Structured Review

Illumina Inc multiplex oligos
Multiplex Oligos, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 89/100, based on 40 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/multiplex oligos/product/Illumina Inc
Average 89 stars, based on 40 article reviews
Price from $9.99 to $1999.99
multiplex oligos - by Bioz Stars, 2020-07
89/100 stars

Images

Related Articles

Multiplex Assay:

Article Title: Convergent microevolution of Cryptococcus neoformans hypervirulence in the laboratory and the clinic
Article Snippet: .. The samples were A-tailed using Klenow fragment (New England Biolabs, USA) before ligating Multiplex Oligos for Illumina (Index primer set 1) (Illumina, USA) using T4 DNA ligase (New England Biolabs, USA). .. Ligated indexed samples were subsequently amplified as per the kit instructions, and then gel purified to remove adapter dimers and select optimal sizes (100 to 500 bp).

Article Title: A new targeted capture method using bacterial artificial chromosome (BAC) libraries as baits for sequencing relatively large genes
Article Snippet: .. To produce an indexed library using NEBNext Ultra DNA Library Prep Kit and Multiplex Oligos for Illumina (New England BioLabs), 500 ng of DNA was used. .. Sheared DNA was end-repaired, dA-tailed, ligated to Illumina specific adaptors, size selected to an approximate insert size of 400–500 bp by Agencourt AMPure XP beads (Beckman Coulter), and amplified by 6 or 7 cycles of PCR.

Article Title: Complete Genome Sequence of the Avian Paramyxovirus Serotype 5 Strain APMV-5/budgerigar/Japan/TI/75
Article Snippet: .. With the extracted RNA, an MiSeq library indexed with i503 and i704 primers was prepared using the NEBNext Ultra RNA library prep kit and Multiplex Oligos for Illumina. .. Of the library, 0.16 fmol was pooled in a total of 9 fmol of MiSeq libraries comprising nonparamyxovirus libraries and sequenced on the MiSeq using the MiSeq reagent kit v3 (Illumina) with 2 × 300-bp paired-end read lengths.

Article Title: PacBio-Based Mitochondrial Genome Assembly of Leucaena trichandra (Leguminosae) and an Intrageneric Assessment of Mitochondrial RNA Editing
Article Snippet: .. RNA was extracted using the Norgen Plant RNA/DNA Purification Kit (Norgen Corp., Toronto, CA) and treated with plant rRNA depletion reagents (courtesy of New England Biolabs) prior to library construction using the NEBNext Ultra II RNA First Strand Synthesis Module (#E7771), Ultra II Directional RNA Second Strand Synthesis Module (#E7550), Ultra II DNA Library Prep Kit for Illumina (#E7645), and Multiplex Oligos for Illumina (Index Primers Sets 1 & 2) (#E7335 and #E7500). .. Pooled libraries were sequenced on an Illumina NextSeq 500 (2 × 150 paired-end), and the untrimmed reads are available via the NCBI SRA project PRJNA379675.

Article Title: The role of maternal-specific H3K9me3 modification in establishing imprinted X-chromosome inactivation and embryogenesis in mice
Article Snippet: .. ChIP combined with deep sequencing ChIP-Seq libraries were prepared using the NEBNext ChIP-Seq Library Prep Master Mix Set and Multiplex Oligos from Illumina (New England BioLabs Inc., Ipswich, MA, USA) according to the manufacturer’s instructions. .. Ten nanograms of ChIP or input DNA was subjected to end repair, dA-tailing and adaptor ligation, and amplified using nine cycles of PCR.

Article Title: Evaluating the Performance of De Novo Assembly Methods for Venom-Gland Transcriptomics
Article Snippet: .. Total RNA from venom glands, with equimolar pooling of right and left venom gland RNA from the snakes, was used for mRNA isolation with the NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs, Ipswich, MA, USA), followed by the preparation of cDNA libraries using the NEBNext Ultra RNA Library Prep Kit (New England Biolabs) and Multiplex Oligos for Illumina (New England Biolabs), according to the manufacturer’s instructions. .. Purification of resultant cDNA was carried out with Agencourt Ampure XP PCR Purification Beads (Beckman Coulter, Inc., Brea, CA, USA).

Article Title: Effect of over expressing protective antigen on global gene transcription in Bacillus anthracis BH500
Article Snippet: .. Later steps involved end repair of extracted cDNA, adapter ligation using blunt/TA ligase and cleavage by USER enzyme, purification with AMPure XP beads and PCR enrichment of cDNA library using different sets of Multiplex oligos for Illumina. .. PCR enrichment mix was performed in thermocycler for initial denaturation (1 cycle): 98 °C for 30 secs; Denaturation-Annealing/Extension (15 cycles): 98 °C for 10 secs, 65 °C for 75 secs; final extension (1 cycle): 65 °C for 5 min.

Sequencing:

Article Title: The role of maternal-specific H3K9me3 modification in establishing imprinted X-chromosome inactivation and embryogenesis in mice
Article Snippet: .. ChIP combined with deep sequencing ChIP-Seq libraries were prepared using the NEBNext ChIP-Seq Library Prep Master Mix Set and Multiplex Oligos from Illumina (New England BioLabs Inc., Ipswich, MA, USA) according to the manufacturer’s instructions. .. Ten nanograms of ChIP or input DNA was subjected to end repair, dA-tailing and adaptor ligation, and amplified using nine cycles of PCR.

Ligation:

Article Title: Effect of over expressing protective antigen on global gene transcription in Bacillus anthracis BH500
Article Snippet: .. Later steps involved end repair of extracted cDNA, adapter ligation using blunt/TA ligase and cleavage by USER enzyme, purification with AMPure XP beads and PCR enrichment of cDNA library using different sets of Multiplex oligos for Illumina. .. PCR enrichment mix was performed in thermocycler for initial denaturation (1 cycle): 98 °C for 30 secs; Denaturation-Annealing/Extension (15 cycles): 98 °C for 10 secs, 65 °C for 75 secs; final extension (1 cycle): 65 °C for 5 min.

Isolation:

Article Title: Evaluating the Performance of De Novo Assembly Methods for Venom-Gland Transcriptomics
Article Snippet: .. Total RNA from venom glands, with equimolar pooling of right and left venom gland RNA from the snakes, was used for mRNA isolation with the NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs, Ipswich, MA, USA), followed by the preparation of cDNA libraries using the NEBNext Ultra RNA Library Prep Kit (New England Biolabs) and Multiplex Oligos for Illumina (New England Biolabs), according to the manufacturer’s instructions. .. Purification of resultant cDNA was carried out with Agencourt Ampure XP PCR Purification Beads (Beckman Coulter, Inc., Brea, CA, USA).

Purification:

Article Title: PacBio-Based Mitochondrial Genome Assembly of Leucaena trichandra (Leguminosae) and an Intrageneric Assessment of Mitochondrial RNA Editing
Article Snippet: .. RNA was extracted using the Norgen Plant RNA/DNA Purification Kit (Norgen Corp., Toronto, CA) and treated with plant rRNA depletion reagents (courtesy of New England Biolabs) prior to library construction using the NEBNext Ultra II RNA First Strand Synthesis Module (#E7771), Ultra II Directional RNA Second Strand Synthesis Module (#E7550), Ultra II DNA Library Prep Kit for Illumina (#E7645), and Multiplex Oligos for Illumina (Index Primers Sets 1 & 2) (#E7335 and #E7500). .. Pooled libraries were sequenced on an Illumina NextSeq 500 (2 × 150 paired-end), and the untrimmed reads are available via the NCBI SRA project PRJNA379675.

Article Title: Effect of over expressing protective antigen on global gene transcription in Bacillus anthracis BH500
Article Snippet: .. Later steps involved end repair of extracted cDNA, adapter ligation using blunt/TA ligase and cleavage by USER enzyme, purification with AMPure XP beads and PCR enrichment of cDNA library using different sets of Multiplex oligos for Illumina. .. PCR enrichment mix was performed in thermocycler for initial denaturation (1 cycle): 98 °C for 30 secs; Denaturation-Annealing/Extension (15 cycles): 98 °C for 10 secs, 65 °C for 75 secs; final extension (1 cycle): 65 °C for 5 min.

cDNA Library Assay:

Article Title: Effect of over expressing protective antigen on global gene transcription in Bacillus anthracis BH500
Article Snippet: .. Later steps involved end repair of extracted cDNA, adapter ligation using blunt/TA ligase and cleavage by USER enzyme, purification with AMPure XP beads and PCR enrichment of cDNA library using different sets of Multiplex oligos for Illumina. .. PCR enrichment mix was performed in thermocycler for initial denaturation (1 cycle): 98 °C for 30 secs; Denaturation-Annealing/Extension (15 cycles): 98 °C for 10 secs, 65 °C for 75 secs; final extension (1 cycle): 65 °C for 5 min.

Polymerase Chain Reaction:

Article Title: Effect of over expressing protective antigen on global gene transcription in Bacillus anthracis BH500
Article Snippet: .. Later steps involved end repair of extracted cDNA, adapter ligation using blunt/TA ligase and cleavage by USER enzyme, purification with AMPure XP beads and PCR enrichment of cDNA library using different sets of Multiplex oligos for Illumina. .. PCR enrichment mix was performed in thermocycler for initial denaturation (1 cycle): 98 °C for 30 secs; Denaturation-Annealing/Extension (15 cycles): 98 °C for 10 secs, 65 °C for 75 secs; final extension (1 cycle): 65 °C for 5 min.

Chromatin Immunoprecipitation:

Article Title: The role of maternal-specific H3K9me3 modification in establishing imprinted X-chromosome inactivation and embryogenesis in mice
Article Snippet: .. ChIP combined with deep sequencing ChIP-Seq libraries were prepared using the NEBNext ChIP-Seq Library Prep Master Mix Set and Multiplex Oligos from Illumina (New England BioLabs Inc., Ipswich, MA, USA) according to the manufacturer’s instructions. .. Ten nanograms of ChIP or input DNA was subjected to end repair, dA-tailing and adaptor ligation, and amplified using nine cycles of PCR.

ChIP-sequencing:

Article Title: The role of maternal-specific H3K9me3 modification in establishing imprinted X-chromosome inactivation and embryogenesis in mice
Article Snippet: .. ChIP combined with deep sequencing ChIP-Seq libraries were prepared using the NEBNext ChIP-Seq Library Prep Master Mix Set and Multiplex Oligos from Illumina (New England BioLabs Inc., Ipswich, MA, USA) according to the manufacturer’s instructions. .. Ten nanograms of ChIP or input DNA was subjected to end repair, dA-tailing and adaptor ligation, and amplified using nine cycles of PCR.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    Illumina Inc multiplexed illumina oligonucleotide assays
    (A) Genotyping of parental lines and 576 Ae. tauschii F 2 plants in the AL8/78 × AS75 mapping population with <t>Illumina</t> GoldenGate oligonucleotide assay querying an A/G SNP at EST locus BE499478 (nucleotide position 403 in the Ae. tauschii reference sequence, ) . The graph is a normalized polar coordinate ( R , θ ) plot. Theta ( x -axis) is an angle of deviation of Cy3 and Cy5 fluorescence from pure Cy3 and pure Cy5 signal (0 and 1). The closer a point is to 0 or 1, the greater the proportion of Cy3 or Cy5 fluorescent signal, respectively, is present. R ( y -axis) is the Manhattan distance of observed Cy3 and Cy5 fluorescence to the origin (pole), which is 0 fluorescence. The closer a point is to 0 on the y -axis, the weaker the total fluorescence. The red, blue and purple ovals have the diameter of 2 standard deviations computed from the dispersal of the red, blue and purple dots, respectively. The darker colored regions define genotype call areas for homozygous (red and blue dots) and heterozygous (purple dots) plants. The numbers of plants in each cluster are indicated below the x -axis. (B) Clustering of 57 BAC and BiBAC super-pools assayed with the same oligonucleotides as in (A). Genotype call areas derived from the mapping population shown in 1A were directly exported for analysis of the BAC pools. The green and orange spots represent the parental genotypes of the mapping population; the red spots are the BAC and BiBAC pools scored by us as positive and black spots BAC and BiBAC pools scored as negative. Note that all red spots have the same normalized angular deviation (normalized theta) as DNA of Ae. tauschii AL8/78 and large distance from origin ( R value) indicating high fluorescence. In contrast, the black spots have a low R value indicating only residual Cy3 and Cy5 fluorescence and variable values of normalized theta ranging from 0 all the way to 1. (C) Clustering of the same 57 BAC and BiBAC super-pools without defining call areas on the basis of clustering segregating Ae. tauschii SNP genotypes. Note failure of separation of the positive and negative clusters from each other.
    Multiplexed Illumina Oligonucleotide Assays, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/multiplexed illumina oligonucleotide assays/product/Illumina Inc
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    multiplexed illumina oligonucleotide assays - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    94
    Illumina Inc illumina adapters
    Schematic representation of different strategies for viral genome resequencing. A) Total RNA library: all the RNA species present in the sample are sequenced, no assumption on which genome is present, B) Hybridisation capture of a mRNA library: a good reference genome is needed to design the probes for capture, C) PCR enrichment: the desired genome is amplified from cDNA, a reference genome is needed to design specific oligos. Red lines, genomes of interest; Blue segments, <t>Illumina</t> adapters; Black lines, other RNA species.
    Illumina Adapters, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 94/100, based on 781 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/illumina adapters/product/Illumina Inc
    Average 94 stars, based on 781 article reviews
    Price from $9.99 to $1999.99
    illumina adapters - by Bioz Stars, 2020-07
    94/100 stars
      Buy from Supplier

    92
    Illumina Inc microarray oligonucleotide
    Results of singleplex amplification and <t>microarray</t> hybridization of select, biotin-labelled amplified purified pathogen DNA targets and hybridization to the Alere ArrayTube TM printed meningitis microarray. ( A ) No template control singleplex amplification, ( B ) Streptococcus pneumoniae singleplex amplification (Primers SPne1_2, 2.5 ng/mL target DNA), ( C ) Listeria monocytogenes singleplex amplification (Primers LiMo4_6, 2.5 ng/mL target DNA), ( D ) Staphyl aureus singleplex amplification (Primers StAUB_3, 2.5 ng/mL DNA). ( E ) N. meningitidis Serogroup B singleplex amplification (Primers NsMB4, 2.5 ng/mL DNA), ( F ) No template control multiplex amplification, ( G ) S. pneumoniae multiplex amplification, ( H ) L. monocytogenes multiplex amplification, ( I ) S. aureus multiplex amplification, ( J ) N. meningitidis serogroup B multiplex amplification.
    Microarray Oligonucleotide, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/microarray oligonucleotide/product/Illumina Inc
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    microarray oligonucleotide - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    94
    Illumina Inc pcr primers
    Genome editing of <t>TBX5</t> in human induced pluripotent stem cells. (A) Diagram of the human TBX5 gene. Exons encoding the T-box domain of TBX5 are indicated in red. sgRNA1 was used to target exon 3 of TBX5 by a CRISPR/Cas9 nuclease. (B) Sequence of the exon 3 of TBX5 is shown, along with the sgRNA1 location. The PAM site is boxed in blue. Loss of the NlaIII site at the PAM site was used in initial screening for mutant iPS cell clones by <t>PCR.</t> The encoded wildtype protein sequence includes the start of the T-box domain. (C) Sequence and chromatogram for the 2bp insertion of the mutant allele for TBX5 in/+ predicts a premature truncation, as indicated by a stop codon (white asterisk in red box) in the frame-shifted protein sequence. (D, E) Sequence and chromatogram for the 1 bp insertion, or 8 bp deletion, respectively, of the mutant allele for TBX5 in/del , along with corresponding protein sequences, are shown. (F) Table shows genotypes of WTC11-derived iPS cell lines that were targeted for TBX5 at exon 3. Predicted translation for each TBX5 genotype is indicated.
    Pcr Primers, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 94/100, based on 331 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr primers/product/Illumina Inc
    Average 94 stars, based on 331 article reviews
    Price from $9.99 to $1999.99
    pcr primers - by Bioz Stars, 2020-07
    94/100 stars
      Buy from Supplier

    Image Search Results


    (A) Genotyping of parental lines and 576 Ae. tauschii F 2 plants in the AL8/78 × AS75 mapping population with Illumina GoldenGate oligonucleotide assay querying an A/G SNP at EST locus BE499478 (nucleotide position 403 in the Ae. tauschii reference sequence, ) . The graph is a normalized polar coordinate ( R , θ ) plot. Theta ( x -axis) is an angle of deviation of Cy3 and Cy5 fluorescence from pure Cy3 and pure Cy5 signal (0 and 1). The closer a point is to 0 or 1, the greater the proportion of Cy3 or Cy5 fluorescent signal, respectively, is present. R ( y -axis) is the Manhattan distance of observed Cy3 and Cy5 fluorescence to the origin (pole), which is 0 fluorescence. The closer a point is to 0 on the y -axis, the weaker the total fluorescence. The red, blue and purple ovals have the diameter of 2 standard deviations computed from the dispersal of the red, blue and purple dots, respectively. The darker colored regions define genotype call areas for homozygous (red and blue dots) and heterozygous (purple dots) plants. The numbers of plants in each cluster are indicated below the x -axis. (B) Clustering of 57 BAC and BiBAC super-pools assayed with the same oligonucleotides as in (A). Genotype call areas derived from the mapping population shown in 1A were directly exported for analysis of the BAC pools. The green and orange spots represent the parental genotypes of the mapping population; the red spots are the BAC and BiBAC pools scored by us as positive and black spots BAC and BiBAC pools scored as negative. Note that all red spots have the same normalized angular deviation (normalized theta) as DNA of Ae. tauschii AL8/78 and large distance from origin ( R value) indicating high fluorescence. In contrast, the black spots have a low R value indicating only residual Cy3 and Cy5 fluorescence and variable values of normalized theta ranging from 0 all the way to 1. (C) Clustering of the same 57 BAC and BiBAC super-pools without defining call areas on the basis of clustering segregating Ae. tauschii SNP genotypes. Note failure of separation of the positive and negative clusters from each other.

    Journal: BMC Genomics

    Article Title: A high-throughput strategy for screening of bacterial artificial chromosome libraries and anchoring of clones on a genetic map constructed with single nucleotide polymorphisms

    doi: 10.1186/1471-2164-10-28

    Figure Lengend Snippet: (A) Genotyping of parental lines and 576 Ae. tauschii F 2 plants in the AL8/78 × AS75 mapping population with Illumina GoldenGate oligonucleotide assay querying an A/G SNP at EST locus BE499478 (nucleotide position 403 in the Ae. tauschii reference sequence, ) . The graph is a normalized polar coordinate ( R , θ ) plot. Theta ( x -axis) is an angle of deviation of Cy3 and Cy5 fluorescence from pure Cy3 and pure Cy5 signal (0 and 1). The closer a point is to 0 or 1, the greater the proportion of Cy3 or Cy5 fluorescent signal, respectively, is present. R ( y -axis) is the Manhattan distance of observed Cy3 and Cy5 fluorescence to the origin (pole), which is 0 fluorescence. The closer a point is to 0 on the y -axis, the weaker the total fluorescence. The red, blue and purple ovals have the diameter of 2 standard deviations computed from the dispersal of the red, blue and purple dots, respectively. The darker colored regions define genotype call areas for homozygous (red and blue dots) and heterozygous (purple dots) plants. The numbers of plants in each cluster are indicated below the x -axis. (B) Clustering of 57 BAC and BiBAC super-pools assayed with the same oligonucleotides as in (A). Genotype call areas derived from the mapping population shown in 1A were directly exported for analysis of the BAC pools. The green and orange spots represent the parental genotypes of the mapping population; the red spots are the BAC and BiBAC pools scored by us as positive and black spots BAC and BiBAC pools scored as negative. Note that all red spots have the same normalized angular deviation (normalized theta) as DNA of Ae. tauschii AL8/78 and large distance from origin ( R value) indicating high fluorescence. In contrast, the black spots have a low R value indicating only residual Cy3 and Cy5 fluorescence and variable values of normalized theta ranging from 0 all the way to 1. (C) Clustering of the same 57 BAC and BiBAC super-pools without defining call areas on the basis of clustering segregating Ae. tauschii SNP genotypes. Note failure of separation of the positive and negative clusters from each other.

    Article Snippet: The multiplexed Illumina oligonucleotide assays are most time and cost effective if large numbers of markers in large numbers of DNAs are genotyped and if no additional work is needed to identify positive BAC clones.

    Techniques: Oligonucleotide Assay, Sequencing, Fluorescence, BAC Assay, Derivative Assay

    Schematic representation of different strategies for viral genome resequencing. A) Total RNA library: all the RNA species present in the sample are sequenced, no assumption on which genome is present, B) Hybridisation capture of a mRNA library: a good reference genome is needed to design the probes for capture, C) PCR enrichment: the desired genome is amplified from cDNA, a reference genome is needed to design specific oligos. Red lines, genomes of interest; Blue segments, Illumina adapters; Black lines, other RNA species.

    Journal: PLoS ONE

    Article Title: A Modified RNA-Seq Approach for Whole Genome Sequencing of RNA Viruses from Faecal and Blood Samples

    doi: 10.1371/journal.pone.0066129

    Figure Lengend Snippet: Schematic representation of different strategies for viral genome resequencing. A) Total RNA library: all the RNA species present in the sample are sequenced, no assumption on which genome is present, B) Hybridisation capture of a mRNA library: a good reference genome is needed to design the probes for capture, C) PCR enrichment: the desired genome is amplified from cDNA, a reference genome is needed to design specific oligos. Red lines, genomes of interest; Blue segments, Illumina adapters; Black lines, other RNA species.

    Article Snippet: Additionally, upon ligation of Illumina Adapters (Multiplexing Sample Preparation Oligonucleotide Kit) each library was size selected with two Ampure Bead steps (firstly, 1∶0.7× volume and secondly, the supernatant from the first bind was taken for a 1∶1.7× volume clean-up), selecting 200–600 bp fragments in 30 µl 10 mM Tris-Cl, pH 8.5.

    Techniques: Hybridization, Capture-C, Polymerase Chain Reaction, Amplification

    Results of singleplex amplification and microarray hybridization of select, biotin-labelled amplified purified pathogen DNA targets and hybridization to the Alere ArrayTube TM printed meningitis microarray. ( A ) No template control singleplex amplification, ( B ) Streptococcus pneumoniae singleplex amplification (Primers SPne1_2, 2.5 ng/mL target DNA), ( C ) Listeria monocytogenes singleplex amplification (Primers LiMo4_6, 2.5 ng/mL target DNA), ( D ) Staphyl aureus singleplex amplification (Primers StAUB_3, 2.5 ng/mL DNA). ( E ) N. meningitidis Serogroup B singleplex amplification (Primers NsMB4, 2.5 ng/mL DNA), ( F ) No template control multiplex amplification, ( G ) S. pneumoniae multiplex amplification, ( H ) L. monocytogenes multiplex amplification, ( I ) S. aureus multiplex amplification, ( J ) N. meningitidis serogroup B multiplex amplification.

    Journal: High-Throughput

    Article Title: Development and Assessment of a Diagnostic DNA Oligonucleotide Microarray for Detection and Typing of Meningitis-Associated Bacterial Species

    doi: 10.3390/ht7040032

    Figure Lengend Snippet: Results of singleplex amplification and microarray hybridization of select, biotin-labelled amplified purified pathogen DNA targets and hybridization to the Alere ArrayTube TM printed meningitis microarray. ( A ) No template control singleplex amplification, ( B ) Streptococcus pneumoniae singleplex amplification (Primers SPne1_2, 2.5 ng/mL target DNA), ( C ) Listeria monocytogenes singleplex amplification (Primers LiMo4_6, 2.5 ng/mL target DNA), ( D ) Staphyl aureus singleplex amplification (Primers StAUB_3, 2.5 ng/mL DNA). ( E ) N. meningitidis Serogroup B singleplex amplification (Primers NsMB4, 2.5 ng/mL DNA), ( F ) No template control multiplex amplification, ( G ) S. pneumoniae multiplex amplification, ( H ) L. monocytogenes multiplex amplification, ( I ) S. aureus multiplex amplification, ( J ) N. meningitidis serogroup B multiplex amplification.

    Article Snippet: Printing of Microarray Oligonucleotide Probes in Glass Slide Format All 50- and 70-mer bacterial species and strain oligonucleotide probes for the glass slide format microarray were synthesised by Illumina (Illumina, Cambridge, UK) and printed in quadruplicate onto epoxy-coated Nexterion E slides (Schott Ltd., Stafford, UK) using a BioRobotics Microgrid II gridder (Digilab Inc., Hopkinton, MA, USA).

    Techniques: Amplification, Microarray, Hybridization, Purification, Multiplex Assay

    Fluorescence intensity heat-map of probe hybridization using amplified targets from patient cerebral spinal fluid (CSF) nucleic acids, hybridized to the glass slide-printed meningitis microarray using the manual hybridization method and formamide-free hybridization buffer.

    Journal: High-Throughput

    Article Title: Development and Assessment of a Diagnostic DNA Oligonucleotide Microarray for Detection and Typing of Meningitis-Associated Bacterial Species

    doi: 10.3390/ht7040032

    Figure Lengend Snippet: Fluorescence intensity heat-map of probe hybridization using amplified targets from patient cerebral spinal fluid (CSF) nucleic acids, hybridized to the glass slide-printed meningitis microarray using the manual hybridization method and formamide-free hybridization buffer.

    Article Snippet: Printing of Microarray Oligonucleotide Probes in Glass Slide Format All 50- and 70-mer bacterial species and strain oligonucleotide probes for the glass slide format microarray were synthesised by Illumina (Illumina, Cambridge, UK) and printed in quadruplicate onto epoxy-coated Nexterion E slides (Schott Ltd., Stafford, UK) using a BioRobotics Microgrid II gridder (Digilab Inc., Hopkinton, MA, USA).

    Techniques: Fluorescence, Hybridization, Amplification, Microarray

    Fluorescence intensity of probe hybridization with amplified Cy3-labelled bacterial DNA targets using purified pathogen nucleic acids to the glass slide-printed meningitis microarray, depicted in heatmap format ( A ) nonmeningococcal pathogens, ( B ) typed meningococcal pathogens, ( C ) untyped meningococcal pathogens, and ( D ) nonmeningococcal Neisseria spp.

    Journal: High-Throughput

    Article Title: Development and Assessment of a Diagnostic DNA Oligonucleotide Microarray for Detection and Typing of Meningitis-Associated Bacterial Species

    doi: 10.3390/ht7040032

    Figure Lengend Snippet: Fluorescence intensity of probe hybridization with amplified Cy3-labelled bacterial DNA targets using purified pathogen nucleic acids to the glass slide-printed meningitis microarray, depicted in heatmap format ( A ) nonmeningococcal pathogens, ( B ) typed meningococcal pathogens, ( C ) untyped meningococcal pathogens, and ( D ) nonmeningococcal Neisseria spp.

    Article Snippet: Printing of Microarray Oligonucleotide Probes in Glass Slide Format All 50- and 70-mer bacterial species and strain oligonucleotide probes for the glass slide format microarray were synthesised by Illumina (Illumina, Cambridge, UK) and printed in quadruplicate onto epoxy-coated Nexterion E slides (Schott Ltd., Stafford, UK) using a BioRobotics Microgrid II gridder (Digilab Inc., Hopkinton, MA, USA).

    Techniques: Fluorescence, Hybridization, Amplification, Purification, Microarray

    Fluorescence intensity of probe hybridization with amplified targets using patient CSF nucleic acids, depicted in heat-map format. From the glass slide-printed meningitis microarray, hybridizations using the Advalytix hybridization platform and formamide-containing hybridization buffer.

    Journal: High-Throughput

    Article Title: Development and Assessment of a Diagnostic DNA Oligonucleotide Microarray for Detection and Typing of Meningitis-Associated Bacterial Species

    doi: 10.3390/ht7040032

    Figure Lengend Snippet: Fluorescence intensity of probe hybridization with amplified targets using patient CSF nucleic acids, depicted in heat-map format. From the glass slide-printed meningitis microarray, hybridizations using the Advalytix hybridization platform and formamide-containing hybridization buffer.

    Article Snippet: Printing of Microarray Oligonucleotide Probes in Glass Slide Format All 50- and 70-mer bacterial species and strain oligonucleotide probes for the glass slide format microarray were synthesised by Illumina (Illumina, Cambridge, UK) and printed in quadruplicate onto epoxy-coated Nexterion E slides (Schott Ltd., Stafford, UK) using a BioRobotics Microgrid II gridder (Digilab Inc., Hopkinton, MA, USA).

    Techniques: Fluorescence, Hybridization, Amplification, Microarray

    Genome editing of TBX5 in human induced pluripotent stem cells. (A) Diagram of the human TBX5 gene. Exons encoding the T-box domain of TBX5 are indicated in red. sgRNA1 was used to target exon 3 of TBX5 by a CRISPR/Cas9 nuclease. (B) Sequence of the exon 3 of TBX5 is shown, along with the sgRNA1 location. The PAM site is boxed in blue. Loss of the NlaIII site at the PAM site was used in initial screening for mutant iPS cell clones by PCR. The encoded wildtype protein sequence includes the start of the T-box domain. (C) Sequence and chromatogram for the 2bp insertion of the mutant allele for TBX5 in/+ predicts a premature truncation, as indicated by a stop codon (white asterisk in red box) in the frame-shifted protein sequence. (D, E) Sequence and chromatogram for the 1 bp insertion, or 8 bp deletion, respectively, of the mutant allele for TBX5 in/del , along with corresponding protein sequences, are shown. (F) Table shows genotypes of WTC11-derived iPS cell lines that were targeted for TBX5 at exon 3. Predicted translation for each TBX5 genotype is indicated.

    Journal: bioRxiv

    Article Title: Modeling human TBX5 haploinsufficiency predicts regulatory networks for congenital heart disease

    doi: 10.1101/835603

    Figure Lengend Snippet: Genome editing of TBX5 in human induced pluripotent stem cells. (A) Diagram of the human TBX5 gene. Exons encoding the T-box domain of TBX5 are indicated in red. sgRNA1 was used to target exon 3 of TBX5 by a CRISPR/Cas9 nuclease. (B) Sequence of the exon 3 of TBX5 is shown, along with the sgRNA1 location. The PAM site is boxed in blue. Loss of the NlaIII site at the PAM site was used in initial screening for mutant iPS cell clones by PCR. The encoded wildtype protein sequence includes the start of the T-box domain. (C) Sequence and chromatogram for the 2bp insertion of the mutant allele for TBX5 in/+ predicts a premature truncation, as indicated by a stop codon (white asterisk in red box) in the frame-shifted protein sequence. (D, E) Sequence and chromatogram for the 1 bp insertion, or 8 bp deletion, respectively, of the mutant allele for TBX5 in/del , along with corresponding protein sequences, are shown. (F) Table shows genotypes of WTC11-derived iPS cell lines that were targeted for TBX5 at exon 3. Predicted translation for each TBX5 genotype is indicated.

    Article Snippet: For screening of TBX5 exon 7 NHEJ mutations, the targeted sequence was amplified using PCR primers (For3: GCTTCTTTTGGTTGCCAGAG, Rev5: CATTCTCCCCATTTCCATGT, Seq2: AGAGGCTGCATTTCCATGAT), Illumina compatible-libraries from clones were generated and multiplex-sequenced on a MiSeq for purity of homogeneity of clones for heterozygous or homozygous mutations, as described in ( ).

    Techniques: CRISPR, Sequencing, Mutagenesis, Clone Assay, Polymerase Chain Reaction, Derivative Assay