Review



aav hsynflex mgfp 2a synaptophysin mruby  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Addgene inc aav hsynflex mgfp 2a synaptophysin mruby
    Aav Hsynflex Mgfp 2a Synaptophysin Mruby, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 63 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mruby/pAAV+hSyn+FLEx+mGFP-2A-Synaptophysin-mRuby+(Plasmid+%2371760)/pm41746362-225-9-12
    Average 94 stars, based on 63 article reviews
    aav hsynflex mgfp 2a synaptophysin mruby - by Bioz Stars, 2026-09
    94/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Activity-driven synaptic translocation of LGI1 controls excitatory neurotransmission
    Article Snippet: Insert containing pHmScarlet was obtained by PCR amplification from VAMP2-pHmScarlet, a gift from Pingyong Xu (Addgene plasmid # 166890). .. A plasmid to express mRuby-synapsin was generated by removing GFP from GFP-synapsin using restriction sites AgeI and BglII, and substituting it in frame with mRuby obtained from pKanCMV-mRuby3-18aa-actin, which was a gift from Michael Lin (Addgene plasmid # 74255). .. This plasmid was cloned in the laboratory of Timothy A. Ryan (Addgene plasmid # 187896).

    Article Title: GABA B R silencing of nerve terminals
    Article Snippet: .. The following published DNA constructs were used: VGLUT1-pHluorin (vGpH) , synaptophysin-GCaMP6f (physin-GCaMP) , cytosolic GCaMP6f , and GPI iGluSnFR3 v857(iGluSnFR) , which was a gift from Kasper Podgorski. mRuby3-synapsin1a (Addgene plasmid #187896) was generated by removing GFP from GFP-synapsin ( ) using restriction sites AgeI and BGIII, and substituting it in frame with mRuby obtained from pKanCMV-mRuby3-18aa-actin, which was a gift from Michael Lin (Addgene plasmid #74255). .. Cytosolic GCaMP6f under the CaMKII promoter was generated by cloning GCaMP6f ( ) (Addgene plasmid #40755) into a CaMKII promoter vector ( ) (Addgene plasmid #22217) as previously described ( ).

    Article Title: GABABR silencing of nerve terminals
    Article Snippet: .. The following published DNA constructs were used: VGLUT1- pHluorin (vGpH) (Voglmaier et al., 2006), synaptophysin- GCaMP6f (physin- GCaMP) (de Juan- Sanz et al., 2017), cytosolic GCaMP6f (Chen et al., 2013), and GPI iGluSnFR3 v857(iGluSnFR) (Aggarwal et al., 2022), which was a gift from Kasper Podgorski. mRuby3- synapsin1a (Addgene plasmid #187896) was generated by removing GFP from GFP- synapsin (Chi et al., 2001) using restriction sites AgeI and BGIII, and substituting it in frame with mRuby obtained from pKanCMV- mRuby3- 18aa- actin, which was a gift from Michael Lin (Addgene plasmid #74255). .. Cytosolic GCaMP6f under the CaMKII promoter was generated by cloning GCaMP6f (Chen et al., 2013) (Addgene plasmid #40755) into a CaMKII promoter vector (Chow et al., 2010) (Addgene plasmid #22217) as previously described (de Juan- Sanz et al., 2017).

    Article Title: Active zone maturation state controls synaptic output and release mode and is differentially regulated by neuronal activity
    Article Snippet: The two constructs were cloned into pBid-UASc (Addgene #35200) using EcoRI and XbaI. .. To create CRISPR-tagged Unc13A, four guide RNAs (gRNAs) were selected using the CRISPR Optimal Target Finder : gRNA1 AGCTCGGCAACGATGGCATT gRNA2 CATGCAGGTGTTACGCCAAA gRNA3 AAAAAAAAAACGCTCTTGAG gRNA4 CCTGCCCTCAATTAAAGTAG These gRNAs were fused with the pCFD5 expression vector (Addgene #73914) according to the Gibson assembly protocol using NEBuilder HighFidelity DNA Assembly Cloning Kit (E5520). mRuby was amplified from a plasmid (Addgene #105802) and flanked with right and left homology arms corresponding to the end of the first exon for Unc13A. ..

    Article Title: Lentiviral-based vectors and related systems and methods for eukaryotic gene editing
    Article Snippet: .. To test this, an experiment was conducted comparing the gene editing rate induced by lentivirus-like particles expressing NC-MCPx1 (using psPAX2-D64V-NC-MS2, Plasmid No. 11) or a control generated using an mRuby-expressing plasmid (pKanCMV-mRuby3-10aa-H2B; Addgene Cat. No. 74258) that did not express any of the lentiviral packaging proteins (mRuby is a red fluorescent protein). ..

    Generated:

    Article Title: Activity-driven synaptic translocation of LGI1 controls excitatory neurotransmission
    Article Snippet: Insert containing pHmScarlet was obtained by PCR amplification from VAMP2-pHmScarlet, a gift from Pingyong Xu (Addgene plasmid # 166890). .. A plasmid to express mRuby-synapsin was generated by removing GFP from GFP-synapsin using restriction sites AgeI and BglII, and substituting it in frame with mRuby obtained from pKanCMV-mRuby3-18aa-actin, which was a gift from Michael Lin (Addgene plasmid # 74255). .. This plasmid was cloned in the laboratory of Timothy A. Ryan (Addgene plasmid # 187896).

    Article Title: GABA B R silencing of nerve terminals
    Article Snippet: .. The following published DNA constructs were used: VGLUT1-pHluorin (vGpH) , synaptophysin-GCaMP6f (physin-GCaMP) , cytosolic GCaMP6f , and GPI iGluSnFR3 v857(iGluSnFR) , which was a gift from Kasper Podgorski. mRuby3-synapsin1a (Addgene plasmid #187896) was generated by removing GFP from GFP-synapsin ( ) using restriction sites AgeI and BGIII, and substituting it in frame with mRuby obtained from pKanCMV-mRuby3-18aa-actin, which was a gift from Michael Lin (Addgene plasmid #74255). .. Cytosolic GCaMP6f under the CaMKII promoter was generated by cloning GCaMP6f ( ) (Addgene plasmid #40755) into a CaMKII promoter vector ( ) (Addgene plasmid #22217) as previously described ( ).

    Article Title: GABABR silencing of nerve terminals
    Article Snippet: .. The following published DNA constructs were used: VGLUT1- pHluorin (vGpH) (Voglmaier et al., 2006), synaptophysin- GCaMP6f (physin- GCaMP) (de Juan- Sanz et al., 2017), cytosolic GCaMP6f (Chen et al., 2013), and GPI iGluSnFR3 v857(iGluSnFR) (Aggarwal et al., 2022), which was a gift from Kasper Podgorski. mRuby3- synapsin1a (Addgene plasmid #187896) was generated by removing GFP from GFP- synapsin (Chi et al., 2001) using restriction sites AgeI and BGIII, and substituting it in frame with mRuby obtained from pKanCMV- mRuby3- 18aa- actin, which was a gift from Michael Lin (Addgene plasmid #74255). .. Cytosolic GCaMP6f under the CaMKII promoter was generated by cloning GCaMP6f (Chen et al., 2013) (Addgene plasmid #40755) into a CaMKII promoter vector (Chow et al., 2010) (Addgene plasmid #22217) as previously described (de Juan- Sanz et al., 2017).

    Article Title: Lentiviral-based vectors and related systems and methods for eukaryotic gene editing
    Article Snippet: .. To test this, an experiment was conducted comparing the gene editing rate induced by lentivirus-like particles expressing NC-MCPx1 (using psPAX2-D64V-NC-MS2, Plasmid No. 11) or a control generated using an mRuby-expressing plasmid (pKanCMV-mRuby3-10aa-H2B; Addgene Cat. No. 74258) that did not express any of the lentiviral packaging proteins (mRuby is a red fluorescent protein). ..

    Construct:

    Article Title: GABA B R silencing of nerve terminals
    Article Snippet: .. The following published DNA constructs were used: VGLUT1-pHluorin (vGpH) , synaptophysin-GCaMP6f (physin-GCaMP) , cytosolic GCaMP6f , and GPI iGluSnFR3 v857(iGluSnFR) , which was a gift from Kasper Podgorski. mRuby3-synapsin1a (Addgene plasmid #187896) was generated by removing GFP from GFP-synapsin ( ) using restriction sites AgeI and BGIII, and substituting it in frame with mRuby obtained from pKanCMV-mRuby3-18aa-actin, which was a gift from Michael Lin (Addgene plasmid #74255). .. Cytosolic GCaMP6f under the CaMKII promoter was generated by cloning GCaMP6f ( ) (Addgene plasmid #40755) into a CaMKII promoter vector ( ) (Addgene plasmid #22217) as previously described ( ).

    Article Title: GABABR silencing of nerve terminals
    Article Snippet: .. The following published DNA constructs were used: VGLUT1- pHluorin (vGpH) (Voglmaier et al., 2006), synaptophysin- GCaMP6f (physin- GCaMP) (de Juan- Sanz et al., 2017), cytosolic GCaMP6f (Chen et al., 2013), and GPI iGluSnFR3 v857(iGluSnFR) (Aggarwal et al., 2022), which was a gift from Kasper Podgorski. mRuby3- synapsin1a (Addgene plasmid #187896) was generated by removing GFP from GFP- synapsin (Chi et al., 2001) using restriction sites AgeI and BGIII, and substituting it in frame with mRuby obtained from pKanCMV- mRuby3- 18aa- actin, which was a gift from Michael Lin (Addgene plasmid #74255). .. Cytosolic GCaMP6f under the CaMKII promoter was generated by cloning GCaMP6f (Chen et al., 2013) (Addgene plasmid #40755) into a CaMKII promoter vector (Chow et al., 2010) (Addgene plasmid #22217) as previously described (de Juan- Sanz et al., 2017).

    other:

    Article Title: Activity-driven synaptic translocation of LGI1 controls excitatory neurotransmission.
    Article Snippet: This plasmid was cloned in the laboratory of Timothy A. Ryan (Addgene plasmid # 187896).

    Amplification:

    Article Title: Genetically encoded lysine photocage for spatiotemporal control of TDP-43 nuclear import.
    Article Snippet: .. For pcMV-TDP-43 mRuby, mRuby was amplified out of Addgene #54581 using primers E and F and pCMV-TDP-43 was amplified using primers G and H as a vector template. .. For pCMV-TDP-43 mCerulean, TDP-43 was amplified out of Addgene plasmid #104480 via PCR using primers I and J.

    Article Title: Active zone maturation state controls synaptic output and release mode and is differentially regulated by neuronal activity
    Article Snippet: The two constructs were cloned into pBid-UASc (Addgene #35200) using EcoRI and XbaI. .. To create CRISPR-tagged Unc13A, four guide RNAs (gRNAs) were selected using the CRISPR Optimal Target Finder : gRNA1 AGCTCGGCAACGATGGCATT gRNA2 CATGCAGGTGTTACGCCAAA gRNA3 AAAAAAAAAACGCTCTTGAG gRNA4 CCTGCCCTCAATTAAAGTAG These gRNAs were fused with the pCFD5 expression vector (Addgene #73914) according to the Gibson assembly protocol using NEBuilder HighFidelity DNA Assembly Cloning Kit (E5520). mRuby was amplified from a plasmid (Addgene #105802) and flanked with right and left homology arms corresponding to the end of the first exon for Unc13A. ..

    Virus:

    Article Title: Co-release of opposing signaling molecules from cortical neurons controls the escalation and release of aggression
    Article Snippet: .. Male and female Tac2-IRES-Cre mice 8-10 weeks were single housed and had surgeries performed to infuse a Cre-dependent adeno-associated virus (AAV) expressing membrane-GFP and synaptophysin fused to mRuby (AAV2-hSynb-FLEx-mGFP-2A-Synaptophysin-mRuby) infused into the mPFC (Addgene #: 71760-AAV2, titer: 2.7 x 10 GC/mL, lot: v138755). ..

    Bioprocessing:

    Article Title: Co-release of opposing signaling molecules from cortical neurons controls the escalation and release of aggression
    Article Snippet: .. Male and female Tac2-IRES-Cre mice 8-10 weeks were single housed and had surgeries performed to infuse a Cre-dependent adeno-associated virus (AAV) expressing membrane-GFP and synaptophysin fused to mRuby (AAV2-hSynb-FLEx-mGFP-2A-Synaptophysin-mRuby) infused into the mPFC (Addgene #: 71760-AAV2, titer: 2.7 x 10 GC/mL, lot: v138755). ..

    Expressing:

    Article Title: Co-release of opposing signaling molecules from cortical neurons controls the escalation and release of aggression
    Article Snippet: .. Male and female Tac2-IRES-Cre mice 8-10 weeks were single housed and had surgeries performed to infuse a Cre-dependent adeno-associated virus (AAV) expressing membrane-GFP and synaptophysin fused to mRuby (AAV2-hSynb-FLEx-mGFP-2A-Synaptophysin-mRuby) infused into the mPFC (Addgene #: 71760-AAV2, titer: 2.7 x 10 GC/mL, lot: v138755). ..

    Article Title: Active zone maturation state controls synaptic output and release mode and is differentially regulated by neuronal activity
    Article Snippet: The two constructs were cloned into pBid-UASc (Addgene #35200) using EcoRI and XbaI. .. To create CRISPR-tagged Unc13A, four guide RNAs (gRNAs) were selected using the CRISPR Optimal Target Finder : gRNA1 AGCTCGGCAACGATGGCATT gRNA2 CATGCAGGTGTTACGCCAAA gRNA3 AAAAAAAAAACGCTCTTGAG gRNA4 CCTGCCCTCAATTAAAGTAG These gRNAs were fused with the pCFD5 expression vector (Addgene #73914) according to the Gibson assembly protocol using NEBuilder HighFidelity DNA Assembly Cloning Kit (E5520). mRuby was amplified from a plasmid (Addgene #105802) and flanked with right and left homology arms corresponding to the end of the first exon for Unc13A. ..

    Article Title: Lentiviral-based vectors and related systems and methods for eukaryotic gene editing
    Article Snippet: .. To test this, an experiment was conducted comparing the gene editing rate induced by lentivirus-like particles expressing NC-MCPx1 (using psPAX2-D64V-NC-MS2, Plasmid No. 11) or a control generated using an mRuby-expressing plasmid (pKanCMV-mRuby3-10aa-H2B; Addgene Cat. No. 74258) that did not express any of the lentiviral packaging proteins (mRuby is a red fluorescent protein). ..

    Membrane:

    Article Title: Co-release of opposing signaling molecules from cortical neurons controls the escalation and release of aggression
    Article Snippet: .. Male and female Tac2-IRES-Cre mice 8-10 weeks were single housed and had surgeries performed to infuse a Cre-dependent adeno-associated virus (AAV) expressing membrane-GFP and synaptophysin fused to mRuby (AAV2-hSynb-FLEx-mGFP-2A-Synaptophysin-mRuby) infused into the mPFC (Addgene #: 71760-AAV2, titer: 2.7 x 10 GC/mL, lot: v138755). ..

    CRISPR:

    Article Title: Active zone maturation state controls synaptic output and release mode and is differentially regulated by neuronal activity
    Article Snippet: The two constructs were cloned into pBid-UASc (Addgene #35200) using EcoRI and XbaI. .. To create CRISPR-tagged Unc13A, four guide RNAs (gRNAs) were selected using the CRISPR Optimal Target Finder : gRNA1 AGCTCGGCAACGATGGCATT gRNA2 CATGCAGGTGTTACGCCAAA gRNA3 AAAAAAAAAACGCTCTTGAG gRNA4 CCTGCCCTCAATTAAAGTAG These gRNAs were fused with the pCFD5 expression vector (Addgene #73914) according to the Gibson assembly protocol using NEBuilder HighFidelity DNA Assembly Cloning Kit (E5520). mRuby was amplified from a plasmid (Addgene #105802) and flanked with right and left homology arms corresponding to the end of the first exon for Unc13A. ..

    Cloning:

    Article Title: Active zone maturation state controls synaptic output and release mode and is differentially regulated by neuronal activity
    Article Snippet: The two constructs were cloned into pBid-UASc (Addgene #35200) using EcoRI and XbaI. .. To create CRISPR-tagged Unc13A, four guide RNAs (gRNAs) were selected using the CRISPR Optimal Target Finder : gRNA1 AGCTCGGCAACGATGGCATT gRNA2 CATGCAGGTGTTACGCCAAA gRNA3 AAAAAAAAAACGCTCTTGAG gRNA4 CCTGCCCTCAATTAAAGTAG These gRNAs were fused with the pCFD5 expression vector (Addgene #73914) according to the Gibson assembly protocol using NEBuilder HighFidelity DNA Assembly Cloning Kit (E5520). mRuby was amplified from a plasmid (Addgene #105802) and flanked with right and left homology arms corresponding to the end of the first exon for Unc13A. ..

    Control:

    Article Title: Lentiviral-based vectors and related systems and methods for eukaryotic gene editing
    Article Snippet: .. To test this, an experiment was conducted comparing the gene editing rate induced by lentivirus-like particles expressing NC-MCPx1 (using psPAX2-D64V-NC-MS2, Plasmid No. 11) or a control generated using an mRuby-expressing plasmid (pKanCMV-mRuby3-10aa-H2B; Addgene Cat. No. 74258) that did not express any of the lentiviral packaging proteins (mRuby is a red fluorescent protein). ..



    Similar Products

    mruby circ3xha nanoluc plasmid ppk001  (New England Biolabs)
    99
    New England Biolabs mruby circ3xha nanoluc plasmid ppk001
    Mruby Circ3xha Nanoluc Plasmid Ppk001, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mruby/NEBuilder+HiFi+DNA+Assembly+Master+Mix/bio_rxiv__64898__2026__03__28__715045-256-9-22
    Average 99 stars, based on 1 article reviews
    mruby circ3xha nanoluc plasmid ppk001 - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    aav hsynflex mgfp 2a synaptophysin mruby  (Addgene inc)
    94
    Addgene inc aav hsynflex mgfp 2a synaptophysin mruby
    Aav Hsynflex Mgfp 2a Synaptophysin Mruby, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mruby/pAAV+hSyn+FLEx+mGFP-2A-Synaptophysin-mRuby+(Plasmid+%2371760)/pm41746362-225-9-12
    Average 94 stars, based on 1 article reviews
    aav hsynflex mgfp 2a synaptophysin mruby - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    aav hsyn flex mgfp 2a synaptophysin mruby  (Addgene inc)
    94
    Addgene inc aav hsyn flex mgfp 2a synaptophysin mruby
    BNST–PVN-RVLM neural signaling mediates IL-1β–induced changes in heart rate and IL-6. (A) Schematic for anterograde tracing of axonal projections and terminals from PBS-TRAPed or IL-1β–TRAPed BNST <t>neurons.</t> <t>The</t> <t>AAV-hSyn-FLEx-mGFP-2A-synaptophysin-mRuby</t> was injected into the BNST of TRAP2 mice. (B) Representative image for GFP + axons and mRuby + terminals in the PVN of PBS-TRAPed or IL-1β–TRAPed mice. The rightmost panel shows a higher-magnification view of the PVN in IL-1β–TRAPed mice. Arrowheads show regions with co-localization of mRuby and EYFP. Scale bars, 100 μm. (C) Schematic for anterograde tracing of IL-1β–TRAPed BNST neurons connected with PVN neurons. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-Ef1a-fDIO-EYFP was injected into the PVN of TRAP2 mice. (D) Representative image for EYFP expression in the PVN, RVLM, and NTS. Arrowheads show neurons, and arrows show axonal projections with expression of EYFP. Scale bar, 100 μm for the PVN and RVLM. Scale bar, 200 μm for the NTS. (E) c-Fos expression in the RVLM after reactivation with saline as a control or CNO of IL-1β–responsive BNST neurons. Scale bar, 100 μm. (F) Schematic for activating the BNST–PVN neural pathway. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-hSyn-fDIO-hM3D(Gq)-mCherry-WPREpA was injected into the PVN of TRAP2 mice. (G) Representative image of PVN showing Gq-DREADD-mCherry–expressing cells (red). Scale bar, 100 μm. (H) Serum IL-6 levels at 2 h after reactivation with saline as a control or CNO of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (I) ΔHR for 60 min after reactivation of the BNST–PVN neuronal pathway: saline (black) or CNO (red) (saline, n = 7 mice; CNO, n = 10 mice, mixed-effects analysis with Šidák correction). (J) AUC of ΔHR after reactivation. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (K) Serum corticosterone levels at 2 h after reactivation of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. *P < 0.05; **P < 0.01.
    Aav Hsyn Flex Mgfp 2a Synaptophysin Mruby, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mruby/pAAV+hSyn+FLEx+mGFP-2A-Synaptophysin-mRuby+(Plasmid+%2371760)/pmc12940476-140-9-12
    Average 94 stars, based on 1 article reviews
    aav hsyn flex mgfp 2a synaptophysin mruby - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    adeno associated virus aav based synaptophysin expression  (Addgene inc)
    94
    Addgene inc adeno associated virus aav based synaptophysin expression
    BNST–PVN-RVLM neural signaling mediates IL-1β–induced changes in heart rate and IL-6. (A) Schematic for anterograde tracing of axonal projections and terminals from PBS-TRAPed or IL-1β–TRAPed BNST <t>neurons.</t> <t>The</t> <t>AAV-hSyn-FLEx-mGFP-2A-synaptophysin-mRuby</t> was injected into the BNST of TRAP2 mice. (B) Representative image for GFP + axons and mRuby + terminals in the PVN of PBS-TRAPed or IL-1β–TRAPed mice. The rightmost panel shows a higher-magnification view of the PVN in IL-1β–TRAPed mice. Arrowheads show regions with co-localization of mRuby and EYFP. Scale bars, 100 μm. (C) Schematic for anterograde tracing of IL-1β–TRAPed BNST neurons connected with PVN neurons. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-Ef1a-fDIO-EYFP was injected into the PVN of TRAP2 mice. (D) Representative image for EYFP expression in the PVN, RVLM, and NTS. Arrowheads show neurons, and arrows show axonal projections with expression of EYFP. Scale bar, 100 μm for the PVN and RVLM. Scale bar, 200 μm for the NTS. (E) c-Fos expression in the RVLM after reactivation with saline as a control or CNO of IL-1β–responsive BNST neurons. Scale bar, 100 μm. (F) Schematic for activating the BNST–PVN neural pathway. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-hSyn-fDIO-hM3D(Gq)-mCherry-WPREpA was injected into the PVN of TRAP2 mice. (G) Representative image of PVN showing Gq-DREADD-mCherry–expressing cells (red). Scale bar, 100 μm. (H) Serum IL-6 levels at 2 h after reactivation with saline as a control or CNO of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (I) ΔHR for 60 min after reactivation of the BNST–PVN neuronal pathway: saline (black) or CNO (red) (saline, n = 7 mice; CNO, n = 10 mice, mixed-effects analysis with Šidák correction). (J) AUC of ΔHR after reactivation. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (K) Serum corticosterone levels at 2 h after reactivation of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. *P < 0.05; **P < 0.01.
    Adeno Associated Virus Aav Based Synaptophysin Expression, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mruby/pAAV+hSyn+FLEx+mGFP-2A-Synaptophysin-mRuby+(Plasmid+%2371760)/pm41932937-404-1-9
    Average 94 stars, based on 1 article reviews
    adeno associated virus aav based synaptophysin expression - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    paav hsynflex mgfp 2a synaptophysin mruby  (Addgene inc)
    94
    Addgene inc paav hsynflex mgfp 2a synaptophysin mruby
    BNST–PVN-RVLM neural signaling mediates IL-1β–induced changes in heart rate and IL-6. (A) Schematic for anterograde tracing of axonal projections and terminals from PBS-TRAPed or IL-1β–TRAPed BNST <t>neurons.</t> <t>The</t> <t>AAV-hSyn-FLEx-mGFP-2A-synaptophysin-mRuby</t> was injected into the BNST of TRAP2 mice. (B) Representative image for GFP + axons and mRuby + terminals in the PVN of PBS-TRAPed or IL-1β–TRAPed mice. The rightmost panel shows a higher-magnification view of the PVN in IL-1β–TRAPed mice. Arrowheads show regions with co-localization of mRuby and EYFP. Scale bars, 100 μm. (C) Schematic for anterograde tracing of IL-1β–TRAPed BNST neurons connected with PVN neurons. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-Ef1a-fDIO-EYFP was injected into the PVN of TRAP2 mice. (D) Representative image for EYFP expression in the PVN, RVLM, and NTS. Arrowheads show neurons, and arrows show axonal projections with expression of EYFP. Scale bar, 100 μm for the PVN and RVLM. Scale bar, 200 μm for the NTS. (E) c-Fos expression in the RVLM after reactivation with saline as a control or CNO of IL-1β–responsive BNST neurons. Scale bar, 100 μm. (F) Schematic for activating the BNST–PVN neural pathway. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-hSyn-fDIO-hM3D(Gq)-mCherry-WPREpA was injected into the PVN of TRAP2 mice. (G) Representative image of PVN showing Gq-DREADD-mCherry–expressing cells (red). Scale bar, 100 μm. (H) Serum IL-6 levels at 2 h after reactivation with saline as a control or CNO of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (I) ΔHR for 60 min after reactivation of the BNST–PVN neuronal pathway: saline (black) or CNO (red) (saline, n = 7 mice; CNO, n = 10 mice, mixed-effects analysis with Šidák correction). (J) AUC of ΔHR after reactivation. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (K) Serum corticosterone levels at 2 h after reactivation of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. *P < 0.05; **P < 0.01.
    Paav Hsynflex Mgfp 2a Synaptophysin Mruby, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mruby/pAAV+hSyn+FLEx+mGFP-2A-Synaptophysin-mRuby+(Plasmid+%2371760)/pm41932937-404-8-9
    Average 94 stars, based on 1 article reviews
    paav hsynflex mgfp 2a synaptophysin mruby - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    aav2 9 cag flex egfp wpre addgene  (Addgene inc)
    94
    Addgene inc aav2 9 cag flex egfp wpre addgene
    BNST–PVN-RVLM neural signaling mediates IL-1β–induced changes in heart rate and IL-6. (A) Schematic for anterograde tracing of axonal projections and terminals from PBS-TRAPed or IL-1β–TRAPed BNST <t>neurons.</t> <t>The</t> <t>AAV-hSyn-FLEx-mGFP-2A-synaptophysin-mRuby</t> was injected into the BNST of TRAP2 mice. (B) Representative image for GFP + axons and mRuby + terminals in the PVN of PBS-TRAPed or IL-1β–TRAPed mice. The rightmost panel shows a higher-magnification view of the PVN in IL-1β–TRAPed mice. Arrowheads show regions with co-localization of mRuby and EYFP. Scale bars, 100 μm. (C) Schematic for anterograde tracing of IL-1β–TRAPed BNST neurons connected with PVN neurons. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-Ef1a-fDIO-EYFP was injected into the PVN of TRAP2 mice. (D) Representative image for EYFP expression in the PVN, RVLM, and NTS. Arrowheads show neurons, and arrows show axonal projections with expression of EYFP. Scale bar, 100 μm for the PVN and RVLM. Scale bar, 200 μm for the NTS. (E) c-Fos expression in the RVLM after reactivation with saline as a control or CNO of IL-1β–responsive BNST neurons. Scale bar, 100 μm. (F) Schematic for activating the BNST–PVN neural pathway. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-hSyn-fDIO-hM3D(Gq)-mCherry-WPREpA was injected into the PVN of TRAP2 mice. (G) Representative image of PVN showing Gq-DREADD-mCherry–expressing cells (red). Scale bar, 100 μm. (H) Serum IL-6 levels at 2 h after reactivation with saline as a control or CNO of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (I) ΔHR for 60 min after reactivation of the BNST–PVN neuronal pathway: saline (black) or CNO (red) (saline, n = 7 mice; CNO, n = 10 mice, mixed-effects analysis with Šidák correction). (J) AUC of ΔHR after reactivation. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (K) Serum corticosterone levels at 2 h after reactivation of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. *P < 0.05; **P < 0.01.
    Aav2 9 Cag Flex Egfp Wpre Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mruby/pAAV+hSyn+FLEx+mGFP-2A-Synaptophysin-mRuby+(Plasmid+%2371760)/pm41863797-674-173-175
    Average 94 stars, based on 1 article reviews
    aav2 9 cag flex egfp wpre addgene - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    mruby 3 galectin 8 fusion protein  (Galectin Therapeutics)
    86
    Galectin Therapeutics mruby 3 galectin 8 fusion protein
    BNST–PVN-RVLM neural signaling mediates IL-1β–induced changes in heart rate and IL-6. (A) Schematic for anterograde tracing of axonal projections and terminals from PBS-TRAPed or IL-1β–TRAPed BNST <t>neurons.</t> <t>The</t> <t>AAV-hSyn-FLEx-mGFP-2A-synaptophysin-mRuby</t> was injected into the BNST of TRAP2 mice. (B) Representative image for GFP + axons and mRuby + terminals in the PVN of PBS-TRAPed or IL-1β–TRAPed mice. The rightmost panel shows a higher-magnification view of the PVN in IL-1β–TRAPed mice. Arrowheads show regions with co-localization of mRuby and EYFP. Scale bars, 100 μm. (C) Schematic for anterograde tracing of IL-1β–TRAPed BNST neurons connected with PVN neurons. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-Ef1a-fDIO-EYFP was injected into the PVN of TRAP2 mice. (D) Representative image for EYFP expression in the PVN, RVLM, and NTS. Arrowheads show neurons, and arrows show axonal projections with expression of EYFP. Scale bar, 100 μm for the PVN and RVLM. Scale bar, 200 μm for the NTS. (E) c-Fos expression in the RVLM after reactivation with saline as a control or CNO of IL-1β–responsive BNST neurons. Scale bar, 100 μm. (F) Schematic for activating the BNST–PVN neural pathway. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-hSyn-fDIO-hM3D(Gq)-mCherry-WPREpA was injected into the PVN of TRAP2 mice. (G) Representative image of PVN showing Gq-DREADD-mCherry–expressing cells (red). Scale bar, 100 μm. (H) Serum IL-6 levels at 2 h after reactivation with saline as a control or CNO of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (I) ΔHR for 60 min after reactivation of the BNST–PVN neuronal pathway: saline (black) or CNO (red) (saline, n = 7 mice; CNO, n = 10 mice, mixed-effects analysis with Šidák correction). (J) AUC of ΔHR after reactivation. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (K) Serum corticosterone levels at 2 h after reactivation of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. *P < 0.05; **P < 0.01.
    Mruby 3 Galectin 8 Fusion Protein, supplied by Galectin Therapeutics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mruby/lgals3/bio_rxiv__64898__2026__03__13__711661-70-16-16
    Average 86 stars, based on 1 article reviews
    mruby 3 galectin 8 fusion protein - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    paav1 hsyn dio mgfpsynaptophysin mruby  (Addgene inc)
    94
    Addgene inc paav1 hsyn dio mgfpsynaptophysin mruby
    BNST–PVN-RVLM neural signaling mediates IL-1β–induced changes in heart rate and IL-6. (A) Schematic for anterograde tracing of axonal projections and terminals from PBS-TRAPed or IL-1β–TRAPed BNST <t>neurons.</t> <t>The</t> <t>AAV-hSyn-FLEx-mGFP-2A-synaptophysin-mRuby</t> was injected into the BNST of TRAP2 mice. (B) Representative image for GFP + axons and mRuby + terminals in the PVN of PBS-TRAPed or IL-1β–TRAPed mice. The rightmost panel shows a higher-magnification view of the PVN in IL-1β–TRAPed mice. Arrowheads show regions with co-localization of mRuby and EYFP. Scale bars, 100 μm. (C) Schematic for anterograde tracing of IL-1β–TRAPed BNST neurons connected with PVN neurons. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-Ef1a-fDIO-EYFP was injected into the PVN of TRAP2 mice. (D) Representative image for EYFP expression in the PVN, RVLM, and NTS. Arrowheads show neurons, and arrows show axonal projections with expression of EYFP. Scale bar, 100 μm for the PVN and RVLM. Scale bar, 200 μm for the NTS. (E) c-Fos expression in the RVLM after reactivation with saline as a control or CNO of IL-1β–responsive BNST neurons. Scale bar, 100 μm. (F) Schematic for activating the BNST–PVN neural pathway. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-hSyn-fDIO-hM3D(Gq)-mCherry-WPREpA was injected into the PVN of TRAP2 mice. (G) Representative image of PVN showing Gq-DREADD-mCherry–expressing cells (red). Scale bar, 100 μm. (H) Serum IL-6 levels at 2 h after reactivation with saline as a control or CNO of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (I) ΔHR for 60 min after reactivation of the BNST–PVN neuronal pathway: saline (black) or CNO (red) (saline, n = 7 mice; CNO, n = 10 mice, mixed-effects analysis with Šidák correction). (J) AUC of ΔHR after reactivation. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (K) Serum corticosterone levels at 2 h after reactivation of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. *P < 0.05; **P < 0.01.
    Paav1 Hsyn Dio Mgfpsynaptophysin Mruby, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mruby/pAAV+hSyn+FLEx+mGFP-2A-Synaptophysin-mRuby+(Plasmid+%2371760)/pm41611731-366-9-10
    Average 94 stars, based on 1 article reviews
    paav1 hsyn dio mgfpsynaptophysin mruby - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    plasmid plix403 capture1 apobec ha p2a mruby  (Addgene inc)
    96
    Addgene inc plasmid plix403 capture1 apobec ha p2a mruby
    BNST–PVN-RVLM neural signaling mediates IL-1β–induced changes in heart rate and IL-6. (A) Schematic for anterograde tracing of axonal projections and terminals from PBS-TRAPed or IL-1β–TRAPed BNST <t>neurons.</t> <t>The</t> <t>AAV-hSyn-FLEx-mGFP-2A-synaptophysin-mRuby</t> was injected into the BNST of TRAP2 mice. (B) Representative image for GFP + axons and mRuby + terminals in the PVN of PBS-TRAPed or IL-1β–TRAPed mice. The rightmost panel shows a higher-magnification view of the PVN in IL-1β–TRAPed mice. Arrowheads show regions with co-localization of mRuby and EYFP. Scale bars, 100 μm. (C) Schematic for anterograde tracing of IL-1β–TRAPed BNST neurons connected with PVN neurons. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-Ef1a-fDIO-EYFP was injected into the PVN of TRAP2 mice. (D) Representative image for EYFP expression in the PVN, RVLM, and NTS. Arrowheads show neurons, and arrows show axonal projections with expression of EYFP. Scale bar, 100 μm for the PVN and RVLM. Scale bar, 200 μm for the NTS. (E) c-Fos expression in the RVLM after reactivation with saline as a control or CNO of IL-1β–responsive BNST neurons. Scale bar, 100 μm. (F) Schematic for activating the BNST–PVN neural pathway. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-hSyn-fDIO-hM3D(Gq)-mCherry-WPREpA was injected into the PVN of TRAP2 mice. (G) Representative image of PVN showing Gq-DREADD-mCherry–expressing cells (red). Scale bar, 100 μm. (H) Serum IL-6 levels at 2 h after reactivation with saline as a control or CNO of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (I) ΔHR for 60 min after reactivation of the BNST–PVN neuronal pathway: saline (black) or CNO (red) (saline, n = 7 mice; CNO, n = 10 mice, mixed-effects analysis with Šidák correction). (J) AUC of ΔHR after reactivation. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (K) Serum corticosterone levels at 2 h after reactivation of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. *P < 0.05; **P < 0.01.
    Plasmid Plix403 Capture1 Apobec Ha P2a Mruby, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mruby/pLIX_403+(Plasmid+%2341395)/bio_rxiv__64898__2026__02__04__703776-231-1-8
    Average 96 stars, based on 1 article reviews
    plasmid plix403 capture1 apobec ha p2a mruby - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    paav1 hsyn dio mgfp synaptophysin mruby  (Addgene inc)
    94
    Addgene inc paav1 hsyn dio mgfp synaptophysin mruby
    BNST–PVN-RVLM neural signaling mediates IL-1β–induced changes in heart rate and IL-6. (A) Schematic for anterograde tracing of axonal projections and terminals from PBS-TRAPed or IL-1β–TRAPed BNST <t>neurons.</t> <t>The</t> <t>AAV-hSyn-FLEx-mGFP-2A-synaptophysin-mRuby</t> was injected into the BNST of TRAP2 mice. (B) Representative image for GFP + axons and mRuby + terminals in the PVN of PBS-TRAPed or IL-1β–TRAPed mice. The rightmost panel shows a higher-magnification view of the PVN in IL-1β–TRAPed mice. Arrowheads show regions with co-localization of mRuby and EYFP. Scale bars, 100 μm. (C) Schematic for anterograde tracing of IL-1β–TRAPed BNST neurons connected with PVN neurons. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-Ef1a-fDIO-EYFP was injected into the PVN of TRAP2 mice. (D) Representative image for EYFP expression in the PVN, RVLM, and NTS. Arrowheads show neurons, and arrows show axonal projections with expression of EYFP. Scale bar, 100 μm for the PVN and RVLM. Scale bar, 200 μm for the NTS. (E) c-Fos expression in the RVLM after reactivation with saline as a control or CNO of IL-1β–responsive BNST neurons. Scale bar, 100 μm. (F) Schematic for activating the BNST–PVN neural pathway. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-hSyn-fDIO-hM3D(Gq)-mCherry-WPREpA was injected into the PVN of TRAP2 mice. (G) Representative image of PVN showing Gq-DREADD-mCherry–expressing cells (red). Scale bar, 100 μm. (H) Serum IL-6 levels at 2 h after reactivation with saline as a control or CNO of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (I) ΔHR for 60 min after reactivation of the BNST–PVN neuronal pathway: saline (black) or CNO (red) (saline, n = 7 mice; CNO, n = 10 mice, mixed-effects analysis with Šidák correction). (J) AUC of ΔHR after reactivation. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (K) Serum corticosterone levels at 2 h after reactivation of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. *P < 0.05; **P < 0.01.
    Paav1 Hsyn Dio Mgfp Synaptophysin Mruby, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mruby/pAAV+hSyn+FLEx+mGFP-2A-Synaptophysin-mRuby+(Plasmid+%2371760)/pmc12957525-370-10-11
    Average 94 stars, based on 1 article reviews
    paav1 hsyn dio mgfp synaptophysin mruby - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier

    Image Search Results


    BNST–PVN-RVLM neural signaling mediates IL-1β–induced changes in heart rate and IL-6. (A) Schematic for anterograde tracing of axonal projections and terminals from PBS-TRAPed or IL-1β–TRAPed BNST neurons. The AAV-hSyn-FLEx-mGFP-2A-synaptophysin-mRuby was injected into the BNST of TRAP2 mice. (B) Representative image for GFP + axons and mRuby + terminals in the PVN of PBS-TRAPed or IL-1β–TRAPed mice. The rightmost panel shows a higher-magnification view of the PVN in IL-1β–TRAPed mice. Arrowheads show regions with co-localization of mRuby and EYFP. Scale bars, 100 μm. (C) Schematic for anterograde tracing of IL-1β–TRAPed BNST neurons connected with PVN neurons. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-Ef1a-fDIO-EYFP was injected into the PVN of TRAP2 mice. (D) Representative image for EYFP expression in the PVN, RVLM, and NTS. Arrowheads show neurons, and arrows show axonal projections with expression of EYFP. Scale bar, 100 μm for the PVN and RVLM. Scale bar, 200 μm for the NTS. (E) c-Fos expression in the RVLM after reactivation with saline as a control or CNO of IL-1β–responsive BNST neurons. Scale bar, 100 μm. (F) Schematic for activating the BNST–PVN neural pathway. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-hSyn-fDIO-hM3D(Gq)-mCherry-WPREpA was injected into the PVN of TRAP2 mice. (G) Representative image of PVN showing Gq-DREADD-mCherry–expressing cells (red). Scale bar, 100 μm. (H) Serum IL-6 levels at 2 h after reactivation with saline as a control or CNO of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (I) ΔHR for 60 min after reactivation of the BNST–PVN neuronal pathway: saline (black) or CNO (red) (saline, n = 7 mice; CNO, n = 10 mice, mixed-effects analysis with Šidák correction). (J) AUC of ΔHR after reactivation. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (K) Serum corticosterone levels at 2 h after reactivation of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. *P < 0.05; **P < 0.01.

    Journal: The Journal of Experimental Medicine

    Article Title: Central neurons encode interleukin-1β signals and mediate stress-induced inflammation

    doi: 10.1084/jem.20252000

    Figure Lengend Snippet: BNST–PVN-RVLM neural signaling mediates IL-1β–induced changes in heart rate and IL-6. (A) Schematic for anterograde tracing of axonal projections and terminals from PBS-TRAPed or IL-1β–TRAPed BNST neurons. The AAV-hSyn-FLEx-mGFP-2A-synaptophysin-mRuby was injected into the BNST of TRAP2 mice. (B) Representative image for GFP + axons and mRuby + terminals in the PVN of PBS-TRAPed or IL-1β–TRAPed mice. The rightmost panel shows a higher-magnification view of the PVN in IL-1β–TRAPed mice. Arrowheads show regions with co-localization of mRuby and EYFP. Scale bars, 100 μm. (C) Schematic for anterograde tracing of IL-1β–TRAPed BNST neurons connected with PVN neurons. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-Ef1a-fDIO-EYFP was injected into the PVN of TRAP2 mice. (D) Representative image for EYFP expression in the PVN, RVLM, and NTS. Arrowheads show neurons, and arrows show axonal projections with expression of EYFP. Scale bar, 100 μm for the PVN and RVLM. Scale bar, 200 μm for the NTS. (E) c-Fos expression in the RVLM after reactivation with saline as a control or CNO of IL-1β–responsive BNST neurons. Scale bar, 100 μm. (F) Schematic for activating the BNST–PVN neural pathway. The AAV-pEF1a-DIO-FLPo-WPRE-hGHpA was injected into the BNST, and the AAV-hSyn-fDIO-hM3D(Gq)-mCherry-WPREpA was injected into the PVN of TRAP2 mice. (G) Representative image of PVN showing Gq-DREADD-mCherry–expressing cells (red). Scale bar, 100 μm. (H) Serum IL-6 levels at 2 h after reactivation with saline as a control or CNO of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (I) ΔHR for 60 min after reactivation of the BNST–PVN neuronal pathway: saline (black) or CNO (red) (saline, n = 7 mice; CNO, n = 10 mice, mixed-effects analysis with Šidák correction). (J) AUC of ΔHR after reactivation. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. (K) Serum corticosterone levels at 2 h after reactivation of the BNST–PVN neuronal pathway. Data are represented as individual mouse data points pooled from two independent experiments. Unpaired t test. *P < 0.05; **P < 0.01.

    Article Snippet: For the tracing studies, either AAV-hSyn-DIO-EGFP (cat #50457; Addgene), AAV-hSyn-FLEx-mGFP-2A-Synaptophysin-mRuby (cat# 71760; Addgene), AAV-Ef1a-fDIO-EYFP (cat# 55641; Addgene), or AAV pEF1a-DIO-FLPo-WPRE-hGHpA (cat# 87306; Addgene) was utilized.

    Techniques: Anterograde Tracing, Injection, Expressing, Saline, Control