Structured Review

Illumina Inc multiplex oligos
Multiplex Oligos, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 45 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/multiplex oligos/product/Illumina Inc
Average 99 stars, based on 45 article reviews
Price from $9.99 to $1999.99
multiplex oligos - by Bioz Stars, 2020-04
99/100 stars

Images

Related Articles

Transduction:

Article Title: Mapping Cellular Reprogramming via Pooled Overexpression Screens with Paired Fitness and Single Cell RNA-Sequencing Readout
Article Snippet: Next Multiplex Oligos for Illumina (New England Biolabs) Index primers were used to attach Illumina adapters and indices to the samples. .. For amplification of barcodes from genomic DNA from cells transduced with the neural TF library in the TF-NoHygro format, genomic DNA was extracted from stored cell pellets with a DNeasy Blood and Tissue Kit (Qiagen).

Clone Assay:

Article Title: The human leukemia virus HTLV-1 alters the structure and transcription of host chromatin in cis
Article Snippet: The ChIP DNA libraries (ChIP and input DNAs) were prepared using NEBNext Ultra II DNA Library Prep Kit for Illumina and Multiplex Oligos for Illumina (New England Biolabs, NEB) according to the manufacturer’s instructions. .. CTCF ChIP libraries from three T-cell clones (two of which carry an HTLV-1 provirus), and a DNA input control were sequenced on the Ilumina platform.

Centrifugation:

Article Title: The genetics of venom ontogeny in the eastern diamondback rattlesnake (Crotalus adamanteus)
Article Snippet: A secondary ethanol precipitation step was used to further purify and concentrate the RNA by using Pellet Paint Co-Precipitant (EMD Millipore), 10% sodium acetate, and 100% ethanol, followed by centrifugation. .. The purified mRNA was immediately used for cDNA library preparation using the NEBNext Ultra RNA Library Prep Kit and Multiplex Oligos for Illumina (New England Biolabs).

Amplification:

Article Title: Convergent microevolution of Cryptococcus neoformans hypervirulence in the laboratory and the clinic
Article Snippet: The samples were A-tailed using Klenow fragment (New England Biolabs, USA) before ligating Multiplex Oligos for Illumina (Index primer set 1) (Illumina, USA) using T4 DNA ligase (New England Biolabs, USA). .. Ligated indexed samples were subsequently amplified as per the kit instructions, and then gel purified to remove adapter dimers and select optimal sizes (100 to 500 bp).

Article Title: Combinatorial CRISPR-Cas9 metabolic screens reveal critical redox control points dependent on the KEAP1-NRF2 regulatory axis
Article Snippet: By testing the amplification efficiency, we used 22 – 24 cycles at an annealing temperature of 55 °C with the following primers: Forward: ACACTCTTTCCCTACACGACGCTCTTCCGATCTTATATATCTTGTGGAAAGGACGAAACACC G; Reverse: GACTGGAGTTCAGACGTGTGCTCTTCCGATCTCCTTATTTTAACTTGCTATTTCTAGCTCTA. .. To attach Illumina sequencing adaptors and indexes, we used 50 ng of purified step I PCR product as template across four 50-μL PCR reactions with Kapa Hifi polymerase using primers of Next Multiplex Oligos for Illumina (New England Biosciences).

Article Title: A new targeted capture method using bacterial artificial chromosome (BAC) libraries as baits for sequencing relatively large genes
Article Snippet: To produce an indexed library using NEBNext Ultra DNA Library Prep Kit and Multiplex Oligos for Illumina (New England BioLabs), 500 ng of DNA was used. .. Sheared DNA was end-repaired, dA-tailed, ligated to Illumina specific adaptors, size selected to an approximate insert size of 400–500 bp by Agencourt AMPure XP beads (Beckman Coulter), and amplified by 6 or 7 cycles of PCR.

Article Title: Mapping Cellular Reprogramming via Pooled Overexpression Screens with Paired Fitness and Single Cell RNA-Sequencing Readout
Article Snippet: Paragraph title: Barcode Amplification ... Next Multiplex Oligos for Illumina (New England Biolabs) Index primers were used to attach Illumina adapters and indices to the samples.

Article Title: Complete Genome Sequence of the Avian Paramyxovirus Serotype 5 Strain APMV-5/budgerigar/Japan/TI/75
Article Snippet: With the extracted RNA, an MiSeq library indexed with i503 and i704 primers was prepared using the NEBNext Ultra RNA library prep kit and Multiplex Oligos for Illumina. .. The 3′-end and 5′-end of the virus genome were determined by the rapid amplification of the cDNA end (RACE) method and conventional Sanger sequencing as described previously , with virus-specific primer (VSP) 5-1 (5′ TCCAGTCATGGGTGGGCAAC 3′), VSP5-2 (5′ CGATCCTGAGAGTGTGATAGGAC 3′), VSP5-3 (5′ GGTCTTAGTAGATCAGCAACCC 3′), VSP3-1 (5′ GTTGCTGAATCGCTGACTATCC 3′), and VSP3-2 (5′ CTTGCGAGATAAGTCGGGAG 3′).

Article Title: The role of maternal-specific H3K9me3 modification in establishing imprinted X-chromosome inactivation and embryogenesis in mice
Article Snippet: ChIP combined with deep sequencing ChIP-Seq libraries were prepared using the NEBNext ChIP-Seq Library Prep Master Mix Set and Multiplex Oligos from Illumina (New England BioLabs Inc., Ipswich, MA, USA) according to the manufacturer’s instructions. .. Ten nanograms of ChIP or input DNA was subjected to end repair, dA-tailing and adaptor ligation, and amplified using nine cycles of PCR.

Article Title: A Method for Selectively Enriching Microbial DNA from Contaminating Vertebrate Host DNA
Article Snippet: Preparation of Next-generation Sequencing Libraries DNA extracted from saliva and leukocytes were used to generate SOLiD 4 libraries using NEBNext® Fast DNA Library Prep Set for Ion Torrent (NEB #E6270) with SOLiD 4 adaptors and primers; mixtures of DNA extracted form E. coli K-12 MG1655 and IMR-90 cells were used to generate Ion Torrent libraries using NEBNext Fast DNA Library Prep Set for Ion Torrent (NEB #E6270); DNA extracted from black molly was used to generate Illumina paired end sequencing libraries using NEBNext Ultra DNA Library Prep Kit and Multiplex Oligos for Illumina (NEB #E7370 and #E7335). .. Sheared DNA was end repaired, dA-tailed (Illumina libraries only), ligated to platform specific adaptors, size selected to an average size of ∼300–350 bp by Agencourt AMPure XP beads (Beckman Coulter #A63880), and amplified by 6 to 12 cycles of PCR.

Synthesized:

Article Title: Effect of over expressing protective antigen on global gene transcription in Bacillus anthracis BH500
Article Snippet: To the same reaction mix, second strand synthesis enzyme mix was added and synthesis was performed by incubating the sample at 16 °C for 1 h. The synthesized cDNA strands were purified using a 1:1 ratio of Agencourt AMPure XP beads (Beckman Coulter Genomics, Danvers, MA) and eluted with 60 µl of 0.1X TE Buffer. .. Later steps involved end repair of extracted cDNA, adapter ligation using blunt/TA ligase and cleavage by USER enzyme, purification with AMPure XP beads and PCR enrichment of cDNA library using different sets of Multiplex oligos for Illumina.

Real-time Polymerase Chain Reaction:

Article Title: The role of maternal-specific H3K9me3 modification in establishing imprinted X-chromosome inactivation and embryogenesis in mice
Article Snippet: ChIP combined with deep sequencing ChIP-Seq libraries were prepared using the NEBNext ChIP-Seq Library Prep Master Mix Set and Multiplex Oligos from Illumina (New England BioLabs Inc., Ipswich, MA, USA) according to the manufacturer’s instructions. .. After the concentration of each library was determined using qPCR with a KAPA Library Quantification Kit-Illumina/Universal system (KK4824, Kapa Biosystems, Wilmington, MA, USA), the libraries were sequenced using the HiSeq 1000 sequencing system (Illumina, San Diego, CA, USA) to generate 100 bp × 2 paired-end data.

Incubation:

Article Title: Convergent microevolution of Cryptococcus neoformans hypervirulence in the laboratory and the clinic
Article Snippet: Chromatin from the input sample and the IP sample was released by adding NaCl to a final concentration of 10 mM and incubation overnight at 65 °C. .. The samples were A-tailed using Klenow fragment (New England Biolabs, USA) before ligating Multiplex Oligos for Illumina (Index primer set 1) (Illumina, USA) using T4 DNA ligase (New England Biolabs, USA).

Article Title: Targeting legume loci: A comparison of three methods for target enrichment bait design in Leguminosae phylogenomics
Article Snippet: Genomic DNA was quantified with a Qubit 2.0 fluorometer (Invitrogen, Carlsbad, California, USA) using a high‐sensitivity kit and samples sonicated by QSonica (model Q800R2; Newtown, Connecticut, USA) for 45 to 60 s. The libraries were prepared using the NEBNext Ultra DNA Kit using multiplex oligos for Illumina (96 index primers; New England Biolabs, Ipswich, Massachusetts, USA) following the manufacturer's protocol. .. Libraries were hybridized with baits by multiplexing eight samples per reaction and incubated for 40 h. The KAPA HiFi HotStart Ready Mix kit (Kapa Biosystems, Wilmington, Massachusetts, USA) with the i5 and i7 primers was used for Illumina sequencing preparation.

Modification:

Article Title: Targeting legume loci: A comparison of three methods for target enrichment bait design in Leguminosae phylogenomics
Article Snippet: Genomic DNA was extracted from silica‐dried or herbarium material using a modified cetyltrimethylammonium bromide (CTAB) method (Doyle and Doyle, ) or the DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). .. Genomic DNA was quantified with a Qubit 2.0 fluorometer (Invitrogen, Carlsbad, California, USA) using a high‐sensitivity kit and samples sonicated by QSonica (model Q800R2; Newtown, Connecticut, USA) for 45 to 60 s. The libraries were prepared using the NEBNext Ultra DNA Kit using multiplex oligos for Illumina (96 index primers; New England Biolabs, Ipswich, Massachusetts, USA) following the manufacturer's protocol.

Western Blot:

Article Title: A new targeted capture method using bacterial artificial chromosome (BAC) libraries as baits for sequencing relatively large genes
Article Snippet: DNA was extracted from bloods of 24 moyamoya disease (MMD) cases collected at Kitasato University Hospital using DNA Extractor WB Kit (Wako Pure Chemical Industries; Osaka, Japan). .. To produce an indexed library using NEBNext Ultra DNA Library Prep Kit and Multiplex Oligos for Illumina (New England BioLabs), 500 ng of DNA was used.

Flow Cytometry:

Article Title: Convergent microevolution of Cryptococcus neoformans hypervirulence in the laboratory and the clinic
Article Snippet: The samples were A-tailed using Klenow fragment (New England Biolabs, USA) before ligating Multiplex Oligos for Illumina (Index primer set 1) (Illumina, USA) using T4 DNA ligase (New England Biolabs, USA). .. Libraries were 7-way multiplexed on an Illumina MiSeq flow cell using MiSeq Reagent Kit v3 (Illumina, USA).

Ligation:

Article Title: The role of maternal-specific H3K9me3 modification in establishing imprinted X-chromosome inactivation and embryogenesis in mice
Article Snippet: ChIP combined with deep sequencing ChIP-Seq libraries were prepared using the NEBNext ChIP-Seq Library Prep Master Mix Set and Multiplex Oligos from Illumina (New England BioLabs Inc., Ipswich, MA, USA) according to the manufacturer’s instructions. .. Ten nanograms of ChIP or input DNA was subjected to end repair, dA-tailing and adaptor ligation, and amplified using nine cycles of PCR.

Article Title: Effect of over expressing protective antigen on global gene transcription in Bacillus anthracis BH500
Article Snippet: .. Later steps involved end repair of extracted cDNA, adapter ligation using blunt/TA ligase and cleavage by USER enzyme, purification with AMPure XP beads and PCR enrichment of cDNA library using different sets of Multiplex oligos for Illumina. .. PCR enrichment mix was performed in thermocycler for initial denaturation (1 cycle): 98 °C for 30 secs; Denaturation-Annealing/Extension (15 cycles): 98 °C for 10 secs, 65 °C for 75 secs; final extension (1 cycle): 65 °C for 5 min.

Generated:

Article Title: Convergent microevolution of Cryptococcus neoformans hypervirulence in the laboratory and the clinic
Article Snippet: The samples were A-tailed using Klenow fragment (New England Biolabs, USA) before ligating Multiplex Oligos for Illumina (Index primer set 1) (Illumina, USA) using T4 DNA ligase (New England Biolabs, USA). .. Reads generated from the input and IP samples were aligned to the C. neoformans type strain H99 genome reference sequence using Bowtie.

Article Title: PacBio-Based Mitochondrial Genome Assembly of Leucaena trichandra (Leguminosae) and an Intrageneric Assessment of Mitochondrial RNA Editing
Article Snippet: RNA-seq data generated from three biological replicates per sample (three whole seedlings harvested at the third-leaf stage of development) that were combined, extracted, sequenced, and mapped to the L. trichandra mt-genome. .. RNA was extracted using the Norgen Plant RNA/DNA Purification Kit (Norgen Corp., Toronto, CA) and treated with plant rRNA depletion reagents (courtesy of New England Biolabs) prior to library construction using the NEBNext Ultra II RNA First Strand Synthesis Module (#E7771), Ultra II Directional RNA Second Strand Synthesis Module (#E7550), Ultra II DNA Library Prep Kit for Illumina (#E7645), and Multiplex Oligos for Illumina (Index Primers Sets 1 & 2) (#E7335 and #E7500).

DNA Sequencing:

Article Title: PacBio-Based Mitochondrial Genome Assembly of Leucaena trichandra (Leguminosae) and an Intrageneric Assessment of Mitochondrial RNA Editing
Article Snippet: RNA editing was assessed empirically through a combination of additional RNA-seq and DNA-seq data resources. .. RNA was extracted using the Norgen Plant RNA/DNA Purification Kit (Norgen Corp., Toronto, CA) and treated with plant rRNA depletion reagents (courtesy of New England Biolabs) prior to library construction using the NEBNext Ultra II RNA First Strand Synthesis Module (#E7771), Ultra II Directional RNA Second Strand Synthesis Module (#E7550), Ultra II DNA Library Prep Kit for Illumina (#E7645), and Multiplex Oligos for Illumina (Index Primers Sets 1 & 2) (#E7335 and #E7500).

Sequencing:

Article Title: Convergent microevolution of Cryptococcus neoformans hypervirulence in the laboratory and the clinic
Article Snippet: The samples were A-tailed using Klenow fragment (New England Biolabs, USA) before ligating Multiplex Oligos for Illumina (Index primer set 1) (Illumina, USA) using T4 DNA ligase (New England Biolabs, USA). .. Reads generated from the input and IP samples were aligned to the C. neoformans type strain H99 genome reference sequence using Bowtie.

Article Title: Combinatorial CRISPR-Cas9 metabolic screens reveal critical redox control points dependent on the KEAP1-NRF2 regulatory axis
Article Snippet: .. To attach Illumina sequencing adaptors and indexes, we used 50 ng of purified step I PCR product as template across four 50-μL PCR reactions with Kapa Hifi polymerase using primers of Next Multiplex Oligos for Illumina (New England Biosciences). ..

Article Title: Mapping Cellular Reprogramming via Pooled Overexpression Screens with Paired Fitness and Single Cell RNA-Sequencing Readout
Article Snippet: Next Multiplex Oligos for Illumina (New England Biolabs) Index primers were used to attach Illumina adapters and indices to the samples. .. The purified second-step PCR library was quantified by Qubit dsDNA HS assay (Thermo Fisher Scientific) and used for downstream sequencing on an Illumina HiSeq platform.

Article Title: The human leukemia virus HTLV-1 alters the structure and transcription of host chromatin in cis
Article Snippet: Paragraph title: ChIP sequencing (ChIP-seq) ... The ChIP DNA libraries (ChIP and input DNAs) were prepared using NEBNext Ultra II DNA Library Prep Kit for Illumina and Multiplex Oligos for Illumina (New England Biolabs, NEB) according to the manufacturer’s instructions.

Article Title: The genetics of venom ontogeny in the eastern diamondback rattlesnake (Crotalus adamanteus)
Article Snippet: Paragraph title: Venom-gland transcriptome sequencing ... The purified mRNA was immediately used for cDNA library preparation using the NEBNext Ultra RNA Library Prep Kit and Multiplex Oligos for Illumina (New England Biolabs).

Article Title: Targeting legume loci: A comparison of three methods for target enrichment bait design in Leguminosae phylogenomics
Article Snippet: Genomic DNA was quantified with a Qubit 2.0 fluorometer (Invitrogen, Carlsbad, California, USA) using a high‐sensitivity kit and samples sonicated by QSonica (model Q800R2; Newtown, Connecticut, USA) for 45 to 60 s. The libraries were prepared using the NEBNext Ultra DNA Kit using multiplex oligos for Illumina (96 index primers; New England Biolabs, Ipswich, Massachusetts, USA) following the manufacturer's protocol. .. Libraries were hybridized with baits by multiplexing eight samples per reaction and incubated for 40 h. The KAPA HiFi HotStart Ready Mix kit (Kapa Biosystems, Wilmington, Massachusetts, USA) with the i5 and i7 primers was used for Illumina sequencing preparation.

Article Title: PacBio-Based Mitochondrial Genome Assembly of Leucaena trichandra (Leguminosae) and an Intrageneric Assessment of Mitochondrial RNA Editing
Article Snippet: Each of these samples was subjected to two-independent library preps and sequencing runs (technical replicates). .. RNA was extracted using the Norgen Plant RNA/DNA Purification Kit (Norgen Corp., Toronto, CA) and treated with plant rRNA depletion reagents (courtesy of New England Biolabs) prior to library construction using the NEBNext Ultra II RNA First Strand Synthesis Module (#E7771), Ultra II Directional RNA Second Strand Synthesis Module (#E7550), Ultra II DNA Library Prep Kit for Illumina (#E7645), and Multiplex Oligos for Illumina (Index Primers Sets 1 & 2) (#E7335 and #E7500).

Article Title: The role of maternal-specific H3K9me3 modification in establishing imprinted X-chromosome inactivation and embryogenesis in mice
Article Snippet: .. ChIP combined with deep sequencing ChIP-Seq libraries were prepared using the NEBNext ChIP-Seq Library Prep Master Mix Set and Multiplex Oligos from Illumina (New England BioLabs Inc., Ipswich, MA, USA) according to the manufacturer’s instructions. .. Ten nanograms of ChIP or input DNA was subjected to end repair, dA-tailing and adaptor ligation, and amplified using nine cycles of PCR.

Article Title: A Method for Selectively Enriching Microbial DNA from Contaminating Vertebrate Host DNA
Article Snippet: .. Preparation of Next-generation Sequencing Libraries DNA extracted from saliva and leukocytes were used to generate SOLiD 4 libraries using NEBNext® Fast DNA Library Prep Set for Ion Torrent (NEB #E6270) with SOLiD 4 adaptors and primers; mixtures of DNA extracted form E. coli K-12 MG1655 and IMR-90 cells were used to generate Ion Torrent libraries using NEBNext Fast DNA Library Prep Set for Ion Torrent (NEB #E6270); DNA extracted from black molly was used to generate Illumina paired end sequencing libraries using NEBNext Ultra DNA Library Prep Kit and Multiplex Oligos for Illumina (NEB #E7370 and #E7335). .. Briefly, genomic DNA was sheared using a Covaris S2 device to obtain an average fragment size of ∼200 bp.

Article Title: Evaluating the Performance of De Novo Assembly Methods for Venom-Gland Transcriptomics
Article Snippet: Paragraph title: 4.2. Tissue Preparation and Sequencing ... Total RNA from venom glands, with equimolar pooling of right and left venom gland RNA from the snakes, was used for mRNA isolation with the NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs, Ipswich, MA, USA), followed by the preparation of cDNA libraries using the NEBNext Ultra RNA Library Prep Kit (New England Biolabs) and Multiplex Oligos for Illumina (New England Biolabs), according to the manufacturer’s instructions.

Sonication:

Article Title: The human leukemia virus HTLV-1 alters the structure and transcription of host chromatin in cis
Article Snippet: ChIP sequencing (ChIP-seq) Cells (1.5 × 107 ) were cross-linked with 1% formaldehyde at room temperature for 5 min. Nuclear cell lysates were sonicated with a Covaris S2 and immunoprecipitated using anti-CTCF (Millipore #07–729; RRID: AB_441965 ) antibody. .. The ChIP DNA libraries (ChIP and input DNAs) were prepared using NEBNext Ultra II DNA Library Prep Kit for Illumina and Multiplex Oligos for Illumina (New England Biolabs, NEB) according to the manufacturer’s instructions.

Article Title: Targeting legume loci: A comparison of three methods for target enrichment bait design in Leguminosae phylogenomics
Article Snippet: .. Genomic DNA was quantified with a Qubit 2.0 fluorometer (Invitrogen, Carlsbad, California, USA) using a high‐sensitivity kit and samples sonicated by QSonica (model Q800R2; Newtown, Connecticut, USA) for 45 to 60 s. The libraries were prepared using the NEBNext Ultra DNA Kit using multiplex oligos for Illumina (96 index primers; New England Biolabs, Ipswich, Massachusetts, USA) following the manufacturer's protocol. .. Quantification of libraries was done by Qubit, and library size validation was carried out using an Agilent 2200 TapeStation system with High Sensitivity D1000 ScreenTapes (Agilent Technologies, Santa Clara, California, USA).

ChIP-sequencing:

Article Title: Convergent microevolution of Cryptococcus neoformans hypervirulence in the laboratory and the clinic
Article Snippet: Paragraph title: ChIP-Seq ... The samples were A-tailed using Klenow fragment (New England Biolabs, USA) before ligating Multiplex Oligos for Illumina (Index primer set 1) (Illumina, USA) using T4 DNA ligase (New England Biolabs, USA).

Article Title: The human leukemia virus HTLV-1 alters the structure and transcription of host chromatin in cis
Article Snippet: Paragraph title: ChIP sequencing (ChIP-seq) ... The ChIP DNA libraries (ChIP and input DNAs) were prepared using NEBNext Ultra II DNA Library Prep Kit for Illumina and Multiplex Oligos for Illumina (New England Biolabs, NEB) according to the manufacturer’s instructions.

Article Title: The role of maternal-specific H3K9me3 modification in establishing imprinted X-chromosome inactivation and embryogenesis in mice
Article Snippet: .. ChIP combined with deep sequencing ChIP-Seq libraries were prepared using the NEBNext ChIP-Seq Library Prep Master Mix Set and Multiplex Oligos from Illumina (New England BioLabs Inc., Ipswich, MA, USA) according to the manufacturer’s instructions. .. Ten nanograms of ChIP or input DNA was subjected to end repair, dA-tailing and adaptor ligation, and amplified using nine cycles of PCR.

Multiplexing:

Article Title: Targeting legume loci: A comparison of three methods for target enrichment bait design in Leguminosae phylogenomics
Article Snippet: Genomic DNA was quantified with a Qubit 2.0 fluorometer (Invitrogen, Carlsbad, California, USA) using a high‐sensitivity kit and samples sonicated by QSonica (model Q800R2; Newtown, Connecticut, USA) for 45 to 60 s. The libraries were prepared using the NEBNext Ultra DNA Kit using multiplex oligos for Illumina (96 index primers; New England Biolabs, Ipswich, Massachusetts, USA) following the manufacturer's protocol. .. Libraries were hybridized with baits by multiplexing eight samples per reaction and incubated for 40 h. The KAPA HiFi HotStart Ready Mix kit (Kapa Biosystems, Wilmington, Massachusetts, USA) with the i5 and i7 primers was used for Illumina sequencing preparation.

RNA Sequencing Assay:

Article Title: The genetics of venom ontogeny in the eastern diamondback rattlesnake (Crotalus adamanteus)
Article Snippet: Prior to RNA-seq library preparation, 1–2 µg of total RNA was used to isolate mRNA using the NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs). .. The purified mRNA was immediately used for cDNA library preparation using the NEBNext Ultra RNA Library Prep Kit and Multiplex Oligos for Illumina (New England Biolabs).

Article Title: PacBio-Based Mitochondrial Genome Assembly of Leucaena trichandra (Leguminosae) and an Intrageneric Assessment of Mitochondrial RNA Editing
Article Snippet: These RNA-seq data (SRP103307) were developed from divergent Leucaena species to represent at least one member of each well-supported clade (genome group) within the genus , including L. cruziana (Oxford Forestry Institute seedlot 43/85/16), L. cuspidata (83/94), L. esculenta (47/87/01), L. pulverulenta (84/87/05), and L. trichandra (4/91/15), as well as the allotetraploid hybrid of L. cruziana and L. pulverulenta , L. leucocephala (80/92/02) ( ). .. RNA was extracted using the Norgen Plant RNA/DNA Purification Kit (Norgen Corp., Toronto, CA) and treated with plant rRNA depletion reagents (courtesy of New England Biolabs) prior to library construction using the NEBNext Ultra II RNA First Strand Synthesis Module (#E7771), Ultra II Directional RNA Second Strand Synthesis Module (#E7550), Ultra II DNA Library Prep Kit for Illumina (#E7645), and Multiplex Oligos for Illumina (Index Primers Sets 1 & 2) (#E7335 and #E7500).

Article Title: Effect of over expressing protective antigen on global gene transcription in Bacillus anthracis BH500
Article Snippet: Paragraph title: RNA-seq library preparation ... Later steps involved end repair of extracted cDNA, adapter ligation using blunt/TA ligase and cleavage by USER enzyme, purification with AMPure XP beads and PCR enrichment of cDNA library using different sets of Multiplex oligos for Illumina.

Isolation:

Article Title: The genetics of venom ontogeny in the eastern diamondback rattlesnake (Crotalus adamanteus)
Article Snippet: Prior to RNA-seq library preparation, 1–2 µg of total RNA was used to isolate mRNA using the NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs). .. The purified mRNA was immediately used for cDNA library preparation using the NEBNext Ultra RNA Library Prep Kit and Multiplex Oligos for Illumina (New England Biolabs).

Article Title: Evaluating the Performance of De Novo Assembly Methods for Venom-Gland Transcriptomics
Article Snippet: .. Total RNA from venom glands, with equimolar pooling of right and left venom gland RNA from the snakes, was used for mRNA isolation with the NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs, Ipswich, MA, USA), followed by the preparation of cDNA libraries using the NEBNext Ultra RNA Library Prep Kit (New England Biolabs) and Multiplex Oligos for Illumina (New England Biolabs), according to the manufacturer’s instructions. .. Purification of resultant cDNA was carried out with Agencourt Ampure XP PCR Purification Beads (Beckman Coulter, Inc., Brea, CA, USA).

Multiplex Assay:

Article Title: Convergent microevolution of Cryptococcus neoformans hypervirulence in the laboratory and the clinic
Article Snippet: .. The samples were A-tailed using Klenow fragment (New England Biolabs, USA) before ligating Multiplex Oligos for Illumina (Index primer set 1) (Illumina, USA) using T4 DNA ligase (New England Biolabs, USA). .. Ligated indexed samples were subsequently amplified as per the kit instructions, and then gel purified to remove adapter dimers and select optimal sizes (100 to 500 bp).

Article Title: Combinatorial CRISPR-Cas9 metabolic screens reveal critical redox control points dependent on the KEAP1-NRF2 regulatory axis
Article Snippet: .. To attach Illumina sequencing adaptors and indexes, we used 50 ng of purified step I PCR product as template across four 50-μL PCR reactions with Kapa Hifi polymerase using primers of Next Multiplex Oligos for Illumina (New England Biosciences). ..

Article Title: A new targeted capture method using bacterial artificial chromosome (BAC) libraries as baits for sequencing relatively large genes
Article Snippet: .. To produce an indexed library using NEBNext Ultra DNA Library Prep Kit and Multiplex Oligos for Illumina (New England BioLabs), 500 ng of DNA was used. .. Sheared DNA was end-repaired, dA-tailed, ligated to Illumina specific adaptors, size selected to an approximate insert size of 400–500 bp by Agencourt AMPure XP beads (Beckman Coulter), and amplified by 6 or 7 cycles of PCR.

Article Title: Mapping Cellular Reprogramming via Pooled Overexpression Screens with Paired Fitness and Single Cell RNA-Sequencing Readout
Article Snippet: .. Next Multiplex Oligos for Illumina (New England Biolabs) Index primers were used to attach Illumina adapters and indices to the samples. ..

Article Title: The human leukemia virus HTLV-1 alters the structure and transcription of host chromatin in cis
Article Snippet: .. The ChIP DNA libraries (ChIP and input DNAs) were prepared using NEBNext Ultra II DNA Library Prep Kit for Illumina and Multiplex Oligos for Illumina (New England Biolabs, NEB) according to the manufacturer’s instructions. .. Libraries were sequenced (single-end 50 bp reads) on a HiSeq 2500 (Illumina).

Article Title: The genetics of venom ontogeny in the eastern diamondback rattlesnake (Crotalus adamanteus)
Article Snippet: .. The purified mRNA was immediately used for cDNA library preparation using the NEBNext Ultra RNA Library Prep Kit and Multiplex Oligos for Illumina (New England Biolabs). .. PCR was performed using the NEBNext High-Fidelity 2X Hot Start PCR Master Mix and 14 cycles of PCR to achieve the desired DNA concentration for sequencing.

Article Title: Complete Genome Sequence of the Avian Paramyxovirus Serotype 5 Strain APMV-5/budgerigar/Japan/TI/75
Article Snippet: .. With the extracted RNA, an MiSeq library indexed with i503 and i704 primers was prepared using the NEBNext Ultra RNA library prep kit and Multiplex Oligos for Illumina. .. Of the library, 0.16 fmol was pooled in a total of 9 fmol of MiSeq libraries comprising nonparamyxovirus libraries and sequenced on the MiSeq using the MiSeq reagent kit v3 (Illumina) with 2 × 300-bp paired-end read lengths.

Article Title: Targeting legume loci: A comparison of three methods for target enrichment bait design in Leguminosae phylogenomics
Article Snippet: .. Genomic DNA was quantified with a Qubit 2.0 fluorometer (Invitrogen, Carlsbad, California, USA) using a high‐sensitivity kit and samples sonicated by QSonica (model Q800R2; Newtown, Connecticut, USA) for 45 to 60 s. The libraries were prepared using the NEBNext Ultra DNA Kit using multiplex oligos for Illumina (96 index primers; New England Biolabs, Ipswich, Massachusetts, USA) following the manufacturer's protocol. .. Quantification of libraries was done by Qubit, and library size validation was carried out using an Agilent 2200 TapeStation system with High Sensitivity D1000 ScreenTapes (Agilent Technologies, Santa Clara, California, USA).

Article Title: PacBio-Based Mitochondrial Genome Assembly of Leucaena trichandra (Leguminosae) and an Intrageneric Assessment of Mitochondrial RNA Editing
Article Snippet: .. RNA was extracted using the Norgen Plant RNA/DNA Purification Kit (Norgen Corp., Toronto, CA) and treated with plant rRNA depletion reagents (courtesy of New England Biolabs) prior to library construction using the NEBNext Ultra II RNA First Strand Synthesis Module (#E7771), Ultra II Directional RNA Second Strand Synthesis Module (#E7550), Ultra II DNA Library Prep Kit for Illumina (#E7645), and Multiplex Oligos for Illumina (Index Primers Sets 1 & 2) (#E7335 and #E7500). .. Pooled libraries were sequenced on an Illumina NextSeq 500 (2 × 150 paired-end), and the untrimmed reads are available via the NCBI SRA project PRJNA379675.

Article Title: The role of maternal-specific H3K9me3 modification in establishing imprinted X-chromosome inactivation and embryogenesis in mice
Article Snippet: .. ChIP combined with deep sequencing ChIP-Seq libraries were prepared using the NEBNext ChIP-Seq Library Prep Master Mix Set and Multiplex Oligos from Illumina (New England BioLabs Inc., Ipswich, MA, USA) according to the manufacturer’s instructions. .. Ten nanograms of ChIP or input DNA was subjected to end repair, dA-tailing and adaptor ligation, and amplified using nine cycles of PCR.

Article Title: A Method for Selectively Enriching Microbial DNA from Contaminating Vertebrate Host DNA
Article Snippet: .. Preparation of Next-generation Sequencing Libraries DNA extracted from saliva and leukocytes were used to generate SOLiD 4 libraries using NEBNext® Fast DNA Library Prep Set for Ion Torrent (NEB #E6270) with SOLiD 4 adaptors and primers; mixtures of DNA extracted form E. coli K-12 MG1655 and IMR-90 cells were used to generate Ion Torrent libraries using NEBNext Fast DNA Library Prep Set for Ion Torrent (NEB #E6270); DNA extracted from black molly was used to generate Illumina paired end sequencing libraries using NEBNext Ultra DNA Library Prep Kit and Multiplex Oligos for Illumina (NEB #E7370 and #E7335). .. Briefly, genomic DNA was sheared using a Covaris S2 device to obtain an average fragment size of ∼200 bp.

Article Title: Evaluating the Performance of De Novo Assembly Methods for Venom-Gland Transcriptomics
Article Snippet: .. Total RNA from venom glands, with equimolar pooling of right and left venom gland RNA from the snakes, was used for mRNA isolation with the NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs, Ipswich, MA, USA), followed by the preparation of cDNA libraries using the NEBNext Ultra RNA Library Prep Kit (New England Biolabs) and Multiplex Oligos for Illumina (New England Biolabs), according to the manufacturer’s instructions. .. Purification of resultant cDNA was carried out with Agencourt Ampure XP PCR Purification Beads (Beckman Coulter, Inc., Brea, CA, USA).

Article Title: Effect of over expressing protective antigen on global gene transcription in Bacillus anthracis BH500
Article Snippet: .. Later steps involved end repair of extracted cDNA, adapter ligation using blunt/TA ligase and cleavage by USER enzyme, purification with AMPure XP beads and PCR enrichment of cDNA library using different sets of Multiplex oligos for Illumina. .. PCR enrichment mix was performed in thermocycler for initial denaturation (1 cycle): 98 °C for 30 secs; Denaturation-Annealing/Extension (15 cycles): 98 °C for 10 secs, 65 °C for 75 secs; final extension (1 cycle): 65 °C for 5 min.

Purification:

Article Title: Convergent microevolution of Cryptococcus neoformans hypervirulence in the laboratory and the clinic
Article Snippet: Purified ChIP-DNA for the input and IP samples was end repaired with Klenow DNA polymerase (New England Biolabs, USA) and purified using AMPure XP beads (Agencourt, USA). .. The samples were A-tailed using Klenow fragment (New England Biolabs, USA) before ligating Multiplex Oligos for Illumina (Index primer set 1) (Illumina, USA) using T4 DNA ligase (New England Biolabs, USA).

Article Title: Combinatorial CRISPR-Cas9 metabolic screens reveal critical redox control points dependent on the KEAP1-NRF2 regulatory axis
Article Snippet: .. To attach Illumina sequencing adaptors and indexes, we used 50 ng of purified step I PCR product as template across four 50-μL PCR reactions with Kapa Hifi polymerase using primers of Next Multiplex Oligos for Illumina (New England Biosciences). ..

Article Title: A new targeted capture method using bacterial artificial chromosome (BAC) libraries as baits for sequencing relatively large genes
Article Snippet: To produce an indexed library using NEBNext Ultra DNA Library Prep Kit and Multiplex Oligos for Illumina (New England BioLabs), 500 ng of DNA was used. .. The libraries were purified using Agencourt AMPure XP beads (Beckman Coulter).

Article Title: Mapping Cellular Reprogramming via Pooled Overexpression Screens with Paired Fitness and Single Cell RNA-Sequencing Readout
Article Snippet: The third step of PCR was performed as two separate 50 μl reactions with 50 ng of second step purified PCR product per reaction with Kapa Hifi Hotstart ReadyMix. .. Next Multiplex Oligos for Illumina (New England Biolabs) Index primers were used to attach Illumina adapters and indices to the samples.

Article Title: The genetics of venom ontogeny in the eastern diamondback rattlesnake (Crotalus adamanteus)
Article Snippet: .. The purified mRNA was immediately used for cDNA library preparation using the NEBNext Ultra RNA Library Prep Kit and Multiplex Oligos for Illumina (New England Biolabs). .. PCR was performed using the NEBNext High-Fidelity 2X Hot Start PCR Master Mix and 14 cycles of PCR to achieve the desired DNA concentration for sequencing.

Article Title: PacBio-Based Mitochondrial Genome Assembly of Leucaena trichandra (Leguminosae) and an Intrageneric Assessment of Mitochondrial RNA Editing
Article Snippet: .. RNA was extracted using the Norgen Plant RNA/DNA Purification Kit (Norgen Corp., Toronto, CA) and treated with plant rRNA depletion reagents (courtesy of New England Biolabs) prior to library construction using the NEBNext Ultra II RNA First Strand Synthesis Module (#E7771), Ultra II Directional RNA Second Strand Synthesis Module (#E7550), Ultra II DNA Library Prep Kit for Illumina (#E7645), and Multiplex Oligos for Illumina (Index Primers Sets 1 & 2) (#E7335 and #E7500). .. Pooled libraries were sequenced on an Illumina NextSeq 500 (2 × 150 paired-end), and the untrimmed reads are available via the NCBI SRA project PRJNA379675.

Article Title: Evaluating the Performance of De Novo Assembly Methods for Venom-Gland Transcriptomics
Article Snippet: Total RNA from venom glands, with equimolar pooling of right and left venom gland RNA from the snakes, was used for mRNA isolation with the NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs, Ipswich, MA, USA), followed by the preparation of cDNA libraries using the NEBNext Ultra RNA Library Prep Kit (New England Biolabs) and Multiplex Oligos for Illumina (New England Biolabs), according to the manufacturer’s instructions. .. Purification of resultant cDNA was carried out with Agencourt Ampure XP PCR Purification Beads (Beckman Coulter, Inc., Brea, CA, USA).

Article Title: Effect of over expressing protective antigen on global gene transcription in Bacillus anthracis BH500
Article Snippet: .. Later steps involved end repair of extracted cDNA, adapter ligation using blunt/TA ligase and cleavage by USER enzyme, purification with AMPure XP beads and PCR enrichment of cDNA library using different sets of Multiplex oligos for Illumina. .. PCR enrichment mix was performed in thermocycler for initial denaturation (1 cycle): 98 °C for 30 secs; Denaturation-Annealing/Extension (15 cycles): 98 °C for 10 secs, 65 °C for 75 secs; final extension (1 cycle): 65 °C for 5 min.

Polymerase Chain Reaction:

Article Title: Convergent microevolution of Cryptococcus neoformans hypervirulence in the laboratory and the clinic
Article Snippet: Samples were treated with RNase A for 30 min at 37 °C followed by pronase for 2 hr at 42 °C, and extracted using a QIAquick PCR Purification Kit (QI AGEN, Netherlands). .. The samples were A-tailed using Klenow fragment (New England Biolabs, USA) before ligating Multiplex Oligos for Illumina (Index primer set 1) (Illumina, USA) using T4 DNA ligase (New England Biolabs, USA).

Article Title: Combinatorial CRISPR-Cas9 metabolic screens reveal critical redox control points dependent on the KEAP1-NRF2 regulatory axis
Article Snippet: .. To attach Illumina sequencing adaptors and indexes, we used 50 ng of purified step I PCR product as template across four 50-μL PCR reactions with Kapa Hifi polymerase using primers of Next Multiplex Oligos for Illumina (New England Biosciences). ..

Article Title: A new targeted capture method using bacterial artificial chromosome (BAC) libraries as baits for sequencing relatively large genes
Article Snippet: To produce an indexed library using NEBNext Ultra DNA Library Prep Kit and Multiplex Oligos for Illumina (New England BioLabs), 500 ng of DNA was used. .. Sheared DNA was end-repaired, dA-tailed, ligated to Illumina specific adaptors, size selected to an approximate insert size of 400–500 bp by Agencourt AMPure XP beads (Beckman Coulter), and amplified by 6 or 7 cycles of PCR.

Article Title: Mapping Cellular Reprogramming via Pooled Overexpression Screens with Paired Fitness and Single Cell RNA-Sequencing Readout
Article Snippet: The third step of PCR was performed as two separate 50 μl reactions with 50 ng of second step purified PCR product per reaction with Kapa Hifi Hotstart ReadyMix. .. Next Multiplex Oligos for Illumina (New England Biolabs) Index primers were used to attach Illumina adapters and indices to the samples.

Article Title: The genetics of venom ontogeny in the eastern diamondback rattlesnake (Crotalus adamanteus)
Article Snippet: The purified mRNA was immediately used for cDNA library preparation using the NEBNext Ultra RNA Library Prep Kit and Multiplex Oligos for Illumina (New England Biolabs). .. PCR was performed using the NEBNext High-Fidelity 2X Hot Start PCR Master Mix and 14 cycles of PCR to achieve the desired DNA concentration for sequencing.

Article Title: The role of maternal-specific H3K9me3 modification in establishing imprinted X-chromosome inactivation and embryogenesis in mice
Article Snippet: ChIP combined with deep sequencing ChIP-Seq libraries were prepared using the NEBNext ChIP-Seq Library Prep Master Mix Set and Multiplex Oligos from Illumina (New England BioLabs Inc., Ipswich, MA, USA) according to the manufacturer’s instructions. .. Ten nanograms of ChIP or input DNA was subjected to end repair, dA-tailing and adaptor ligation, and amplified using nine cycles of PCR.

Article Title: A Method for Selectively Enriching Microbial DNA from Contaminating Vertebrate Host DNA
Article Snippet: Preparation of Next-generation Sequencing Libraries DNA extracted from saliva and leukocytes were used to generate SOLiD 4 libraries using NEBNext® Fast DNA Library Prep Set for Ion Torrent (NEB #E6270) with SOLiD 4 adaptors and primers; mixtures of DNA extracted form E. coli K-12 MG1655 and IMR-90 cells were used to generate Ion Torrent libraries using NEBNext Fast DNA Library Prep Set for Ion Torrent (NEB #E6270); DNA extracted from black molly was used to generate Illumina paired end sequencing libraries using NEBNext Ultra DNA Library Prep Kit and Multiplex Oligos for Illumina (NEB #E7370 and #E7335). .. Sheared DNA was end repaired, dA-tailed (Illumina libraries only), ligated to platform specific adaptors, size selected to an average size of ∼300–350 bp by Agencourt AMPure XP beads (Beckman Coulter #A63880), and amplified by 6 to 12 cycles of PCR.

Article Title: Evaluating the Performance of De Novo Assembly Methods for Venom-Gland Transcriptomics
Article Snippet: Total RNA from venom glands, with equimolar pooling of right and left venom gland RNA from the snakes, was used for mRNA isolation with the NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs, Ipswich, MA, USA), followed by the preparation of cDNA libraries using the NEBNext Ultra RNA Library Prep Kit (New England Biolabs) and Multiplex Oligos for Illumina (New England Biolabs), according to the manufacturer’s instructions. .. Purification of resultant cDNA was carried out with Agencourt Ampure XP PCR Purification Beads (Beckman Coulter, Inc., Brea, CA, USA).

Article Title: Effect of over expressing protective antigen on global gene transcription in Bacillus anthracis BH500
Article Snippet: .. Later steps involved end repair of extracted cDNA, adapter ligation using blunt/TA ligase and cleavage by USER enzyme, purification with AMPure XP beads and PCR enrichment of cDNA library using different sets of Multiplex oligos for Illumina. .. PCR enrichment mix was performed in thermocycler for initial denaturation (1 cycle): 98 °C for 30 secs; Denaturation-Annealing/Extension (15 cycles): 98 °C for 10 secs, 65 °C for 75 secs; final extension (1 cycle): 65 °C for 5 min.

Immunoprecipitation:

Article Title: Convergent microevolution of Cryptococcus neoformans hypervirulence in the laboratory and the clinic
Article Snippet: The protein-bound beads were washed sequentially with rotation in 1 mL buffer A, buffer B (50 mM HEPES pH 7.5, 500 mM NaCl, 1 mM EDTA, 1% (v/v) Triton X-100, 0.1% (w/v) sodium deoxycholate), buffer C (10 mM Tris-HCl pH 8.0, 250 mM LiCl, 1 mM EDTA, 0.5% (v/v) NP-40, 0.5% w/v sodium deoxycholate), and buffer D (10 mM Tris, 1 mM EDTA), with immunoprecipitated protein eluted in buffer E (50 mM Tris pH 8.0, 10 mM EDTA, 1% (w/v) SDS). .. The samples were A-tailed using Klenow fragment (New England Biolabs, USA) before ligating Multiplex Oligos for Illumina (Index primer set 1) (Illumina, USA) using T4 DNA ligase (New England Biolabs, USA).

Article Title: The human leukemia virus HTLV-1 alters the structure and transcription of host chromatin in cis
Article Snippet: ChIP sequencing (ChIP-seq) Cells (1.5 × 107 ) were cross-linked with 1% formaldehyde at room temperature for 5 min. Nuclear cell lysates were sonicated with a Covaris S2 and immunoprecipitated using anti-CTCF (Millipore #07–729; RRID: AB_441965 ) antibody. .. The ChIP DNA libraries (ChIP and input DNAs) were prepared using NEBNext Ultra II DNA Library Prep Kit for Illumina and Multiplex Oligos for Illumina (New England Biolabs, NEB) according to the manufacturer’s instructions.

cDNA Library Assay:

Article Title: The genetics of venom ontogeny in the eastern diamondback rattlesnake (Crotalus adamanteus)
Article Snippet: .. The purified mRNA was immediately used for cDNA library preparation using the NEBNext Ultra RNA Library Prep Kit and Multiplex Oligos for Illumina (New England Biolabs). .. PCR was performed using the NEBNext High-Fidelity 2X Hot Start PCR Master Mix and 14 cycles of PCR to achieve the desired DNA concentration for sequencing.

Article Title: Effect of over expressing protective antigen on global gene transcription in Bacillus anthracis BH500
Article Snippet: .. Later steps involved end repair of extracted cDNA, adapter ligation using blunt/TA ligase and cleavage by USER enzyme, purification with AMPure XP beads and PCR enrichment of cDNA library using different sets of Multiplex oligos for Illumina. .. PCR enrichment mix was performed in thermocycler for initial denaturation (1 cycle): 98 °C for 30 secs; Denaturation-Annealing/Extension (15 cycles): 98 °C for 10 secs, 65 °C for 75 secs; final extension (1 cycle): 65 °C for 5 min.

Hot Start PCR:

Article Title: The genetics of venom ontogeny in the eastern diamondback rattlesnake (Crotalus adamanteus)
Article Snippet: The purified mRNA was immediately used for cDNA library preparation using the NEBNext Ultra RNA Library Prep Kit and Multiplex Oligos for Illumina (New England Biolabs). .. PCR was performed using the NEBNext High-Fidelity 2X Hot Start PCR Master Mix and 14 cycles of PCR to achieve the desired DNA concentration for sequencing.

Chromatin Immunoprecipitation:

Article Title: Convergent microevolution of Cryptococcus neoformans hypervirulence in the laboratory and the clinic
Article Snippet: Purified ChIP-DNA for the input and IP samples was end repaired with Klenow DNA polymerase (New England Biolabs, USA) and purified using AMPure XP beads (Agencourt, USA). .. The samples were A-tailed using Klenow fragment (New England Biolabs, USA) before ligating Multiplex Oligos for Illumina (Index primer set 1) (Illumina, USA) using T4 DNA ligase (New England Biolabs, USA).

Article Title: The human leukemia virus HTLV-1 alters the structure and transcription of host chromatin in cis
Article Snippet: .. The ChIP DNA libraries (ChIP and input DNAs) were prepared using NEBNext Ultra II DNA Library Prep Kit for Illumina and Multiplex Oligos for Illumina (New England Biolabs, NEB) according to the manufacturer’s instructions. .. Libraries were sequenced (single-end 50 bp reads) on a HiSeq 2500 (Illumina).

Article Title: The role of maternal-specific H3K9me3 modification in establishing imprinted X-chromosome inactivation and embryogenesis in mice
Article Snippet: .. ChIP combined with deep sequencing ChIP-Seq libraries were prepared using the NEBNext ChIP-Seq Library Prep Master Mix Set and Multiplex Oligos from Illumina (New England BioLabs Inc., Ipswich, MA, USA) according to the manufacturer’s instructions. .. Ten nanograms of ChIP or input DNA was subjected to end repair, dA-tailing and adaptor ligation, and amplified using nine cycles of PCR.

RNA Extraction:

Article Title: Evaluating the Performance of De Novo Assembly Methods for Venom-Gland Transcriptomics
Article Snippet: Venom gland RNA extraction was accomplished with Trizol (Invitrogen, Carlsbad, CA, USA) extraction, where homogenized gland tissue was transferred to 500 μL of Trizol. .. Total RNA from venom glands, with equimolar pooling of right and left venom gland RNA from the snakes, was used for mRNA isolation with the NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs, Ipswich, MA, USA), followed by the preparation of cDNA libraries using the NEBNext Ultra RNA Library Prep Kit (New England Biolabs) and Multiplex Oligos for Illumina (New England Biolabs), according to the manufacturer’s instructions.

Selection:

Article Title: Combinatorial CRISPR-Cas9 metabolic screens reveal critical redox control points dependent on the KEAP1-NRF2 regulatory axis
Article Snippet: The amplicons were pooled and purified with Agencourt AMPure XP bead at a double selection of 0.55× and then 0.8×. .. To attach Illumina sequencing adaptors and indexes, we used 50 ng of purified step I PCR product as template across four 50-μL PCR reactions with Kapa Hifi polymerase using primers of Next Multiplex Oligos for Illumina (New England Biosciences).

Ethanol Precipitation:

Article Title: The genetics of venom ontogeny in the eastern diamondback rattlesnake (Crotalus adamanteus)
Article Snippet: A secondary ethanol precipitation step was used to further purify and concentrate the RNA by using Pellet Paint Co-Precipitant (EMD Millipore), 10% sodium acetate, and 100% ethanol, followed by centrifugation. .. The purified mRNA was immediately used for cDNA library preparation using the NEBNext Ultra RNA Library Prep Kit and Multiplex Oligos for Illumina (New England Biolabs).

Next-Generation Sequencing:

Article Title: A Method for Selectively Enriching Microbial DNA from Contaminating Vertebrate Host DNA
Article Snippet: .. Preparation of Next-generation Sequencing Libraries DNA extracted from saliva and leukocytes were used to generate SOLiD 4 libraries using NEBNext® Fast DNA Library Prep Set for Ion Torrent (NEB #E6270) with SOLiD 4 adaptors and primers; mixtures of DNA extracted form E. coli K-12 MG1655 and IMR-90 cells were used to generate Ion Torrent libraries using NEBNext Fast DNA Library Prep Set for Ion Torrent (NEB #E6270); DNA extracted from black molly was used to generate Illumina paired end sequencing libraries using NEBNext Ultra DNA Library Prep Kit and Multiplex Oligos for Illumina (NEB #E7370 and #E7335). .. Briefly, genomic DNA was sheared using a Covaris S2 device to obtain an average fragment size of ∼200 bp.

Concentration Assay:

Article Title: Convergent microevolution of Cryptococcus neoformans hypervirulence in the laboratory and the clinic
Article Snippet: Chromatin from the input sample and the IP sample was released by adding NaCl to a final concentration of 10 mM and incubation overnight at 65 °C. .. The samples were A-tailed using Klenow fragment (New England Biolabs, USA) before ligating Multiplex Oligos for Illumina (Index primer set 1) (Illumina, USA) using T4 DNA ligase (New England Biolabs, USA).

Article Title: The genetics of venom ontogeny in the eastern diamondback rattlesnake (Crotalus adamanteus)
Article Snippet: The purified mRNA was immediately used for cDNA library preparation using the NEBNext Ultra RNA Library Prep Kit and Multiplex Oligos for Illumina (New England Biolabs). .. PCR was performed using the NEBNext High-Fidelity 2X Hot Start PCR Master Mix and 14 cycles of PCR to achieve the desired DNA concentration for sequencing.

Article Title: The role of maternal-specific H3K9me3 modification in establishing imprinted X-chromosome inactivation and embryogenesis in mice
Article Snippet: ChIP combined with deep sequencing ChIP-Seq libraries were prepared using the NEBNext ChIP-Seq Library Prep Master Mix Set and Multiplex Oligos from Illumina (New England BioLabs Inc., Ipswich, MA, USA) according to the manufacturer’s instructions. .. After the concentration of each library was determined using qPCR with a KAPA Library Quantification Kit-Illumina/Universal system (KK4824, Kapa Biosystems, Wilmington, MA, USA), the libraries were sequenced using the HiSeq 1000 sequencing system (Illumina, San Diego, CA, USA) to generate 100 bp × 2 paired-end data.

Article Title: Evaluating the Performance of De Novo Assembly Methods for Venom-Gland Transcriptomics
Article Snippet: The concentration of the RNA was determined with the Qubit Broad Range RNA assay (Thermo-Fisher Scientific, Waltham, MA, USA) and quality of the extraction was checked on a Bioanalyzer using the RNA 6000 Pico Kit (Agilent Technologies, Santa Clara, CA, USA). .. Total RNA from venom glands, with equimolar pooling of right and left venom gland RNA from the snakes, was used for mRNA isolation with the NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs, Ipswich, MA, USA), followed by the preparation of cDNA libraries using the NEBNext Ultra RNA Library Prep Kit (New England Biolabs) and Multiplex Oligos for Illumina (New England Biolabs), according to the manufacturer’s instructions.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    Illumina Inc multiplexed illumina oligonucleotide assays
    (A) Genotyping of parental lines and 576 Ae. tauschii F 2 plants in the AL8/78 × AS75 mapping population with <t>Illumina</t> GoldenGate oligonucleotide assay querying an A/G SNP at EST locus BE499478 (nucleotide position 403 in the Ae. tauschii reference sequence, ) . The graph is a normalized polar coordinate ( R , θ ) plot. Theta ( x -axis) is an angle of deviation of Cy3 and Cy5 fluorescence from pure Cy3 and pure Cy5 signal (0 and 1). The closer a point is to 0 or 1, the greater the proportion of Cy3 or Cy5 fluorescent signal, respectively, is present. R ( y -axis) is the Manhattan distance of observed Cy3 and Cy5 fluorescence to the origin (pole), which is 0 fluorescence. The closer a point is to 0 on the y -axis, the weaker the total fluorescence. The red, blue and purple ovals have the diameter of 2 standard deviations computed from the dispersal of the red, blue and purple dots, respectively. The darker colored regions define genotype call areas for homozygous (red and blue dots) and heterozygous (purple dots) plants. The numbers of plants in each cluster are indicated below the x -axis. (B) Clustering of 57 BAC and BiBAC super-pools assayed with the same oligonucleotides as in (A). Genotype call areas derived from the mapping population shown in 1A were directly exported for analysis of the BAC pools. The green and orange spots represent the parental genotypes of the mapping population; the red spots are the BAC and BiBAC pools scored by us as positive and black spots BAC and BiBAC pools scored as negative. Note that all red spots have the same normalized angular deviation (normalized theta) as DNA of Ae. tauschii AL8/78 and large distance from origin ( R value) indicating high fluorescence. In contrast, the black spots have a low R value indicating only residual Cy3 and Cy5 fluorescence and variable values of normalized theta ranging from 0 all the way to 1. (C) Clustering of the same 57 BAC and BiBAC super-pools without defining call areas on the basis of clustering segregating Ae. tauschii SNP genotypes. Note failure of separation of the positive and negative clusters from each other.
    Multiplexed Illumina Oligonucleotide Assays, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/multiplexed illumina oligonucleotide assays/product/Illumina Inc
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    multiplexed illumina oligonucleotide assays - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    99
    Illumina Inc illumina adapters
    Schematic representation of different strategies for viral genome resequencing. A) Total RNA library: all the RNA species present in the sample are sequenced, no assumption on which genome is present, B) Hybridisation capture of a mRNA library: a good reference genome is needed to design the probes for capture, C) PCR enrichment: the desired genome is amplified from cDNA, a reference genome is needed to design specific oligos. Red lines, genomes of interest; Blue segments, <t>Illumina</t> adapters; Black lines, other RNA species.
    Illumina Adapters, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 44 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/illumina adapters/product/Illumina Inc
    Average 99 stars, based on 44 article reviews
    Price from $9.99 to $1999.99
    illumina adapters - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    92
    Illumina Inc microarray oligonucleotide
    Results of singleplex amplification and <t>microarray</t> hybridization of select, biotin-labelled amplified purified pathogen DNA targets and hybridization to the Alere ArrayTube TM printed meningitis microarray. ( A ) No template control singleplex amplification, ( B ) Streptococcus pneumoniae singleplex amplification (Primers SPne1_2, 2.5 ng/mL target DNA), ( C ) Listeria monocytogenes singleplex amplification (Primers LiMo4_6, 2.5 ng/mL target DNA), ( D ) Staphyl aureus singleplex amplification (Primers StAUB_3, 2.5 ng/mL DNA). ( E ) N. meningitidis Serogroup B singleplex amplification (Primers NsMB4, 2.5 ng/mL DNA), ( F ) No template control multiplex amplification, ( G ) S. pneumoniae multiplex amplification, ( H ) L. monocytogenes multiplex amplification, ( I ) S. aureus multiplex amplification, ( J ) N. meningitidis serogroup B multiplex amplification.
    Microarray Oligonucleotide, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/microarray oligonucleotide/product/Illumina Inc
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    microarray oligonucleotide - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    94
    Illumina Inc illumina primer sequences
    SdRNAs are specifically processed from annotated snoRNA loci. a Transcripts arising from various annotated snoRNA loci have now been definitively shown to participate in at least two distinct noncoding RNA regulatory pathways. Individual loci can produce snoRNAs functioning exclusively as either a traditional RNA editor ( right ) or as a functional miRNA precursor ( left ) while some loci have now been confirmed to produce transcripts at times engaging in both types of noncoding RNA regulation ( center ) (reviewed in ref. 5 ). MiRNA-like excision products are illustrated in black ( left and center ) as excision products of primary transcript. Complementary RNA editing targets are shown in red ( right and center ). b The most thermodynamically stable secondary structures of putative sdRNA producing snoRNAs with sdRNA sequences highlighted in green as calculated by Mfold. 53 Common name and Ensembl gene id for putatively processed snoRNAs are listed below corresponding structures. “Hits” refer to the number of times fragments of putative sdRNA producing snoRNAs perfectly aligned to small RNA-seq reads from individual SRA datasets. Numbers preceding total numbers of hits correspond to the number of times positions highlighted in green (putative sdRNAs) perfectly aligned to small RNA-seq reads (e.g., 1555 of 1581 small RNA reads aligning to snoRNA-1b corresponded to the sequence highlighted in green ). c Alignment between the human genome (GRCh38:7:22856601:22856699:1) ( top ), snoRNA-93 (ENSG00000221740) ( middle ), and next generation small RNA sequence read ( bottom ) obtained by <t>Illumina</t> sequencing of MDA-MB-231 RNA is shown. All sequences are in the 5′ to 3′ direction. An asterisk indicates base identity between the snoRNA and genome. Vertical lines indicate identity across all three sequences
    Illumina Primer Sequences, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 94/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/illumina primer sequences/product/Illumina Inc
    Average 94 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    illumina primer sequences - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    Image Search Results


    (A) Genotyping of parental lines and 576 Ae. tauschii F 2 plants in the AL8/78 × AS75 mapping population with Illumina GoldenGate oligonucleotide assay querying an A/G SNP at EST locus BE499478 (nucleotide position 403 in the Ae. tauschii reference sequence, ) . The graph is a normalized polar coordinate ( R , θ ) plot. Theta ( x -axis) is an angle of deviation of Cy3 and Cy5 fluorescence from pure Cy3 and pure Cy5 signal (0 and 1). The closer a point is to 0 or 1, the greater the proportion of Cy3 or Cy5 fluorescent signal, respectively, is present. R ( y -axis) is the Manhattan distance of observed Cy3 and Cy5 fluorescence to the origin (pole), which is 0 fluorescence. The closer a point is to 0 on the y -axis, the weaker the total fluorescence. The red, blue and purple ovals have the diameter of 2 standard deviations computed from the dispersal of the red, blue and purple dots, respectively. The darker colored regions define genotype call areas for homozygous (red and blue dots) and heterozygous (purple dots) plants. The numbers of plants in each cluster are indicated below the x -axis. (B) Clustering of 57 BAC and BiBAC super-pools assayed with the same oligonucleotides as in (A). Genotype call areas derived from the mapping population shown in 1A were directly exported for analysis of the BAC pools. The green and orange spots represent the parental genotypes of the mapping population; the red spots are the BAC and BiBAC pools scored by us as positive and black spots BAC and BiBAC pools scored as negative. Note that all red spots have the same normalized angular deviation (normalized theta) as DNA of Ae. tauschii AL8/78 and large distance from origin ( R value) indicating high fluorescence. In contrast, the black spots have a low R value indicating only residual Cy3 and Cy5 fluorescence and variable values of normalized theta ranging from 0 all the way to 1. (C) Clustering of the same 57 BAC and BiBAC super-pools without defining call areas on the basis of clustering segregating Ae. tauschii SNP genotypes. Note failure of separation of the positive and negative clusters from each other.

    Journal: BMC Genomics

    Article Title: A high-throughput strategy for screening of bacterial artificial chromosome libraries and anchoring of clones on a genetic map constructed with single nucleotide polymorphisms

    doi: 10.1186/1471-2164-10-28

    Figure Lengend Snippet: (A) Genotyping of parental lines and 576 Ae. tauschii F 2 plants in the AL8/78 × AS75 mapping population with Illumina GoldenGate oligonucleotide assay querying an A/G SNP at EST locus BE499478 (nucleotide position 403 in the Ae. tauschii reference sequence, ) . The graph is a normalized polar coordinate ( R , θ ) plot. Theta ( x -axis) is an angle of deviation of Cy3 and Cy5 fluorescence from pure Cy3 and pure Cy5 signal (0 and 1). The closer a point is to 0 or 1, the greater the proportion of Cy3 or Cy5 fluorescent signal, respectively, is present. R ( y -axis) is the Manhattan distance of observed Cy3 and Cy5 fluorescence to the origin (pole), which is 0 fluorescence. The closer a point is to 0 on the y -axis, the weaker the total fluorescence. The red, blue and purple ovals have the diameter of 2 standard deviations computed from the dispersal of the red, blue and purple dots, respectively. The darker colored regions define genotype call areas for homozygous (red and blue dots) and heterozygous (purple dots) plants. The numbers of plants in each cluster are indicated below the x -axis. (B) Clustering of 57 BAC and BiBAC super-pools assayed with the same oligonucleotides as in (A). Genotype call areas derived from the mapping population shown in 1A were directly exported for analysis of the BAC pools. The green and orange spots represent the parental genotypes of the mapping population; the red spots are the BAC and BiBAC pools scored by us as positive and black spots BAC and BiBAC pools scored as negative. Note that all red spots have the same normalized angular deviation (normalized theta) as DNA of Ae. tauschii AL8/78 and large distance from origin ( R value) indicating high fluorescence. In contrast, the black spots have a low R value indicating only residual Cy3 and Cy5 fluorescence and variable values of normalized theta ranging from 0 all the way to 1. (C) Clustering of the same 57 BAC and BiBAC super-pools without defining call areas on the basis of clustering segregating Ae. tauschii SNP genotypes. Note failure of separation of the positive and negative clusters from each other.

    Article Snippet: The multiplexed Illumina oligonucleotide assays are most time and cost effective if large numbers of markers in large numbers of DNAs are genotyped and if no additional work is needed to identify positive BAC clones.

    Techniques: Oligonucleotide Assay, Sequencing, Fluorescence, BAC Assay, Derivative Assay

    Schematic representation of different strategies for viral genome resequencing. A) Total RNA library: all the RNA species present in the sample are sequenced, no assumption on which genome is present, B) Hybridisation capture of a mRNA library: a good reference genome is needed to design the probes for capture, C) PCR enrichment: the desired genome is amplified from cDNA, a reference genome is needed to design specific oligos. Red lines, genomes of interest; Blue segments, Illumina adapters; Black lines, other RNA species.

    Journal: PLoS ONE

    Article Title: A Modified RNA-Seq Approach for Whole Genome Sequencing of RNA Viruses from Faecal and Blood Samples

    doi: 10.1371/journal.pone.0066129

    Figure Lengend Snippet: Schematic representation of different strategies for viral genome resequencing. A) Total RNA library: all the RNA species present in the sample are sequenced, no assumption on which genome is present, B) Hybridisation capture of a mRNA library: a good reference genome is needed to design the probes for capture, C) PCR enrichment: the desired genome is amplified from cDNA, a reference genome is needed to design specific oligos. Red lines, genomes of interest; Blue segments, Illumina adapters; Black lines, other RNA species.

    Article Snippet: Additionally, upon ligation of Illumina Adapters (Multiplexing Sample Preparation Oligonucleotide Kit) each library was size selected with two Ampure Bead steps (firstly, 1∶0.7× volume and secondly, the supernatant from the first bind was taken for a 1∶1.7× volume clean-up), selecting 200–600 bp fragments in 30 µl 10 mM Tris-Cl, pH 8.5.

    Techniques: Hybridization, Capture-C, Polymerase Chain Reaction, Amplification

    Results of singleplex amplification and microarray hybridization of select, biotin-labelled amplified purified pathogen DNA targets and hybridization to the Alere ArrayTube TM printed meningitis microarray. ( A ) No template control singleplex amplification, ( B ) Streptococcus pneumoniae singleplex amplification (Primers SPne1_2, 2.5 ng/mL target DNA), ( C ) Listeria monocytogenes singleplex amplification (Primers LiMo4_6, 2.5 ng/mL target DNA), ( D ) Staphyl aureus singleplex amplification (Primers StAUB_3, 2.5 ng/mL DNA). ( E ) N. meningitidis Serogroup B singleplex amplification (Primers NsMB4, 2.5 ng/mL DNA), ( F ) No template control multiplex amplification, ( G ) S. pneumoniae multiplex amplification, ( H ) L. monocytogenes multiplex amplification, ( I ) S. aureus multiplex amplification, ( J ) N. meningitidis serogroup B multiplex amplification.

    Journal: High-Throughput

    Article Title: Development and Assessment of a Diagnostic DNA Oligonucleotide Microarray for Detection and Typing of Meningitis-Associated Bacterial Species

    doi: 10.3390/ht7040032

    Figure Lengend Snippet: Results of singleplex amplification and microarray hybridization of select, biotin-labelled amplified purified pathogen DNA targets and hybridization to the Alere ArrayTube TM printed meningitis microarray. ( A ) No template control singleplex amplification, ( B ) Streptococcus pneumoniae singleplex amplification (Primers SPne1_2, 2.5 ng/mL target DNA), ( C ) Listeria monocytogenes singleplex amplification (Primers LiMo4_6, 2.5 ng/mL target DNA), ( D ) Staphyl aureus singleplex amplification (Primers StAUB_3, 2.5 ng/mL DNA). ( E ) N. meningitidis Serogroup B singleplex amplification (Primers NsMB4, 2.5 ng/mL DNA), ( F ) No template control multiplex amplification, ( G ) S. pneumoniae multiplex amplification, ( H ) L. monocytogenes multiplex amplification, ( I ) S. aureus multiplex amplification, ( J ) N. meningitidis serogroup B multiplex amplification.

    Article Snippet: Printing of Microarray Oligonucleotide Probes in Glass Slide Format All 50- and 70-mer bacterial species and strain oligonucleotide probes for the glass slide format microarray were synthesised by Illumina (Illumina, Cambridge, UK) and printed in quadruplicate onto epoxy-coated Nexterion E slides (Schott Ltd., Stafford, UK) using a BioRobotics Microgrid II gridder (Digilab Inc., Hopkinton, MA, USA).

    Techniques: Amplification, Microarray, Hybridization, Purification, Multiplex Assay

    Fluorescence intensity heat-map of probe hybridization using amplified targets from patient cerebral spinal fluid (CSF) nucleic acids, hybridized to the glass slide-printed meningitis microarray using the manual hybridization method and formamide-free hybridization buffer.

    Journal: High-Throughput

    Article Title: Development and Assessment of a Diagnostic DNA Oligonucleotide Microarray for Detection and Typing of Meningitis-Associated Bacterial Species

    doi: 10.3390/ht7040032

    Figure Lengend Snippet: Fluorescence intensity heat-map of probe hybridization using amplified targets from patient cerebral spinal fluid (CSF) nucleic acids, hybridized to the glass slide-printed meningitis microarray using the manual hybridization method and formamide-free hybridization buffer.

    Article Snippet: Printing of Microarray Oligonucleotide Probes in Glass Slide Format All 50- and 70-mer bacterial species and strain oligonucleotide probes for the glass slide format microarray were synthesised by Illumina (Illumina, Cambridge, UK) and printed in quadruplicate onto epoxy-coated Nexterion E slides (Schott Ltd., Stafford, UK) using a BioRobotics Microgrid II gridder (Digilab Inc., Hopkinton, MA, USA).

    Techniques: Fluorescence, Hybridization, Amplification, Microarray

    Fluorescence intensity of probe hybridization with amplified Cy3-labelled bacterial DNA targets using purified pathogen nucleic acids to the glass slide-printed meningitis microarray, depicted in heatmap format ( A ) nonmeningococcal pathogens, ( B ) typed meningococcal pathogens, ( C ) untyped meningococcal pathogens, and ( D ) nonmeningococcal Neisseria spp.

    Journal: High-Throughput

    Article Title: Development and Assessment of a Diagnostic DNA Oligonucleotide Microarray for Detection and Typing of Meningitis-Associated Bacterial Species

    doi: 10.3390/ht7040032

    Figure Lengend Snippet: Fluorescence intensity of probe hybridization with amplified Cy3-labelled bacterial DNA targets using purified pathogen nucleic acids to the glass slide-printed meningitis microarray, depicted in heatmap format ( A ) nonmeningococcal pathogens, ( B ) typed meningococcal pathogens, ( C ) untyped meningococcal pathogens, and ( D ) nonmeningococcal Neisseria spp.

    Article Snippet: Printing of Microarray Oligonucleotide Probes in Glass Slide Format All 50- and 70-mer bacterial species and strain oligonucleotide probes for the glass slide format microarray were synthesised by Illumina (Illumina, Cambridge, UK) and printed in quadruplicate onto epoxy-coated Nexterion E slides (Schott Ltd., Stafford, UK) using a BioRobotics Microgrid II gridder (Digilab Inc., Hopkinton, MA, USA).

    Techniques: Fluorescence, Hybridization, Amplification, Purification, Microarray

    Fluorescence intensity of probe hybridization with amplified targets using patient CSF nucleic acids, depicted in heat-map format. From the glass slide-printed meningitis microarray, hybridizations using the Advalytix hybridization platform and formamide-containing hybridization buffer.

    Journal: High-Throughput

    Article Title: Development and Assessment of a Diagnostic DNA Oligonucleotide Microarray for Detection and Typing of Meningitis-Associated Bacterial Species

    doi: 10.3390/ht7040032

    Figure Lengend Snippet: Fluorescence intensity of probe hybridization with amplified targets using patient CSF nucleic acids, depicted in heat-map format. From the glass slide-printed meningitis microarray, hybridizations using the Advalytix hybridization platform and formamide-containing hybridization buffer.

    Article Snippet: Printing of Microarray Oligonucleotide Probes in Glass Slide Format All 50- and 70-mer bacterial species and strain oligonucleotide probes for the glass slide format microarray were synthesised by Illumina (Illumina, Cambridge, UK) and printed in quadruplicate onto epoxy-coated Nexterion E slides (Schott Ltd., Stafford, UK) using a BioRobotics Microgrid II gridder (Digilab Inc., Hopkinton, MA, USA).

    Techniques: Fluorescence, Hybridization, Amplification, Microarray

    SdRNAs are specifically processed from annotated snoRNA loci. a Transcripts arising from various annotated snoRNA loci have now been definitively shown to participate in at least two distinct noncoding RNA regulatory pathways. Individual loci can produce snoRNAs functioning exclusively as either a traditional RNA editor ( right ) or as a functional miRNA precursor ( left ) while some loci have now been confirmed to produce transcripts at times engaging in both types of noncoding RNA regulation ( center ) (reviewed in ref. 5 ). MiRNA-like excision products are illustrated in black ( left and center ) as excision products of primary transcript. Complementary RNA editing targets are shown in red ( right and center ). b The most thermodynamically stable secondary structures of putative sdRNA producing snoRNAs with sdRNA sequences highlighted in green as calculated by Mfold. 53 Common name and Ensembl gene id for putatively processed snoRNAs are listed below corresponding structures. “Hits” refer to the number of times fragments of putative sdRNA producing snoRNAs perfectly aligned to small RNA-seq reads from individual SRA datasets. Numbers preceding total numbers of hits correspond to the number of times positions highlighted in green (putative sdRNAs) perfectly aligned to small RNA-seq reads (e.g., 1555 of 1581 small RNA reads aligning to snoRNA-1b corresponded to the sequence highlighted in green ). c Alignment between the human genome (GRCh38:7:22856601:22856699:1) ( top ), snoRNA-93 (ENSG00000221740) ( middle ), and next generation small RNA sequence read ( bottom ) obtained by Illumina sequencing of MDA-MB-231 RNA is shown. All sequences are in the 5′ to 3′ direction. An asterisk indicates base identity between the snoRNA and genome. Vertical lines indicate identity across all three sequences

    Journal: NPJ Breast Cancer

    Article Title: Human snoRNA-93 is processed into a microRNA-like RNA that promotes breast cancer cell invasion

    doi: 10.1038/s41523-017-0032-8

    Figure Lengend Snippet: SdRNAs are specifically processed from annotated snoRNA loci. a Transcripts arising from various annotated snoRNA loci have now been definitively shown to participate in at least two distinct noncoding RNA regulatory pathways. Individual loci can produce snoRNAs functioning exclusively as either a traditional RNA editor ( right ) or as a functional miRNA precursor ( left ) while some loci have now been confirmed to produce transcripts at times engaging in both types of noncoding RNA regulation ( center ) (reviewed in ref. 5 ). MiRNA-like excision products are illustrated in black ( left and center ) as excision products of primary transcript. Complementary RNA editing targets are shown in red ( right and center ). b The most thermodynamically stable secondary structures of putative sdRNA producing snoRNAs with sdRNA sequences highlighted in green as calculated by Mfold. 53 Common name and Ensembl gene id for putatively processed snoRNAs are listed below corresponding structures. “Hits” refer to the number of times fragments of putative sdRNA producing snoRNAs perfectly aligned to small RNA-seq reads from individual SRA datasets. Numbers preceding total numbers of hits correspond to the number of times positions highlighted in green (putative sdRNAs) perfectly aligned to small RNA-seq reads (e.g., 1555 of 1581 small RNA reads aligning to snoRNA-1b corresponded to the sequence highlighted in green ). c Alignment between the human genome (GRCh38:7:22856601:22856699:1) ( top ), snoRNA-93 (ENSG00000221740) ( middle ), and next generation small RNA sequence read ( bottom ) obtained by Illumina sequencing of MDA-MB-231 RNA is shown. All sequences are in the 5′ to 3′ direction. An asterisk indicates base identity between the snoRNA and genome. Vertical lines indicate identity across all three sequences

    Article Snippet: Trimmomatic v0.22 (available at www.usadellab.org ) was utilized to remove 5′ and 3′ adapter and Illumina primer sequences from raw reads.

    Techniques: Functional Assay, RNA Sequencing Assay, Sequencing, Multiple Displacement Amplification