mspi  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    MspI
    Description:
    MspI 25 000 units
    Catalog Number:
    r0106l
    Price:
    269
    Size:
    25 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs mspi
    MspI
    MspI 25 000 units
    https://www.bioz.com/result/mspi/product/New England Biolabs
    Average 99 stars, based on 183 article reviews
    Price from $9.99 to $1999.99
    mspi - by Bioz Stars, 2020-07
    99/100 stars

    Images

    1) Product Images from "DNA Analysis by Restriction Enzyme (DARE) enables concurrent genomic and epigenomic characterization of single cells"

    Article Title: DNA Analysis by Restriction Enzyme (DARE) enables concurrent genomic and epigenomic characterization of single cells

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkz717

    Workflow of DNA Analysis by Restriction Enzyme (DARE) assay. ( A ) Workflow of DARE assay—cell lysis and protease treatment are followed by digestion of unmethylated CCGG sites with methylation sensitive HpaII enzyme. U-tag adapters are ligated and the remaining CCGG sites are digested by methylation insensitive MspI enzyme. NlaIII digestion is included to reduce the fragment length. This is followed by ligation with the respective adapters (M-tag and N-tag adapters). Thermolabile USER ® II enzyme is used to remove excess uracil-containing adapters after each ligation. ( B ) Adapter system: U-tag adapter consists of Read 1 primer sequence of Illumina adapter, unique molecular identifier (UMI), unmethylated site specific tag (U-tag), and CG overhang. M-tag adapter similarly consists of Read 1 primer sequence of Illumina adapter, UMI, methylated site specific tag (M-tag), and CG overhang. N-tag adapter consists of Read 2 primer sequence of Illumina adapter and CATG overhang.
    Figure Legend Snippet: Workflow of DNA Analysis by Restriction Enzyme (DARE) assay. ( A ) Workflow of DARE assay—cell lysis and protease treatment are followed by digestion of unmethylated CCGG sites with methylation sensitive HpaII enzyme. U-tag adapters are ligated and the remaining CCGG sites are digested by methylation insensitive MspI enzyme. NlaIII digestion is included to reduce the fragment length. This is followed by ligation with the respective adapters (M-tag and N-tag adapters). Thermolabile USER ® II enzyme is used to remove excess uracil-containing adapters after each ligation. ( B ) Adapter system: U-tag adapter consists of Read 1 primer sequence of Illumina adapter, unique molecular identifier (UMI), unmethylated site specific tag (U-tag), and CG overhang. M-tag adapter similarly consists of Read 1 primer sequence of Illumina adapter, UMI, methylated site specific tag (M-tag), and CG overhang. N-tag adapter consists of Read 2 primer sequence of Illumina adapter and CATG overhang.

    Techniques Used: Lysis, Methylation, Ligation, Sequencing

    2) Product Images from "VIM1, a methylcytosine-binding protein required for centromeric heterochromatinization"

    Article Title: VIM1, a methylcytosine-binding protein required for centromeric heterochromatinization

    Journal: Genes & Development

    doi: 10.1101/gad.1512007

    Reduced cytosine methylation of centromeric repeats in Bor-4. ( A ) Genomic DNA samples from the indicated genotypes were digested with the isoschizomers HpaII or MspI, and DNA blot hybridization with a 180-bp centromere repeat probe (CEN) was performed. ( B ) The filter shown in A was rehybridized with a 5S rRNA probe (5S rRNA). ( C ) A DNA blot hybridization pattern with the CEN probe after HpaII digestion demonstrates that centromeric repeat arrays hypomethylated in Bor-4 were fully remethylated in F1 hybrids resulting from reciprocal crosses between strains Bor-4 and Ler. The lane labeled Ler + Bor-4 contains a 1:1 mixture of Ler and Bor-4 HpaII-digested genomic DNA and shows the hybridization pattern expected if no remethylation occurred in the F1 hybrids.
    Figure Legend Snippet: Reduced cytosine methylation of centromeric repeats in Bor-4. ( A ) Genomic DNA samples from the indicated genotypes were digested with the isoschizomers HpaII or MspI, and DNA blot hybridization with a 180-bp centromere repeat probe (CEN) was performed. ( B ) The filter shown in A was rehybridized with a 5S rRNA probe (5S rRNA). ( C ) A DNA blot hybridization pattern with the CEN probe after HpaII digestion demonstrates that centromeric repeat arrays hypomethylated in Bor-4 were fully remethylated in F1 hybrids resulting from reciprocal crosses between strains Bor-4 and Ler. The lane labeled Ler + Bor-4 contains a 1:1 mixture of Ler and Bor-4 HpaII-digested genomic DNA and shows the hybridization pattern expected if no remethylation occurred in the F1 hybrids.

    Techniques Used: Methylation, Hybridization, Labeling

    3) Product Images from "JMJ24 targets CHROMOMETHYLASE3 for proteasomal degradation in Arabidopsis"

    Article Title: JMJ24 targets CHROMOMETHYLASE3 for proteasomal degradation in Arabidopsis

    Journal: Genes & Development

    doi: 10.1101/gad.274647.115

    JMJ24 regulates CHG methylation and H3K9me2 through CMT3. ( A , B ) Southern blot of MspI- and HpaII-digested genomic DNAs probed with an Athila LTR ( A ) or a 5s rDNA repeat ( B ). See Supplemental Figure S4A for the full scanning of B . ( C , D ) DNA methylation levels on FWA ( C ) and QQS ( D ) determined by sequencing of bisulfite-treated genomic DNAs. ( E – G ) H3K9me2 accumulation on FWA ( E ), QQS ( F ), or SDC ( G ) promoters in different mutant backgrounds. ( H , I ) QQS ( H ) and SDC ( I ) transcripts levels in different mutant backgrounds. ( jmj24;cmt3 ) jmj24 and cmt3 double mutant; ( JMJ24/jmj24 ) jmj24 mutant complemented with wild-type JMJ24; ( JMJ24m/jmj24 ) jmj24 mutant complemented with JMJ24(H244A, C263S).
    Figure Legend Snippet: JMJ24 regulates CHG methylation and H3K9me2 through CMT3. ( A , B ) Southern blot of MspI- and HpaII-digested genomic DNAs probed with an Athila LTR ( A ) or a 5s rDNA repeat ( B ). See Supplemental Figure S4A for the full scanning of B . ( C , D ) DNA methylation levels on FWA ( C ) and QQS ( D ) determined by sequencing of bisulfite-treated genomic DNAs. ( E – G ) H3K9me2 accumulation on FWA ( E ), QQS ( F ), or SDC ( G ) promoters in different mutant backgrounds. ( H , I ) QQS ( H ) and SDC ( I ) transcripts levels in different mutant backgrounds. ( jmj24;cmt3 ) jmj24 and cmt3 double mutant; ( JMJ24/jmj24 ) jmj24 mutant complemented with wild-type JMJ24; ( JMJ24m/jmj24 ) jmj24 mutant complemented with JMJ24(H244A, C263S).

    Techniques Used: Methylation, Southern Blot, DNA Methylation Assay, Sequencing, Mutagenesis

    4) Product Images from "Cell-type-specific brain methylomes profiled via ultralow-input microfluidics"

    Article Title: Cell-type-specific brain methylomes profiled via ultralow-input microfluidics

    Journal: Nature biomedical engineering

    doi:

    MID-RRBS generated high quality data using sub-1 ng DNA (a) The percentage of the theoretical maximum of CpGs covered at 1× and 10× coverage with starting DNA samples of various amounts. MspI in silico . (e) Saturation analysis of MID-RRBS data in comparison with other works. The analysis was conducted by random selection of a number of raw reads followed by using the same pipeline to identify unique CpGs. Each data point was generated with 4 subsamplings per dataset. The error bars represent s.d. The centre represents mean. n = 3 for LCM-RRBS, n = 8 for mRRBS, n = 2 for the rest.
    Figure Legend Snippet: MID-RRBS generated high quality data using sub-1 ng DNA (a) The percentage of the theoretical maximum of CpGs covered at 1× and 10× coverage with starting DNA samples of various amounts. MspI in silico . (e) Saturation analysis of MID-RRBS data in comparison with other works. The analysis was conducted by random selection of a number of raw reads followed by using the same pipeline to identify unique CpGs. Each data point was generated with 4 subsamplings per dataset. The error bars represent s.d. The centre represents mean. n = 3 for LCM-RRBS, n = 8 for mRRBS, n = 2 for the rest.

    Techniques Used: Generated, In Silico, Selection, Laser Capture Microdissection

    5) Product Images from "Distinct Roles of RNA Helicases MVH and TDRD9 in PIWI Slicing-Triggered Mammalian piRNA Biogenesis and Function"

    Article Title: Distinct Roles of RNA Helicases MVH and TDRD9 in PIWI Slicing-Triggered Mammalian piRNA Biogenesis and Function

    Journal: Developmental Cell

    doi: 10.1016/j.devcel.2017.05.021

    Mouse TDRD9 Is an ATPase, and Its Activity Is Essential for Transposon Silencing, but Not for piRNA Biogenesis (A) Domain architecture of mouse TDRD9 with putative consensus amino acid residues responsible for ATP binding and ATP hydrolysis is shown. The point mutation E257Q that abolishes ATPase activity is indicated. (B) Quality of recombinant mouse TDRD9 protein used for ATPase assays. Wild-type and E257Q point mutant versions were produced. (C) Thin-layer chromatography of ATPase reactions revealing the faster-migrating free phosphate in the presence of the wild-type TDRD9 protein. (D) Creation of the catalytic-dead Tdrd9 knockin (KI) mouse carrying the E257Q mutation in the ATPase motif (DEVH → DQVH). The same mouse line also allows creation of the knockout (−/−) mutant, by using loxP sites flanking exons 3–5. See also Figure S6 . (E) Representative image of adult testes from indicated genotypes, showing atrophied testes in homozygous Tdrd9 knockout and knockin mutants. (F) H E staining of adult testes from homozygous Tdrd9 knockin mutant showing arrested germ cell development. Scale bar, 40 μm. See also Figure S7 A. (G) Northern analysis of transposons in total testicular RNA, showing derepression of LINE1 retrotransposons in homozygous Tdrd9 knockout and knockin mutants. Age of donor animals is indicated. (H) Western analysis of total testicular lysates for L1ORF1p expression. MILI (germ cell marker) and TUBULIN (loading control) expression was also examined. (I) Methylation-sensitive Southern blotting for LINE1 genomic loci. The red arrows point to fragments appearing under conditions of reduced DNA methylation in the homozygous Tdrd9 mutants. H, HpaII-digested DNA; M, MspI-digested DNA. (J) Immunoprecipitation of PIWI proteins and 5′ end labeling of associated small RNAs from neonatal (P0) testes. (K) Comparison of MILI-associated piRNAs mapping to individual repeats. There is a striking enrichment of the piRNAs produced from LINE and LTR repeats in Tdrd9 mutants ( Tdrd9 KI / KI and Tdrd9 − / − ). See also Figure S8 . (L) Graphs show the distribution of MIWI2-associated piRNAs mapped along B1Mus1.SINE consensus sequence, revealing a depletion of piRNAs in the Tdrd9 KI / KI and Tdrd9 − / − mutants. (M) Immunofluorescence analysis of indicated proteins in embryonic testes (embryonic day 16.5) of the different genotypes. Note the nucleo-cytoplasmic distribution of TDRD9 in wild-type germ cells, while it is restricted to the cytoplasm in the Tdrd9 KI / KI mutant.
    Figure Legend Snippet: Mouse TDRD9 Is an ATPase, and Its Activity Is Essential for Transposon Silencing, but Not for piRNA Biogenesis (A) Domain architecture of mouse TDRD9 with putative consensus amino acid residues responsible for ATP binding and ATP hydrolysis is shown. The point mutation E257Q that abolishes ATPase activity is indicated. (B) Quality of recombinant mouse TDRD9 protein used for ATPase assays. Wild-type and E257Q point mutant versions were produced. (C) Thin-layer chromatography of ATPase reactions revealing the faster-migrating free phosphate in the presence of the wild-type TDRD9 protein. (D) Creation of the catalytic-dead Tdrd9 knockin (KI) mouse carrying the E257Q mutation in the ATPase motif (DEVH → DQVH). The same mouse line also allows creation of the knockout (−/−) mutant, by using loxP sites flanking exons 3–5. See also Figure S6 . (E) Representative image of adult testes from indicated genotypes, showing atrophied testes in homozygous Tdrd9 knockout and knockin mutants. (F) H E staining of adult testes from homozygous Tdrd9 knockin mutant showing arrested germ cell development. Scale bar, 40 μm. See also Figure S7 A. (G) Northern analysis of transposons in total testicular RNA, showing derepression of LINE1 retrotransposons in homozygous Tdrd9 knockout and knockin mutants. Age of donor animals is indicated. (H) Western analysis of total testicular lysates for L1ORF1p expression. MILI (germ cell marker) and TUBULIN (loading control) expression was also examined. (I) Methylation-sensitive Southern blotting for LINE1 genomic loci. The red arrows point to fragments appearing under conditions of reduced DNA methylation in the homozygous Tdrd9 mutants. H, HpaII-digested DNA; M, MspI-digested DNA. (J) Immunoprecipitation of PIWI proteins and 5′ end labeling of associated small RNAs from neonatal (P0) testes. (K) Comparison of MILI-associated piRNAs mapping to individual repeats. There is a striking enrichment of the piRNAs produced from LINE and LTR repeats in Tdrd9 mutants ( Tdrd9 KI / KI and Tdrd9 − / − ). See also Figure S8 . (L) Graphs show the distribution of MIWI2-associated piRNAs mapped along B1Mus1.SINE consensus sequence, revealing a depletion of piRNAs in the Tdrd9 KI / KI and Tdrd9 − / − mutants. (M) Immunofluorescence analysis of indicated proteins in embryonic testes (embryonic day 16.5) of the different genotypes. Note the nucleo-cytoplasmic distribution of TDRD9 in wild-type germ cells, while it is restricted to the cytoplasm in the Tdrd9 KI / KI mutant.

    Techniques Used: Activity Assay, Binding Assay, Mutagenesis, Recombinant, Produced, Thin Layer Chromatography, Knock-In, Knock-Out, Staining, Northern Blot, Western Blot, Expressing, Marker, Methylation, Southern Blot, DNA Methylation Assay, Immunoprecipitation, End Labeling, Sequencing, Immunofluorescence

    Catalytic Activity of MVH Is Essential for Transposon Silencing and Biogenesis of MIWI2 piRNAs (A) Creation of the catalytic-dead Mvh mouse carrying a point mutation E446Q in the ATPase motif (DEAD → DQAD). See also Figure S2 . (B) Representative testes from adult animals (P80; 80 days old) of indicated Mvh genotypes. (C) Testes weight in different genotypes. (D and E) H E staining of adult mouse testes showing arrested germ cell development in the Mvh − / KI mutant (D), and (E) presence of sperm in the lumen of the wild-type epididymis, but not from that of the mutant. sp, spermatocytes; rs, round spermatids; es, elongated spermatids. Scale bars, 50 μm. (F) Staining for γ-H2AX in adult testes sections. Arrows point to the XY body. Scale bar, 10 μm. (G) Northern analysis for indicated transposon transcripts in total testicular RNA. The donor animals are numbered and their ages indicated. Total testicular DNA from the same animals were used for Southern blotting in (I). (H) Staining for L1ORF1p in mouse testes from animals of indicated ages. Scale bars, 38 μm (upper) and 48 μm (lower). (I) Methylation-sensitive Southern blotting examining L1 genomic loci. The donor animals are the same as those used for northern analysis (indicated by animal numbers). The red arrows point to the cleavage fragment seen under conditions of reduced DNA methylation, and only in the Mvh − / KI mutant. H, HpaII-digested DNA; M, MspI-digested DNA. (J and K) Immunoprecipitation of PIWI proteins from neonatal (P0) testes and 5′ end labeling of associated piRNAs. RNA size markers are 5′ end labeled (length in nucleotides). (L) Immunofluorescence detection of indicated proteins in neonatal testes Scale bar, 10 μm.
    Figure Legend Snippet: Catalytic Activity of MVH Is Essential for Transposon Silencing and Biogenesis of MIWI2 piRNAs (A) Creation of the catalytic-dead Mvh mouse carrying a point mutation E446Q in the ATPase motif (DEAD → DQAD). See also Figure S2 . (B) Representative testes from adult animals (P80; 80 days old) of indicated Mvh genotypes. (C) Testes weight in different genotypes. (D and E) H E staining of adult mouse testes showing arrested germ cell development in the Mvh − / KI mutant (D), and (E) presence of sperm in the lumen of the wild-type epididymis, but not from that of the mutant. sp, spermatocytes; rs, round spermatids; es, elongated spermatids. Scale bars, 50 μm. (F) Staining for γ-H2AX in adult testes sections. Arrows point to the XY body. Scale bar, 10 μm. (G) Northern analysis for indicated transposon transcripts in total testicular RNA. The donor animals are numbered and their ages indicated. Total testicular DNA from the same animals were used for Southern blotting in (I). (H) Staining for L1ORF1p in mouse testes from animals of indicated ages. Scale bars, 38 μm (upper) and 48 μm (lower). (I) Methylation-sensitive Southern blotting examining L1 genomic loci. The donor animals are the same as those used for northern analysis (indicated by animal numbers). The red arrows point to the cleavage fragment seen under conditions of reduced DNA methylation, and only in the Mvh − / KI mutant. H, HpaII-digested DNA; M, MspI-digested DNA. (J and K) Immunoprecipitation of PIWI proteins from neonatal (P0) testes and 5′ end labeling of associated piRNAs. RNA size markers are 5′ end labeled (length in nucleotides). (L) Immunofluorescence detection of indicated proteins in neonatal testes Scale bar, 10 μm.

    Techniques Used: Activity Assay, Mutagenesis, Staining, Northern Blot, Southern Blot, Methylation, DNA Methylation Assay, Immunoprecipitation, End Labeling, Labeling, Immunofluorescence

    6) Product Images from "Cell-type-specific brain methylomes profiled via ultralow-input microfluidics"

    Article Title: Cell-type-specific brain methylomes profiled via ultralow-input microfluidics

    Journal: Nature biomedical engineering

    doi:

    MID-RRBS generated high quality data using sub-1 ng DNA (a) The percentage of the theoretical maximum of CpGs covered at 1× and 10× coverage with starting DNA samples of various amounts. MspI in silico digestion followed by size selection of the hg19 genome produces the theoretical maximum of 2,782,793 CpGs. The centre represents mean. (b) Pearson’s correlations in the CG methylation level among various samples processed by MID-RRBS and Zymo kit. CpGs with ≥25× coverage were examined in the calculations. n = 14871. (c) MID-RRBS coverage of gene promoters (2 kb regions upstream of transcription starting sites of RefSeq genes), CpG islands (UCSC annotation database), CpG island shores (2 kb regions adjacent to CpG islands), enhancers (regions defined by H3K4me1+ H3K27ac based on ENCODE ChIP-seq data of GM12878 cells, ENCFF001SUE and ENCFF660QDF), and 5 kb tiles (non-overlapping consecutive 5 kb windows), in comparison to those of 1 μg and 1 ng samples processed by the Zymo kit. (d) The number of CpGs with various coverages (0–100×), in comparison to those of data produced using Zymo kit, mRRBS 30 , and LCM-RRBS 34 . (e) Saturation analysis of MID-RRBS data in comparison with other works. The analysis was conducted by random selection of a number of raw reads followed by using the same pipeline to identify unique CpGs. Each data point was generated with 4 subsamplings per dataset. The error bars represent s.d. The centre represents mean. n = 3 for LCM-RRBS, n = 8 for mRRBS, n = 2 for the rest.
    Figure Legend Snippet: MID-RRBS generated high quality data using sub-1 ng DNA (a) The percentage of the theoretical maximum of CpGs covered at 1× and 10× coverage with starting DNA samples of various amounts. MspI in silico digestion followed by size selection of the hg19 genome produces the theoretical maximum of 2,782,793 CpGs. The centre represents mean. (b) Pearson’s correlations in the CG methylation level among various samples processed by MID-RRBS and Zymo kit. CpGs with ≥25× coverage were examined in the calculations. n = 14871. (c) MID-RRBS coverage of gene promoters (2 kb regions upstream of transcription starting sites of RefSeq genes), CpG islands (UCSC annotation database), CpG island shores (2 kb regions adjacent to CpG islands), enhancers (regions defined by H3K4me1+ H3K27ac based on ENCODE ChIP-seq data of GM12878 cells, ENCFF001SUE and ENCFF660QDF), and 5 kb tiles (non-overlapping consecutive 5 kb windows), in comparison to those of 1 μg and 1 ng samples processed by the Zymo kit. (d) The number of CpGs with various coverages (0–100×), in comparison to those of data produced using Zymo kit, mRRBS 30 , and LCM-RRBS 34 . (e) Saturation analysis of MID-RRBS data in comparison with other works. The analysis was conducted by random selection of a number of raw reads followed by using the same pipeline to identify unique CpGs. Each data point was generated with 4 subsamplings per dataset. The error bars represent s.d. The centre represents mean. n = 3 for LCM-RRBS, n = 8 for mRRBS, n = 2 for the rest.

    Techniques Used: Generated, In Silico, Selection, Methylation, Chromatin Immunoprecipitation, Produced, Laser Capture Microdissection

    7) Product Images from "Integrated detection of both 5-mC and 5-hmC by high-throughput tag sequencing technology highlights methylation reprogramming of bivalent genes during cellular differentiation"

    Article Title: Integrated detection of both 5-mC and 5-hmC by high-throughput tag sequencing technology highlights methylation reprogramming of bivalent genes during cellular differentiation

    Journal: Epigenetics

    doi: 10.4161/epi.24280

    Figure 1. Schematic presentation of the HMST-Seq method. For (A) “C + mC” library, the genomic DNA was first glucosylated, and then digested with MspI. For (B) “C” library and (C) “C + mC + hmC”
    Figure Legend Snippet: Figure 1. Schematic presentation of the HMST-Seq method. For (A) “C + mC” library, the genomic DNA was first glucosylated, and then digested with MspI. For (B) “C” library and (C) “C + mC + hmC”

    Techniques Used:

    8) Product Images from "Laser capture microdissection-reduced representation bisulfite sequencing (LCM-RRBS) maps changes in DNA methylation associated with gonadectomy-induced adrenocortical neoplasia in the mouse"

    Article Title: Laser capture microdissection-reduced representation bisulfite sequencing (LCM-RRBS) maps changes in DNA methylation associated with gonadectomy-induced adrenocortical neoplasia in the mouse

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkt230

    LCM-RRBS workflow. A complex tissue is dissected using LCM. Extracted DNA is digested by the methylation-insensitive enzyme MspI, end repaired and ligated with methylated Illumina adapters. After bisulfite conversion, each sample is ‘barcoded’ by introducing a sample-specific index (shown as green, blue or violet boxes) through low-cycle PCR. Samples are pooled and loaded onto a high-percentage gel for fragment separation and size selection. Using universal primers, the final library is amplified and sequenced on the Illumina platform.
    Figure Legend Snippet: LCM-RRBS workflow. A complex tissue is dissected using LCM. Extracted DNA is digested by the methylation-insensitive enzyme MspI, end repaired and ligated with methylated Illumina adapters. After bisulfite conversion, each sample is ‘barcoded’ by introducing a sample-specific index (shown as green, blue or violet boxes) through low-cycle PCR. Samples are pooled and loaded onto a high-percentage gel for fragment separation and size selection. Using universal primers, the final library is amplified and sequenced on the Illumina platform.

    Techniques Used: Laser Capture Microdissection, Methylation, Polymerase Chain Reaction, Selection, Amplification

    9) Product Images from "Tissue-specific Distribution and Dynamic Changes of 5-Hydroxymethylcytosine in Mammalian Genomes *"

    Article Title: Tissue-specific Distribution and Dynamic Changes of 5-Hydroxymethylcytosine in Mammalian Genomes *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M110.217083

    MspI and HpaII isoschizomer can distinguish between 5-hmC and 5-ghmC at the internal cytosine residue. Cleavage specificity is shown for MspI and HpaII on FAM-end-labeled oligonucleotide duplex with internal CG being symmetrically hydroxymethylated or hemihydroxymethylated in the presence or absence of β-GT. Complete cleavage products are labeled as 24 and 19 nt, respectively, on a non-denaturing acrylamide gel for double-hydroxymethylated ( upper panel ) and denaturing acrylamide gel for hemi-hydroxymethylated DNA ( lower panel ). The arrow at the right indicates small amounts of 24-nt-long product.
    Figure Legend Snippet: MspI and HpaII isoschizomer can distinguish between 5-hmC and 5-ghmC at the internal cytosine residue. Cleavage specificity is shown for MspI and HpaII on FAM-end-labeled oligonucleotide duplex with internal CG being symmetrically hydroxymethylated or hemihydroxymethylated in the presence or absence of β-GT. Complete cleavage products are labeled as 24 and 19 nt, respectively, on a non-denaturing acrylamide gel for double-hydroxymethylated ( upper panel ) and denaturing acrylamide gel for hemi-hydroxymethylated DNA ( lower panel ). The arrow at the right indicates small amounts of 24-nt-long product.

    Techniques Used: Labeling, Acrylamide Gel Assay

    Methylation and hydroxymethylation analysis across gene body. A , VANGL1. B , EGFR . The genes are depicted with exons shown as black rectangles . The interrogated CCGG site numbers are indicated on the top along with the primer sets on the bottom . Diagrams are not drawn to scale. Total methylated cytosines (5-mC plus 5-hmC) obtained from β-GT-treated ( BGT ) HpaII-digested DNA and β-GT-treated MspI-digested DNA show the percentage of 5-hmC ( bottom panels ) at each specific site.
    Figure Legend Snippet: Methylation and hydroxymethylation analysis across gene body. A , VANGL1. B , EGFR . The genes are depicted with exons shown as black rectangles . The interrogated CCGG site numbers are indicated on the top along with the primer sets on the bottom . Diagrams are not drawn to scale. Total methylated cytosines (5-mC plus 5-hmC) obtained from β-GT-treated ( BGT ) HpaII-digested DNA and β-GT-treated MspI-digested DNA show the percentage of 5-hmC ( bottom panels ) at each specific site.

    Techniques Used: Methylation

    Cloning, sequence identification, and tissue-specific distribution of 5-hydroxymethylcytosine. A , a scheme for cloning and identification of 5-hmC containing DNA fragments using MspI restriction enzyme and β-GT ( Beta-GT ) is shown. B , a scheme for identification of 5-hmC containing CCGG locus using MspI ( M ) and HpaII ( H ) isoschizomers using glucosylation reaction is shown along with control ( C ). C , locus-specific end point PCR to interrogate and detect 5-hmC at CCGG sites in mouse genomic DNA is shown. The loci are discovered based on cloning scheme as shown in A and in supplemental Table 1 . Mouse brain, liver, heart, and spleen along with NIH3T3 cultured cell DNAs were interrogated for the 4 loci ( supplemental Table 3 : loci 2 and 3 are 5′ and 3′ MspI sites of chromosome 10, respectively, bp 34,574,152; locus 4 is the 5′ MspI site of chromosome 12, bp 17,432,255; locus 12 is the 5′ MspI site of Lpr1 intron, bp 2,372,508) as shown. D , shown is the locus-specific end point PCR to interrogate and detect 5-hmC at CCGG sites in human genomic DNA The loci are discovered based on the cloning scheme as shown in A and in supplemental Table 2 . Human brain (pons, occipital lobe ( OL )), liver, heart, and spleen along with HeLa-cultured cell DNAs were interrogated for both of the VANGL1 loci as shown. The control DNA interrogated fragment without CCGG sequence is miR17A.
    Figure Legend Snippet: Cloning, sequence identification, and tissue-specific distribution of 5-hydroxymethylcytosine. A , a scheme for cloning and identification of 5-hmC containing DNA fragments using MspI restriction enzyme and β-GT ( Beta-GT ) is shown. B , a scheme for identification of 5-hmC containing CCGG locus using MspI ( M ) and HpaII ( H ) isoschizomers using glucosylation reaction is shown along with control ( C ). C , locus-specific end point PCR to interrogate and detect 5-hmC at CCGG sites in mouse genomic DNA is shown. The loci are discovered based on cloning scheme as shown in A and in supplemental Table 1 . Mouse brain, liver, heart, and spleen along with NIH3T3 cultured cell DNAs were interrogated for the 4 loci ( supplemental Table 3 : loci 2 and 3 are 5′ and 3′ MspI sites of chromosome 10, respectively, bp 34,574,152; locus 4 is the 5′ MspI site of chromosome 12, bp 17,432,255; locus 12 is the 5′ MspI site of Lpr1 intron, bp 2,372,508) as shown. D , shown is the locus-specific end point PCR to interrogate and detect 5-hmC at CCGG sites in human genomic DNA The loci are discovered based on the cloning scheme as shown in A and in supplemental Table 2 . Human brain (pons, occipital lobe ( OL )), liver, heart, and spleen along with HeLa-cultured cell DNAs were interrogated for both of the VANGL1 loci as shown. The control DNA interrogated fragment without CCGG sequence is miR17A.

    Techniques Used: Clone Assay, Sequencing, Polymerase Chain Reaction, Cell Culture

    10) Product Images from "Copper bis-Dipyridoquinoxaline Is a Potent DNA Intercalator that Induces Superoxide-Mediated Cleavage via the Minor Groove"

    Article Title: Copper bis-Dipyridoquinoxaline Is a Potent DNA Intercalator that Induces Superoxide-Mediated Cleavage via the Minor Groove

    Journal: Molecules

    doi: 10.3390/molecules24234301

    ( A ) Cartoon representation of enzyme restriction sites. ( B ) Control experiment with isoschizomers HpaII and MspI in the presence and absence of HpaII-MT. ( C ) A quantity of 400 ng of 798 bp linear sequence ( I non-methylated and II methylated) treated with Cu-DPQ in the absence of reductant. ( D ) 400 ng of 798 bp linear sequence ( I non-methylated and II methylated) treated with Cu-DPQ in the presence of reductant Na- L -asc.
    Figure Legend Snippet: ( A ) Cartoon representation of enzyme restriction sites. ( B ) Control experiment with isoschizomers HpaII and MspI in the presence and absence of HpaII-MT. ( C ) A quantity of 400 ng of 798 bp linear sequence ( I non-methylated and II methylated) treated with Cu-DPQ in the absence of reductant. ( D ) 400 ng of 798 bp linear sequence ( I non-methylated and II methylated) treated with Cu-DPQ in the presence of reductant Na- L -asc.

    Techniques Used: Sequencing, Methylation

    11) Product Images from "Telomere damage induces internal loops that generate telomeric circles"

    Article Title: Telomere damage induces internal loops that generate telomeric circles

    Journal: bioRxiv

    doi: 10.1101/2020.01.29.924951

    A two-step procedure for the purification of mammalian telomeres A. Top: agarose gel showing the separation of the large telomeric repeat fragments from the bulk DNA in a sucrose gradient. Genomic DNA (~2.5 mg) from SV40-MEFs was digested with HinfI and MspI. The digested DNA was separated by centrifugation on a sucrose gradient. Seven fractions were collected and an aliquot (~1/500) of each fraction was loaded on an agarose gel. Bottom: the gel was blotted onto a membrane and hybridized with a TTAGGG repeats probe to verify that telomeric repeats remained in the high molecular weight (HMW) fractions. B. Left: agarose gel showing the separation of the large telomeric repeat fragments from the remaining non-telomeric DNA, in the second purification round. The HMW DNA, contained in the last four fractions of the sucrose gradient described in (A), was recovered and digested with RsaI, AluI, MboI, HinfI, MspI, HphI and MnlI. The digested DNA was separated on a preparative agarose gel and the DNA migrating in the area above 5 kb was extracted from the gel. The image shows an aliquot (~1/100) of the digested DNA, separated on an agarose gel. Right: the gel was blotted onto a membrane and hybridized with a TTAGGG repeats probe to verify that telomeric repeats remained in the HMW area. C. Dot blot analysis showing the enrichment of telomeric repeats. The indicated amounts of DNA from each enrichment step were spotted on a membrane and hybridized either with a probe recognizing the long interspersed BamHI repeats or TTAGGG repeats. The amount of TTAGGG repeat signal/ng was quantified and reported relative to the signal/ng value in the initial, non-enriched DNA. D. Single molecule analysis showing the enrichment of the telomeric repeats. The DNA was combed onto silanized coverslips, denatured in situ and labeled sequentially with an antibody against single-stranded DNA and a Cy3-labeled (TTAGGG) 3 PNA probe.
    Figure Legend Snippet: A two-step procedure for the purification of mammalian telomeres A. Top: agarose gel showing the separation of the large telomeric repeat fragments from the bulk DNA in a sucrose gradient. Genomic DNA (~2.5 mg) from SV40-MEFs was digested with HinfI and MspI. The digested DNA was separated by centrifugation on a sucrose gradient. Seven fractions were collected and an aliquot (~1/500) of each fraction was loaded on an agarose gel. Bottom: the gel was blotted onto a membrane and hybridized with a TTAGGG repeats probe to verify that telomeric repeats remained in the high molecular weight (HMW) fractions. B. Left: agarose gel showing the separation of the large telomeric repeat fragments from the remaining non-telomeric DNA, in the second purification round. The HMW DNA, contained in the last four fractions of the sucrose gradient described in (A), was recovered and digested with RsaI, AluI, MboI, HinfI, MspI, HphI and MnlI. The digested DNA was separated on a preparative agarose gel and the DNA migrating in the area above 5 kb was extracted from the gel. The image shows an aliquot (~1/100) of the digested DNA, separated on an agarose gel. Right: the gel was blotted onto a membrane and hybridized with a TTAGGG repeats probe to verify that telomeric repeats remained in the HMW area. C. Dot blot analysis showing the enrichment of telomeric repeats. The indicated amounts of DNA from each enrichment step were spotted on a membrane and hybridized either with a probe recognizing the long interspersed BamHI repeats or TTAGGG repeats. The amount of TTAGGG repeat signal/ng was quantified and reported relative to the signal/ng value in the initial, non-enriched DNA. D. Single molecule analysis showing the enrichment of the telomeric repeats. The DNA was combed onto silanized coverslips, denatured in situ and labeled sequentially with an antibody against single-stranded DNA and a Cy3-labeled (TTAGGG) 3 PNA probe.

    Techniques Used: Purification, Agarose Gel Electrophoresis, Centrifugation, Molecular Weight, Dot Blot, In Situ, Labeling

    12) Product Images from "NuRD-dependent DNA methylation prevents ES cells from accessing a trophectoderm fate"

    Article Title: NuRD-dependent DNA methylation prevents ES cells from accessing a trophectoderm fate

    Journal: Biology Open

    doi: 10.1242/bio.2012513

    Global analysis of DNA methylation in Mbd3 −/− ES cells. Genomic DNA from parental ES cells (+/−), Mbd3 −/− ES cells (−/−) or from ES cells expressing only Mbd3a, Mbd3b or Mbd3c was digested with MspI (M) and HpaII (H) (A) or with HpyCH4IV (B) before being Southern blotted and hybridised with probes for the minor (A) or major satellite DNA repeats (B), or for IAP LTRs (A). Mito: mitochondrial DNA probe used as a loading and digestion control. (C) Total 5-methylcytosine levels were quantitated in two different Mbd3 Flox/- ES cell lines (WT1 and WT2) and two different Mbd3 −/− ES cell lines (KO1 and KO2) by HPLC and mass spectrometry. Error bars represent SEM of three technical replicates.
    Figure Legend Snippet: Global analysis of DNA methylation in Mbd3 −/− ES cells. Genomic DNA from parental ES cells (+/−), Mbd3 −/− ES cells (−/−) or from ES cells expressing only Mbd3a, Mbd3b or Mbd3c was digested with MspI (M) and HpaII (H) (A) or with HpyCH4IV (B) before being Southern blotted and hybridised with probes for the minor (A) or major satellite DNA repeats (B), or for IAP LTRs (A). Mito: mitochondrial DNA probe used as a loading and digestion control. (C) Total 5-methylcytosine levels were quantitated in two different Mbd3 Flox/- ES cell lines (WT1 and WT2) and two different Mbd3 −/− ES cell lines (KO1 and KO2) by HPLC and mass spectrometry. Error bars represent SEM of three technical replicates.

    Techniques Used: DNA Methylation Assay, Expressing, High Performance Liquid Chromatography, Mass Spectrometry

    13) Product Images from "Methylation detection oligonucleotide microarray analysis: a high-resolution method for detection of CpG island methylation"

    Article Title: Methylation detection oligonucleotide microarray analysis: a high-resolution method for detection of CpG island methylation

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkp413

    Schematic of the procedure. Shown at the top is genomic DNA with a CpG island that is methylated. The DNA is cleaved with the restriction endonuclease MspI and adaptors ligated. The ligated material is divided evenly, one half being digested with McrBC and the other half being mock digested. This material is used as template for PCR amplification and the resulting product is used for microarray comparison.
    Figure Legend Snippet: Schematic of the procedure. Shown at the top is genomic DNA with a CpG island that is methylated. The DNA is cleaved with the restriction endonuclease MspI and adaptors ligated. The ligated material is divided evenly, one half being digested with McrBC and the other half being mock digested. This material is used as template for PCR amplification and the resulting product is used for microarray comparison.

    Techniques Used: Methylation, Polymerase Chain Reaction, Amplification, Microarray

    McrBC PCR of two different fragments of the MTSS1 CpG island for tumors identified of having methylation of this island compared to matched normal samples. Fragment 1 encompasses the MspI fragment we have identified as being methylated and overlaps the gene TSS. Fragment 5, we do not detect methylation. Both Normal and Tumor were digested with McrBC or mock digested for both matched pairs.
    Figure Legend Snippet: McrBC PCR of two different fragments of the MTSS1 CpG island for tumors identified of having methylation of this island compared to matched normal samples. Fragment 1 encompasses the MspI fragment we have identified as being methylated and overlaps the gene TSS. Fragment 5, we do not detect methylation. Both Normal and Tumor were digested with McrBC or mock digested for both matched pairs.

    Techniques Used: Polymerase Chain Reaction, Methylation

    14) Product Images from "Poly(ADP-ribosyl)ation is involved in the epigenetic control of TET1 gene transcription"

    Article Title: Poly(ADP-ribosyl)ation is involved in the epigenetic control of TET1 gene transcription

    Journal: Oncotarget

    doi:

    DNA methylation negatively regulates TET1 transcription (A) Western blot analysis of TET1 protein in MOLT-3 and SKW-3 cell lines. LAMIN B1 (LMNB1) was used as loading control. (B) Schematic representation of TET1 gene where the expanded region is the fragment investigated by EpiTYPER assay for DNA methylation analysis. Each stick is a CpG and each circle represents CpGs detectable by EpiTYPER assay. (C) DNA methylation analysis of TET1 CGI performed by using EpiTYPER assay. (D) Analysis of TET1 DNA methylation using MspI/HpaII restriction and PCR amplification performed on SKW-3 cells treated for 48 hrs with different doses of 5-azacytidine (5-aza). U, uncut; H, HpaII; M, MspI. (E) qRT-PCR analysis of TET1 gene expression on SKW-3 cells treated for 48 hrs with different doses of 5-aza. The results are shown as means ± S.E.M. (n=3). P-value was determined by paired Student's t-test (**P
    Figure Legend Snippet: DNA methylation negatively regulates TET1 transcription (A) Western blot analysis of TET1 protein in MOLT-3 and SKW-3 cell lines. LAMIN B1 (LMNB1) was used as loading control. (B) Schematic representation of TET1 gene where the expanded region is the fragment investigated by EpiTYPER assay for DNA methylation analysis. Each stick is a CpG and each circle represents CpGs detectable by EpiTYPER assay. (C) DNA methylation analysis of TET1 CGI performed by using EpiTYPER assay. (D) Analysis of TET1 DNA methylation using MspI/HpaII restriction and PCR amplification performed on SKW-3 cells treated for 48 hrs with different doses of 5-azacytidine (5-aza). U, uncut; H, HpaII; M, MspI. (E) qRT-PCR analysis of TET1 gene expression on SKW-3 cells treated for 48 hrs with different doses of 5-aza. The results are shown as means ± S.E.M. (n=3). P-value was determined by paired Student's t-test (**P

    Techniques Used: DNA Methylation Assay, Western Blot, EpiTYPER Assay, Polymerase Chain Reaction, Amplification, Quantitative RT-PCR, Expressing

    PARylation regulates DNA methylation patterns of TET1 CpG island (A) Schematic representation of TET1 gene where fragments BC (arrows) and A (arrowheads), amplified by PCR after endonuclease restriction for DNA methylation analysis, are indicated. Fragment BC contains recognition sites for MspI/HpaII which are not present in fragment A. The expanded region corresponds to the fragment analyzed by bisulfite sequencing where each stick is a CpG dinucleotide. (B) Analysis of TET1 DNA methylation using MspI/HpaII restriction and PCR amplification performed on MOLT-3 and SKW-3 treated for 72 hrs with 1μM PJ-34 or 1μM ABT-888. Fragment A was used as loading control. (C) Analysis of TET1 DNA methylation by bisulfite sequencing performed on MOLT-3 treated for 72 hrs with 1μM PJ-34 or 1μM ABT-888. Each clone is represented by a row, and the CpG dinucleotide being investigated is arranged in columns. White and black circles represent unmethylated and methylated/modified cytosines, respectively. (D) Analysis of DNA hydroxymethylation of TET1 CGI performed using glucosyltransferase reaction and MspI restriction followed by PCR amplification. Fragment A was used as loading control. Analysis was performed on MOLT-3 treated for 72 hrs with 1μM PJ-34 or 1μM ABT-888.
    Figure Legend Snippet: PARylation regulates DNA methylation patterns of TET1 CpG island (A) Schematic representation of TET1 gene where fragments BC (arrows) and A (arrowheads), amplified by PCR after endonuclease restriction for DNA methylation analysis, are indicated. Fragment BC contains recognition sites for MspI/HpaII which are not present in fragment A. The expanded region corresponds to the fragment analyzed by bisulfite sequencing where each stick is a CpG dinucleotide. (B) Analysis of TET1 DNA methylation using MspI/HpaII restriction and PCR amplification performed on MOLT-3 and SKW-3 treated for 72 hrs with 1μM PJ-34 or 1μM ABT-888. Fragment A was used as loading control. (C) Analysis of TET1 DNA methylation by bisulfite sequencing performed on MOLT-3 treated for 72 hrs with 1μM PJ-34 or 1μM ABT-888. Each clone is represented by a row, and the CpG dinucleotide being investigated is arranged in columns. White and black circles represent unmethylated and methylated/modified cytosines, respectively. (D) Analysis of DNA hydroxymethylation of TET1 CGI performed using glucosyltransferase reaction and MspI restriction followed by PCR amplification. Fragment A was used as loading control. Analysis was performed on MOLT-3 treated for 72 hrs with 1μM PJ-34 or 1μM ABT-888.

    Techniques Used: DNA Methylation Assay, Amplification, Polymerase Chain Reaction, Methylation Sequencing, Methylation, Modification

    15) Product Images from "Differential DNA Methylation Analysis without a Reference Genome"

    Article Title: Differential DNA Methylation Analysis without a Reference Genome

    Journal: Cell Reports

    doi: 10.1016/j.celrep.2015.11.024

    DNA Methylation Analysis without a Reference Genome Workflow for reference-genome-independent analysis of differential DNA methylation using an optimized RRBS protocol and the RefFreeDMA software. Colored bars represent RRBS sequencing reads, and identical colors indicate high sequence similarity. Bisulfite-converted MspI restriction sites are shown at the beginning of each read (CGG for methylated sites and TGG for unmethylated sites). To derive a deduced genome, reads from all samples are clustered by sequence similarity, and a consensus sequence is determined. These deduced genome fragments (black-edged bars) are concatenated into one deduced genome, to which the RRBS reads for each sample are mapped. DNA methylation levels are obtained by counting the number of Cs versus Ts for individual cytosines in the deduced genome (this step typically focuses on CpG sites, but the method also supports the analysis of non-CpG methylation). Differential methylation analysis is performed by comparing site-specific and fragment-specific DNA methylation levels between sample groups. Finally, the identified differentially methylated fragments are analyzed by cross-mapping to well-annotated genomes of other species (e.g., mouse or human) and by motif enrichment analysis (e.g., for identifying enriched transcription factor binding sites).
    Figure Legend Snippet: DNA Methylation Analysis without a Reference Genome Workflow for reference-genome-independent analysis of differential DNA methylation using an optimized RRBS protocol and the RefFreeDMA software. Colored bars represent RRBS sequencing reads, and identical colors indicate high sequence similarity. Bisulfite-converted MspI restriction sites are shown at the beginning of each read (CGG for methylated sites and TGG for unmethylated sites). To derive a deduced genome, reads from all samples are clustered by sequence similarity, and a consensus sequence is determined. These deduced genome fragments (black-edged bars) are concatenated into one deduced genome, to which the RRBS reads for each sample are mapped. DNA methylation levels are obtained by counting the number of Cs versus Ts for individual cytosines in the deduced genome (this step typically focuses on CpG sites, but the method also supports the analysis of non-CpG methylation). Differential methylation analysis is performed by comparing site-specific and fragment-specific DNA methylation levels between sample groups. Finally, the identified differentially methylated fragments are analyzed by cross-mapping to well-annotated genomes of other species (e.g., mouse or human) and by motif enrichment analysis (e.g., for identifying enriched transcription factor binding sites).

    Techniques Used: DNA Methylation Assay, Software, Sequencing, Methylation, CpG Methylation Assay, Binding Assay

    An Optimized RRBS Protocol Validated in Nine Species (A) Schematic outline of RRBS library preparation and the corresponding sequencing reads. (B) Computationally predicted (blue) and experimentally measured (red) fragment length distribution of RRBS libraries in nine vertebrate species. Predictions were based on in silico MspI restriction digests of the reference genomes using the BSgenome R package. Experimental results were obtained by electrophoresis (Experion DNA 1k chip). In species with a reference genome, concordance between predicted and experimentally measured peaks can be used to confirm successful RRBS library preparation.
    Figure Legend Snippet: An Optimized RRBS Protocol Validated in Nine Species (A) Schematic outline of RRBS library preparation and the corresponding sequencing reads. (B) Computationally predicted (blue) and experimentally measured (red) fragment length distribution of RRBS libraries in nine vertebrate species. Predictions were based on in silico MspI restriction digests of the reference genomes using the BSgenome R package. Experimental results were obtained by electrophoresis (Experion DNA 1k chip). In species with a reference genome, concordance between predicted and experimentally measured peaks can be used to confirm successful RRBS library preparation.

    Techniques Used: Sequencing, In Silico, Electrophoresis, Chromatin Immunoprecipitation

    16) Product Images from "Loci specific epigenetic drug sensitivity"

    Article Title: Loci specific epigenetic drug sensitivity

    Journal: bioRxiv

    doi: 10.1101/686139

    An overview of MAPMEDS. (a) Schematic structure of barcoded lentiviral constructs. The library vector contains short barcode, CMV promoter and mClover fluorescent protein as a reporter. The barcode is random 16-bp-long DNA with repeats of A,G and T. MspI restriction site is integrated upstream CMV promoter for genomic location mapping. (b) Barcoded lentivirus was packed and transduced into K562 cells at low MOI to create founder cells with singly integrated reporter. (c-d) Barcoded founder cells, selected by flow cytometry, were expanded for two weeks and split into two pools. Cells in the first pool were collected for locating reporter integration site. Founder cells in the second pool were sorted into 96-well plates to establish clonal cell lines. Barcode of each clone was simultaneously identified by split-pool encoding and deep sequencing. Library of characterized reporter clones is a useful resource to examine loci specific epigenetic drug sensitivity. (e) Loci specific effects were decoupled from global effects through mixing individual barcoded clones of interests with control cells expressing mClover and IRFP from multiple integration sites. Co-cultured cells were treated with TSA, JQ1 and 5’AZA for 24 hours. Expression of reporter proteins were measured by flow cytometers. Distribution of mClover expression in control cells was used to remove global effects of drugs. (f) A cartoon illustrating known mechanisms of actions of Trichostatin A, JQ1 and 5-Azacytidine.
    Figure Legend Snippet: An overview of MAPMEDS. (a) Schematic structure of barcoded lentiviral constructs. The library vector contains short barcode, CMV promoter and mClover fluorescent protein as a reporter. The barcode is random 16-bp-long DNA with repeats of A,G and T. MspI restriction site is integrated upstream CMV promoter for genomic location mapping. (b) Barcoded lentivirus was packed and transduced into K562 cells at low MOI to create founder cells with singly integrated reporter. (c-d) Barcoded founder cells, selected by flow cytometry, were expanded for two weeks and split into two pools. Cells in the first pool were collected for locating reporter integration site. Founder cells in the second pool were sorted into 96-well plates to establish clonal cell lines. Barcode of each clone was simultaneously identified by split-pool encoding and deep sequencing. Library of characterized reporter clones is a useful resource to examine loci specific epigenetic drug sensitivity. (e) Loci specific effects were decoupled from global effects through mixing individual barcoded clones of interests with control cells expressing mClover and IRFP from multiple integration sites. Co-cultured cells were treated with TSA, JQ1 and 5’AZA for 24 hours. Expression of reporter proteins were measured by flow cytometers. Distribution of mClover expression in control cells was used to remove global effects of drugs. (f) A cartoon illustrating known mechanisms of actions of Trichostatin A, JQ1 and 5-Azacytidine.

    Techniques Used: Construct, Plasmid Preparation, Flow Cytometry, Sequencing, Clone Assay, Expressing, Cell Culture

    Diverse insertion landscapes of barcoded reporter. (a) Reporter mapping by inverse PCR. Genomic DNA of founder cells was extracted, digested with restriction enzyme MspI and self-ligated to stitch barcode with its neighboring genome. Ligated product was amplified and followed by next generation sequencing. (b) Ideogram plot displaying reporter integration sites of individual clones in the library. Centromere position is indicated in red and stalk is marked in light blue. Heterochromatic region, which tend to be rich with adenine and thymine and relatively gene-poor, is represented by black and variation of grey. R-band in white on the ideogram is less condensed chromatin that is transcriptionally more active.
    Figure Legend Snippet: Diverse insertion landscapes of barcoded reporter. (a) Reporter mapping by inverse PCR. Genomic DNA of founder cells was extracted, digested with restriction enzyme MspI and self-ligated to stitch barcode with its neighboring genome. Ligated product was amplified and followed by next generation sequencing. (b) Ideogram plot displaying reporter integration sites of individual clones in the library. Centromere position is indicated in red and stalk is marked in light blue. Heterochromatic region, which tend to be rich with adenine and thymine and relatively gene-poor, is represented by black and variation of grey. R-band in white on the ideogram is less condensed chromatin that is transcriptionally more active.

    Techniques Used: Inverse PCR, Amplification, Next-Generation Sequencing, Clone Assay

    17) Product Images from "Interplay between Cellular Methyl Metabolism and Adaptive Efflux during Oncogenic Transformation from Chronic Arsenic Exposure in Human Cells *Interplay between Cellular Methyl Metabolism and Adaptive Efflux during Oncogenic Transformation from Chronic Arsenic Exposure in Human Cells * S⃞"

    Article Title: Interplay between Cellular Methyl Metabolism and Adaptive Efflux during Oncogenic Transformation from Chronic Arsenic Exposure in Human Cells *Interplay between Cellular Methyl Metabolism and Adaptive Efflux during Oncogenic Transformation from Chronic Arsenic Exposure in Human Cells * S⃞

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M802942200

    Selected areas of DNA methylation in control or arsenic-exposed RWPE-1 cells at 4 weeks of exposure using arbitrarily primed PCR after restriction enzyme digestions. Shown are details of a representative gel with an area of distinct DNA hypomethylation in arsenic-treated DNA ( left panels, two-headed arrows ) and densitometric analysis ( n = 3) of this band ( right panel ). See methods for details. An asterisk indicates a significant difference ( p ≤ 0.05) from control. Unmethylated DNA is not protected from digestion by methylation-sensitive HpaII restriction enzyme resulting in a loss of DNA for PCR amplification. Digestion with RsaI + MspI would also result in no PCR amplification regardless of methylation status. Digestion with RsaI alone and RsaI + MspI were used as controls to determine whether there was differential methylation.
    Figure Legend Snippet: Selected areas of DNA methylation in control or arsenic-exposed RWPE-1 cells at 4 weeks of exposure using arbitrarily primed PCR after restriction enzyme digestions. Shown are details of a representative gel with an area of distinct DNA hypomethylation in arsenic-treated DNA ( left panels, two-headed arrows ) and densitometric analysis ( n = 3) of this band ( right panel ). See methods for details. An asterisk indicates a significant difference ( p ≤ 0.05) from control. Unmethylated DNA is not protected from digestion by methylation-sensitive HpaII restriction enzyme resulting in a loss of DNA for PCR amplification. Digestion with RsaI + MspI would also result in no PCR amplification regardless of methylation status. Digestion with RsaI alone and RsaI + MspI were used as controls to determine whether there was differential methylation.

    Techniques Used: DNA Methylation Assay, Polymerase Chain Reaction, Methylation, Amplification

    18) Product Images from "Integrated detection of both 5-mC and 5-hmC by high-throughput tag sequencing technology highlights methylation reprogramming of bivalent genes during cellular differentiation"

    Article Title: Integrated detection of both 5-mC and 5-hmC by high-throughput tag sequencing technology highlights methylation reprogramming of bivalent genes during cellular differentiation

    Journal: Epigenetics

    doi: 10.4161/epi.24280

    Figure 1. Schematic presentation of the HMST-Seq method. For (A) “C + mC” library, the genomic DNA was first glucosylated, and then digested with MspI. For (B) “C” library and (C) “C + mC + hmC”
    Figure Legend Snippet: Figure 1. Schematic presentation of the HMST-Seq method. For (A) “C + mC” library, the genomic DNA was first glucosylated, and then digested with MspI. For (B) “C” library and (C) “C + mC + hmC”

    Techniques Used:

    19) Product Images from "First Case of Segniliparus rotundus Pneumonia in a Patient with Bronchiectasis ▿"

    Article Title: First Case of Segniliparus rotundus Pneumonia in a Patient with Bronchiectasis ▿

    Journal: Journal of Clinical Microbiology

    doi: 10.1128/JCM.01023-11

    PCR restriction-enzyme polymorphism analysis (PRA). (A) Simulation of PRA of the hsp65 and rpoB genes. (B) PRA electrophoresis results. M, size marker; lanes 1 to 3, hsp65 amplicons digested by MspI from S. rugosus CIP 108378 T , S. rotundus CIP 108380
    Figure Legend Snippet: PCR restriction-enzyme polymorphism analysis (PRA). (A) Simulation of PRA of the hsp65 and rpoB genes. (B) PRA electrophoresis results. M, size marker; lanes 1 to 3, hsp65 amplicons digested by MspI from S. rugosus CIP 108378 T , S. rotundus CIP 108380

    Techniques Used: Polymerase Chain Reaction, Electrophoresis, Marker

    20) Product Images from "Colonization of the Cecal Mucosa by Helicobacter hepaticus Impacts the Diversity of the Indigenous Microbiota "

    Article Title: Colonization of the Cecal Mucosa by Helicobacter hepaticus Impacts the Diversity of the Indigenous Microbiota

    Journal: Infection and Immunity

    doi: 10.1128/IAI.73.10.6852-6961.2005

    Changes in diversity measures of the mucosa-associated microbiota of the murine cecum 30 days after experimental infection with H. hepaticus . The Shannon diversity index ( H ) and Shannon evenness ( H / H max ) were calculated for each mouse based on normalized T-RFLP profiles obtained with HhaI and MspI digestion. Compared to uninfected animals (“Uninfected” category), animals experimentally infected with H. hepaticus (“Infected” category) had significant decreases in both diversity and evenness. When the analysis was repeated, this time suppressing the H. hepaticus terminal restriction fragment before normalization of the profiles (“Infected [suppressed]” category), the change in diversity and evenness in infected animals was no longer apparent. Comparisons for all pairs of time points was performed by analysis of variance using Tukey-Kramer honestly significant difference. Categories within each plot not connected by the same roman numeral are significantly different with an alpha level set to 0.05.
    Figure Legend Snippet: Changes in diversity measures of the mucosa-associated microbiota of the murine cecum 30 days after experimental infection with H. hepaticus . The Shannon diversity index ( H ) and Shannon evenness ( H / H max ) were calculated for each mouse based on normalized T-RFLP profiles obtained with HhaI and MspI digestion. Compared to uninfected animals (“Uninfected” category), animals experimentally infected with H. hepaticus (“Infected” category) had significant decreases in both diversity and evenness. When the analysis was repeated, this time suppressing the H. hepaticus terminal restriction fragment before normalization of the profiles (“Infected [suppressed]” category), the change in diversity and evenness in infected animals was no longer apparent. Comparisons for all pairs of time points was performed by analysis of variance using Tukey-Kramer honestly significant difference. Categories within each plot not connected by the same roman numeral are significantly different with an alpha level set to 0.05.

    Techniques Used: Infection

    21) Product Images from "Development of High-Density Genetic Maps for Barley and Wheat Using a Novel Two-Enzyme Genotyping-by-Sequencing Approach"

    Article Title: Development of High-Density Genetic Maps for Barley and Wheat Using a Novel Two-Enzyme Genotyping-by-Sequencing Approach

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0032253

    Adapter Design, PCR amplification of fragments. 1) The ligation product of a genomic DNA fragment (black) containing a PstI restriction site and a MspI restriction site. The forward adapter (blue) binds to a PstI generated overhang. The 4–9 bp barcode for this adapter is in bold with “X”. The MspI generated overhang corresponds to the reverse Y-adapter (green). The unpaired tail of the Y-adapter is underlined. 2) During the first round of PCR only the forward primer (red) can anneal. PCR synthesis of the complementary strand proceeds to the end of the fragment synthesizing the compliment of the Y-adapter tail. 3) During the second round of PCR the reverse primer (orange) can anneal to the newly synthesized compliment of the Y-adapter tail. This PCR reaction then proceeds to fill in the compliment of the forward adapter/primer on the other end of the same fragment.
    Figure Legend Snippet: Adapter Design, PCR amplification of fragments. 1) The ligation product of a genomic DNA fragment (black) containing a PstI restriction site and a MspI restriction site. The forward adapter (blue) binds to a PstI generated overhang. The 4–9 bp barcode for this adapter is in bold with “X”. The MspI generated overhang corresponds to the reverse Y-adapter (green). The unpaired tail of the Y-adapter is underlined. 2) During the first round of PCR only the forward primer (red) can anneal. PCR synthesis of the complementary strand proceeds to the end of the fragment synthesizing the compliment of the Y-adapter tail. 3) During the second round of PCR the reverse primer (orange) can anneal to the newly synthesized compliment of the Y-adapter tail. This PCR reaction then proceeds to fill in the compliment of the forward adapter/primer on the other end of the same fragment.

    Techniques Used: Polymerase Chain Reaction, Amplification, Ligation, Generated, Synthesized

    22) Product Images from "PADI4 Haplotypes in Association with RA Mexican Patients, a New Prospect for Antigen Modulation"

    Article Title: PADI4 Haplotypes in Association with RA Mexican Patients, a New Prospect for Antigen Modulation

    Journal: Clinical and Developmental Immunology

    doi: 10.1155/2013/383681

    PADI4 SNPs enzyme digestion. The figure shows digestion of three SNPs in the PADI4 gene. (a) Shows digestion of PADI4_89, with HaeIII enzyme; lane 1 represents the A/A genotype, lane 2 A/G and 3 G/G. (b) Demonstrates PADI4_90 amplification (221 bp) in lane 1 and digested products with MscI enzyme in lanes 2 (C/C genotype), 3 (C/T genotype), and 4 (T/T genotype). (c) Shows amplification product of PADI4_92 in lane 1 (363 bp) and restriction products obtained with the enzyme MspI; lane 2 corresponds to the G/G genotype, lane 3 G/C, and lane 4 C/C. Visualized in 8% (29 : 1) polyacrylamide gel with silver staining. M: molecular weight marker (50 bp).
    Figure Legend Snippet: PADI4 SNPs enzyme digestion. The figure shows digestion of three SNPs in the PADI4 gene. (a) Shows digestion of PADI4_89, with HaeIII enzyme; lane 1 represents the A/A genotype, lane 2 A/G and 3 G/G. (b) Demonstrates PADI4_90 amplification (221 bp) in lane 1 and digested products with MscI enzyme in lanes 2 (C/C genotype), 3 (C/T genotype), and 4 (T/T genotype). (c) Shows amplification product of PADI4_92 in lane 1 (363 bp) and restriction products obtained with the enzyme MspI; lane 2 corresponds to the G/G genotype, lane 3 G/C, and lane 4 C/C. Visualized in 8% (29 : 1) polyacrylamide gel with silver staining. M: molecular weight marker (50 bp).

    Techniques Used: Amplification, Silver Staining, Molecular Weight, Marker

    23) Product Images from "In Silico Enhanced Restriction Enzyme Based Methylation Analysis of the Human Glioblastoma Genome Using Agilent 244K CpG Island Microarrays"

    Article Title: In Silico Enhanced Restriction Enzyme Based Methylation Analysis of the Human Glioblastoma Genome Using Agilent 244K CpG Island Microarrays

    Journal: Frontiers in Neuroscience

    doi: 10.3389/neuro.15.005.2009

    Schematic diagram of in silico annotated genomic DNA and MSRE method . (A) Using in silico simulation, genomic DNA can be separated into MSRE sensitive and insensitive BfaI fragments (flanked by gray boxes) based on the presence or absence of internal HpaII/MspI sites (CCGG) (blue squares). Microarray probes binding to sensitive fragments are represented with green rectangles. Probes binding to insensitive fragments are represented by blue rectangles. Sensitive fragments can have multiple CCGG sites that can be fully methylated, partially methylated, or completely unmethylated in tandem. Methylated CCGG sites (CC m GG) are indicated with a red dot placed above the blue square. (B) Genomic DNA is fragmented with BfaI, ligated to H12/H24 linkers, digested with HpaII and MspI in parallel, amplified, differentially labeled and co-hybridized to Agilent CpG island arrays. Uncleaved fragments will have high intensities compared to cleaved fragments since only uncleaved fragments are amplified. Fully methylated fragments are cut by MspI but not HpaII, resulting in amplification of HpaII digested fragments only with resultant M -value [log 2 (HpaII/MspI)] > 0. Completely unmethylated or partially methylated (not all CCGGs methylated in tandem) fragments are cut by both MspI and HpaII. With the absence of amplification, these fragments resulting in low signal intensities in both channels (HpaII and MspI ∼ 0) with M = 0. Insensitive fragments should not be cut by either enzyme, resulting in M = 0.
    Figure Legend Snippet: Schematic diagram of in silico annotated genomic DNA and MSRE method . (A) Using in silico simulation, genomic DNA can be separated into MSRE sensitive and insensitive BfaI fragments (flanked by gray boxes) based on the presence or absence of internal HpaII/MspI sites (CCGG) (blue squares). Microarray probes binding to sensitive fragments are represented with green rectangles. Probes binding to insensitive fragments are represented by blue rectangles. Sensitive fragments can have multiple CCGG sites that can be fully methylated, partially methylated, or completely unmethylated in tandem. Methylated CCGG sites (CC m GG) are indicated with a red dot placed above the blue square. (B) Genomic DNA is fragmented with BfaI, ligated to H12/H24 linkers, digested with HpaII and MspI in parallel, amplified, differentially labeled and co-hybridized to Agilent CpG island arrays. Uncleaved fragments will have high intensities compared to cleaved fragments since only uncleaved fragments are amplified. Fully methylated fragments are cut by MspI but not HpaII, resulting in amplification of HpaII digested fragments only with resultant M -value [log 2 (HpaII/MspI)] > 0. Completely unmethylated or partially methylated (not all CCGGs methylated in tandem) fragments are cut by both MspI and HpaII. With the absence of amplification, these fragments resulting in low signal intensities in both channels (HpaII and MspI ∼ 0) with M = 0. Insensitive fragments should not be cut by either enzyme, resulting in M = 0.

    Techniques Used: In Silico, Microarray, Binding Assay, Methylation, Amplification, Labeling

    24) Product Images from "AFSM sequencing approach: a simple and rapid method for genome-wide SNP and methylation site discovery and genetic mapping"

    Article Title: AFSM sequencing approach: a simple and rapid method for genome-wide SNP and methylation site discovery and genetic mapping

    Journal: Scientific Reports

    doi: 10.1038/srep07300

    AFSM adapters and primers. (a, c) Sequences of three different types of double-stranded AFSM adapters. The barcode adapter terminates with a 5-bp barcode at the 3′ end of its top stand and a 5-bp overhang at the 5′ end of its bottom strand that is complementary to the sticky end generated by EcoRI. The HpaII-methylation adapter has a HpaII-compatible sticky end, and the MspI-methylation adapter has a MspI-compatible sticky end. (b) PCR primer sequences for EcoRI-HpaII. (d) PCR primer sequences for EcoRI-MspI.
    Figure Legend Snippet: AFSM adapters and primers. (a, c) Sequences of three different types of double-stranded AFSM adapters. The barcode adapter terminates with a 5-bp barcode at the 3′ end of its top stand and a 5-bp overhang at the 5′ end of its bottom strand that is complementary to the sticky end generated by EcoRI. The HpaII-methylation adapter has a HpaII-compatible sticky end, and the MspI-methylation adapter has a MspI-compatible sticky end. (b) PCR primer sequences for EcoRI-HpaII. (d) PCR primer sequences for EcoRI-MspI.

    Techniques Used: Generated, Methylation, Polymerase Chain Reaction

    Preparation and sequencing of AFSM tags. Sample preparation for AFSM genotyping is accomplished by combining two restriction enzyme pairs (EcoRI-MspI and EcoRI-HpaII) to digest genomic DNA and incorporating barcodes for multiplex sequencing. EcoRI is used as a rare cutter, and the methylation-retraction enzymes HpaII and MspI are employed as frequent cutters. HpaII and MspI have different sensitivities to methylation of the inner or outer cytosines and can produce different products, reflecting the different methylation states of the cytosines.
    Figure Legend Snippet: Preparation and sequencing of AFSM tags. Sample preparation for AFSM genotyping is accomplished by combining two restriction enzyme pairs (EcoRI-MspI and EcoRI-HpaII) to digest genomic DNA and incorporating barcodes for multiplex sequencing. EcoRI is used as a rare cutter, and the methylation-retraction enzymes HpaII and MspI are employed as frequent cutters. HpaII and MspI have different sensitivities to methylation of the inner or outer cytosines and can produce different products, reflecting the different methylation states of the cytosines.

    Techniques Used: Sequencing, Sample Prep, Multiplex Assay, Methylation

    25) Product Images from "Mutations in CDCA7 and HELLS cause immunodeficiency–centromeric instability–facial anomalies syndrome"

    Article Title: Mutations in CDCA7 and HELLS cause immunodeficiency–centromeric instability–facial anomalies syndrome

    Journal: Nature Communications

    doi: 10.1038/ncomms8870

    Mutations in HELLS in five ICF4 patients. ( a ) Schematic representation of HELLS, with the identified mutations in red. ( b ) Sanger sequencing confirmation of HELLS mutations in family E. Only c.370+2T > A was identified in maternal DNA, indicating different allelic origins of both mutations, or de novo occurrence of the second mutation. ( c ) RT–PCR analysis of HELLS mRNA on treatment of patient-derived fibroblasts with cycloheximide (C) revealed that c.370+2T > A leads to complete skipping of exon 5 and disruption of the open reading frame. Ethanol-treated samples (E) served as controls, alternative splicing was confirmed using Sanger's sequencing in two independent experiments for both samples. ( d ) Sanger sequencing confirmation of a homozygous out-of-frame deletion in HELLS in family F. Both parents as well as unaffected sibling 2.1 are heterozygous for the deletion allele; unaffected sibling 2.3 is homozygous for the wt allele. ( e ) Sanger sequencing confirmation of a homozygous in-frame deletion in HELLS in family G. Both parents are heterozygous for the deletion allele. ( f ) Sanger sequencing confirmation of nonsense mutations in HELLS in family H. Different allelic origin was confirmed in parental DNA. ( g ) Southern blot analysis of minor satellite DNA methylation in Dnmt3b −/− and siRNA-treated wt MEFs after digesting DNA with MspI or its methylation-sensitive isoschizomer HpaII revealed CpG hypomethylation on knockdown of Zbtb24, Cdca7 and Hells. Molecular weights of the 2-Log DNA size marker are in kilobasepairs.
    Figure Legend Snippet: Mutations in HELLS in five ICF4 patients. ( a ) Schematic representation of HELLS, with the identified mutations in red. ( b ) Sanger sequencing confirmation of HELLS mutations in family E. Only c.370+2T > A was identified in maternal DNA, indicating different allelic origins of both mutations, or de novo occurrence of the second mutation. ( c ) RT–PCR analysis of HELLS mRNA on treatment of patient-derived fibroblasts with cycloheximide (C) revealed that c.370+2T > A leads to complete skipping of exon 5 and disruption of the open reading frame. Ethanol-treated samples (E) served as controls, alternative splicing was confirmed using Sanger's sequencing in two independent experiments for both samples. ( d ) Sanger sequencing confirmation of a homozygous out-of-frame deletion in HELLS in family F. Both parents as well as unaffected sibling 2.1 are heterozygous for the deletion allele; unaffected sibling 2.3 is homozygous for the wt allele. ( e ) Sanger sequencing confirmation of a homozygous in-frame deletion in HELLS in family G. Both parents are heterozygous for the deletion allele. ( f ) Sanger sequencing confirmation of nonsense mutations in HELLS in family H. Different allelic origin was confirmed in parental DNA. ( g ) Southern blot analysis of minor satellite DNA methylation in Dnmt3b −/− and siRNA-treated wt MEFs after digesting DNA with MspI or its methylation-sensitive isoschizomer HpaII revealed CpG hypomethylation on knockdown of Zbtb24, Cdca7 and Hells. Molecular weights of the 2-Log DNA size marker are in kilobasepairs.

    Techniques Used: Sequencing, Mutagenesis, Reverse Transcription Polymerase Chain Reaction, Derivative Assay, Southern Blot, DNA Methylation Assay, Methylation, Marker

    26) Product Images from "Endogenous melatonin promotes rhythmic recruitment of neutrophils toward an injury in zebrafish"

    Article Title: Endogenous melatonin promotes rhythmic recruitment of neutrophils toward an injury in zebrafish

    Journal: Scientific Reports

    doi: 10.1038/s41598-017-05074-w

    Establishment of a visual model for monitoring neutrophil migration in aanat2 −/− zebrafish. ( A ) Hybridization of transgenic line Tg ( lyz:EGFP ) labeling neutrophils and aanat2 mutants for two consecutive generations. ( B ) In F 2 zebrafish, we identified the homozygous aanat2 −/− transgenic zebrafish. Extracted genomic DNA from the tail fin of screened transgenic zebrafish was amplified using PCR and digested using the MspI enzyme. The uncleaved band indicated homozygous zebrafish. ( C ) To evaluate the functional effect of Tg ( lyz:EGFP ) ;aanat2 −/− zebrafish, we measured melatonin levels using an ELISA. Fifty larvae were homogenated and then melatonin was extracted using methanol as an individual sample (IBL international, Germany). The experiment used three samples. Results indicated that melatonin was significantly decreased at night compared with WT/AB larvae. The melatonin content could be partly rescued by injection of aanat2 capped mRNA (control, n = 50; mutant, n = 50; mutant + mRNA, n = 50) (ANOVA analysis). (*** P
    Figure Legend Snippet: Establishment of a visual model for monitoring neutrophil migration in aanat2 −/− zebrafish. ( A ) Hybridization of transgenic line Tg ( lyz:EGFP ) labeling neutrophils and aanat2 mutants for two consecutive generations. ( B ) In F 2 zebrafish, we identified the homozygous aanat2 −/− transgenic zebrafish. Extracted genomic DNA from the tail fin of screened transgenic zebrafish was amplified using PCR and digested using the MspI enzyme. The uncleaved band indicated homozygous zebrafish. ( C ) To evaluate the functional effect of Tg ( lyz:EGFP ) ;aanat2 −/− zebrafish, we measured melatonin levels using an ELISA. Fifty larvae were homogenated and then melatonin was extracted using methanol as an individual sample (IBL international, Germany). The experiment used three samples. Results indicated that melatonin was significantly decreased at night compared with WT/AB larvae. The melatonin content could be partly rescued by injection of aanat2 capped mRNA (control, n = 50; mutant, n = 50; mutant + mRNA, n = 50) (ANOVA analysis). (*** P

    Techniques Used: Migration, Hybridization, Transgenic Assay, Labeling, Amplification, Polymerase Chain Reaction, Functional Assay, Enzyme-linked Immunosorbent Assay, Injection, Mutagenesis

    Generation of aanat2 mutant zebrafish using CRISPR-Cas9. ( A ) Schematic of the Cas9-gRNA-targeted site in the first aanat2 exon. The protospacer-adjacent motif (PAM) sequence (CGG) is labeled in blue and the MspI restriction site is underlined. ( B ) The targeted fragment was PCR-amplified from pooled genomic DNA of 15 embryos co-microinjected with 300 pg Cas9 mRNA and 100–200 pg gRNA, and then digested with MspI. The uncleaved (290 bp) and cleaved PCR products (167 bp and 123 bp) were indicated. Mutagenesis efficiencies were calculated by the ratios of intensities of uncleaved bands to the sum of cleaved bands using Image J software. M, marker: 1–2, injected groups at concentrations of 100 pg and 200 pg of aanat2 gRNA, respectively; 3, wild-type control with digestion of MspI; 4, undigested wild-type PCR products. ( C ) Representative sequencing results of the two mutated fish lines. One had a 9-bp insertion and a 1-bp deletion, the other had a 14-bp deletion (upper), and both lines had frameshift mutations that resulted in truncated proteins (lower). AA, amino acids.
    Figure Legend Snippet: Generation of aanat2 mutant zebrafish using CRISPR-Cas9. ( A ) Schematic of the Cas9-gRNA-targeted site in the first aanat2 exon. The protospacer-adjacent motif (PAM) sequence (CGG) is labeled in blue and the MspI restriction site is underlined. ( B ) The targeted fragment was PCR-amplified from pooled genomic DNA of 15 embryos co-microinjected with 300 pg Cas9 mRNA and 100–200 pg gRNA, and then digested with MspI. The uncleaved (290 bp) and cleaved PCR products (167 bp and 123 bp) were indicated. Mutagenesis efficiencies were calculated by the ratios of intensities of uncleaved bands to the sum of cleaved bands using Image J software. M, marker: 1–2, injected groups at concentrations of 100 pg and 200 pg of aanat2 gRNA, respectively; 3, wild-type control with digestion of MspI; 4, undigested wild-type PCR products. ( C ) Representative sequencing results of the two mutated fish lines. One had a 9-bp insertion and a 1-bp deletion, the other had a 14-bp deletion (upper), and both lines had frameshift mutations that resulted in truncated proteins (lower). AA, amino acids.

    Techniques Used: Mutagenesis, CRISPR, Sequencing, Labeling, Polymerase Chain Reaction, Amplification, Software, Marker, Injection, Fluorescence In Situ Hybridization

    27) Product Images from "Double restriction-enzyme digestion improves the coverage and accuracy of genome-wide CpG methylation profiling by reduced representation bisulfite sequencing"

    Article Title: Double restriction-enzyme digestion improves the coverage and accuracy of genome-wide CpG methylation profiling by reduced representation bisulfite sequencing

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-14-11

    CpG coverage in different genomic regions detected by the single-enzyme ( MspI ) and double-enzyme RRBS ( MspI plus ApeKI ) methods. ( a ) Genomic coverage by single-enzyme (top) and double-enzyme (bottom) RRBS in the YH genome with the same size selection (40-220 bp) and the same read lengths (50 bp). The number of individual CpG dinucleotides measurements in each genomic element, including promoters (2 kb upstream to TSS), CGIs and CGI shores (2 kb adjacent to upstream and downstream of CGIs) are displayed by incremental colors. ( b ) Genomic CpG coverage (CpG was covered at least once, CpG depth ≥ 1×) by single- or double-enzyme RRBS based on in silico analysis or sequencing data in YH and mDC samples. Ranges of size-selections for enzyme digested fragments and read lengths are displayed.
    Figure Legend Snippet: CpG coverage in different genomic regions detected by the single-enzyme ( MspI ) and double-enzyme RRBS ( MspI plus ApeKI ) methods. ( a ) Genomic coverage by single-enzyme (top) and double-enzyme (bottom) RRBS in the YH genome with the same size selection (40-220 bp) and the same read lengths (50 bp). The number of individual CpG dinucleotides measurements in each genomic element, including promoters (2 kb upstream to TSS), CGIs and CGI shores (2 kb adjacent to upstream and downstream of CGIs) are displayed by incremental colors. ( b ) Genomic CpG coverage (CpG was covered at least once, CpG depth ≥ 1×) by single- or double-enzyme RRBS based on in silico analysis or sequencing data in YH and mDC samples. Ranges of size-selections for enzyme digested fragments and read lengths are displayed.

    Techniques Used: Selection, In Silico, Sequencing

    28) Product Images from "Host Cell Detection of Noncoding Stuffer DNA Contained in Helper-Dependent Adenovirus Vectors Leads to Epigenetic Repression of Transgene Expression "

    Article Title: Host Cell Detection of Noncoding Stuffer DNA Contained in Helper-Dependent Adenovirus Vectors Leads to Epigenetic Repression of Transgene Expression

    Journal: Journal of Virology

    doi: 10.1128/JVI.00796-09

    hdAd-prok DNA is unmethylated. (A) hdAd-prok plasmid DNA or DNA from purified hdAd-prok virions was digested with MspI (M) or HpaII (H). The digested DNA was resolved on an agarose gel and visualized by ethidium bromide staining. (B) A549 cells were infected
    Figure Legend Snippet: hdAd-prok DNA is unmethylated. (A) hdAd-prok plasmid DNA or DNA from purified hdAd-prok virions was digested with MspI (M) or HpaII (H). The digested DNA was resolved on an agarose gel and visualized by ethidium bromide staining. (B) A549 cells were infected

    Techniques Used: Plasmid Preparation, Purification, Agarose Gel Electrophoresis, Staining, Infection

    29) Product Images from "High Resolution Methylome Analysis Reveals Widespread Functional Hypomethylation during Adult Human Erythropoiesis *"

    Article Title: High Resolution Methylome Analysis Reveals Widespread Functional Hypomethylation during Adult Human Erythropoiesis *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M112.423756

    High resolution analysis of methylation can reveal changes in intragenic regions that correlate with changes in gene expression for GATA1 . A , methylation is depicted as ratio of HpaII/MspI signals ( red bars ) with a negative value representing hypermethylation.
    Figure Legend Snippet: High resolution analysis of methylation can reveal changes in intragenic regions that correlate with changes in gene expression for GATA1 . A , methylation is depicted as ratio of HpaII/MspI signals ( red bars ) with a negative value representing hypermethylation.

    Techniques Used: Methylation, Expressing

    30) Product Images from "CpG-island promoters drive transcription of human telomeres"

    Article Title: CpG-island promoters drive transcription of human telomeres

    Journal: RNA

    doi: 10.1261/rna.1748309

    Cytosine methylation at 61-29-37 repeats. ( A,B ) Genomic DNA extracted from the indicated cell lines was digested with the methylation-sensitive HpaII restriction enzyme or with its methylation-insensitive isoschizomer MspI. Digested DNA was electrophoresed, blotted, and hybridized with radioactive DNA probes detecting 61-29-37 repeats. ( B ) DNMT1 −/− and DNMT3b − /− are HCT116-derived clonal cell lines knocked-out for DNA methyltransferases 1 and 3b, respectively. Double KO (DKO–) are HCT116-derived clonal cell lines knocked-out for both methyltransferases. Standard molecular weights are shown on the left of each blot in kilobases (kb).
    Figure Legend Snippet: Cytosine methylation at 61-29-37 repeats. ( A,B ) Genomic DNA extracted from the indicated cell lines was digested with the methylation-sensitive HpaII restriction enzyme or with its methylation-insensitive isoschizomer MspI. Digested DNA was electrophoresed, blotted, and hybridized with radioactive DNA probes detecting 61-29-37 repeats. ( B ) DNMT1 −/− and DNMT3b − /− are HCT116-derived clonal cell lines knocked-out for DNA methyltransferases 1 and 3b, respectively. Double KO (DKO–) are HCT116-derived clonal cell lines knocked-out for both methyltransferases. Standard molecular weights are shown on the left of each blot in kilobases (kb).

    Techniques Used: Methylation, Derivative Assay

    31) Product Images from "A cassette of basic amino acids in histone H2B regulates nucleosome dynamics and access to DNA damage"

    Article Title: A cassette of basic amino acids in histone H2B regulates nucleosome dynamics and access to DNA damage

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.RA117.000358

    Restriction enzyme accessibility assay on nucleosomal DNA containing WT (unmodified) or ΔHBR (H2BΔ24–31 amino acids ) histone octamers. A , schematic of the nucleosome core particle showing the approximate locations of two restriction sites relative to the dyad, where the number in parentheses indicates the cleavage site (base number) on the I strand toward the 5′ end from the dyad. The samples were incubated with either HaeIII or MspI, where indicated (+) for 2 h at 37 °C. In B , the substrate contained a uracil at −21 in B and at +4 in C. Error bars represent standard deviation of the means for at least three independent experiments. Two-tailed, unpaired t tests were performed, and asterisks indicate the level of significance with p values of 0.0001 and 0.004 for MspI and HaeIII, respectively, in B and 0.002 in C .
    Figure Legend Snippet: Restriction enzyme accessibility assay on nucleosomal DNA containing WT (unmodified) or ΔHBR (H2BΔ24–31 amino acids ) histone octamers. A , schematic of the nucleosome core particle showing the approximate locations of two restriction sites relative to the dyad, where the number in parentheses indicates the cleavage site (base number) on the I strand toward the 5′ end from the dyad. The samples were incubated with either HaeIII or MspI, where indicated (+) for 2 h at 37 °C. In B , the substrate contained a uracil at −21 in B and at +4 in C. Error bars represent standard deviation of the means for at least three independent experiments. Two-tailed, unpaired t tests were performed, and asterisks indicate the level of significance with p values of 0.0001 and 0.004 for MspI and HaeIII, respectively, in B and 0.002 in C .

    Techniques Used: Incubation, Standard Deviation, Two Tailed Test

    32) Product Images from "Ascorbic acid–induced TET activation mitigates adverse hydroxymethylcytosine loss in renal cell carcinoma"

    Article Title: Ascorbic acid–induced TET activation mitigates adverse hydroxymethylcytosine loss in renal cell carcinoma

    Journal: The Journal of Clinical Investigation

    doi: 10.1172/JCI98747

    AA leads to increased TET activity and 5hmC levels in ccRCC cells. ( A ) Schematic showing the role of AA as an essential cofactor for TET enzymatic activity. ( B ) Intracellular L2HG levels measured by MS in ccRCC cell line 786-O are much higher than in the immortalized normal kidney cell line HKC8 ( n = 2). ( C and D ) TET activity was measured in vitro with AA-treated RCC cells (769-P and 786-O) and was increased after treatment. t test, P values as indicated. Data are shown as mean ± SEM with individual data points overlaid ( n = 2). Exposure time was 4 hours, mimicking bioavailability curves with i.v. AA, followed by 24-hour incubation with fresh media prior to harvesting the cells for nuclear extraction and TET activity analysis. We adjusted for multiple comparisons by dividing the significance level by the number of comparisons performed via Bonferroni’s correction. Hypotheses were deemed significant if P values were lower than 0.025 (0.05/2 to account for multiple comparisons). ( E ) 5hmC was measured by LC-ESI-MS/MS and was significantly increased after AA treatment of RCC cells 769-P. Addition of catalase did not change the percentage of 5hmC. t test, P values as indicated. Data are shown as mean ± SEM with individual data points overlaid ( n = 2). We adjusted for multiple comparisons by dividing the significance level by the number of comparisons performed via Bonferroni’s correction. Hypotheses were deemed significant if P values were lower than 0.0125 (0.05/4 to account for multiple variations). ( F ) Unsupervised clustering based on genome-wide methylation analysis conducted by HELP assay. Ward clustering shows global methylation changes are induced by AA treatment. ( G ) Histograms based on methylation (log [HpaII/MspI]) show increased hypomethylation after AA treatment. ( H ) Smad6 promoter becomes demethylated after AA treatment in both 786-O and 769-P ccRCC cells.
    Figure Legend Snippet: AA leads to increased TET activity and 5hmC levels in ccRCC cells. ( A ) Schematic showing the role of AA as an essential cofactor for TET enzymatic activity. ( B ) Intracellular L2HG levels measured by MS in ccRCC cell line 786-O are much higher than in the immortalized normal kidney cell line HKC8 ( n = 2). ( C and D ) TET activity was measured in vitro with AA-treated RCC cells (769-P and 786-O) and was increased after treatment. t test, P values as indicated. Data are shown as mean ± SEM with individual data points overlaid ( n = 2). Exposure time was 4 hours, mimicking bioavailability curves with i.v. AA, followed by 24-hour incubation with fresh media prior to harvesting the cells for nuclear extraction and TET activity analysis. We adjusted for multiple comparisons by dividing the significance level by the number of comparisons performed via Bonferroni’s correction. Hypotheses were deemed significant if P values were lower than 0.025 (0.05/2 to account for multiple comparisons). ( E ) 5hmC was measured by LC-ESI-MS/MS and was significantly increased after AA treatment of RCC cells 769-P. Addition of catalase did not change the percentage of 5hmC. t test, P values as indicated. Data are shown as mean ± SEM with individual data points overlaid ( n = 2). We adjusted for multiple comparisons by dividing the significance level by the number of comparisons performed via Bonferroni’s correction. Hypotheses were deemed significant if P values were lower than 0.0125 (0.05/4 to account for multiple variations). ( F ) Unsupervised clustering based on genome-wide methylation analysis conducted by HELP assay. Ward clustering shows global methylation changes are induced by AA treatment. ( G ) Histograms based on methylation (log [HpaII/MspI]) show increased hypomethylation after AA treatment. ( H ) Smad6 promoter becomes demethylated after AA treatment in both 786-O and 769-P ccRCC cells.

    Techniques Used: Activity Assay, Mass Spectrometry, In Vitro, Incubation, IF-P, Genome Wide, Methylation, HELP Assay

    33) Product Images from "The high mobility group A2 protein epigenetically silences the Cdh1 gene during epithelial-to-mesenchymal transition"

    Article Title: The high mobility group A2 protein epigenetically silences the Cdh1 gene during epithelial-to-mesenchymal transition

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gku1293

    The Cdh1 promoter is epigenetically silenced in HMGA2-overexpressing NMuMG cells. ( A ) An illustration of the mouse Cdh1 promoter, position −230 to +200 base pairs relative to the transcription start site (+1), containing E-boxes (yellow) and CpG dinucleotides (black lines). The blue underline indicates the proximal region (position −108 to +3) examined in ChIP-qPCR assays in this study. ( B ) HMGA2 binding to proximal region of the mouse Cdh1 promoter was analysed by ChIP assays with non-specific IgG or HA antibody in NM-Mock and NM-Hmga2 cells. Precipitated DNA was analysed by qPCR and data are graphed as explained in the methods. ( C ) ChIP-qPCR assays were performed to examine levels of histone H3 and its lysine modifications (active marks, K4me3 and K9ac; repressive marks, K9me3 and K27me3) on the proximal region of the mouse Cdh1 promoter in NM-Mock and NM-Hmga2 cells. ( D ) HpaII–MspI digestion–methylation assay using primers which span the proximal region of the Cdh1 promoter in NM-Mock and NM-Hmga2 cells. The PCR product was subjected to agarose gel electrophoresis and a band observed after HpaII-digestion indicates that the amplified DNA is methylated (asterisk). ( E ) The DNA methylation status of the Cdh1 promoter in NM-Mock and NM-Hmga2 cells was analysed by bisulphite sequencing of the promoter region shown in panel A, where CpG sites are denoted by circles, and five independent clones of each cell line are shown here. White and black circles represent unmethylated and methylated CpG sites respectively. ( F ) Expression of HMGA2 and CDH1 in human breast cancer cell lines classified as basal A (red), basal B (grey) and luminal (blue) subtypes. Expression values derived from microarray analysis of gene expression are shown in logarithmic (log 2 ) scale.
    Figure Legend Snippet: The Cdh1 promoter is epigenetically silenced in HMGA2-overexpressing NMuMG cells. ( A ) An illustration of the mouse Cdh1 promoter, position −230 to +200 base pairs relative to the transcription start site (+1), containing E-boxes (yellow) and CpG dinucleotides (black lines). The blue underline indicates the proximal region (position −108 to +3) examined in ChIP-qPCR assays in this study. ( B ) HMGA2 binding to proximal region of the mouse Cdh1 promoter was analysed by ChIP assays with non-specific IgG or HA antibody in NM-Mock and NM-Hmga2 cells. Precipitated DNA was analysed by qPCR and data are graphed as explained in the methods. ( C ) ChIP-qPCR assays were performed to examine levels of histone H3 and its lysine modifications (active marks, K4me3 and K9ac; repressive marks, K9me3 and K27me3) on the proximal region of the mouse Cdh1 promoter in NM-Mock and NM-Hmga2 cells. ( D ) HpaII–MspI digestion–methylation assay using primers which span the proximal region of the Cdh1 promoter in NM-Mock and NM-Hmga2 cells. The PCR product was subjected to agarose gel electrophoresis and a band observed after HpaII-digestion indicates that the amplified DNA is methylated (asterisk). ( E ) The DNA methylation status of the Cdh1 promoter in NM-Mock and NM-Hmga2 cells was analysed by bisulphite sequencing of the promoter region shown in panel A, where CpG sites are denoted by circles, and five independent clones of each cell line are shown here. White and black circles represent unmethylated and methylated CpG sites respectively. ( F ) Expression of HMGA2 and CDH1 in human breast cancer cell lines classified as basal A (red), basal B (grey) and luminal (blue) subtypes. Expression values derived from microarray analysis of gene expression are shown in logarithmic (log 2 ) scale.

    Techniques Used: Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Binding Assay, Methylation, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Amplification, DNA Methylation Assay, Bisulfite Sequencing, Clone Assay, Expressing, Derivative Assay, Microarray

    DNMT3A upregulation by TGFβ in NMuMG cells. ( A ) Immunoblots for E-cadherin and GAPDH in NMuMG cells unstimulated or stimulated with TGFβ1 (5 ng/ml) for 24 or 48 h, in the presence of vehicle or 10 μM 5-aza. ( B ) Phase contrast microscopy of cells as described in (A). Scale bar: 50 μm. ( C ) Luciferase reporter assay of human Cdh1 promoter in NMuMG cells stimulated with TGFβ1 for the indicated time period. ( D ) HpaII–MspI digestion–methylation assay of Cdh1 promoter in NMuMG cells stimulated with TGFβ1 for the indicated time period. ( E ) Dnmt mRNA levels after TGFβ1 treatment of NMuMG cells for the indicated time periods, were normalized to Gapdh mRNA expression. Expression values of the 0-h time point are normalized to 1. ( F ) Dnmt3a mRNA expression in NMuMG cells pre-treated for 30 min with or without TGFβ type I receptor kinase inhibitor SB505124 (10 μM), in the absence or presence of TGFβ1 for 24 h. DMSO was used as a vehicle. qPCR values were normalized to that of Gapdh and the expression values of DMSO-treated, unstimulated cells were normalized to 1. ( G ) Phase contrast images (left panel) and immunoblot analysis (right panel) of DNMT3A and GAPDH protein levels in NMuMG cells transfected with si Control or si Dnmt3a , untreated or treated with TGFβ1 for 24 h. Scale bar : 50 μm. ( H ) E-cadherin, DNMT1, DNMT3A and α-tubulin protein levels in NMuMG cells transfected with si Control , si Dnmt1 or si Dnmt3a , in the absence or presence of TGFβ1 for 48 h.
    Figure Legend Snippet: DNMT3A upregulation by TGFβ in NMuMG cells. ( A ) Immunoblots for E-cadherin and GAPDH in NMuMG cells unstimulated or stimulated with TGFβ1 (5 ng/ml) for 24 or 48 h, in the presence of vehicle or 10 μM 5-aza. ( B ) Phase contrast microscopy of cells as described in (A). Scale bar: 50 μm. ( C ) Luciferase reporter assay of human Cdh1 promoter in NMuMG cells stimulated with TGFβ1 for the indicated time period. ( D ) HpaII–MspI digestion–methylation assay of Cdh1 promoter in NMuMG cells stimulated with TGFβ1 for the indicated time period. ( E ) Dnmt mRNA levels after TGFβ1 treatment of NMuMG cells for the indicated time periods, were normalized to Gapdh mRNA expression. Expression values of the 0-h time point are normalized to 1. ( F ) Dnmt3a mRNA expression in NMuMG cells pre-treated for 30 min with or without TGFβ type I receptor kinase inhibitor SB505124 (10 μM), in the absence or presence of TGFβ1 for 24 h. DMSO was used as a vehicle. qPCR values were normalized to that of Gapdh and the expression values of DMSO-treated, unstimulated cells were normalized to 1. ( G ) Phase contrast images (left panel) and immunoblot analysis (right panel) of DNMT3A and GAPDH protein levels in NMuMG cells transfected with si Control or si Dnmt3a , untreated or treated with TGFβ1 for 24 h. Scale bar : 50 μm. ( H ) E-cadherin, DNMT1, DNMT3A and α-tubulin protein levels in NMuMG cells transfected with si Control , si Dnmt1 or si Dnmt3a , in the absence or presence of TGFβ1 for 48 h.

    Techniques Used: Western Blot, Microscopy, Luciferase, Reporter Assay, Methylation, Expressing, Real-time Polymerase Chain Reaction, Transfection

    34) Product Images from "Microsphere-Based Multiplex Analysis of DNA Methylation in Acute Myeloid Leukemia"

    Article Title: Microsphere-Based Multiplex Analysis of DNA Methylation in Acute Myeloid Leukemia

    Journal: The Journal of Molecular Diagnostics : JMD

    doi: 10.1016/j.jmoldx.2013.10.010

    The MELP assay accurately reflects HELP-derived data. A: Comparison of HELP-derived HpaII/MspI ratios ( x axis) to MELP-derived ratios ( y axis) at the 18 loci used in the methylation classifier for AML ( r = 0.63 to 0.92, P
    Figure Legend Snippet: The MELP assay accurately reflects HELP-derived data. A: Comparison of HELP-derived HpaII/MspI ratios ( x axis) to MELP-derived ratios ( y axis) at the 18 loci used in the methylation classifier for AML ( r = 0.63 to 0.92, P

    Techniques Used: Derivative Assay, Methylation

    A: Schematic of the HELP assay. Genomic DNA is digested with either MspI (methylation insensitive) or HpaII (methylation sensitive). The resulting fragments are ligated to linkers and PCR amplified with linker-specific primers. Amplicons are fluorescently
    Figure Legend Snippet: A: Schematic of the HELP assay. Genomic DNA is digested with either MspI (methylation insensitive) or HpaII (methylation sensitive). The resulting fragments are ligated to linkers and PCR amplified with linker-specific primers. Amplicons are fluorescently

    Techniques Used: HELP Assay, Methylation, Polymerase Chain Reaction, Amplification

    35) Product Images from "Higher-order unfolding of satellite heterochromatin is a consistent and early event in cell senescence"

    Article Title: Higher-order unfolding of satellite heterochromatin is a consistent and early event in cell senescence

    Journal: The Journal of Cell Biology

    doi: 10.1083/jcb.201306073

    Analysis of expression, heterochromatin proteins, DNA methylation, and histone modifications in satellites. (A and B) FISH to sat II RNA (green) shows no increased expression with SADS formation in senescent (left) versus cycling (right) cells, with satellite chromatin marked by CENP-B staining (red). (C) CENP-A (green) and CENP-B (red) are still present in senescent cells as determined by the presence of SAHF (DAPI) and decondensed CENP-B staining (magnified in inset). (D) Comparison of H3K9me3, H3K27me3, and H3K4me3 read densities between cycling and senescent IMR90 cells and between cycling IMR90 and H1hES cells on α-sat (RepeatMasker class: HSATII) sequences with corresponding Pearson’s r values. (E and F) As all cancer samples examined, U2OS cells have compact satellites (F; α-sat, green; sat II, red) and do not form SADS unless treated with 5-AzaC, which induces senescence (E). (G) Quantification of mean 1q12 signal areas ( n > 60) in different cell samples (error bars represent standard error). (H) A DNA methylation-sensitive Southern blot with U2OS and cycling Tig1 cells digested by BstB1 (B), HpaII (H), or MspI (M) and detected with a probe for sat II 1q12 sequences. The arrow points to a band size that is lacking in some of the methylation-sensitive HpaII lanes, indicating that the 1q12 region is methylated in the corresponding cell types. (I–K) Cells with normal levels of LaminB1 (red; top left) rarely contain distended α-sat (green; I and K), but in cells with SADS (bottom right) LaminB1 is often diminished (J and K; n = 100 from one of three replicates).
    Figure Legend Snippet: Analysis of expression, heterochromatin proteins, DNA methylation, and histone modifications in satellites. (A and B) FISH to sat II RNA (green) shows no increased expression with SADS formation in senescent (left) versus cycling (right) cells, with satellite chromatin marked by CENP-B staining (red). (C) CENP-A (green) and CENP-B (red) are still present in senescent cells as determined by the presence of SAHF (DAPI) and decondensed CENP-B staining (magnified in inset). (D) Comparison of H3K9me3, H3K27me3, and H3K4me3 read densities between cycling and senescent IMR90 cells and between cycling IMR90 and H1hES cells on α-sat (RepeatMasker class: HSATII) sequences with corresponding Pearson’s r values. (E and F) As all cancer samples examined, U2OS cells have compact satellites (F; α-sat, green; sat II, red) and do not form SADS unless treated with 5-AzaC, which induces senescence (E). (G) Quantification of mean 1q12 signal areas ( n > 60) in different cell samples (error bars represent standard error). (H) A DNA methylation-sensitive Southern blot with U2OS and cycling Tig1 cells digested by BstB1 (B), HpaII (H), or MspI (M) and detected with a probe for sat II 1q12 sequences. The arrow points to a band size that is lacking in some of the methylation-sensitive HpaII lanes, indicating that the 1q12 region is methylated in the corresponding cell types. (I–K) Cells with normal levels of LaminB1 (red; top left) rarely contain distended α-sat (green; I and K), but in cells with SADS (bottom right) LaminB1 is often diminished (J and K; n = 100 from one of three replicates).

    Techniques Used: Expressing, DNA Methylation Assay, Fluorescence In Situ Hybridization, Staining, Southern Blot, Methylation

    36) Product Images from "Parp1 Localizes within the Dnmt1 Promoter and Protects Its Unmethylated State by Its Enzymatic Activity"

    Article Title: Parp1 Localizes within the Dnmt1 Promoter and Protects Its Unmethylated State by Its Enzymatic Activity

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0004717

    Dnmt1 down-regulation dependent on PARG over-expression leads to a widespread genome hypomethylation. A, Endogenous DNA methyltransferase activity (dnmt) of nuclear extract from cultures at 24 and 72 hours of puromycin selection transfected with either pCS2 (white bar) or pCS2-Myc-PARG (black bar) vectors. The DNA methyltransferase activity of pCS2 samples was considered as 1.0. B, Methyl-accepting ability assay was carried out on genomic DNA purified from cells transfected with either pCS2 (white bars) or pCS2-Myc-PARG (black bars) vectors at 24 and 72 hours of puromycin selection. Results are displayed as number of picomoles of labelled S-Adenosyl methionine incorporated per microgram of DNA. DNA obtained from cells treated with 5-AZA was used as positive control for genome hypomethylation (black bar). Data reported in A and B are mean±S.E. of three experiments, each performed in triplicate. C, Analysis of Southern blot against minor satellite DNA repeats performed on genomic DNA purified from cells transfected with either pCS2 or pCS2-Myc-PARG vectors at 24 and 72 hours of puromycin selection and digested with HpaII or MspI restriction enzymes. DNA obtained from cells treated with 5-AZA was used as positive control for genome hypomethylation.
    Figure Legend Snippet: Dnmt1 down-regulation dependent on PARG over-expression leads to a widespread genome hypomethylation. A, Endogenous DNA methyltransferase activity (dnmt) of nuclear extract from cultures at 24 and 72 hours of puromycin selection transfected with either pCS2 (white bar) or pCS2-Myc-PARG (black bar) vectors. The DNA methyltransferase activity of pCS2 samples was considered as 1.0. B, Methyl-accepting ability assay was carried out on genomic DNA purified from cells transfected with either pCS2 (white bars) or pCS2-Myc-PARG (black bars) vectors at 24 and 72 hours of puromycin selection. Results are displayed as number of picomoles of labelled S-Adenosyl methionine incorporated per microgram of DNA. DNA obtained from cells treated with 5-AZA was used as positive control for genome hypomethylation (black bar). Data reported in A and B are mean±S.E. of three experiments, each performed in triplicate. C, Analysis of Southern blot against minor satellite DNA repeats performed on genomic DNA purified from cells transfected with either pCS2 or pCS2-Myc-PARG vectors at 24 and 72 hours of puromycin selection and digested with HpaII or MspI restriction enzymes. DNA obtained from cells treated with 5-AZA was used as positive control for genome hypomethylation.

    Techniques Used: Over Expression, Activity Assay, Selection, Transfection, Purification, Positive Control, Southern Blot

    37) Product Images from "BisQC: an operational pipeline for multiplexed bisulfite sequencing"

    Article Title: BisQC: an operational pipeline for multiplexed bisulfite sequencing

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-15-290

    Major RRBS library construction steps. This figure demonstrates adaptor ligation (step 1) and barcode indexing (step 2) for Illumina two-step library preparation, as well as in between steps including bisulfite treatment. We show how the 2-step procedure affects DNA inserts when used for RRBS directional sequencing. First, DNA inserts (underlined) with ‘A’ overhangs are ligated to methylated Illumina adaptors (methylated cytosines are marked in bold), meC-PE1 and meC-PE2. Next, adaptor ligated-DNA inserts are bisulfite treated and amplified using primer indPEPCR1F and indPEPCR2R. All unmethylated cytosines deaminate to uracil. We show two cycles of the PCR reaction toamplify bisulfite fragments to show how DNA inserts change after bisulfite treatment and amplification, as well as to track original top (OT) and original bottom (OB) strands. After an appropriate number of cycles (appropriate is defined by the visualization of bands shown in this manuscript in the library preparation stage), bisulfite treated libraries can be indexed, then sent for sequencing. Note that for directional sequencing all sequencing reads are either from the original top (OT) or the original bottom (OB) strands. The first three bases of almost all RRBS reads are either CGG or TGG, depending on their genomic methylation state and this applies to reads generated from both OT and OB strand. Therefore almost every read in a directional RRBS sequencing experiment that use MspI digestion contains at least one CpG at the 2nd and 3rd base positions, plus any internal CpGs (provided they are not in CCGG or CCGG sequences). Internal CpGs can be in CCGG sequence where MspI does not cut when the first C is methylated. Abbreviations: C (Bold): methylated C; p: phosphate; s: phosphorothioate bond. Illustrated insert DNA is underlined. P5 (5′ AATGATACGGCGACCACCGA 3′) and P7 (5′ CAAGCAGAAGACGGCATACGA 3′) are flow cell attachment sites.
    Figure Legend Snippet: Major RRBS library construction steps. This figure demonstrates adaptor ligation (step 1) and barcode indexing (step 2) for Illumina two-step library preparation, as well as in between steps including bisulfite treatment. We show how the 2-step procedure affects DNA inserts when used for RRBS directional sequencing. First, DNA inserts (underlined) with ‘A’ overhangs are ligated to methylated Illumina adaptors (methylated cytosines are marked in bold), meC-PE1 and meC-PE2. Next, adaptor ligated-DNA inserts are bisulfite treated and amplified using primer indPEPCR1F and indPEPCR2R. All unmethylated cytosines deaminate to uracil. We show two cycles of the PCR reaction toamplify bisulfite fragments to show how DNA inserts change after bisulfite treatment and amplification, as well as to track original top (OT) and original bottom (OB) strands. After an appropriate number of cycles (appropriate is defined by the visualization of bands shown in this manuscript in the library preparation stage), bisulfite treated libraries can be indexed, then sent for sequencing. Note that for directional sequencing all sequencing reads are either from the original top (OT) or the original bottom (OB) strands. The first three bases of almost all RRBS reads are either CGG or TGG, depending on their genomic methylation state and this applies to reads generated from both OT and OB strand. Therefore almost every read in a directional RRBS sequencing experiment that use MspI digestion contains at least one CpG at the 2nd and 3rd base positions, plus any internal CpGs (provided they are not in CCGG or CCGG sequences). Internal CpGs can be in CCGG sequence where MspI does not cut when the first C is methylated. Abbreviations: C (Bold): methylated C; p: phosphate; s: phosphorothioate bond. Illustrated insert DNA is underlined. P5 (5′ AATGATACGGCGACCACCGA 3′) and P7 (5′ CAAGCAGAAGACGGCATACGA 3′) are flow cell attachment sites.

    Techniques Used: Ligation, Sequencing, Methylation, Amplification, Polymerase Chain Reaction, Generated, Cell Attachment Assay

    Standards for MspI digestion and progressive PCR. A) MspI digestion of human genomic DNA isolated from human post-mortem brain tissues. DNA (200 ng) was digested by MspI and run on a 4–20% precast polyacrylamide gel and stained with EtBr. Arrows show three satellite DNA bands characteristic of this enzymatic digestion. B) Agilent 2100 Bioanalyzer chromatogram of MspI digested genomic DNA. C) Bioanalyzer 2100 image of a single library from an MspI digested DNA sample. Notice that the satellite bands (indicated by arrows) are still visible on the Bioanalyzer image. D) Progressive PCR amplification combined with limited PCR extension time allows for size selection and amplification of six bisulfite converted libraries (Lanes 1–5 are distinct RRBS libraries; lane 6 (‘C’) is a negative control). After different progressive PCR cycles (18X, 22X, 24X, or 26X – the same libraries are shown for each cycle number) band intensity increases as cycle number increases. Arrows indicate the three satellite DNA bands that are still visible in these libraries.
    Figure Legend Snippet: Standards for MspI digestion and progressive PCR. A) MspI digestion of human genomic DNA isolated from human post-mortem brain tissues. DNA (200 ng) was digested by MspI and run on a 4–20% precast polyacrylamide gel and stained with EtBr. Arrows show three satellite DNA bands characteristic of this enzymatic digestion. B) Agilent 2100 Bioanalyzer chromatogram of MspI digested genomic DNA. C) Bioanalyzer 2100 image of a single library from an MspI digested DNA sample. Notice that the satellite bands (indicated by arrows) are still visible on the Bioanalyzer image. D) Progressive PCR amplification combined with limited PCR extension time allows for size selection and amplification of six bisulfite converted libraries (Lanes 1–5 are distinct RRBS libraries; lane 6 (‘C’) is a negative control). After different progressive PCR cycles (18X, 22X, 24X, or 26X – the same libraries are shown for each cycle number) band intensity increases as cycle number increases. Arrows indicate the three satellite DNA bands that are still visible in these libraries.

    Techniques Used: Polymerase Chain Reaction, Isolation, Staining, Amplification, Selection, Negative Control

    38) Product Images from "Rhizosphere Protists Change Metabolite Profiles in Zea mays"

    Article Title: Rhizosphere Protists Change Metabolite Profiles in Zea mays

    Journal: Frontiers in Microbiology

    doi: 10.3389/fmicb.2018.00857

    nMDS plots of T-RFLP profiles of bacterial communities obtained after digestion with the three different restriction enzymes MspI (A) , HhaI (B) , and AluI (C) from three soil fractions (bulk soil – circles, rhizosphere soil – triangles – adhering sand to the maize root which was gained by shaking the root, rhizosphere II – squares – remaining sand which was washed from the root). Samples not treated with protists are represented in white ( n = 10), samples treated with protists once in gray ( n = 5), and samples treated twice with protists in black ( n = 5). Stress value = 0.14.
    Figure Legend Snippet: nMDS plots of T-RFLP profiles of bacterial communities obtained after digestion with the three different restriction enzymes MspI (A) , HhaI (B) , and AluI (C) from three soil fractions (bulk soil – circles, rhizosphere soil – triangles – adhering sand to the maize root which was gained by shaking the root, rhizosphere II – squares – remaining sand which was washed from the root). Samples not treated with protists are represented in white ( n = 10), samples treated with protists once in gray ( n = 5), and samples treated twice with protists in black ( n = 5). Stress value = 0.14.

    Techniques Used:

    39) Product Images from "Structure-Dependent Modulation of Alpha Interferon Production by Porcine Circovirus 2 Oligodeoxyribonucleotide and CpG DNAs in Porcine Peripheral Blood Mononuclear Cells ▿"

    Article Title: Structure-Dependent Modulation of Alpha Interferon Production by Porcine Circovirus 2 Oligodeoxyribonucleotide and CpG DNAs in Porcine Peripheral Blood Mononuclear Cells ▿

    Journal: Journal of Virology

    doi: 10.1128/JVI.02797-06

    Southern blot analysis of low-molecular-weight DNA extracted from PCV2-infected PK15A cells. The methylation status of PCV2 DNA was studied using the RE isochizomer pairs HpaII/MspI and MboI/DpnI which differ in their sensitivity to CpG methylation as described in Materials and Methods. An asterisk indicates the specific RE of the pairs that is insensitive to methylation. Digestion with EcoRI was used as a control to linearize the PCV2 RF DNAs at a single site and provide a size reference. The positions of the linearized double-stranded RF of DNA (linearized dsDNA) and single-stranded covalently closed circular genomic DNA (circular ssDNA) are indicated by arrows.
    Figure Legend Snippet: Southern blot analysis of low-molecular-weight DNA extracted from PCV2-infected PK15A cells. The methylation status of PCV2 DNA was studied using the RE isochizomer pairs HpaII/MspI and MboI/DpnI which differ in their sensitivity to CpG methylation as described in Materials and Methods. An asterisk indicates the specific RE of the pairs that is insensitive to methylation. Digestion with EcoRI was used as a control to linearize the PCV2 RF DNAs at a single site and provide a size reference. The positions of the linearized double-stranded RF of DNA (linearized dsDNA) and single-stranded covalently closed circular genomic DNA (circular ssDNA) are indicated by arrows.

    Techniques Used: Southern Blot, Molecular Weight, Infection, Methylation, CpG Methylation Assay

    40) Product Images from "Different Roles for Tet1 and Tet2 Proteins in Reprogramming-Mediated Erasure of Imprints Induced by EGC Fusion"

    Article Title: Different Roles for Tet1 and Tet2 Proteins in Reprogramming-Mediated Erasure of Imprints Induced by EGC Fusion

    Journal: Molecular Cell

    doi: 10.1016/j.molcel.2013.01.032

    Evidence that 5hmC Levels Increase at ICRs in Somatic Cells after Fusion with EGCs (A) Detection of 5hmC ( I ) and unmodified cytosine ( II ) in human heterokaryon samples. Genomic DNA was divided and was either treated with T4-β-glucosyltransferase, which binds glucose groups selectively at 5hmC sites (red asterisk) and creates 5hgmC (open hexagon, left), or left untreated (H 2 O). Samples were digested with MspI (which does not digest 5hgmC) or left undigested (H 2 O), and the abundance of locus-specific DNA in each was compared by qPCR. In strategy II , unmodified (C) and modified CpG (5mC and 5hmC) levels were evaluated by HpaII digestion (right); DNA samples were treated with HpaII (which does not cut 5mC and 5hmC), left undigested (H 2 O), or treated with MspI (which cuts both and provides a positive control). The abundance of locus-specific DNA within each of these samples was estimated by qPCR and used to calculate the percentage of HpaII resistance. (B) Levels of 5hmC at OCT4 in hB cells before (0 hr), and 48 hr and 72 hr after fusion with mouse EGCs (black bars) or ESCs (white bars) are shown as the mean and SE of three to five independent experiments. (C) HpaII digestion analysis of OCT4 in hB lymphocytes before (0 hr) and 48 hr and 72 hr after fusion with EGCs (closed circles) or ESCs (open circles) are shown. Red bars mark the position of primer-amplified PCR products derived from the promoter (right) and downstream of the TSS (left), and values represent the mean and SE of three to five independent experiments. ∗∗ , p value
    Figure Legend Snippet: Evidence that 5hmC Levels Increase at ICRs in Somatic Cells after Fusion with EGCs (A) Detection of 5hmC ( I ) and unmodified cytosine ( II ) in human heterokaryon samples. Genomic DNA was divided and was either treated with T4-β-glucosyltransferase, which binds glucose groups selectively at 5hmC sites (red asterisk) and creates 5hgmC (open hexagon, left), or left untreated (H 2 O). Samples were digested with MspI (which does not digest 5hgmC) or left undigested (H 2 O), and the abundance of locus-specific DNA in each was compared by qPCR. In strategy II , unmodified (C) and modified CpG (5mC and 5hmC) levels were evaluated by HpaII digestion (right); DNA samples were treated with HpaII (which does not cut 5mC and 5hmC), left undigested (H 2 O), or treated with MspI (which cuts both and provides a positive control). The abundance of locus-specific DNA within each of these samples was estimated by qPCR and used to calculate the percentage of HpaII resistance. (B) Levels of 5hmC at OCT4 in hB cells before (0 hr), and 48 hr and 72 hr after fusion with mouse EGCs (black bars) or ESCs (white bars) are shown as the mean and SE of three to five independent experiments. (C) HpaII digestion analysis of OCT4 in hB lymphocytes before (0 hr) and 48 hr and 72 hr after fusion with EGCs (closed circles) or ESCs (open circles) are shown. Red bars mark the position of primer-amplified PCR products derived from the promoter (right) and downstream of the TSS (left), and values represent the mean and SE of three to five independent experiments. ∗∗ , p value

    Techniques Used: Real-time Polymerase Chain Reaction, Modification, Positive Control, Amplification, Polymerase Chain Reaction, Derivative Assay

    Related Articles

    Ligation:

    Article Title: Methylated site display (MSD)-AFLP, a sensitive and affordable method for analysis of CpG methylation profiles
    Article Snippet: .. Reagents The reagents and materials used in this study were purchased from the manufacturers indicated in parentheses: CpG methyltransferase (M.Sss I), T4 DNA ligase, and restriction enzymes Hpa II, Msp I, Sbf I, and Stu I (New England Biolabs, MA, USA) it guarantees that the efficiency of their restriction enzymes is almost and the methylation of CpG blocks 100% Hpa II digestion reaction; EpiTect Bisulfite Kit and AllPrep DNA/RNA Mini Kit (Qiagen, Hilden, Germany); Oligonucleotides (Operon, Alameda, CA, USA); Magnetic beads coated with streptavidin (Dynabeads® M-280 Streptavidin) (Dynal, Oslo, Norway); TITANIUM Taq DNA polymerase (Takara Bio, Kusatsu, Japan); GenElute™ Agarose Spin Columns (Sigma-Aldrich, St. Louis, MO, USA); Ligation Convenience Kit (Nippon Gene, Tokyo, Japan); pGEM® -T Easy Vector (Promega, Madison, WI, USA); Competent Cell DH5α and Insert Check-Ready (Toyobo, Osaka, Japan); LightCycler® 480 SYBR Green I Master (Roche Diagnostics GmbH, Mannheim, Germany); POP-7™ Polymer, GeneScan™ 500 LIZ® Size Standard, and BigDye® Terminator v3.1 Cycle Sequencing Kit (ThermoFisher Scientific Inc., San Diego, CA, USA). .. Animals and tissues Thirteen-week old male C57BL/6 J mice (n = 3) purchased from CLEA Japan Inc. (CLEA Japan Inc., Tokyo, Japan) were sacrificed by cervical dislocation to collect liver, kidney, and hippocampus samples.

    Article Title: DNA Analysis by Restriction Enzyme (DARE) enables concurrent genomic and epigenomic characterization of single cells
    Article Snippet: .. The remaining CCGG sites and CATG sites were then digested with 21 μl of MspI (New England Biolabs) and NlaIII (New England Biolabs) digestion reaction mixture at 37°C for 3 h, and the enzymes were inactivated at 65°C for 20 min. MspI and NlaIII digested sites were then ligated with 7 μl of M-tag/N-tag adapter ligation reaction mixture at 25°C for 2 h and T4 DNA ligase HC (Thermo Scientific) was inactivated at 65°C for 20 min. 1 μl of Thermolabile USER® II enzyme (New England Biolabs) was used to remove excess M-tag adapters and N-tag adapters at 37°C for 20 min, 25°C for 20 min, and inactivated at 65°C for 20 min. .. Single stranded excess adapter oligonucleotides were eliminated by the addition of 1 μl of Exonuclease I (Enzymatics) at 37°C for 30 min.

    Magnetic Beads:

    Article Title: Methylated site display (MSD)-AFLP, a sensitive and affordable method for analysis of CpG methylation profiles
    Article Snippet: .. Reagents The reagents and materials used in this study were purchased from the manufacturers indicated in parentheses: CpG methyltransferase (M.Sss I), T4 DNA ligase, and restriction enzymes Hpa II, Msp I, Sbf I, and Stu I (New England Biolabs, MA, USA) it guarantees that the efficiency of their restriction enzymes is almost and the methylation of CpG blocks 100% Hpa II digestion reaction; EpiTect Bisulfite Kit and AllPrep DNA/RNA Mini Kit (Qiagen, Hilden, Germany); Oligonucleotides (Operon, Alameda, CA, USA); Magnetic beads coated with streptavidin (Dynabeads® M-280 Streptavidin) (Dynal, Oslo, Norway); TITANIUM Taq DNA polymerase (Takara Bio, Kusatsu, Japan); GenElute™ Agarose Spin Columns (Sigma-Aldrich, St. Louis, MO, USA); Ligation Convenience Kit (Nippon Gene, Tokyo, Japan); pGEM® -T Easy Vector (Promega, Madison, WI, USA); Competent Cell DH5α and Insert Check-Ready (Toyobo, Osaka, Japan); LightCycler® 480 SYBR Green I Master (Roche Diagnostics GmbH, Mannheim, Germany); POP-7™ Polymer, GeneScan™ 500 LIZ® Size Standard, and BigDye® Terminator v3.1 Cycle Sequencing Kit (ThermoFisher Scientific Inc., San Diego, CA, USA). .. Animals and tissues Thirteen-week old male C57BL/6 J mice (n = 3) purchased from CLEA Japan Inc. (CLEA Japan Inc., Tokyo, Japan) were sacrificed by cervical dislocation to collect liver, kidney, and hippocampus samples.

    Lambda DNA Preparation:

    Article Title: Global DNA methylation in old subjects is correlated with frailty
    Article Snippet: .. One hundred nanograms of methylated and unmethylated lambda DNA were separately incubated with 5 U of HpaII and MspI restriction endonucleases (New England Biolabs) at 37°C overnight and successively at 65°C for 20 min to inactivate the endonucleases. .. The samples were loaded on a 1.4% agarose gel, electrophoresed in TAE (Tris/Acetate/EDTA) buffer and stained with ethidium bromide.

    SYBR Green Assay:

    Article Title: Methylated site display (MSD)-AFLP, a sensitive and affordable method for analysis of CpG methylation profiles
    Article Snippet: .. Reagents The reagents and materials used in this study were purchased from the manufacturers indicated in parentheses: CpG methyltransferase (M.Sss I), T4 DNA ligase, and restriction enzymes Hpa II, Msp I, Sbf I, and Stu I (New England Biolabs, MA, USA) it guarantees that the efficiency of their restriction enzymes is almost and the methylation of CpG blocks 100% Hpa II digestion reaction; EpiTect Bisulfite Kit and AllPrep DNA/RNA Mini Kit (Qiagen, Hilden, Germany); Oligonucleotides (Operon, Alameda, CA, USA); Magnetic beads coated with streptavidin (Dynabeads® M-280 Streptavidin) (Dynal, Oslo, Norway); TITANIUM Taq DNA polymerase (Takara Bio, Kusatsu, Japan); GenElute™ Agarose Spin Columns (Sigma-Aldrich, St. Louis, MO, USA); Ligation Convenience Kit (Nippon Gene, Tokyo, Japan); pGEM® -T Easy Vector (Promega, Madison, WI, USA); Competent Cell DH5α and Insert Check-Ready (Toyobo, Osaka, Japan); LightCycler® 480 SYBR Green I Master (Roche Diagnostics GmbH, Mannheim, Germany); POP-7™ Polymer, GeneScan™ 500 LIZ® Size Standard, and BigDye® Terminator v3.1 Cycle Sequencing Kit (ThermoFisher Scientific Inc., San Diego, CA, USA). .. Animals and tissues Thirteen-week old male C57BL/6 J mice (n = 3) purchased from CLEA Japan Inc. (CLEA Japan Inc., Tokyo, Japan) were sacrificed by cervical dislocation to collect liver, kidney, and hippocampus samples.

    Incubation:

    Article Title: Global DNA methylation in old subjects is correlated with frailty
    Article Snippet: .. One hundred nanograms of methylated and unmethylated lambda DNA were separately incubated with 5 U of HpaII and MspI restriction endonucleases (New England Biolabs) at 37°C overnight and successively at 65°C for 20 min to inactivate the endonucleases. .. The samples were loaded on a 1.4% agarose gel, electrophoresed in TAE (Tris/Acetate/EDTA) buffer and stained with ethidium bromide.

    Article Title: Oligodeoxynucleotides Can Transiently Up- and Downregulate CHS Gene Expression in Flax by Changing DNA Methylation in a Sequence-Specific Manner
    Article Snippet: .. The DNA was incubated with restriction enzymes MspI and HpaII for at least 3 h (restriction enzymes MspI and HpaII (New England Biolabs) differ in sensitivity to cytosine methylation). .. The genomic DNA digested by the restriction enzymes and undigested DNA were used as templates for the real-time PCR reaction.

    Methylation:

    Article Title: Methylated site display (MSD)-AFLP, a sensitive and affordable method for analysis of CpG methylation profiles
    Article Snippet: .. Reagents The reagents and materials used in this study were purchased from the manufacturers indicated in parentheses: CpG methyltransferase (M.Sss I), T4 DNA ligase, and restriction enzymes Hpa II, Msp I, Sbf I, and Stu I (New England Biolabs, MA, USA) it guarantees that the efficiency of their restriction enzymes is almost and the methylation of CpG blocks 100% Hpa II digestion reaction; EpiTect Bisulfite Kit and AllPrep DNA/RNA Mini Kit (Qiagen, Hilden, Germany); Oligonucleotides (Operon, Alameda, CA, USA); Magnetic beads coated with streptavidin (Dynabeads® M-280 Streptavidin) (Dynal, Oslo, Norway); TITANIUM Taq DNA polymerase (Takara Bio, Kusatsu, Japan); GenElute™ Agarose Spin Columns (Sigma-Aldrich, St. Louis, MO, USA); Ligation Convenience Kit (Nippon Gene, Tokyo, Japan); pGEM® -T Easy Vector (Promega, Madison, WI, USA); Competent Cell DH5α and Insert Check-Ready (Toyobo, Osaka, Japan); LightCycler® 480 SYBR Green I Master (Roche Diagnostics GmbH, Mannheim, Germany); POP-7™ Polymer, GeneScan™ 500 LIZ® Size Standard, and BigDye® Terminator v3.1 Cycle Sequencing Kit (ThermoFisher Scientific Inc., San Diego, CA, USA). .. Animals and tissues Thirteen-week old male C57BL/6 J mice (n = 3) purchased from CLEA Japan Inc. (CLEA Japan Inc., Tokyo, Japan) were sacrificed by cervical dislocation to collect liver, kidney, and hippocampus samples.

    Article Title: Global DNA methylation in old subjects is correlated with frailty
    Article Snippet: .. One hundred nanograms of methylated and unmethylated lambda DNA were separately incubated with 5 U of HpaII and MspI restriction endonucleases (New England Biolabs) at 37°C overnight and successively at 65°C for 20 min to inactivate the endonucleases. .. The samples were loaded on a 1.4% agarose gel, electrophoresed in TAE (Tris/Acetate/EDTA) buffer and stained with ethidium bromide.

    Article Title: Oligodeoxynucleotides Can Transiently Up- and Downregulate CHS Gene Expression in Flax by Changing DNA Methylation in a Sequence-Specific Manner
    Article Snippet: .. The DNA was incubated with restriction enzymes MspI and HpaII for at least 3 h (restriction enzymes MspI and HpaII (New England Biolabs) differ in sensitivity to cytosine methylation). .. The genomic DNA digested by the restriction enzymes and undigested DNA were used as templates for the real-time PCR reaction.

    Sequencing:

    Article Title: Methylated site display (MSD)-AFLP, a sensitive and affordable method for analysis of CpG methylation profiles
    Article Snippet: .. Reagents The reagents and materials used in this study were purchased from the manufacturers indicated in parentheses: CpG methyltransferase (M.Sss I), T4 DNA ligase, and restriction enzymes Hpa II, Msp I, Sbf I, and Stu I (New England Biolabs, MA, USA) it guarantees that the efficiency of their restriction enzymes is almost and the methylation of CpG blocks 100% Hpa II digestion reaction; EpiTect Bisulfite Kit and AllPrep DNA/RNA Mini Kit (Qiagen, Hilden, Germany); Oligonucleotides (Operon, Alameda, CA, USA); Magnetic beads coated with streptavidin (Dynabeads® M-280 Streptavidin) (Dynal, Oslo, Norway); TITANIUM Taq DNA polymerase (Takara Bio, Kusatsu, Japan); GenElute™ Agarose Spin Columns (Sigma-Aldrich, St. Louis, MO, USA); Ligation Convenience Kit (Nippon Gene, Tokyo, Japan); pGEM® -T Easy Vector (Promega, Madison, WI, USA); Competent Cell DH5α and Insert Check-Ready (Toyobo, Osaka, Japan); LightCycler® 480 SYBR Green I Master (Roche Diagnostics GmbH, Mannheim, Germany); POP-7™ Polymer, GeneScan™ 500 LIZ® Size Standard, and BigDye® Terminator v3.1 Cycle Sequencing Kit (ThermoFisher Scientific Inc., San Diego, CA, USA). .. Animals and tissues Thirteen-week old male C57BL/6 J mice (n = 3) purchased from CLEA Japan Inc. (CLEA Japan Inc., Tokyo, Japan) were sacrificed by cervical dislocation to collect liver, kidney, and hippocampus samples.

    Plasmid Preparation:

    Article Title: Methylated site display (MSD)-AFLP, a sensitive and affordable method for analysis of CpG methylation profiles
    Article Snippet: .. Reagents The reagents and materials used in this study were purchased from the manufacturers indicated in parentheses: CpG methyltransferase (M.Sss I), T4 DNA ligase, and restriction enzymes Hpa II, Msp I, Sbf I, and Stu I (New England Biolabs, MA, USA) it guarantees that the efficiency of their restriction enzymes is almost and the methylation of CpG blocks 100% Hpa II digestion reaction; EpiTect Bisulfite Kit and AllPrep DNA/RNA Mini Kit (Qiagen, Hilden, Germany); Oligonucleotides (Operon, Alameda, CA, USA); Magnetic beads coated with streptavidin (Dynabeads® M-280 Streptavidin) (Dynal, Oslo, Norway); TITANIUM Taq DNA polymerase (Takara Bio, Kusatsu, Japan); GenElute™ Agarose Spin Columns (Sigma-Aldrich, St. Louis, MO, USA); Ligation Convenience Kit (Nippon Gene, Tokyo, Japan); pGEM® -T Easy Vector (Promega, Madison, WI, USA); Competent Cell DH5α and Insert Check-Ready (Toyobo, Osaka, Japan); LightCycler® 480 SYBR Green I Master (Roche Diagnostics GmbH, Mannheim, Germany); POP-7™ Polymer, GeneScan™ 500 LIZ® Size Standard, and BigDye® Terminator v3.1 Cycle Sequencing Kit (ThermoFisher Scientific Inc., San Diego, CA, USA). .. Animals and tissues Thirteen-week old male C57BL/6 J mice (n = 3) purchased from CLEA Japan Inc. (CLEA Japan Inc., Tokyo, Japan) were sacrificed by cervical dislocation to collect liver, kidney, and hippocampus samples.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs restriction enzymes mspi
    Stable demethylated and variable methylation profiles for the control (A) , ODN-treated (B–D) and GM-CHS (E–G) plants. The figure presents the percentage of the cytosine methylation in the CCGG sites in the flax genome. The genomic <t>DNA</t> was digested by restriction enzymes HpaII and <t>MspI.</t> The amount of non-digested DNA was determined by real-time PCR. The percentage of particular modification was presented for studied plants and control: CCGG, lack of methylation (dark gray); CCmGG, methylation of internal cytosine (light gray); CmCmGG, methylation of both cytosines (middle gray). The site positions were presented according to the CHS2 sequence (the presence of all CCGG sites). Stably demethylated sites: 5′-UTR (−232), non-coding (+217) and coding (+1,606). Variable sites: coding region (+996, +1,219, +1,273). Data constitute the mean value ± SD from at least three independent experiments. The significance of the differences between each mean and control was determined by Student's t -test. Asterisk indicates p
    Restriction Enzymes Mspi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 339 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/restriction enzymes mspi/product/New England Biolabs
    Average 99 stars, based on 339 article reviews
    Price from $9.99 to $1999.99
    restriction enzymes mspi - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    Image Search Results


    Stable demethylated and variable methylation profiles for the control (A) , ODN-treated (B–D) and GM-CHS (E–G) plants. The figure presents the percentage of the cytosine methylation in the CCGG sites in the flax genome. The genomic DNA was digested by restriction enzymes HpaII and MspI. The amount of non-digested DNA was determined by real-time PCR. The percentage of particular modification was presented for studied plants and control: CCGG, lack of methylation (dark gray); CCmGG, methylation of internal cytosine (light gray); CmCmGG, methylation of both cytosines (middle gray). The site positions were presented according to the CHS2 sequence (the presence of all CCGG sites). Stably demethylated sites: 5′-UTR (−232), non-coding (+217) and coding (+1,606). Variable sites: coding region (+996, +1,219, +1,273). Data constitute the mean value ± SD from at least three independent experiments. The significance of the differences between each mean and control was determined by Student's t -test. Asterisk indicates p

    Journal: Frontiers in Plant Science

    Article Title: Oligodeoxynucleotides Can Transiently Up- and Downregulate CHS Gene Expression in Flax by Changing DNA Methylation in a Sequence-Specific Manner

    doi: 10.3389/fpls.2017.00755

    Figure Lengend Snippet: Stable demethylated and variable methylation profiles for the control (A) , ODN-treated (B–D) and GM-CHS (E–G) plants. The figure presents the percentage of the cytosine methylation in the CCGG sites in the flax genome. The genomic DNA was digested by restriction enzymes HpaII and MspI. The amount of non-digested DNA was determined by real-time PCR. The percentage of particular modification was presented for studied plants and control: CCGG, lack of methylation (dark gray); CCmGG, methylation of internal cytosine (light gray); CmCmGG, methylation of both cytosines (middle gray). The site positions were presented according to the CHS2 sequence (the presence of all CCGG sites). Stably demethylated sites: 5′-UTR (−232), non-coding (+217) and coding (+1,606). Variable sites: coding region (+996, +1,219, +1,273). Data constitute the mean value ± SD from at least three independent experiments. The significance of the differences between each mean and control was determined by Student's t -test. Asterisk indicates p

    Article Snippet: The DNA was incubated with restriction enzymes MspI and HpaII for at least 3 h (restriction enzymes MspI and HpaII (New England Biolabs) differ in sensitivity to cytosine methylation).

    Techniques: Methylation, Real-time Polymerase Chain Reaction, Modification, Sequencing, Stable Transfection

    Workflow of DNA Analysis by Restriction Enzyme (DARE) assay. ( A ) Workflow of DARE assay—cell lysis and protease treatment are followed by digestion of unmethylated CCGG sites with methylation sensitive HpaII enzyme. U-tag adapters are ligated and the remaining CCGG sites are digested by methylation insensitive MspI enzyme. NlaIII digestion is included to reduce the fragment length. This is followed by ligation with the respective adapters (M-tag and N-tag adapters). Thermolabile USER ® II enzyme is used to remove excess uracil-containing adapters after each ligation. ( B ) Adapter system: U-tag adapter consists of Read 1 primer sequence of Illumina adapter, unique molecular identifier (UMI), unmethylated site specific tag (U-tag), and CG overhang. M-tag adapter similarly consists of Read 1 primer sequence of Illumina adapter, UMI, methylated site specific tag (M-tag), and CG overhang. N-tag adapter consists of Read 2 primer sequence of Illumina adapter and CATG overhang.

    Journal: Nucleic Acids Research

    Article Title: DNA Analysis by Restriction Enzyme (DARE) enables concurrent genomic and epigenomic characterization of single cells

    doi: 10.1093/nar/gkz717

    Figure Lengend Snippet: Workflow of DNA Analysis by Restriction Enzyme (DARE) assay. ( A ) Workflow of DARE assay—cell lysis and protease treatment are followed by digestion of unmethylated CCGG sites with methylation sensitive HpaII enzyme. U-tag adapters are ligated and the remaining CCGG sites are digested by methylation insensitive MspI enzyme. NlaIII digestion is included to reduce the fragment length. This is followed by ligation with the respective adapters (M-tag and N-tag adapters). Thermolabile USER ® II enzyme is used to remove excess uracil-containing adapters after each ligation. ( B ) Adapter system: U-tag adapter consists of Read 1 primer sequence of Illumina adapter, unique molecular identifier (UMI), unmethylated site specific tag (U-tag), and CG overhang. M-tag adapter similarly consists of Read 1 primer sequence of Illumina adapter, UMI, methylated site specific tag (M-tag), and CG overhang. N-tag adapter consists of Read 2 primer sequence of Illumina adapter and CATG overhang.

    Article Snippet: The remaining CCGG sites and CATG sites were then digested with 21 μl of MspI (New England Biolabs) and NlaIII (New England Biolabs) digestion reaction mixture at 37°C for 3 h, and the enzymes were inactivated at 65°C for 20 min. MspI and NlaIII digested sites were then ligated with 7 μl of M-tag/N-tag adapter ligation reaction mixture at 25°C for 2 h and T4 DNA ligase HC (Thermo Scientific) was inactivated at 65°C for 20 min. 1 μl of Thermolabile USER® II enzyme (New England Biolabs) was used to remove excess M-tag adapters and N-tag adapters at 37°C for 20 min, 25°C for 20 min, and inactivated at 65°C for 20 min.

    Techniques: Lysis, Methylation, Ligation, Sequencing

    Hypermethylation of the C9orf72 promoter. a Cerebellar DNA from control ( n = 8, left ) and repeat-expanded cases ( n = 8, right ) were mock digested (no enzyme) or digested with Msp I, Hpa II or MspJ I. DNA was subject to repeat primed PCR and representative

    Journal: Acta neuropathologica

    Article Title: C9orf72 hypermethylation protects against repeat expansion-associated pathology in ALS/FTD

    doi: 10.1007/s00401-014-1286-y

    Figure Lengend Snippet: Hypermethylation of the C9orf72 promoter. a Cerebellar DNA from control ( n = 8, left ) and repeat-expanded cases ( n = 8, right ) were mock digested (no enzyme) or digested with Msp I, Hpa II or MspJ I. DNA was subject to repeat primed PCR and representative

    Article Snippet: DNA (1 μg) from post-mortem cerebellar tissue was restriction enzyme digested for 4 h with Hpa II (10 U), Msp I (10 U), or MspJ I (4 U) (New England Biolabs) at 37°C followed by phenol:chloroform:isoamyl alcohol extraction.

    Techniques: Polymerase Chain Reaction

    Control lambda DNA analysis. a Ethidium bromide-staining agarose gel showing unmethylated and methylated lambda DNAs digested with HpaII and MspI. ND: lambda DNA not digested. b GDMI values of unmethylated and methylated lambda DNAs. The values represent the main of three independent triplicate experiments with standard error mean

    Journal: Age

    Article Title: Global DNA methylation in old subjects is correlated with frailty

    doi: 10.1007/s11357-011-9216-6

    Figure Lengend Snippet: Control lambda DNA analysis. a Ethidium bromide-staining agarose gel showing unmethylated and methylated lambda DNAs digested with HpaII and MspI. ND: lambda DNA not digested. b GDMI values of unmethylated and methylated lambda DNAs. The values represent the main of three independent triplicate experiments with standard error mean

    Article Snippet: One hundred nanograms of methylated and unmethylated lambda DNA were separately incubated with 5 U of HpaII and MspI restriction endonucleases (New England Biolabs) at 37°C overnight and successively at 65°C for 20 min to inactivate the endonucleases.

    Techniques: Lambda DNA Preparation, Staining, Agarose Gel Electrophoresis, Methylation

    Control human DNA analysis. a Ethidium bromide-staining agarose gel showing unmethylated and methylated human DNAs and a mixture of equal amount of unmethylated and methylated human DNAs digested with HpaII and MspI. ND human DNA not digested. b GDMI values of unmethylated, methylated and the mixture of unmethylated and methylated human DNAs. The values represent the main of three independent triplicate experiments with standard error mean

    Journal: Age

    Article Title: Global DNA methylation in old subjects is correlated with frailty

    doi: 10.1007/s11357-011-9216-6

    Figure Lengend Snippet: Control human DNA analysis. a Ethidium bromide-staining agarose gel showing unmethylated and methylated human DNAs and a mixture of equal amount of unmethylated and methylated human DNAs digested with HpaII and MspI. ND human DNA not digested. b GDMI values of unmethylated, methylated and the mixture of unmethylated and methylated human DNAs. The values represent the main of three independent triplicate experiments with standard error mean

    Article Snippet: One hundred nanograms of methylated and unmethylated lambda DNA were separately incubated with 5 U of HpaII and MspI restriction endonucleases (New England Biolabs) at 37°C overnight and successively at 65°C for 20 min to inactivate the endonucleases.

    Techniques: Staining, Agarose Gel Electrophoresis, Methylation