Article Title: Gene regulatory network plasticity predates a switch in function of a conserved transcription regulator
    Article Snippet: Libraries were prepared using NEBNext Multiplex Kit for Illumina as previously described ( ) and sequenced on an Illumina HiSeq 4000. .. For ChIP of strains with pGal1 driving Ndt80 expression, strains were grown overnight in SRaffinose, diluted back and grown until log-phase in SRaffinose, then grown in SRaffinose +1.7% galactose for 5 hr.

    Multiplexing:

    Article Title: Post-transcriptional Control of Tumor Cell Autonomous Metastatic Potential by CCR4-NOT Deadenylase CNOT7
    Article Snippet: Array-based transcriptome profiling of Cnot7 -knockdown and CNOT7-overexpressing 4T1 tumor cells was performed on Affymetrix GeneChip Mouse Gene 1.0 ST arrays by the Microarray Core in the NCI Laboratory of Molecular Technology. .. Library preparation was performed using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina with NEBNext multiplexing oligos using manufacturer’s protocol. .. RNA sequencing was conducted on the Illumina HiSeq 2500.

    Nucleic Acid Electrophoresis:

    Article Title: The Resistance of Vibrio cholerae O1 El Tor Strains to the Typing Phage 919TP, a Member of K139 Phage Family
    Article Snippet: After the DNA sample was extracted, the sample quality was analyzed by gel electrophoresis. .. Following addition of an ‘A’ base to the 3′ end of the blunt phosphorylated DNA fragments, adapters (The NEBNext Multiplex Oligos for Illumina, E7600S, NEB) were ligated to the ends of the DNA fragments.

    Article Title: Stochastic processes constrain the within and between host evolution of influenza virus
    Article Snippet: The thermocycler protocol was: 42 ˚C for 60 min then 94 ˚C for 2 min then 5 cycles of 94 ˚C for 30 s, 44 ˚C for 30 s, 68 ˚C for 3 min, then 28 cycles of 94 ˚C for 30 s, 57 ˚C for 30 s, 68 ˚C for 3 min. Amplification of all eight segments was confirmed by gel electrophoresis, and 750 ng of each cDNA mixture were sheared to an average size of 300 to 400 bp using a Covaris (Woburn, MA) S220 focused ultrasonicator. .. Sequencing libraries were prepared using the NEBNext Ultra DNA library prep kit (NEB E7370L), Agencourt AMPure XP beads (Beckman Coulter A63881, Indianapolis, IN), and NEBNext multiplex oligonucleotides for Illumina (NEB E7600S, Ipswich, MA).

    Article Title: Vaccination has minimal impact on the intrahost diversity of H3N2 influenza viruses
    Article Snippet: The thermocycler protocol was: 42°C for 60 min then 94°C for 2 min then 5 cycles of 94°C for 30 sec, 44°C for 30 sec, 68°C for 3 min, then 28 cycles of 94°C for 30 sec, 57°C for 30 sec, 68°C for 3 min. Amplification of all 8 segments was confirmed by gel electrophoresis, and 750ng of each cDNA mixture were sheared to an average size of 300 to 400bp using a Covaris S220 focused ultrasonicator. .. Sequencing libraries were prepared using the NEBNext Ultra DNA library prep kit (NEB E7370L), Agencourt AMPure XP beads (Beckman Coulter A63881), and NEBNext multiplex oligonucleotides for Illumina (NEB E7600S).

    RNA Sequencing Assay:

    Article Title: Monocyte-derived alveolar macrophages drive lung fibrosis and persist in the lung over the life span
    Article Snippet: RNA quality and quantity were assessed using Bioanalyzer 2100 or TapeStation 4200 instruments (Agilent Technologies). .. RNA-seq libraries were prepared in 96-well plate format using NEBNext Poly(A) mRNA Magnetic Isolation Module, NEBNext Ultra RNA Library Prep kit for Illumina and NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) according to the standard protocol. .. 50 ng total RNA was enriched for poly(A) mRNA using NEBNext Poly(A) mRNA Magnetic Isolation Module, the mRNA was subjected to chemical fragmentation in the presence of divalent cations at 94°C for 15 min, and cDNA was generated using random primers and ProtoScript II reverse transcription in the presence of mouse RNase inhibitor using the following program: 10 min at 25°C, 15 min at 42°C, and 15 min and 70°C.

    Article Title: Intrinsic retroviral reactivation in human preimplantation embryos and pluripotent cells
    Article Snippet: Paragraph title: RNA-seq library construction ... Libraries were constructed as described ,using ∼10 micrograms of total RNA followed by poly-A selection with oligo-dT beads, ligation and 10 cycles of PCR with NEBnext kit oligos, and sequenced using Illumina Hi-Seq2000 at the Stanford Sequencing Facility or ELIM Bio (Hayward, CA).

    Article Title: Profiling the macrofilaricidal effects of flubendazole on adult female Brugia malayi using RNAseq
    Article Snippet: Paragraph title: cDNA library preparation and RNA sequencing ... The enriched mRNA served as template for cDNA library preparation with the NEBNext® Ultra RNA Library Prep Kit Illumina (NEB, E7530) and NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) (NEB, E7600) following the manufacturer's instructions.

    Article Title: Post-transcriptional Control of Tumor Cell Autonomous Metastatic Potential by CCR4-NOT Deadenylase CNOT7
    Article Snippet: Paragraph title: Library preparation and RNA sequencing ... Library preparation was performed using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina with NEBNext multiplexing oligos using manufacturer’s protocol.

    Article Title: Comparative RNA-seq analysis of transcriptome dynamics during petal development in Rosa chinensis
    Article Snippet: Paragraph title: RNA preparation, cDNA library construction, and RNA-seq ... The adaptor-ligated and size-selected cDNA was mixed with 3 μL USER Enzyme (New England Biosystems) and incubated at 37 °C for 15 min and then at 95 °C for 5 min. Multiplex PCR was performed using Phusion High-Fidelity DNA polymerase, universal PCR primers, and the NEBNext Index (X) Primer (New England Biosystems), and following these steps: 1) 98 °C for 10 s; 2) 98 °C for 10 s, 65 °C for 30 s, 72 °C for 30 s, repeats 15 cycles; 3) 72 °C for 5 min. An Agilent Bioanalyzer 2100 system (Agilent Technologies) was used to assess the library quality.

    Magnetic Beads:

    Article Title: Targeted error-suppressed quantification of circulating tumor DNA using semi-degenerate barcoded adapters and biotinylated baits
    Article Snippet: The ligation reaction was cleaned with 0.8x volumes (76 µl) of Agencourt AMPure® XP magnetic beads (Beckman Coulter). .. Ligated cfDNA products were eluted in 25 µl of 10 mM Tris-HCl pH = 8.0 and mixed with 5 µl of indexed PCR primers at 10 µM each and 30 µl of NEBNext Ultra II Q5 Master Mix (New England BioLabs).

    Article Title: Comparative RNA-seq analysis of transcriptome dynamics during petal development in Rosa chinensis
    Article Snippet: Poly-T oligo-attached magnetic beads were used to isolate mRNA from the total RNA. .. The adaptor-ligated and size-selected cDNA was mixed with 3 μL USER Enzyme (New England Biosystems) and incubated at 37 °C for 15 min and then at 95 °C for 5 min. Multiplex PCR was performed using Phusion High-Fidelity DNA polymerase, universal PCR primers, and the NEBNext Index (X) Primer (New England Biosystems), and following these steps: 1) 98 °C for 10 s; 2) 98 °C for 10 s, 65 °C for 30 s, 72 °C for 30 s, repeats 15 cycles; 3) 72 °C for 5 min. An Agilent Bioanalyzer 2100 system (Agilent Technologies) was used to assess the library quality.

    Isolation:

    Article Title: Monocyte-derived alveolar macrophages drive lung fibrosis and persist in the lung over the life span
    Article Snippet: RNA quality and quantity were assessed using Bioanalyzer 2100 or TapeStation 4200 instruments (Agilent Technologies). .. RNA-seq libraries were prepared in 96-well plate format using NEBNext Poly(A) mRNA Magnetic Isolation Module, NEBNext Ultra RNA Library Prep kit for Illumina and NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) according to the standard protocol. .. 50 ng total RNA was enriched for poly(A) mRNA using NEBNext Poly(A) mRNA Magnetic Isolation Module, the mRNA was subjected to chemical fragmentation in the presence of divalent cations at 94°C for 15 min, and cDNA was generated using random primers and ProtoScript II reverse transcription in the presence of mouse RNase inhibitor using the following program: 10 min at 25°C, 15 min at 42°C, and 15 min and 70°C.

    Article Title: Stochastic processes constrain the within and between host evolution of influenza virus
    Article Snippet: Sequencing libraries were prepared using the NEBNext Ultra DNA library prep kit (NEB E7370L), Agencourt AMPure XP beads (Beckman Coulter A63881, Indianapolis, IN), and NEBNext multiplex oligonucleotides for Illumina (NEB E7600S, Ipswich, MA). .. The final concentration of each barcoded library was determined by Quanti PicoGreen dsDNA quantification (ThermoFisher Scientific, Waltham, MA), and equal nanomolar concentrations were pooled.

    Article Title: Complete Sequence and Annotation of the Mycoplasma phocidae Strain 105T Genome
    Article Snippet: Mycoplasma phocidae strain 105T was first isolated from the lungs of one of more than 400 harbor seals ( Phoca vitulina ) that died along the U.S. New England coastline during a mass mortality event in 1980. .. Sequencing libraries were constructed using the NEBNext UltraTMII DNA library prep kit (catalog number E7645S; New England Biolabs) and dual-index NEBNext Multiplex Oligos (catalog number E7600S; New England Biolabs).

    Article Title: Profiling the macrofilaricidal effects of flubendazole on adult female Brugia malayi using RNAseq
    Article Snippet: 2.4 RNA concentration and purity were measured using the Qubit RNA BR Assay Kit (Life Technologies, Q10210, Burlington, ON) on an Agilent 2100 Bioanalyzer (Santa Clara, CA). mRNA was obtained by Poly (A) magnetic isolation (NEBNext Poly (A) mRNA Magnetic Isolation Module, NEB, Ipswich, MA). .. The enriched mRNA served as template for cDNA library preparation with the NEBNext® Ultra RNA Library Prep Kit Illumina (NEB, E7530) and NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) (NEB, E7600) following the manufacturer's instructions.

    Article Title: Gene regulatory network plasticity predates a switch in function of a conserved transcription regulator
    Article Snippet: For all ChIP experiments with endogenous or pTef1 promoters driving Ndt80 expression, samples were isolated from log-phase cultures grown in YPD and chromatin immunoprecipitation was performed as previously described ( ) using an anti-Myc monoclonal antibody (RRID: AB_2536303 ). .. Libraries were prepared using NEBNext Multiplex Kit for Illumina as previously described ( ) and sequenced on an Illumina HiSeq 4000.

    Article Title: Vaccination has minimal impact on the intrahost diversity of H3N2 influenza viruses
    Article Snippet: Sequencing libraries were prepared using the NEBNext Ultra DNA library prep kit (NEB E7370L), Agencourt AMPure XP beads (Beckman Coulter A63881), and NEBNext multiplex oligonucleotides for Illumina (NEB E7600S). .. The final concentration of each barcoded library was determined by Quanti PicoGreen dsDNA quantification (ThermoFisher Scientific), and equal nanomolar concentrations were pooled.

    Sequencing:

    Article Title: The Resistance of Vibrio cholerae O1 El Tor Strains to the Typing Phage 919TP, a Member of K139 Phage Family
    Article Snippet: Paragraph title: Genome Sequencing of 919TP from Phage Particles and of Its Host Strain V. cholerae 919T ... Following addition of an ‘A’ base to the 3′ end of the blunt phosphorylated DNA fragments, adapters (The NEBNext Multiplex Oligos for Illumina, E7600S, NEB) were ligated to the ends of the DNA fragments.

    Article Title: Intrinsic retroviral reactivation in human preimplantation embryos and pluripotent cells
    Article Snippet: Sequencing datasets generated for this study are deposited under the GEO accession GSE63570, and summarized in . .. Libraries were constructed as described ,using ∼10 micrograms of total RNA followed by poly-A selection with oligo-dT beads, ligation and 10 cycles of PCR with NEBnext kit oligos, and sequenced using Illumina Hi-Seq2000 at the Stanford Sequencing Facility or ELIM Bio (Hayward, CA). .. For RNA-seq repeat analysis of data from embryo and hESC libraries (for , ), FASTQ files were aligned to repbase consensus sequences with bowtie using the command "bowtie -q -p 8 -S -n 2 -e 70 -l 28 --maxbts 800 -k 1 –best”.

    Article Title: The Mutational Robustness of Influenza A Virus
    Article Snippet: Seven hundred fifty nanograms of the each amplified cDNA were sheared to an average size of 300 to 400 bp using a Covaris S220 focused ultrasonicator. .. Sequencing libraries were prepared using the NEBNext Ultra DNA library prep kit (NEB E7370L), Agencourt AMPure XP beads (Beckman Coulter A63881), and NEBNext multiplex oligonucleotides for Illumina (NEB E7600S). .. Indexed samples were pooled in equal quantities and sequenced on an Illumina MiSeq instrument with 2 x 250-base paired end reads.

    Article Title: Stochastic processes constrain the within and between host evolution of influenza virus
    Article Snippet: The thermocycler protocol was: 42 ˚C for 60 min then 94 ˚C for 2 min then 5 cycles of 94 ˚C for 30 s, 44 ˚C for 30 s, 68 ˚C for 3 min, then 28 cycles of 94 ˚C for 30 s, 57 ˚C for 30 s, 68 ˚C for 3 min. Amplification of all eight segments was confirmed by gel electrophoresis, and 750 ng of each cDNA mixture were sheared to an average size of 300 to 400 bp using a Covaris (Woburn, MA) S220 focused ultrasonicator. .. Sequencing libraries were prepared using the NEBNext Ultra DNA library prep kit (NEB E7370L), Agencourt AMPure XP beads (Beckman Coulter A63881, Indianapolis, IN), and NEBNext multiplex oligonucleotides for Illumina (NEB E7600S, Ipswich, MA). .. The final concentration of each barcoded library was determined by Quanti PicoGreen dsDNA quantification (ThermoFisher Scientific, Waltham, MA), and equal nanomolar concentrations were pooled.

    Article Title: Complete Sequence and Annotation of the Mycoplasma phocidae Strain 105T Genome
    Article Snippet: The DNA was extracted using an Easy-DNA genomic DNA purification kit (catalog number K180001; Thermo Fisher Scientific). .. Sequencing libraries were constructed using the NEBNext UltraTMII DNA library prep kit (catalog number E7645S; New England Biolabs) and dual-index NEBNext Multiplex Oligos (catalog number E7600S; New England Biolabs). .. Illumina MiSeq 2 × 300-bp paired-end sequencing yielded approximately 5 × 107 Phred quality-filtered reads with a quality score greater than 30.

    Article Title: Non-homologous DNA increases gene disruption efficiency by altering DNA repair outcomes
    Article Snippet: PCR amplicons were repaired, A-tailed, adapter ligated and amplified using the NEB (Ipswich, MA) Next Ultra kit (NEB E7370L). .. Dual indexing (NEB E7600S) was implemented to permit multiplex sequencing. .. All samples were pooled in equimolar amounts and sequenced on an Illumina (San Diego, CA) MiSeq using the MiSeq Reagent Kit v3 (2 × 300).

    Article Title: Effective Lethal Mutagenesis of Influenza Virus by Three Nucleoside Analogs
    Article Snippet: Seven hundred fifty nanograms of the each amplified cDNA was sheared to an average size of 300 to 400 bp using a Covaris S220 focused ultrasonicator. .. Sequencing libraries were prepared using the NEBNext Ultra DNA library prep kit (NEB E7370L), Agencourt AMPure XP beads (Beckman Coulter ), and NEBNext multiplex oligonucleotides for Illumina (NEB E7600S). .. Indexed samples were pooled in equal volumes and sequenced on an Illumina MiSeq instrument with 2 × 250-base paired end reads.

    Article Title: Comparative RNA-seq analysis of transcriptome dynamics during petal development in Rosa chinensis
    Article Snippet: The adaptor-ligated and size-selected cDNA was mixed with 3 μL USER Enzyme (New England Biosystems) and incubated at 37 °C for 15 min and then at 95 °C for 5 min. Multiplex PCR was performed using Phusion High-Fidelity DNA polymerase, universal PCR primers, and the NEBNext Index (X) Primer (New England Biosystems), and following these steps: 1) 98 °C for 10 s; 2) 98 °C for 10 s, 65 °C for 30 s, 72 °C for 30 s, repeats 15 cycles; 3) 72 °C for 5 min. An Agilent Bioanalyzer 2100 system (Agilent Technologies) was used to assess the library quality. .. The adaptor-ligated and size-selected cDNA was mixed with 3 μL USER Enzyme (New England Biosystems) and incubated at 37 °C for 15 min and then at 95 °C for 5 min. Multiplex PCR was performed using Phusion High-Fidelity DNA polymerase, universal PCR primers, and the NEBNext Index (X) Primer (New England Biosystems), and following these steps: 1) 98 °C for 10 s; 2) 98 °C for 10 s, 65 °C for 30 s, 72 °C for 30 s, repeats 15 cycles; 3) 72 °C for 5 min. An Agilent Bioanalyzer 2100 system (Agilent Technologies) was used to assess the library quality.

    Article Title: Gene regulatory network plasticity predates a switch in function of a conserved transcription regulator
    Article Snippet: Paragraph title: Chromatin immunoprecipitation and high-throughput sequencing ... Libraries were prepared using NEBNext Multiplex Kit for Illumina as previously described ( ) and sequenced on an Illumina HiSeq 4000.

    Article Title: Vaccination has minimal impact on the intrahost diversity of H3N2 influenza viruses
    Article Snippet: The thermocycler protocol was: 42°C for 60 min then 94°C for 2 min then 5 cycles of 94°C for 30 sec, 44°C for 30 sec, 68°C for 3 min, then 28 cycles of 94°C for 30 sec, 57°C for 30 sec, 68°C for 3 min. Amplification of all 8 segments was confirmed by gel electrophoresis, and 750ng of each cDNA mixture were sheared to an average size of 300 to 400bp using a Covaris S220 focused ultrasonicator. .. Sequencing libraries were prepared using the NEBNext Ultra DNA library prep kit (NEB E7370L), Agencourt AMPure XP beads (Beckman Coulter A63881), and NEBNext multiplex oligonucleotides for Illumina (NEB E7600S). .. The final concentration of each barcoded library was determined by Quanti PicoGreen dsDNA quantification (ThermoFisher Scientific), and equal nanomolar concentrations were pooled.

    Article Title: A genetic risk factor for thrombophilia in a Han Chinese family
    Article Snippet: Paragraph title: Whole exome sequencing ... The primers of LM-PCR and qPCR were obtained from Multiplex Oligos Kit (New England Biolabs Inc., Ipswich, MA, USA) and NEBNext Library Quant Kit (New England Biolabs Inc.), respectively.

    Article Title: Germinal Center B Cells Replace Their Antigen Receptors in Dark Zones and Fail Light Zone Entry when Immunoglobulin Gene Mutations are Damaging
    Article Snippet: Paragraph title: Library preparation and analysis for Ighv NGS sequencing ... The DNA was subsequently purified, end prep and adaptor ligation was performed using NEBNext® Ultra II DNA Library Prep Kit for Illumina® (New Enlgand Biolabs, E7645S) according to the manufacturer’s instructions and NEBNext® Multiplex Oligos for Illumina® (New England Biolabs, E7600S) were added according to the manufacturers instructions.

    Size-exclusion Chromatography:

    Article Title: Targeted error-suppressed quantification of circulating tumor DNA using semi-degenerate barcoded adapters and biotinylated baits
    Article Snippet: Ligated cfDNA products were eluted in 25 µl of 10 mM Tris-HCl pH = 8.0 and mixed with 5 µl of indexed PCR primers at 10 µM each and 30 µl of NEBNext Ultra II Q5 Master Mix (New England BioLabs). .. Ligated cfDNA products were eluted in 25 µl of 10 mM Tris-HCl pH = 8.0 and mixed with 5 µl of indexed PCR primers at 10 µM each and 30 µl of NEBNext Ultra II Q5 Master Mix (New England BioLabs).

    Article Title: Vaccination has minimal impact on the intrahost diversity of H3N2 influenza viruses
    Article Snippet: The thermocycler protocol was: 42°C for 60 min then 94°C for 2 min then 5 cycles of 94°C for 30 sec, 44°C for 30 sec, 68°C for 3 min, then 28 cycles of 94°C for 30 sec, 57°C for 30 sec, 68°C for 3 min. Amplification of all 8 segments was confirmed by gel electrophoresis, and 750ng of each cDNA mixture were sheared to an average size of 300 to 400bp using a Covaris S220 focused ultrasonicator. .. Sequencing libraries were prepared using the NEBNext Ultra DNA library prep kit (NEB E7370L), Agencourt AMPure XP beads (Beckman Coulter A63881), and NEBNext multiplex oligonucleotides for Illumina (NEB E7600S).

    Purification:

    Article Title: The Resistance of Vibrio cholerae O1 El Tor Strains to the Typing Phage 919TP, a Member of K139 Phage Family
    Article Snippet: The DNA sample was then used to construct a library following shearing of the purified DNA into smaller fragments of the desired size using a Covaris S/E210 focused-ultrasonicator. .. Following addition of an ‘A’ base to the 3′ end of the blunt phosphorylated DNA fragments, adapters (The NEBNext Multiplex Oligos for Illumina, E7600S, NEB) were ligated to the ends of the DNA fragments.

    Article Title: Monocyte-derived alveolar macrophages drive lung fibrosis and persist in the lung over the life span
    Article Snippet: RNA-seq libraries were prepared in 96-well plate format using NEBNext Poly(A) mRNA Magnetic Isolation Module, NEBNext Ultra RNA Library Prep kit for Illumina and NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) according to the standard protocol. .. RNA-seq libraries were prepared in 96-well plate format using NEBNext Poly(A) mRNA Magnetic Isolation Module, NEBNext Ultra RNA Library Prep kit for Illumina and NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) according to the standard protocol.

    Article Title: Stochastic processes constrain the within and between host evolution of influenza virus
    Article Snippet: Sequencing libraries were prepared using the NEBNext Ultra DNA library prep kit (NEB E7370L), Agencourt AMPure XP beads (Beckman Coulter A63881, Indianapolis, IN), and NEBNext multiplex oligonucleotides for Illumina (NEB E7600S, Ipswich, MA). .. Sequencing libraries were prepared using the NEBNext Ultra DNA library prep kit (NEB E7370L), Agencourt AMPure XP beads (Beckman Coulter A63881, Indianapolis, IN), and NEBNext multiplex oligonucleotides for Illumina (NEB E7600S, Ipswich, MA).

    Article Title: Comparative RNA-seq analysis of transcriptome dynamics during petal development in Rosa chinensis
    Article Snippet: The library fragments were purified using the Agencourt AMPure XP system (Beckman Coulter, CA, USA) and 150–200 bp cDNA fragments were selected. .. The adaptor-ligated and size-selected cDNA was mixed with 3 μL USER Enzyme (New England Biosystems) and incubated at 37 °C for 15 min and then at 95 °C for 5 min. Multiplex PCR was performed using Phusion High-Fidelity DNA polymerase, universal PCR primers, and the NEBNext Index (X) Primer (New England Biosystems), and following these steps: 1) 98 °C for 10 s; 2) 98 °C for 10 s, 65 °C for 30 s, 72 °C for 30 s, repeats 15 cycles; 3) 72 °C for 5 min. An Agilent Bioanalyzer 2100 system (Agilent Technologies) was used to assess the library quality.

    Article Title: Vaccination has minimal impact on the intrahost diversity of H3N2 influenza viruses
    Article Snippet: Sequencing libraries were prepared using the NEBNext Ultra DNA library prep kit (NEB E7370L), Agencourt AMPure XP beads (Beckman Coulter A63881), and NEBNext multiplex oligonucleotides for Illumina (NEB E7600S). .. Sequencing libraries were prepared using the NEBNext Ultra DNA library prep kit (NEB E7370L), Agencourt AMPure XP beads (Beckman Coulter A63881), and NEBNext multiplex oligonucleotides for Illumina (NEB E7600S).

    Article Title: Genome editing reveals a role for OCT4 in human embryogenesis
    Article Snippet: Ten microlitres of cDNA sample and 32 μl purification buffer was added to a Covaris AFA Fibre Pre-Slit Snap Cap microTUBE. cDNA was sheared using the following settings: Peak Incident power 175 W, Duty Factor 10%, 200 cycles per burst, water level 5. .. Dual indexing was performed by substituting the manufacturer’s provided indexing adaptors with NEBNext Multiplex Oligos for Illumina Dual Index primers set 1 (NEB; E7600S).

    Article Title: Germinal Center B Cells Replace Their Antigen Receptors in Dark Zones and Fail Light Zone Entry when Immunoglobulin Gene Mutations are Damaging
    Article Snippet: DNA was purified using Agencourt AMPure XP PCR purification beads (Beckman coulter), and the DNA products were sequentially cut with NsiI-HF and AFlIIII to produce a ∼435bp product. .. The DNA was subsequently purified, end prep and adaptor ligation was performed using NEBNext® Ultra II DNA Library Prep Kit for Illumina® (New Enlgand Biolabs, E7645S) according to the manufacturer’s instructions and NEBNext® Multiplex Oligos for Illumina® (New England Biolabs, E7600S) were added according to the manufacturers instructions. .. The DNA was again purified, quantified using Qubit dsDNA HS Assay Kit (Invitrogen, Q32854).

    Polymerase Chain Reaction:

    Article Title: Hierarchical regulation of the genome: global changes in nucleosome organization potentiate genome response
    Article Snippet: The adaptor-ligated DNA was cleaned up using AMPure XP beads to remove any unwanted ligated products. .. The universal and indexed sequences were added by PCR using 23 ul of adaptor-ligated DNA fragments, NEBNext High Fidelity 2X PCR Master Mix, index primers provided in NEBNext Multiplex (NEB #E7335, #E7500) Oligos for Illumina, and Universal PCR Primers provided in NEBNext Multiplex (NEB #E7335, #E7500) Oligos for Illumina. .. Then PCR was done for 8 cycles (not including the initial denaturation and final extension).

    Article Title: Targeted error-suppressed quantification of circulating tumor DNA using semi-degenerate barcoded adapters and biotinylated baits
    Article Snippet: This strategy has been suggested to improve the removal of adapter dimers . .. Ligated cfDNA products were eluted in 25 µl of 10 mM Tris-HCl pH = 8.0 and mixed with 5 µl of indexed PCR primers at 10 µM each and 30 µl of NEBNext Ultra II Q5 Master Mix (New England BioLabs). .. The sequences of our PCR primers, suitable for dual-indexing in Illumina platforms, are: 5′-CAAGCAGAAGACGGCATACGAGAT NNNNNN GTGACTGGAGTT3′ and 5′-AATGATACGGCGACCACCGAGATCTACAC NNNNNN ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3′.

    Article Title: The Resistance of Vibrio cholerae O1 El Tor Strains to the Typing Phage 919TP, a Member of K139 Phage Family
    Article Snippet: Following addition of an ‘A’ base to the 3′ end of the blunt phosphorylated DNA fragments, adapters (The NEBNext Multiplex Oligos for Illumina, E7600S, NEB) were ligated to the ends of the DNA fragments. .. Following addition of an ‘A’ base to the 3′ end of the blunt phosphorylated DNA fragments, adapters (The NEBNext Multiplex Oligos for Illumina, E7600S, NEB) were ligated to the ends of the DNA fragments.

    Article Title: Monocyte-derived alveolar macrophages drive lung fibrosis and persist in the lung over the life span
    Article Snippet: RNA-seq libraries were prepared in 96-well plate format using NEBNext Poly(A) mRNA Magnetic Isolation Module, NEBNext Ultra RNA Library Prep kit for Illumina and NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) according to the standard protocol. .. RNA-seq libraries were prepared in 96-well plate format using NEBNext Poly(A) mRNA Magnetic Isolation Module, NEBNext Ultra RNA Library Prep kit for Illumina and NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) according to the standard protocol.

    Article Title: Intrinsic retroviral reactivation in human preimplantation embryos and pluripotent cells
    Article Snippet: Sequencing datasets generated for this study are deposited under the GEO accession GSE63570, and summarized in . .. Libraries were constructed as described ,using ∼10 micrograms of total RNA followed by poly-A selection with oligo-dT beads, ligation and 10 cycles of PCR with NEBnext kit oligos, and sequenced using Illumina Hi-Seq2000 at the Stanford Sequencing Facility or ELIM Bio (Hayward, CA). .. For RNA-seq repeat analysis of data from embryo and hESC libraries (for , ), FASTQ files were aligned to repbase consensus sequences with bowtie using the command "bowtie -q -p 8 -S -n 2 -e 70 -l 28 --maxbts 800 -k 1 –best”.

    Article Title: Non-homologous DNA increases gene disruption efficiency by altering DNA repair outcomes
    Article Snippet: PCR amplicons were repaired, A-tailed, adapter ligated and amplified using the NEB (Ipswich, MA) Next Ultra kit (NEB E7370L). .. Dual indexing (NEB E7600S) was implemented to permit multiplex sequencing.

    Article Title: Comparative RNA-seq analysis of transcriptome dynamics during petal development in Rosa chinensis
    Article Snippet: The library fragments were purified using the Agencourt AMPure XP system (Beckman Coulter, CA, USA) and 150–200 bp cDNA fragments were selected. .. The adaptor-ligated and size-selected cDNA was mixed with 3 μL USER Enzyme (New England Biosystems) and incubated at 37 °C for 15 min and then at 95 °C for 5 min. Multiplex PCR was performed using Phusion High-Fidelity DNA polymerase, universal PCR primers, and the NEBNext Index (X) Primer (New England Biosystems), and following these steps: 1) 98 °C for 10 s; 2) 98 °C for 10 s, 65 °C for 30 s, 72 °C for 30 s, repeats 15 cycles; 3) 72 °C for 5 min. An Agilent Bioanalyzer 2100 system (Agilent Technologies) was used to assess the library quality. .. Using a TruSeq PE Cluster Kit v3-cBot-HS (Illumina), the index-coded samples were clustered on a cBot Cluster Generation System (Illumina), according to the manufacturer’s instructions.

    Article Title: Comprehensive nucleosome mapping of the human genome in cancer progression
    Article Snippet: Universal and indexed sequences were added through 8 cycles of PCR, using NEBNext® Multiplex Oligos for Illumina® (Index Primers Set 1, NEB #E7335S/L). .. The NEBNext® Multiplex Oligos kit contains indices 1-12 which correspond to the identical product if using Illumina® TruSeq primers.

    Article Title: A genetic risk factor for thrombophilia in a Han Chinese family
    Article Snippet: The captured fragments were amplified by ligation-mediated polymerase chain reaction (LM-PCR) and hybridized to the Nimblegen SeqCap EZ Library so that enriched, non-hybridized fragments were washed out ( ). .. The primers of LM-PCR and qPCR were obtained from Multiplex Oligos Kit (New England Biolabs Inc., Ipswich, MA, USA) and NEBNext Library Quant Kit (New England Biolabs Inc.), respectively.

    Article Title: Germinal Center B Cells Replace Their Antigen Receptors in Dark Zones and Fail Light Zone Entry when Immunoglobulin Gene Mutations are Damaging
    Article Snippet: DNA was purified using Agencourt AMPure XP PCR purification beads (Beckman coulter), and the DNA products were sequentially cut with NsiI-HF and AFlIIII to produce a ∼435bp product. .. The DNA was subsequently purified, end prep and adaptor ligation was performed using NEBNext® Ultra II DNA Library Prep Kit for Illumina® (New Enlgand Biolabs, E7645S) according to the manufacturer’s instructions and NEBNext® Multiplex Oligos for Illumina® (New England Biolabs, E7600S) were added according to the manufacturers instructions.

    cDNA Library Assay:

    Article Title: Profiling the macrofilaricidal effects of flubendazole on adult female Brugia malayi using RNAseq
    Article Snippet: 2.4 RNA concentration and purity were measured using the Qubit RNA BR Assay Kit (Life Technologies, Q10210, Burlington, ON) on an Agilent 2100 Bioanalyzer (Santa Clara, CA). mRNA was obtained by Poly (A) magnetic isolation (NEBNext Poly (A) mRNA Magnetic Isolation Module, NEB, Ipswich, MA). .. The enriched mRNA served as template for cDNA library preparation with the NEBNext® Ultra RNA Library Prep Kit Illumina (NEB, E7530) and NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) (NEB, E7600) following the manufacturer's instructions. .. Assessment of quality, DNA concentration and product size of the cDNA was performed for each library using a Qubit® 2.0 Fluorometer (Life Technologies, Q32866), Qubit® dsDNA BR assay kit (Life Technologies, Q32850), High Sensitivity DNA Analysis Kit (Agilent, 5067-4626) and Agilent 2100 Bioanalyzer. cDNA libraries were sequenced on an Illumina MiSeq Platform employing a 150 base pair paired-end NGS setting.

    Article Title: Comparative RNA-seq analysis of transcriptome dynamics during petal development in Rosa chinensis
    Article Snippet: Paragraph title: RNA preparation, cDNA library construction, and RNA-seq ... The adaptor-ligated and size-selected cDNA was mixed with 3 μL USER Enzyme (New England Biosystems) and incubated at 37 °C for 15 min and then at 95 °C for 5 min. Multiplex PCR was performed using Phusion High-Fidelity DNA polymerase, universal PCR primers, and the NEBNext Index (X) Primer (New England Biosystems), and following these steps: 1) 98 °C for 10 s; 2) 98 °C for 10 s, 65 °C for 30 s, 72 °C for 30 s, repeats 15 cycles; 3) 72 °C for 5 min. An Agilent Bioanalyzer 2100 system (Agilent Technologies) was used to assess the library quality.

    Chromatin Immunoprecipitation:

    Article Title: Gene regulatory network plasticity predates a switch in function of a conserved transcription regulator
    Article Snippet: Paragraph title: Chromatin immunoprecipitation and high-throughput sequencing ... Libraries were prepared using NEBNext Multiplex Kit for Illumina as previously described ( ) and sequenced on an Illumina HiSeq 4000.

    Software:

    Article Title: Complete Sequence and Annotation of the Mycoplasma phocidae Strain 105T Genome
    Article Snippet: Sequencing libraries were constructed using the NEBNext UltraTMII DNA library prep kit (catalog number E7645S; New England Biolabs) and dual-index NEBNext Multiplex Oligos (catalog number E7600S; New England Biolabs). .. Illumina MiSeq 2 × 300-bp paired-end sequencing yielded approximately 5 × 107 Phred quality-filtered reads with a quality score greater than 30.

    SYBR Green Assay:

    Article Title: A genetic risk factor for thrombophilia in a Han Chinese family
    Article Snippet: Capture efficiency was evaluated by quantitative PCR (qPCR) using SYBR green setting on the real-time instrument (Roche Light Cycler 480, Indianapolis, IN, USA) ( ). .. The primers of LM-PCR and qPCR were obtained from Multiplex Oligos Kit (New England Biolabs Inc., Ipswich, MA, USA) and NEBNext Library Quant Kit (New England Biolabs Inc.), respectively.

    Multiplex Assay:

    Article Title: Hierarchical regulation of the genome: global changes in nucleosome organization potentiate genome response
    Article Snippet: The adaptor-ligated DNA was cleaned up using AMPure XP beads to remove any unwanted ligated products. .. The universal and indexed sequences were added by PCR using 23 ul of adaptor-ligated DNA fragments, NEBNext High Fidelity 2X PCR Master Mix, index primers provided in NEBNext Multiplex (NEB #E7335, #E7500) Oligos for Illumina, and Universal PCR Primers provided in NEBNext Multiplex (NEB #E7335, #E7500) Oligos for Illumina. .. Then PCR was done for 8 cycles (not including the initial denaturation and final extension).

    Article Title: The Resistance of Vibrio cholerae O1 El Tor Strains to the Typing Phage 919TP, a Member of K139 Phage Family
    Article Snippet: The overhanging genomic sequences resulting from fragmentation were converted into blunt ends using T4 DNA polymerase, the Klenow fragment and T4 polynucleotide kinase. .. Following addition of an ‘A’ base to the 3′ end of the blunt phosphorylated DNA fragments, adapters (The NEBNext Multiplex Oligos for Illumina, E7600S, NEB) were ligated to the ends of the DNA fragments. .. The desired fragments were then purified following gel-electrophoresis, selectively enriched, and amplified by PCR.

    Article Title: Monocyte-derived alveolar macrophages drive lung fibrosis and persist in the lung over the life span
    Article Snippet: RNA quality and quantity were assessed using Bioanalyzer 2100 or TapeStation 4200 instruments (Agilent Technologies). .. RNA-seq libraries were prepared in 96-well plate format using NEBNext Poly(A) mRNA Magnetic Isolation Module, NEBNext Ultra RNA Library Prep kit for Illumina and NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) according to the standard protocol. .. 50 ng total RNA was enriched for poly(A) mRNA using NEBNext Poly(A) mRNA Magnetic Isolation Module, the mRNA was subjected to chemical fragmentation in the presence of divalent cations at 94°C for 15 min, and cDNA was generated using random primers and ProtoScript II reverse transcription in the presence of mouse RNase inhibitor using the following program: 10 min at 25°C, 15 min at 42°C, and 15 min and 70°C.

    Article Title: The Mutational Robustness of Influenza A Virus
    Article Snippet: Seven hundred fifty nanograms of the each amplified cDNA were sheared to an average size of 300 to 400 bp using a Covaris S220 focused ultrasonicator. .. Sequencing libraries were prepared using the NEBNext Ultra DNA library prep kit (NEB E7370L), Agencourt AMPure XP beads (Beckman Coulter A63881), and NEBNext multiplex oligonucleotides for Illumina (NEB E7600S). .. Indexed samples were pooled in equal quantities and sequenced on an Illumina MiSeq instrument with 2 x 250-base paired end reads.

    Article Title: Stochastic processes constrain the within and between host evolution of influenza virus
    Article Snippet: The thermocycler protocol was: 42 ˚C for 60 min then 94 ˚C for 2 min then 5 cycles of 94 ˚C for 30 s, 44 ˚C for 30 s, 68 ˚C for 3 min, then 28 cycles of 94 ˚C for 30 s, 57 ˚C for 30 s, 68 ˚C for 3 min. Amplification of all eight segments was confirmed by gel electrophoresis, and 750 ng of each cDNA mixture were sheared to an average size of 300 to 400 bp using a Covaris (Woburn, MA) S220 focused ultrasonicator. .. Sequencing libraries were prepared using the NEBNext Ultra DNA library prep kit (NEB E7370L), Agencourt AMPure XP beads (Beckman Coulter A63881, Indianapolis, IN), and NEBNext multiplex oligonucleotides for Illumina (NEB E7600S, Ipswich, MA). .. The final concentration of each barcoded library was determined by Quanti PicoGreen dsDNA quantification (ThermoFisher Scientific, Waltham, MA), and equal nanomolar concentrations were pooled.

    Article Title: Complete Sequence and Annotation of the Mycoplasma phocidae Strain 105T Genome
    Article Snippet: The DNA was extracted using an Easy-DNA genomic DNA purification kit (catalog number K180001; Thermo Fisher Scientific). .. Sequencing libraries were constructed using the NEBNext UltraTMII DNA library prep kit (catalog number E7645S; New England Biolabs) and dual-index NEBNext Multiplex Oligos (catalog number E7600S; New England Biolabs). .. Illumina MiSeq 2 × 300-bp paired-end sequencing yielded approximately 5 × 107 Phred quality-filtered reads with a quality score greater than 30.

    Article Title: Nucleosome repositioning underlies dynamic gene expression
    Article Snippet: DNA was resuspended in 15 µL of TE (pH 8.0) and dA tailed with Taq polymerase. .. Libraries were prepared with the NEBNext Multiplex kit with oligos for Illumina (E7335S). .. Barcoded samples were then submitted for sequencing on the Illumina HiSeq platform by the Sloan Kettering Integrated Genomics Operations Core facility.

    Article Title: Non-homologous DNA increases gene disruption efficiency by altering DNA repair outcomes
    Article Snippet: PCR amplicons were repaired, A-tailed, adapter ligated and amplified using the NEB (Ipswich, MA) Next Ultra kit (NEB E7370L). .. Dual indexing (NEB E7600S) was implemented to permit multiplex sequencing. .. All samples were pooled in equimolar amounts and sequenced on an Illumina (San Diego, CA) MiSeq using the MiSeq Reagent Kit v3 (2 × 300).

    Article Title: Effective Lethal Mutagenesis of Influenza Virus by Three Nucleoside Analogs
    Article Snippet: Seven hundred fifty nanograms of the each amplified cDNA was sheared to an average size of 300 to 400 bp using a Covaris S220 focused ultrasonicator. .. Sequencing libraries were prepared using the NEBNext Ultra DNA library prep kit (NEB E7370L), Agencourt AMPure XP beads (Beckman Coulter ), and NEBNext multiplex oligonucleotides for Illumina (NEB E7600S). .. Indexed samples were pooled in equal volumes and sequenced on an Illumina MiSeq instrument with 2 × 250-base paired end reads.

    Article Title: Profiling the macrofilaricidal effects of flubendazole on adult female Brugia malayi using RNAseq
    Article Snippet: 2.4 RNA concentration and purity were measured using the Qubit RNA BR Assay Kit (Life Technologies, Q10210, Burlington, ON) on an Agilent 2100 Bioanalyzer (Santa Clara, CA). mRNA was obtained by Poly (A) magnetic isolation (NEBNext Poly (A) mRNA Magnetic Isolation Module, NEB, Ipswich, MA). .. The enriched mRNA served as template for cDNA library preparation with the NEBNext® Ultra RNA Library Prep Kit Illumina (NEB, E7530) and NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) (NEB, E7600) following the manufacturer's instructions. .. Assessment of quality, DNA concentration and product size of the cDNA was performed for each library using a Qubit® 2.0 Fluorometer (Life Technologies, Q32866), Qubit® dsDNA BR assay kit (Life Technologies, Q32850), High Sensitivity DNA Analysis Kit (Agilent, 5067-4626) and Agilent 2100 Bioanalyzer. cDNA libraries were sequenced on an Illumina MiSeq Platform employing a 150 base pair paired-end NGS setting.

    Article Title: Comparative RNA-seq analysis of transcriptome dynamics during petal development in Rosa chinensis
    Article Snippet: The library fragments were purified using the Agencourt AMPure XP system (Beckman Coulter, CA, USA) and 150–200 bp cDNA fragments were selected. .. The adaptor-ligated and size-selected cDNA was mixed with 3 μL USER Enzyme (New England Biosystems) and incubated at 37 °C for 15 min and then at 95 °C for 5 min. Multiplex PCR was performed using Phusion High-Fidelity DNA polymerase, universal PCR primers, and the NEBNext Index (X) Primer (New England Biosystems), and following these steps: 1) 98 °C for 10 s; 2) 98 °C for 10 s, 65 °C for 30 s, 72 °C for 30 s, repeats 15 cycles; 3) 72 °C for 5 min. An Agilent Bioanalyzer 2100 system (Agilent Technologies) was used to assess the library quality. .. Using a TruSeq PE Cluster Kit v3-cBot-HS (Illumina), the index-coded samples were clustered on a cBot Cluster Generation System (Illumina), according to the manufacturer’s instructions.

    Article Title: Gene regulatory network plasticity predates a switch in function of a conserved transcription regulator
    Article Snippet: For all ChIP experiments with endogenous or pTef1 promoters driving Ndt80 expression, samples were isolated from log-phase cultures grown in YPD and chromatin immunoprecipitation was performed as previously described ( ) using an anti-Myc monoclonal antibody (RRID: AB_2536303 ). .. Libraries were prepared using NEBNext Multiplex Kit for Illumina as previously described ( ) and sequenced on an Illumina HiSeq 4000. .. For the mid-sporulation ChIP in S. cerevisiae , cells were induced to sporulate as previously described ( ; ), and samples were isolated after 16 hr in sporulation media.

    Article Title: Comprehensive nucleosome mapping of the human genome in cancer progression
    Article Snippet: Universal and indexed sequences were added through 8 cycles of PCR, using NEBNext® Multiplex Oligos for Illumina® (Index Primers Set 1, NEB #E7335S/L). .. The NEBNext® Multiplex Oligos kit contains indices 1-12 which correspond to the identical product if using Illumina® TruSeq primers. .. The libraries were quantity and quality checked using the Qubit Fluorometer High Sensitivity Kit and Agilent High Sensitivity DNA kit on the Agilent 2100 Bioanalyzer.

    Article Title: Vaccination has minimal impact on the intrahost diversity of H3N2 influenza viruses
    Article Snippet: The thermocycler protocol was: 42°C for 60 min then 94°C for 2 min then 5 cycles of 94°C for 30 sec, 44°C for 30 sec, 68°C for 3 min, then 28 cycles of 94°C for 30 sec, 57°C for 30 sec, 68°C for 3 min. Amplification of all 8 segments was confirmed by gel electrophoresis, and 750ng of each cDNA mixture were sheared to an average size of 300 to 400bp using a Covaris S220 focused ultrasonicator. .. Sequencing libraries were prepared using the NEBNext Ultra DNA library prep kit (NEB E7370L), Agencourt AMPure XP beads (Beckman Coulter A63881), and NEBNext multiplex oligonucleotides for Illumina (NEB E7600S). .. The final concentration of each barcoded library was determined by Quanti PicoGreen dsDNA quantification (ThermoFisher Scientific), and equal nanomolar concentrations were pooled.

    Article Title: A genetic risk factor for thrombophilia in a Han Chinese family
    Article Snippet: Capture efficiency was evaluated by quantitative PCR (qPCR) using SYBR green setting on the real-time instrument (Roche Light Cycler 480, Indianapolis, IN, USA) ( ). .. The primers of LM-PCR and qPCR were obtained from Multiplex Oligos Kit (New England Biolabs Inc., Ipswich, MA, USA) and NEBNext Library Quant Kit (New England Biolabs Inc.), respectively. .. The conditions of LM-PCR and qPCR were provided in the and .

    Article Title: Genome editing reveals a role for OCT4 in human embryogenesis
    Article Snippet: Libraries were prepared using Low Input Library Prep Kit v2 (Clontech; 634899) according to manufacturer’s instructions. .. Dual indexing was performed by substituting the manufacturer’s provided indexing adaptors with NEBNext Multiplex Oligos for Illumina Dual Index primers set 1 (NEB; E7600S). .. Library quality was assessed by Bioanalyser and the concentration was measured by high sensitivity QuBit assay.

    Article Title: Germinal Center B Cells Replace Their Antigen Receptors in Dark Zones and Fail Light Zone Entry when Immunoglobulin Gene Mutations are Damaging
    Article Snippet: DNA was purified using Agencourt AMPure XP PCR purification beads (Beckman coulter), and the DNA products were sequentially cut with NsiI-HF and AFlIIII to produce a ∼435bp product. .. The DNA was subsequently purified, end prep and adaptor ligation was performed using NEBNext® Ultra II DNA Library Prep Kit for Illumina® (New Enlgand Biolabs, E7645S) according to the manufacturer’s instructions and NEBNext® Multiplex Oligos for Illumina® (New England Biolabs, E7600S) were added according to the manufacturers instructions. .. The DNA was again purified, quantified using Qubit dsDNA HS Assay Kit (Invitrogen, Q32854).

    Selection:

    Article Title: Intrinsic retroviral reactivation in human preimplantation embryos and pluripotent cells
    Article Snippet: Sequencing datasets generated for this study are deposited under the GEO accession GSE63570, and summarized in . .. Libraries were constructed as described ,using ∼10 micrograms of total RNA followed by poly-A selection with oligo-dT beads, ligation and 10 cycles of PCR with NEBnext kit oligos, and sequenced using Illumina Hi-Seq2000 at the Stanford Sequencing Facility or ELIM Bio (Hayward, CA). .. For RNA-seq repeat analysis of data from embryo and hESC libraries (for , ), FASTQ files were aligned to repbase consensus sequences with bowtie using the command "bowtie -q -p 8 -S -n 2 -e 70 -l 28 --maxbts 800 -k 1 –best”.

    Article Title: Comprehensive nucleosome mapping of the human genome in cancer progression
    Article Snippet: Following end prep and adaptor ligation, libraries were cleaned-up with AMPure® XP Beads (Beckman Coulter, Inc. #A63881) without size selection due to the original input of a size population of ~150bp. .. The NEBNext® Multiplex Oligos kit contains indices 1-12 which correspond to the identical product if using Illumina® TruSeq primers.

    Next-Generation Sequencing:

    Article Title: The Mutational Robustness of Influenza A Virus
    Article Snippet: Paragraph title: Next generation sequencing ... Sequencing libraries were prepared using the NEBNext Ultra DNA library prep kit (NEB E7370L), Agencourt AMPure XP beads (Beckman Coulter A63881), and NEBNext multiplex oligonucleotides for Illumina (NEB E7600S).

    Article Title: Non-homologous DNA increases gene disruption efficiency by altering DNA repair outcomes
    Article Snippet: Paragraph title: Next-generation sequencing (NGS) analysis of edited cells ... Dual indexing (NEB E7600S) was implemented to permit multiplex sequencing.

    Article Title: Effective Lethal Mutagenesis of Influenza Virus by Three Nucleoside Analogs
    Article Snippet: Paragraph title: Next-generation sequencing. ... Sequencing libraries were prepared using the NEBNext Ultra DNA library prep kit (NEB E7370L), Agencourt AMPure XP beads (Beckman Coulter ), and NEBNext multiplex oligonucleotides for Illumina (NEB E7600S).

    Article Title: Comparative RNA-seq analysis of transcriptome dynamics during petal development in Rosa chinensis
    Article Snippet: A NEBNext® UltraTM RNA Library Prep Kit (New England Biolabs, MA, USA) was used to generate libraries for next-generation sequencing on the Illumina® platform (Illumina, CA, USA), following the manufacturer’s recommendations. .. The adaptor-ligated and size-selected cDNA was mixed with 3 μL USER Enzyme (New England Biosystems) and incubated at 37 °C for 15 min and then at 95 °C for 5 min. Multiplex PCR was performed using Phusion High-Fidelity DNA polymerase, universal PCR primers, and the NEBNext Index (X) Primer (New England Biosystems), and following these steps: 1) 98 °C for 10 s; 2) 98 °C for 10 s, 65 °C for 30 s, 72 °C for 30 s, repeats 15 cycles; 3) 72 °C for 5 min. An Agilent Bioanalyzer 2100 system (Agilent Technologies) was used to assess the library quality.

    Article Title: Germinal Center B Cells Replace Their Antigen Receptors in Dark Zones and Fail Light Zone Entry when Immunoglobulin Gene Mutations are Damaging
    Article Snippet: Paragraph title: Library preparation and analysis for Ighv NGS sequencing ... The DNA was subsequently purified, end prep and adaptor ligation was performed using NEBNext® Ultra II DNA Library Prep Kit for Illumina® (New Enlgand Biolabs, E7645S) according to the manufacturer’s instructions and NEBNext® Multiplex Oligos for Illumina® (New England Biolabs, E7600S) were added according to the manufacturers instructions.

    Random Hexamer Labeling:

    Article Title: Comparative RNA-seq analysis of transcriptome dynamics during petal development in Rosa chinensis
    Article Snippet: First strand cDNA was synthesised using random hexamer primers and a M-MuLV Reverse Transcriptase (RNase H-; New England Biolabs), with DNA polymerase I and RNase H used to perform the subsequent second strand cDNA synthesis. .. The adaptor-ligated and size-selected cDNA was mixed with 3 μL USER Enzyme (New England Biosystems) and incubated at 37 °C for 15 min and then at 95 °C for 5 min. Multiplex PCR was performed using Phusion High-Fidelity DNA polymerase, universal PCR primers, and the NEBNext Index (X) Primer (New England Biosystems), and following these steps: 1) 98 °C for 10 s; 2) 98 °C for 10 s, 65 °C for 30 s, 72 °C for 30 s, repeats 15 cycles; 3) 72 °C for 5 min. An Agilent Bioanalyzer 2100 system (Agilent Technologies) was used to assess the library quality.

    Concentration Assay:

    Article Title: Profiling the macrofilaricidal effects of flubendazole on adult female Brugia malayi using RNAseq
    Article Snippet: 2.4 RNA concentration and purity were measured using the Qubit RNA BR Assay Kit (Life Technologies, Q10210, Burlington, ON) on an Agilent 2100 Bioanalyzer (Santa Clara, CA). mRNA was obtained by Poly (A) magnetic isolation (NEBNext Poly (A) mRNA Magnetic Isolation Module, NEB, Ipswich, MA). .. The enriched mRNA served as template for cDNA library preparation with the NEBNext® Ultra RNA Library Prep Kit Illumina (NEB, E7530) and NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) (NEB, E7600) following the manufacturer's instructions.

    Article Title: Genome editing reveals a role for OCT4 in human embryogenesis
    Article Snippet: The clear supernatant containing the cDNA was removed from the immobilised beads and transferred to a new low-bind tube. cDNA was stored at −80 °C until library preparation. cDNA quality was assessed by High Sensitivity DNA assay on an Agilent 2100 Bioanalyser with good quality cDNA showing a broad peak from 300 to 9,000 bp. cDNA concentration was measured using QuBit dsDNA HS kit (Life Technologies). .. Dual indexing was performed by substituting the manufacturer’s provided indexing adaptors with NEBNext Multiplex Oligos for Illumina Dual Index primers set 1 (NEB; E7600S).

    DNA Purification:

    Article Title: Complete Sequence and Annotation of the Mycoplasma phocidae Strain 105T Genome
    Article Snippet: The DNA was extracted using an Easy-DNA genomic DNA purification kit (catalog number K180001; Thermo Fisher Scientific). .. Sequencing libraries were constructed using the NEBNext UltraTMII DNA library prep kit (catalog number E7645S; New England Biolabs) and dual-index NEBNext Multiplex Oligos (catalog number E7600S; New England Biolabs).

    High Throughput Screening Assay:

    Article Title: Gene regulatory network plasticity predates a switch in function of a conserved transcription regulator
    Article Snippet: Paragraph title: Chromatin immunoprecipitation and high-throughput sequencing ... Libraries were prepared using NEBNext Multiplex Kit for Illumina as previously described ( ) and sequenced on an Illumina HiSeq 4000.

    Gel Extraction:

    Article Title: Stochastic processes constrain the within and between host evolution of influenza virus
    Article Snippet: Sequencing libraries were prepared using the NEBNext Ultra DNA library prep kit (NEB E7370L), Agencourt AMPure XP beads (Beckman Coulter A63881, Indianapolis, IN), and NEBNext multiplex oligonucleotides for Illumina (NEB E7600S, Ipswich, MA). .. The final concentration of each barcoded library was determined by Quanti PicoGreen dsDNA quantification (ThermoFisher Scientific, Waltham, MA), and equal nanomolar concentrations were pooled.

    Article Title: Vaccination has minimal impact on the intrahost diversity of H3N2 influenza viruses
    Article Snippet: Sequencing libraries were prepared using the NEBNext Ultra DNA library prep kit (NEB E7370L), Agencourt AMPure XP beads (Beckman Coulter A63881), and NEBNext multiplex oligonucleotides for Illumina (NEB E7600S). .. The final concentration of each barcoded library was determined by Quanti PicoGreen dsDNA quantification (ThermoFisher Scientific), and equal nanomolar concentrations were pooled.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs multiplex oligos
    SIRT7 is involved in pre-rRNA processing. ( a ) Knockdown of SIRT7 impairs pre-rRNA synthesis and processing in vivo . U2OS cells transfected with control (siCtrl) or SIRT7-specific siRNAs (siSIRT7) were metabolically labelled with 3 H-uridine. <t>RNA</t> was analysed by agarose gel electrophoresis and fluorography. The bar diagram shows quantification of the processing intermediates, values from siCtrl cells being set to 1. ( b ) In vitro processing assay. Extracts from L1210 cells were incubated with 32 P-labelled RNA comprising the 5′ETS depicted in the scheme above. 32 P-labelled RNA and cleavage products were analysed by gel electrophoresis and PhosphorImaging. See also Supplementary Fig. 3a . ( c ) 5′ETS processing is inhibited by NAM. The assay contained radiolabelled RNA (+541/+1290) and extracts from L1210 cells cultured for 6 h in the absence or presence of NAM. ( d ) Processing is enhanced by NAD + . Processing assays containing radiolabelled RNA (+541/+1290) were substituted with NAD + as indicated. ( e ) The catalytic activity of SIRT7 is required for pre-rRNA cleavage. Assays were supplemented with 15 or 30 ng of purified wildtype (WT) or mutant (H187Y) Flag-SIRT7 ( Supplementary Fig. 3b ). ( f ) Depletion of SIRT7 impairs processing. SIRT7 was depleted from L1210 cells by shRNAs (shSIRT7-1, shSIRT7-2, Supplementary Fig. 3c ). Extracts from non-infected cells (−) or cells expressing control shRNA (shCtrl) served as control (left). To rescue impaired cleavage, 15 ng of wild-type Flag-SIRT7 (WT) or mutant H187Y (HY) were added to SIRT7-depleted extracts (right). ( g ) Depletion of U3 snoRNA abolishes processing. U3 snoRNA was depleted by preincubating extracts with U3-specific antisense <t>oligos</t> (ASO, 50 ng μl −1 ) and 2 U of RNase H ( Supplementary Fig. 3d ). In vitro processing was performed with undepleted (−) or depleted extracts in the absence or presence of 15 ng Flag-SIRT7. Bar diagrams in c – g show quantification of the ratio of cleaved versus uncleaved transcripts, presented as mean±s.d. from three independent experiments (* P
    Multiplex Oligos, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/multiplex oligos/product/New England Biolabs
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    multiplex oligos - by Bioz Stars, 2019-08
    99/100 stars
      Buy from Supplier

    N/A
    NEBNext Multiplex Oligos for Illumina Index Primers Set 1 96 rxns
      Buy from Supplier

    Image Search Results


    SIRT7 is involved in pre-rRNA processing. ( a ) Knockdown of SIRT7 impairs pre-rRNA synthesis and processing in vivo . U2OS cells transfected with control (siCtrl) or SIRT7-specific siRNAs (siSIRT7) were metabolically labelled with 3 H-uridine. RNA was analysed by agarose gel electrophoresis and fluorography. The bar diagram shows quantification of the processing intermediates, values from siCtrl cells being set to 1. ( b ) In vitro processing assay. Extracts from L1210 cells were incubated with 32 P-labelled RNA comprising the 5′ETS depicted in the scheme above. 32 P-labelled RNA and cleavage products were analysed by gel electrophoresis and PhosphorImaging. See also Supplementary Fig. 3a . ( c ) 5′ETS processing is inhibited by NAM. The assay contained radiolabelled RNA (+541/+1290) and extracts from L1210 cells cultured for 6 h in the absence or presence of NAM. ( d ) Processing is enhanced by NAD + . Processing assays containing radiolabelled RNA (+541/+1290) were substituted with NAD + as indicated. ( e ) The catalytic activity of SIRT7 is required for pre-rRNA cleavage. Assays were supplemented with 15 or 30 ng of purified wildtype (WT) or mutant (H187Y) Flag-SIRT7 ( Supplementary Fig. 3b ). ( f ) Depletion of SIRT7 impairs processing. SIRT7 was depleted from L1210 cells by shRNAs (shSIRT7-1, shSIRT7-2, Supplementary Fig. 3c ). Extracts from non-infected cells (−) or cells expressing control shRNA (shCtrl) served as control (left). To rescue impaired cleavage, 15 ng of wild-type Flag-SIRT7 (WT) or mutant H187Y (HY) were added to SIRT7-depleted extracts (right). ( g ) Depletion of U3 snoRNA abolishes processing. U3 snoRNA was depleted by preincubating extracts with U3-specific antisense oligos (ASO, 50 ng μl −1 ) and 2 U of RNase H ( Supplementary Fig. 3d ). In vitro processing was performed with undepleted (−) or depleted extracts in the absence or presence of 15 ng Flag-SIRT7. Bar diagrams in c – g show quantification of the ratio of cleaved versus uncleaved transcripts, presented as mean±s.d. from three independent experiments (* P

    Journal: Nature Communications

    Article Title: SIRT7-dependent deacetylation of the U3-55k protein controls pre-rRNA processing

    doi: 10.1038/ncomms10734

    Figure Lengend Snippet: SIRT7 is involved in pre-rRNA processing. ( a ) Knockdown of SIRT7 impairs pre-rRNA synthesis and processing in vivo . U2OS cells transfected with control (siCtrl) or SIRT7-specific siRNAs (siSIRT7) were metabolically labelled with 3 H-uridine. RNA was analysed by agarose gel electrophoresis and fluorography. The bar diagram shows quantification of the processing intermediates, values from siCtrl cells being set to 1. ( b ) In vitro processing assay. Extracts from L1210 cells were incubated with 32 P-labelled RNA comprising the 5′ETS depicted in the scheme above. 32 P-labelled RNA and cleavage products were analysed by gel electrophoresis and PhosphorImaging. See also Supplementary Fig. 3a . ( c ) 5′ETS processing is inhibited by NAM. The assay contained radiolabelled RNA (+541/+1290) and extracts from L1210 cells cultured for 6 h in the absence or presence of NAM. ( d ) Processing is enhanced by NAD + . Processing assays containing radiolabelled RNA (+541/+1290) were substituted with NAD + as indicated. ( e ) The catalytic activity of SIRT7 is required for pre-rRNA cleavage. Assays were supplemented with 15 or 30 ng of purified wildtype (WT) or mutant (H187Y) Flag-SIRT7 ( Supplementary Fig. 3b ). ( f ) Depletion of SIRT7 impairs processing. SIRT7 was depleted from L1210 cells by shRNAs (shSIRT7-1, shSIRT7-2, Supplementary Fig. 3c ). Extracts from non-infected cells (−) or cells expressing control shRNA (shCtrl) served as control (left). To rescue impaired cleavage, 15 ng of wild-type Flag-SIRT7 (WT) or mutant H187Y (HY) were added to SIRT7-depleted extracts (right). ( g ) Depletion of U3 snoRNA abolishes processing. U3 snoRNA was depleted by preincubating extracts with U3-specific antisense oligos (ASO, 50 ng μl −1 ) and 2 U of RNase H ( Supplementary Fig. 3d ). In vitro processing was performed with undepleted (−) or depleted extracts in the absence or presence of 15 ng Flag-SIRT7. Bar diagrams in c – g show quantification of the ratio of cleaved versus uncleaved transcripts, presented as mean±s.d. from three independent experiments (* P

    Article Snippet: The RNA-seq libraries were created using the NEBNext Ultra RNA Library Prep kit for Illumina (E7530) with NEBNext Multiplex Oligos for Illumina (E7300).

    Techniques: In Vivo, Transfection, Metabolic Labelling, Agarose Gel Electrophoresis, In Vitro, Incubation, Nucleic Acid Electrophoresis, Cell Culture, Activity Assay, Purification, Mutagenesis, Infection, Expressing, shRNA, Allele-specific Oligonucleotide

    SIRT7 is associated with pre-rRNA and snoRNAs. ( a ) SIRT7 CLIP-seq reads mapped to a custom annotation file of a human rDNA repeat (middle) or the transcribed region (bottom). The region encoding 18S, 5.8S and 28S rRNA is highlighted. SIRT7 reads after subtraction of IgG reads were normalized to input reads ( y axis). ( b ) Gene ontology categories of SIRT7 CLIP-seq peaks. The most representative clusters are shown according to the ajusted P value (−log 10 ). ( c ) SIRT7-bound snoRNAs comprise C/D box, H/ACA box snoRNAs and scaRNAs. The number ( n ) and relative abundance (%) of each snoRNA class associated with SIRT7 is presented. ( d ) U3, SNORA73A and 73B snoRNAs are overrepresented among SIRT7-associated snoRNAs. SIRT7 reads mapped to corresponding snoRNAs are indicated as percentage of all snoRNAs identified by CLIP-seq. ( e ) Comparison of SIRT7-associated RNAs under native and denaturing conditions. His/V5-tagged SIRT7 expressed in HEK293T cells was affinity-purified on Ni-NTA-agarose under native or denaturing conditions, and associated RNAs were detected by RT–qPCR. Lysates from non-transfected HEK293T cells were used for control (Ctrl). Associated pre-RNA was monitored by RT–qPCR using primer H1 ( Supplementary Table 3 ). Bars represent means±s.d. from three experiments. See also Supplementary Fig. 2b,d . ( f ) ChIP assays showing association of endogenous SIRT7 (left panel) or transiently overexpressed Flag-SIRT7 (right panel) with the indicated gene loci in HEK293T cells. rDNA was amplified using primers H4 (coding) and H18 (IGS; Supplementary Table 3 ). Bars represent means±s.d. from three experiments. See also Supplementary Fig. 2d .

    Journal: Nature Communications

    Article Title: SIRT7-dependent deacetylation of the U3-55k protein controls pre-rRNA processing

    doi: 10.1038/ncomms10734

    Figure Lengend Snippet: SIRT7 is associated with pre-rRNA and snoRNAs. ( a ) SIRT7 CLIP-seq reads mapped to a custom annotation file of a human rDNA repeat (middle) or the transcribed region (bottom). The region encoding 18S, 5.8S and 28S rRNA is highlighted. SIRT7 reads after subtraction of IgG reads were normalized to input reads ( y axis). ( b ) Gene ontology categories of SIRT7 CLIP-seq peaks. The most representative clusters are shown according to the ajusted P value (−log 10 ). ( c ) SIRT7-bound snoRNAs comprise C/D box, H/ACA box snoRNAs and scaRNAs. The number ( n ) and relative abundance (%) of each snoRNA class associated with SIRT7 is presented. ( d ) U3, SNORA73A and 73B snoRNAs are overrepresented among SIRT7-associated snoRNAs. SIRT7 reads mapped to corresponding snoRNAs are indicated as percentage of all snoRNAs identified by CLIP-seq. ( e ) Comparison of SIRT7-associated RNAs under native and denaturing conditions. His/V5-tagged SIRT7 expressed in HEK293T cells was affinity-purified on Ni-NTA-agarose under native or denaturing conditions, and associated RNAs were detected by RT–qPCR. Lysates from non-transfected HEK293T cells were used for control (Ctrl). Associated pre-RNA was monitored by RT–qPCR using primer H1 ( Supplementary Table 3 ). Bars represent means±s.d. from three experiments. See also Supplementary Fig. 2b,d . ( f ) ChIP assays showing association of endogenous SIRT7 (left panel) or transiently overexpressed Flag-SIRT7 (right panel) with the indicated gene loci in HEK293T cells. rDNA was amplified using primers H4 (coding) and H18 (IGS; Supplementary Table 3 ). Bars represent means±s.d. from three experiments. See also Supplementary Fig. 2d .

    Article Snippet: The RNA-seq libraries were created using the NEBNext Ultra RNA Library Prep kit for Illumina (E7530) with NEBNext Multiplex Oligos for Illumina (E7300).

    Techniques: Cross-linking Immunoprecipitation, Affinity Purification, Quantitative RT-PCR, Transfection, Chromatin Immunoprecipitation, Amplification

    Pre-rRNA transcription and processing are attenuated under stress. ( a ) Northern blot of pre-rRNA and processing intermediates from HEK293T cells that were untreated, exposed to hyperosmotic stress for 90 min (hypertonic), or recovered to regular medium for 60 min (hypertonic rel.). Membranes were probed with 32 P-labelled antisense riboprobe specific to 47S pre-rRNA (5'ETS, top) or with ITS1 oligos hybridizing to pre-rRNA intermediates (middle panel). ( b ) Acetylation of U3-55k is increased on different cellular stress conditions. HEK293T cells expressing Flag-U3-55k were treated with actinomycin D (Act D, 0.1 μg ml −1 , 4 h), AICAR (0.5 mM, 12 h) or exposed to hypertonic stress. Acetylation of immunopurified Flag-U3-55k and equal loading was monitored on western blots using anti-pan-AcK and anti-Flag antibodies. ( c ) Cellular localization of SIRT7 and U3-55k on hyperosmotic stress. Images showing localization of GFP-U3-55k and SIRT7 in normal conditions and on exposure to hyperosmotic stress for 90 min. Nuclei were stained with Hoechst 33342. Scale bars, 10 μm. ( d ) Overexpression of SIRT7 alleviates processing defects on hypertonic stress. Northern blot of RNA from parental U2OS cells and from cells which stably express GFP-SIRT7 (U2OS-GFP-SIRT7) using 5′ETS and ITS1 probes as in a . ( e ) CLIP-RT–qPCR monitoring binding of Flag-U3-55k to pre-rRNA, U3 snoRNA and U2 snRNA in HEK293T cells cultured in normo-osmotic medium or exposed to hypertonic stress for 90 min. Precipitated RNA was analysed by RT–qPCR using the indicated primers. Bars represent the means±s.d. from three biological repeats (* P

    Journal: Nature Communications

    Article Title: SIRT7-dependent deacetylation of the U3-55k protein controls pre-rRNA processing

    doi: 10.1038/ncomms10734

    Figure Lengend Snippet: Pre-rRNA transcription and processing are attenuated under stress. ( a ) Northern blot of pre-rRNA and processing intermediates from HEK293T cells that were untreated, exposed to hyperosmotic stress for 90 min (hypertonic), or recovered to regular medium for 60 min (hypertonic rel.). Membranes were probed with 32 P-labelled antisense riboprobe specific to 47S pre-rRNA (5'ETS, top) or with ITS1 oligos hybridizing to pre-rRNA intermediates (middle panel). ( b ) Acetylation of U3-55k is increased on different cellular stress conditions. HEK293T cells expressing Flag-U3-55k were treated with actinomycin D (Act D, 0.1 μg ml −1 , 4 h), AICAR (0.5 mM, 12 h) or exposed to hypertonic stress. Acetylation of immunopurified Flag-U3-55k and equal loading was monitored on western blots using anti-pan-AcK and anti-Flag antibodies. ( c ) Cellular localization of SIRT7 and U3-55k on hyperosmotic stress. Images showing localization of GFP-U3-55k and SIRT7 in normal conditions and on exposure to hyperosmotic stress for 90 min. Nuclei were stained with Hoechst 33342. Scale bars, 10 μm. ( d ) Overexpression of SIRT7 alleviates processing defects on hypertonic stress. Northern blot of RNA from parental U2OS cells and from cells which stably express GFP-SIRT7 (U2OS-GFP-SIRT7) using 5′ETS and ITS1 probes as in a . ( e ) CLIP-RT–qPCR monitoring binding of Flag-U3-55k to pre-rRNA, U3 snoRNA and U2 snRNA in HEK293T cells cultured in normo-osmotic medium or exposed to hypertonic stress for 90 min. Precipitated RNA was analysed by RT–qPCR using the indicated primers. Bars represent the means±s.d. from three biological repeats (* P

    Article Snippet: The RNA-seq libraries were created using the NEBNext Ultra RNA Library Prep kit for Illumina (E7530) with NEBNext Multiplex Oligos for Illumina (E7300).

    Techniques: Northern Blot, Expressing, Activated Clotting Time Assay, Western Blot, Staining, Over Expression, Stable Transfection, Cross-linking Immunoprecipitation, Quantitative RT-PCR, Binding Assay, Cell Culture

    NEAT1 forms triplexes at numerous genomic sites. ( A ) NEAT1 profiles in TriplexRNA-seq (DNA-IP) (red) and nuclear RNA (blue) from HeLa S3 and U2OS cells with shaded TFR1 and TFR2. Minus (-) and plus (+) strands are shown. The position and sequence of NEAT1-TFR1 and -TFR2 are shown below. ( B ) EMSAs using 10 or 100 pmol of synthetic NEAT1 versions comprising TFR1 (40 or 52 nt) or TFR2 incubated with 0.25 pmol of double–stranded 32 P-labeled oligonucleotides which harbor sequences of NEAT1 target genes predicted from CHART-seq ( Supplementary Table S2 ). Reactions marked with an asterisk (*) were treated with 0.5 U RNase H. As a control, RNA without a putative TFR was used. Potential Hoogsteen base pairing between motifs and respective TFR sequences are shown; mismatches are marked (*). ( C ) Schematic depiction of the TFR-based capture assay. Biotinylated RNA oligos covering NEAT1-TFR1 and NEAT1-TFR2 were used to capture genomic DNA. ( D ) MEME motif analysis identifying consensus motifs in DNA captured by NEAT1-TFR1 (399 of top 500 peaks) and by NEAT1-TFR2 (500 of top 500 peaks ranked by peak P -value). Potential Hoogsteen base pairing between motifs and respective TFR sequences are shown; mismatches are marked (*). ( E ) TDF analysis of the triplex-forming potential of NEAT1-TFR1 and NEAT1-TFR2 RNAs with top 500 TFR-associated and control DNA peaks (ranked by peak P -value) compared to 500 randomized regions ( N = 1000, colored grey). P -values were obtained from one-tailed Mann–Whitney test. ( F ) Scheme presenting antisense oligo (ASO)-based capture of NEAT1-associated DNA. ( G ) Consensus motif in NEAT1-associated DNA sites (314 of top 500 peaks ranked by peak P -value). ( H ) TDF analysis predicting the triplex-forming potential of NEAT1 on ASO-captured DNA regions. Significant TFRs along NEAT1 are shown in orange, the number of target sites (DBS) for each TFR in purple. For TFR- and ASO-based capture assays nucleic acids isolated from HeLa S3 chromatin were used.

    Journal: Nucleic Acids Research

    Article Title: Isolation and genome-wide characterization of cellular DNA:RNA triplex structures

    doi: 10.1093/nar/gky1305

    Figure Lengend Snippet: NEAT1 forms triplexes at numerous genomic sites. ( A ) NEAT1 profiles in TriplexRNA-seq (DNA-IP) (red) and nuclear RNA (blue) from HeLa S3 and U2OS cells with shaded TFR1 and TFR2. Minus (-) and plus (+) strands are shown. The position and sequence of NEAT1-TFR1 and -TFR2 are shown below. ( B ) EMSAs using 10 or 100 pmol of synthetic NEAT1 versions comprising TFR1 (40 or 52 nt) or TFR2 incubated with 0.25 pmol of double–stranded 32 P-labeled oligonucleotides which harbor sequences of NEAT1 target genes predicted from CHART-seq ( Supplementary Table S2 ). Reactions marked with an asterisk (*) were treated with 0.5 U RNase H. As a control, RNA without a putative TFR was used. Potential Hoogsteen base pairing between motifs and respective TFR sequences are shown; mismatches are marked (*). ( C ) Schematic depiction of the TFR-based capture assay. Biotinylated RNA oligos covering NEAT1-TFR1 and NEAT1-TFR2 were used to capture genomic DNA. ( D ) MEME motif analysis identifying consensus motifs in DNA captured by NEAT1-TFR1 (399 of top 500 peaks) and by NEAT1-TFR2 (500 of top 500 peaks ranked by peak P -value). Potential Hoogsteen base pairing between motifs and respective TFR sequences are shown; mismatches are marked (*). ( E ) TDF analysis of the triplex-forming potential of NEAT1-TFR1 and NEAT1-TFR2 RNAs with top 500 TFR-associated and control DNA peaks (ranked by peak P -value) compared to 500 randomized regions ( N = 1000, colored grey). P -values were obtained from one-tailed Mann–Whitney test. ( F ) Scheme presenting antisense oligo (ASO)-based capture of NEAT1-associated DNA. ( G ) Consensus motif in NEAT1-associated DNA sites (314 of top 500 peaks ranked by peak P -value). ( H ) TDF analysis predicting the triplex-forming potential of NEAT1 on ASO-captured DNA regions. Significant TFRs along NEAT1 are shown in orange, the number of target sites (DBS) for each TFR in purple. For TFR- and ASO-based capture assays nucleic acids isolated from HeLa S3 chromatin were used.

    Article Snippet: Libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit and NEBNext Multiplex Oligos for Illumina (NEB).

    Techniques: Sequencing, Incubation, Labeling, One-tailed Test, MANN-WHITNEY, Allele-specific Oligonucleotide, Isolation

    Validation of triplex-forming RNA and DNAs. ( A ) TDF analysis predicting the potential of top 1000 enriched TriplexRNA (DNA-IP) regions (ranked by peak P -value) to bind to active promoters defined by ChromHMM. Number of TFRs in RNA (per kilobase of RNA, left) and the number of putative DBSs at promoters (per kilobase of RNA, right) are shown. Boxplot borders are defined by the 1st and 3rd quantiles of the distributions, the middle line corresponds to the median value. The top whisker denotes the maximum value within the third quartile plus 1.5 times the interquartile range (bottom whisker is defined analogously). Dark gray dots represent outliers with values higher or lower than whiskers. Further box plots are based on the same definitions. ( B ) Motif analysis of triplexes formed between TriplexRNA (DNA-IP) and active promoters. The diagram depicts the fraction of antiparallel and parallel triplexes with the respective motif and nucleotide composition of TFRs in TriplexRNA. ( C ) TDF analysis comparing the triplex-forming potential of top 2000 TriplexDNA-seq regions with top 1000 TriplexRNA (DNA-IP) (ranked by peak P -value). The number of putative DBSs (per kilobase of RNA) is shown. ( D ) Motif analysis of predicted triplexes formed between TriplexRNAs (DNA-IP) and TriplexDNA. The diagram depicts the fraction of antiparallel and parallel triplexes, with the respective motif and nucleotide composition of TFRs in TriplexRNA. ( E ) Box plot classifying triplex interactions between TriplexRNAs (DNA-IP) and TriplexDNA-seq regions as cis ( > 10 kb in the same chromosome) and trans (at different chromosomes) interactions, excluding underrepresented local interactions (within 10 kb distance). ( F ) EMSAs using 10 or 100 pmol of synthetic TriplexRNAs and 0.25 pmol of double–stranded 32 P-labeled oligonucleotides comprising target regions from TriplexDNA ( Supplementary Table S2 ). Reactions marked with an asterisk (*) were treated with 0.5 U RNase H. As a control (C), RNA without a putative TFR was used. Potential Hoogsteen base pairing between motifs and respective TFR sequences are shown; mismatches are marked (*). TriplexRNA-seq and TriplexDNA-seq data are from HeLa S3 cells. Adjusted P -values

    Journal: Nucleic Acids Research

    Article Title: Isolation and genome-wide characterization of cellular DNA:RNA triplex structures

    doi: 10.1093/nar/gky1305

    Figure Lengend Snippet: Validation of triplex-forming RNA and DNAs. ( A ) TDF analysis predicting the potential of top 1000 enriched TriplexRNA (DNA-IP) regions (ranked by peak P -value) to bind to active promoters defined by ChromHMM. Number of TFRs in RNA (per kilobase of RNA, left) and the number of putative DBSs at promoters (per kilobase of RNA, right) are shown. Boxplot borders are defined by the 1st and 3rd quantiles of the distributions, the middle line corresponds to the median value. The top whisker denotes the maximum value within the third quartile plus 1.5 times the interquartile range (bottom whisker is defined analogously). Dark gray dots represent outliers with values higher or lower than whiskers. Further box plots are based on the same definitions. ( B ) Motif analysis of triplexes formed between TriplexRNA (DNA-IP) and active promoters. The diagram depicts the fraction of antiparallel and parallel triplexes with the respective motif and nucleotide composition of TFRs in TriplexRNA. ( C ) TDF analysis comparing the triplex-forming potential of top 2000 TriplexDNA-seq regions with top 1000 TriplexRNA (DNA-IP) (ranked by peak P -value). The number of putative DBSs (per kilobase of RNA) is shown. ( D ) Motif analysis of predicted triplexes formed between TriplexRNAs (DNA-IP) and TriplexDNA. The diagram depicts the fraction of antiparallel and parallel triplexes, with the respective motif and nucleotide composition of TFRs in TriplexRNA. ( E ) Box plot classifying triplex interactions between TriplexRNAs (DNA-IP) and TriplexDNA-seq regions as cis ( > 10 kb in the same chromosome) and trans (at different chromosomes) interactions, excluding underrepresented local interactions (within 10 kb distance). ( F ) EMSAs using 10 or 100 pmol of synthetic TriplexRNAs and 0.25 pmol of double–stranded 32 P-labeled oligonucleotides comprising target regions from TriplexDNA ( Supplementary Table S2 ). Reactions marked with an asterisk (*) were treated with 0.5 U RNase H. As a control (C), RNA without a putative TFR was used. Potential Hoogsteen base pairing between motifs and respective TFR sequences are shown; mismatches are marked (*). TriplexRNA-seq and TriplexDNA-seq data are from HeLa S3 cells. Adjusted P -values

    Article Snippet: Libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit and NEBNext Multiplex Oligos for Illumina (NEB).

    Techniques: Whisker Assay, Labeling

    Detection of bisulfite-resistant cytosines in purified, linearized human mtDNA by bisulfite pyrosequencing using converted template-selective (A9515) and unselective (hND1) sequencing primers. Ratios of brCs were determined by bisulfite pyrosequencing (Mean±SD, triplicated assays). (A) The A9515 sequencing primer, which was highly selective to bisulfite-converted DNA, interrogated three CpG sites (CpG #3–5) whereas non-selective sequencing primer hND1 interrogated all these CpG sites plus two additional CpG sites (CpG #1 and 2). (B) Positive control assay was performed using in vitro partially methylated NCAs templates. High CpG methylation levels at three CpG sites (CpG #3–5) were detected using A9515 sequencing primer (CpG sites #1 and #2 were out of the assay coverage using this sequencing primer). hND1 sequencing primer detected high CpG methylation at all five CpG sites (CpG #1–5).

    Journal: PLoS ONE

    Article Title: Technical adequacy of bisulfite sequencing and pyrosequencing for detection of mitochondrial DNA methylation: Sources and avoidance of false-positive detection

    doi: 10.1371/journal.pone.0192722

    Figure Lengend Snippet: Detection of bisulfite-resistant cytosines in purified, linearized human mtDNA by bisulfite pyrosequencing using converted template-selective (A9515) and unselective (hND1) sequencing primers. Ratios of brCs were determined by bisulfite pyrosequencing (Mean±SD, triplicated assays). (A) The A9515 sequencing primer, which was highly selective to bisulfite-converted DNA, interrogated three CpG sites (CpG #3–5) whereas non-selective sequencing primer hND1 interrogated all these CpG sites plus two additional CpG sites (CpG #1 and 2). (B) Positive control assay was performed using in vitro partially methylated NCAs templates. High CpG methylation levels at three CpG sites (CpG #3–5) were detected using A9515 sequencing primer (CpG sites #1 and #2 were out of the assay coverage using this sequencing primer). hND1 sequencing primer detected high CpG methylation at all five CpG sites (CpG #1–5).

    Article Snippet: Equimolar mixture of shared mtDNA and lambda DNA was subjected to construction of Illumina shotgun bisulfite-seq deep sequencing libraries using NEBNEXT Ultra II DNA Library Prep Kit for Illumina, NEBNext Multiplex Oligos for Illumina (Methylated Adaptor, Index Primers Set 1), and the bisulfite conversion-compatible EpiMark Hot Start Taq DNA Polymerase (New England Biolabs).

    Techniques: Purification, Sequencing, Positive Control Assay, In Vitro, Methylation, CpG Methylation Assay

    Effects of unconverted DNA on false-positive detection of CpG methylation. Mixtures of bisulfite-converted and unconverted NCAs were subjected to bisulfite pyrosequencing using sequencing primers A9515 or hND1. Each bar represents mean±SD of three independent analyses.

    Journal: PLoS ONE

    Article Title: Technical adequacy of bisulfite sequencing and pyrosequencing for detection of mitochondrial DNA methylation: Sources and avoidance of false-positive detection

    doi: 10.1371/journal.pone.0192722

    Figure Lengend Snippet: Effects of unconverted DNA on false-positive detection of CpG methylation. Mixtures of bisulfite-converted and unconverted NCAs were subjected to bisulfite pyrosequencing using sequencing primers A9515 or hND1. Each bar represents mean±SD of three independent analyses.

    Article Snippet: Equimolar mixture of shared mtDNA and lambda DNA was subjected to construction of Illumina shotgun bisulfite-seq deep sequencing libraries using NEBNEXT Ultra II DNA Library Prep Kit for Illumina, NEBNext Multiplex Oligos for Illumina (Methylated Adaptor, Index Primers Set 1), and the bisulfite conversion-compatible EpiMark Hot Start Taq DNA Polymerase (New England Biolabs).

    Techniques: CpG Methylation Assay, Sequencing

    RepeatExplorer (RE) analysis of next-generation sequencing (NGS) data in Chenopodium diploids. ( A ) Cluster 61 of C. ficifolium demonstrate layouts that are typical for tandem repeats where nodes represent the sequence reads and edges between the nodes correspond to similarity hits; ( B ) Self-to-self comparisons of the contig 25 cluster 61 displayed as dot plots (genomic similarity search tool YASS program output) where parallel lines indicate tandem repeats (the distance between the diagonals equals the lengths of the motifs ~40 bp); ( C ) Agarose gel electrophoresis of PCR products obtained with primers designed from consensus monomer sequence of C. ficifolium (Cluster 61) showing typical ladder structure of tandem array.

    Journal: International Journal of Molecular Sciences

    Article Title: Natural History of a Satellite DNA Family: From the Ancestral Genome Component to Species-Specific Sequences, Concerted and Non-Concerted Evolution

    doi: 10.3390/ijms20051201

    Figure Lengend Snippet: RepeatExplorer (RE) analysis of next-generation sequencing (NGS) data in Chenopodium diploids. ( A ) Cluster 61 of C. ficifolium demonstrate layouts that are typical for tandem repeats where nodes represent the sequence reads and edges between the nodes correspond to similarity hits; ( B ) Self-to-self comparisons of the contig 25 cluster 61 displayed as dot plots (genomic similarity search tool YASS program output) where parallel lines indicate tandem repeats (the distance between the diagonals equals the lengths of the motifs ~40 bp); ( C ) Agarose gel electrophoresis of PCR products obtained with primers designed from consensus monomer sequence of C. ficifolium (Cluster 61) showing typical ladder structure of tandem array.

    Article Snippet: The individual libraries (corresponding to individual species) were enriched and indexed by unique barcodes using PCR with NEBNext Q5 HotStart HiFi PCR Master Mix and NEBNext Multiplex Oligos for Illumina (New England BioLabs) according to the manufacturer’s instructions.

    Techniques: Next-Generation Sequencing, Sequencing, Agarose Gel Electrophoresis, Polymerase Chain Reaction

    Agarose gel electrophoresis of PCR products obtained with primers designed from consensus monomer sequence of proposed high order repeat (HOR) units for determination of their physical counterparts. Cloned DNA fragments are shown by asterisks. The far-right line is an example of negative amplification of a computer-generated proposed HOR unit.

    Journal: International Journal of Molecular Sciences

    Article Title: Natural History of a Satellite DNA Family: From the Ancestral Genome Component to Species-Specific Sequences, Concerted and Non-Concerted Evolution

    doi: 10.3390/ijms20051201

    Figure Lengend Snippet: Agarose gel electrophoresis of PCR products obtained with primers designed from consensus monomer sequence of proposed high order repeat (HOR) units for determination of their physical counterparts. Cloned DNA fragments are shown by asterisks. The far-right line is an example of negative amplification of a computer-generated proposed HOR unit.

    Article Snippet: The individual libraries (corresponding to individual species) were enriched and indexed by unique barcodes using PCR with NEBNext Q5 HotStart HiFi PCR Master Mix and NEBNext Multiplex Oligos for Illumina (New England BioLabs) according to the manufacturer’s instructions.

    Techniques: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Sequencing, Clone Assay, Amplification, Generated