mmei new england biolabs  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    MmeI
    Description:
    MmeI 500 units
    Catalog Number:
    r0637l
    Price:
    282
    Size:
    500 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs mmei new england biolabs
    MmeI
    MmeI 500 units
    https://www.bioz.com/result/mmei new england biolabs/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mmei new england biolabs - by Bioz Stars, 2020-04
    99/100 stars

    Images

    Related Articles

    Multiplexing:

    Article Title: Genome-wide identification of histone H2A and histone variant H2A.Z-interacting proteins by bPPI-seq
    Article Snippet: Then the DNA was amplified by MmeI-SD-1, MmeI-SD-2, MmeI-SD-3 and T7 primers to add a Mme I recognition site at both ends, followed by digestion with Mme I (New England Biolabs). .. After treatment with Klenow Enzyme (New England Biolabs), indexed libraries were prepared with a Multiplexing Sample Preparation Oligonucleotide Kit (Illumina) according to the user's manual.

    Amplification:

    Article Title: Genome-wide identification of histone H2A and histone variant H2A.Z-interacting proteins by bPPI-seq
    Article Snippet: .. Then the DNA was amplified by MmeI-SD-1, MmeI-SD-2, MmeI-SD-3 and T7 primers to add a Mme I recognition site at both ends, followed by digestion with Mme I (New England Biolabs). .. After treatment with Klenow Enzyme (New England Biolabs), indexed libraries were prepared with a Multiplexing Sample Preparation Oligonucleotide Kit (Illumina) according to the user's manual.

    Article Title: Zebrafish bmp4 functions during late gastrulation to specify ventroposterior cell fates
    Article Snippet: 10 ug of the genomic DNA was digested with BstXI, PsiI, HpyCHIV, NheI, SmlI, SfcI, MmeI, BspMI, or BssSI (NEB), run on a 1% agarose gel, and then transferred to a charged nylon membrane (Hybond-N+, Amersham Biosciences). .. Probes were amplified from genomic DNA (5′ probe: 5′-CCGCTGATAAATAAGAGACTAAGC-3′ and 5′-GCTTTAAGCATAATCTGAAATCACTC-3′, 667bp; 3′probe: 5′-ACACCGTGCGCATCTCTT-3′ and 5′-GGCTGCTAATATGATTTCCCTGT-3′, 579bp) and radioactively labeled with the Rediprime II Random Prime Labelling System (Amersham Biosciences).

    Synthesized:

    Article Title: 5'-Serial Analysis of Gene Expression studies reveal a transcriptomic switch during fruiting body development in Coprinopsis cinerea
    Article Snippet: Second strand cDNA was then synthesized by low cycle primer extension using Advantage® 2 polymerase (Clontech). .. The cDNAs were digested by 10units of Mme I (New England Biolabs) at 37°C for 2 hours.

    Blocking Assay:

    Article Title: Primer Extension Enrichment Reaction (PEER): a new subtraction method for identification of genetic differences between biological specimens
    Article Snippet: MmeI digestion : The ligation products are digested with 5 U MmeI (NEB) for 2 h. The cleaved DNA is resolved in 10% polyacrylamide gel, the resulting 50 bp fragment is cut out, isolated from the gel with QIAquick gel extraction kit (Qiagen) and resuspended in 50 μl of 10 mM Tris (pH 8). .. Blocking of MmeI-tagged primers : 25 μl Of the fragment is used as primer with 10 μl Driver bio-dsDNA template in the presence of 2.5 mM each ddNTPs-bio (Biotin-11-ddNTPs, NEN® Life Science Products Inc., Boston, MA), 0.025 mM each dNTPs (Roche) and Thermo Sequenase™ (Amersham Pharmacia Biotech, Inc., Piscataway, NJ).

    Electrophoresis:

    Article Title: 5'-Serial Analysis of Gene Expression studies reveal a transcriptomic switch during fruiting body development in Coprinopsis cinerea
    Article Snippet: Double-stranded cDNA was purified by QIAquick PCR purification kit (Qiagen) and checked by electrophoresis on a 1.5% agarose gel. .. The cDNAs were digested by 10units of Mme I (New England Biolabs) at 37°C for 2 hours.

    Incubation:

    Article Title: Targeted and genome-scale methylomics reveals gene body signatures in human cell lines
    Article Snippet: .. This was incubated at 50°C for 20 min, then 85°C for 20 min. Ethanol precipitation was performed again, and the pellet was resuspended to 50ul with a reaction mixture containing 2 units Mme I (NEB), 50 µM SAM and 1× NEBuffer 4. .. This was incubated at 37°C for 2 hours, then 80°C for 20 min. To this was added 1.66 µl of 10 µM adapter B, 6 µl 10mM ATP, and 3 µl T4 DNA ligase, and the mixture was incubated at 16°C for 4 hours, then 65°C for 15 min.

    Article Title: Effects of Diet on Resource Utilization by a Model Human Gut Microbiota Containing Bacteroides cellulosilyticus WH2, a Symbiont with an Extensive Glycobiome
    Article Snippet: 500 ng of each fecal DNA extraction was diluted in 15 µL of TE buffer and digested with MmeI (4 U, New England Biolabs) in a 20 µL reaction supplemented with 10 pmoles of 12 bp DNA containing an MmeI restriction site (to improve the efficiency of restriction enzyme digestion) . .. The digested DNA was added to the beads and the solution incubated at room temperature for 5 min. Beads were pelleted with a magnetic particle collector (MPC), washed twice (each time using a mixture composed of 20 µL TE buffer (pH 7.0) and 100 µL sizing solution, with bead recovery via MPC after each wash), followed by two ethanol washes (180 µL 70% ethanol/wash) and air-drying for 10 min.

    Activity Assay:

    Article Title: Structure of Type IIL Restriction-Modification Enzyme MmeI in Complex with DNA Has Implications for Engineering New Specificities
    Article Snippet: .. DNA Cleavage Assay Endonuclease activity was assayed by incubating various amounts of MmeI (wt or mutant) enzyme for 30 min at 37°C in NEBuffer 4 (20 mM Tris-acetate, pH 7.9, 10 mM magnesium acetate, 50 mM potassium acetate, 1 mM DTT) supplemented with AdoMet at 80 μM, containing 1 μg substrate DNA per 50 μl. .. Reactions were terminated by the addition of loading dye (NEB B7024) and reaction products were analyzed by gel electrophoresis in 1% LE agarose gels.

    Modification:

    Article Title: Effects of Diet on Resource Utilization by a Model Human Gut Microbiota Containing Bacteroides cellulosilyticus WH2, a Symbiont with an Extensive Glycobiome
    Article Snippet: The resulting library consisted of 93,458 distinct isogenic mutants, with each mutant strain containing a single randomly inserted modified mariner transposon. .. 500 ng of each fecal DNA extraction was diluted in 15 µL of TE buffer and digested with MmeI (4 U, New England Biolabs) in a 20 µL reaction supplemented with 10 pmoles of 12 bp DNA containing an MmeI restriction site (to improve the efficiency of restriction enzyme digestion) .

    Gel Purification:

    Article Title: Development and application of a recombination-based library versus library high- throughput yeast two-hybrid (RLL-Y2H) screening system
    Article Snippet: .. Digest the purified PCR products with MmeI (NEB, CA) which yields a ∼110 bp target band, followed by low-melting gel purification. .. Prepare Illumina P5 and P7 adapters by annealing overhang NN-nucleotides P5: 5′-ACACTCTTTCCCTACACGACGCTCTTCCGATCTNN-3′ and 5′-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT-3′; P7: 5′-GATCGGAAGAGCACACGTCTGAACTCCAGTCAC-3′ and 5′-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCNN-3′, respectively.

    Ligation:

    Article Title: Primer Extension Enrichment Reaction (PEER): a new subtraction method for identification of genetic differences between biological specimens
    Article Snippet: .. MmeI digestion : The ligation products are digested with 5 U MmeI (NEB) for 2 h. The cleaved DNA is resolved in 10% polyacrylamide gel, the resulting 50 bp fragment is cut out, isolated from the gel with QIAquick gel extraction kit (Qiagen) and resuspended in 50 μl of 10 mM Tris (pH 8). .. Blocking of MmeI-tagged primers : 25 μl Of the fragment is used as primer with 10 μl Driver bio-dsDNA template in the presence of 2.5 mM each ddNTPs-bio (Biotin-11-ddNTPs, NEN® Life Science Products Inc., Boston, MA), 0.025 mM each dNTPs (Roche) and Thermo Sequenase™ (Amersham Pharmacia Biotech, Inc., Piscataway, NJ).

    Article Title: Genome-wide identification of histone H2A and histone variant H2A.Z-interacting proteins by bPPI-seq
    Article Snippet: Following ligation of a pair of top-Phops-oligo-17bp/T7Mme I-18bp adaptors, fragments between 250 and 650 bp were isolated from agarose gel. .. Then the DNA was amplified by MmeI-SD-1, MmeI-SD-2, MmeI-SD-3 and T7 primers to add a Mme I recognition site at both ends, followed by digestion with Mme I (New England Biolabs).

    Article Title: Distributed probing of chromatin structure in vivo reveals pervasive chromatin accessibility for expressed and non-expressed genes during tissue differentiation in C. elegans
    Article Snippet: .. Ligation to Linker B Linker B was purchased as two separate oligonucleotides (5'P-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCGGTGGTCGCCGTATCATT-OH3', 5'OH-TCATCTTTCCCTACACGACGCTCTTCCGATCTNN-OH3') and hybridized using the same procedure as described for Linker A. Mme I products were ligated to Linker B using the following 50 μl reaction mix: 10.0 μl Mme I product, 1.0 μl of 0.05 mM Linker B, 5.0 μl 10× ligase buffer, 3.0 μl T4 DNA ligase (2,000 U/μl; NEB #M0202), 31.0 μl dH2 O. Ligations were performed overnight using a PCR machine. ..

    Article Title: Development and application of a recombination-based library versus library high- throughput yeast two-hybrid (RLL-Y2H) screening system
    Article Snippet: Digest the purified PCR products with MmeI (NEB, CA) which yields a ∼110 bp target band, followed by low-melting gel purification. .. Add P5 and P7 adapters to purified 110bp fragments by T4 ligation at 16°C for more than 2 h. Amplify the ligation products using primers (5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ and 5′-CAAGCAGAAGACGGCATACGAGAT(index)GTGACTGGAGTTCAGACGTGTGCTC TTCCGATC-3′) to construct high-throughput sequencing library.

    other:

    Article Title: Distributed probing of chromatin structure in vivo reveals pervasive chromatin accessibility for expressed and non-expressed genes during tissue differentiation in C. elegans
    Article Snippet: Mme I digestion Linker A-ligated molecules were subjected to Mme I digestion using the following 200 μl reaction mix: 20 μl Linker A-ligated product, 20.0 μl 10× NEB 4, 0.3 μl 32 mM S-adenosyl methionine, 2.0 μl Mme I (2 U/μl; NEB R0637), 157.7 μl dH2 O.

    Article Title: MmeI: a minimal Type II restriction-modification system that only modifies one DNA strand for host protection
    Article Snippet: MATERIALS AND METHODS MmeI, AdoMet, all restriction endonucleases, T4 DNA Ligase, Phusion DNA polymerase, DNA size standards and competent cells were obtained from New England Biolabs (Ipswich, MA).

    Polymerase Chain Reaction:

    Article Title: Targeted and genome-scale methylomics reveals gene body signatures in human cell lines
    Article Snippet: This was incubated at 50°C for 20 min, then 85°C for 20 min. Ethanol precipitation was performed again, and the pellet was resuspended to 50ul with a reaction mixture containing 2 units Mme I (NEB), 50 µM SAM and 1× NEBuffer 4. .. PCR was then performed on ~80% of this purified sample using primers matching the sequences of adapter A and adapter B.

    Article Title: 5'-Serial Analysis of Gene Expression studies reveal a transcriptomic switch during fruiting body development in Coprinopsis cinerea
    Article Snippet: Double-stranded cDNA was purified by QIAquick PCR purification kit (Qiagen) and checked by electrophoresis on a 1.5% agarose gel. .. The cDNAs were digested by 10units of Mme I (New England Biolabs) at 37°C for 2 hours.

    Article Title: Generating high accuracy peptide binding data in high throughput with yeast surface display and SORTCERY
    Article Snippet: .. Zymoprep Yeast Plasmid Miniprep I (Zymo Research) Isopropanole High-Fidelity DNA Polymerase (e.g. Phusion) Thermocycler Gel equipment PCR purification and gel extraction kits (QiaGen) MmeI (New England Biolabs): MmeI restriction enzyme, NEB Cut Smart Buffer, 1 mM SAM T4 Ligase Primers and oligos .. Dilute cells to OD600 of 0.05 in SD + CAA and grow for 8 h at 30 °C.

    Article Title: Distributed probing of chromatin structure in vivo reveals pervasive chromatin accessibility for expressed and non-expressed genes during tissue differentiation in C. elegans
    Article Snippet: .. Ligation to Linker B Linker B was purchased as two separate oligonucleotides (5'P-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCGGTGGTCGCCGTATCATT-OH3', 5'OH-TCATCTTTCCCTACACGACGCTCTTCCGATCTNN-OH3') and hybridized using the same procedure as described for Linker A. Mme I products were ligated to Linker B using the following 50 μl reaction mix: 10.0 μl Mme I product, 1.0 μl of 0.05 mM Linker B, 5.0 μl 10× ligase buffer, 3.0 μl T4 DNA ligase (2,000 U/μl; NEB #M0202), 31.0 μl dH2 O. Ligations were performed overnight using a PCR machine. ..

    Article Title: Development and application of a recombination-based library versus library high- throughput yeast two-hybrid (RLL-Y2H) screening system
    Article Snippet: .. Digest the purified PCR products with MmeI (NEB, CA) which yields a ∼110 bp target band, followed by low-melting gel purification. .. Prepare Illumina P5 and P7 adapters by annealing overhang NN-nucleotides P5: 5′-ACACTCTTTCCCTACACGACGCTCTTCCGATCTNN-3′ and 5′-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT-3′; P7: 5′-GATCGGAAGAGCACACGTCTGAACTCCAGTCAC-3′ and 5′-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCNN-3′, respectively.

    Sonication:

    Article Title: Genome-wide identification of histone H2A and histone variant H2A.Z-interacting proteins by bPPI-seq
    Article Snippet: The cDNAs were amplified by a GFPC-specific (VNC primer) and T7 primers, and fragmented to 200 to 500 bp by sonication. .. Then the DNA was amplified by MmeI-SD-1, MmeI-SD-2, MmeI-SD-3 and T7 primers to add a Mme I recognition site at both ends, followed by digestion with Mme I (New England Biolabs).

    Hybridization:

    Article Title: Zebrafish bmp4 functions during late gastrulation to specify ventroposterior cell fates
    Article Snippet: 10 ug of the genomic DNA was digested with BstXI, PsiI, HpyCHIV, NheI, SmlI, SfcI, MmeI, BspMI, or BssSI (NEB), run on a 1% agarose gel, and then transferred to a charged nylon membrane (Hybond-N+, Amersham Biosciences). .. Hybridization of the probes to the nylon membrane was performed with Rapid-hyb buffer (Amersham Biosciences) following the supplied protocol.

    DNA Extraction:

    Article Title: Effects of Diet on Resource Utilization by a Model Human Gut Microbiota Containing Bacteroides cellulosilyticus WH2, a Symbiont with an Extensive Glycobiome
    Article Snippet: .. 500 ng of each fecal DNA extraction was diluted in 15 µL of TE buffer and digested with MmeI (4 U, New England Biolabs) in a 20 µL reaction supplemented with 10 pmoles of 12 bp DNA containing an MmeI restriction site (to improve the efficiency of restriction enzyme digestion) . .. MmeI-digested DNA was subsequently purified using 125 µL of AMPure beads (after washing the beads once with 100 µL of sizing solution (1.2 M NaCl and 8.4% PEG 8000)).

    Nucleic Acid Electrophoresis:

    Article Title: Structure of Type IIL Restriction-Modification Enzyme MmeI in Complex with DNA Has Implications for Engineering New Specificities
    Article Snippet: DNA Cleavage Assay Endonuclease activity was assayed by incubating various amounts of MmeI (wt or mutant) enzyme for 30 min at 37°C in NEBuffer 4 (20 mM Tris-acetate, pH 7.9, 10 mM magnesium acetate, 50 mM potassium acetate, 1 mM DTT) supplemented with AdoMet at 80 μM, containing 1 μg substrate DNA per 50 μl. .. Reactions were terminated by the addition of loading dye (NEB B7024) and reaction products were analyzed by gel electrophoresis in 1% LE agarose gels.

    DNA Cleavage Assay:

    Article Title: Structure of Type IIL Restriction-Modification Enzyme MmeI in Complex with DNA Has Implications for Engineering New Specificities
    Article Snippet: .. DNA Cleavage Assay Endonuclease activity was assayed by incubating various amounts of MmeI (wt or mutant) enzyme for 30 min at 37°C in NEBuffer 4 (20 mM Tris-acetate, pH 7.9, 10 mM magnesium acetate, 50 mM potassium acetate, 1 mM DTT) supplemented with AdoMet at 80 μM, containing 1 μg substrate DNA per 50 μl. .. Reactions were terminated by the addition of loading dye (NEB B7024) and reaction products were analyzed by gel electrophoresis in 1% LE agarose gels.

    Magnetic Beads:

    Article Title: Primer Extension Enrichment Reaction (PEER): a new subtraction method for identification of genetic differences between biological specimens
    Article Snippet: MmeI digestion : The ligation products are digested with 5 U MmeI (NEB) for 2 h. The cleaved DNA is resolved in 10% polyacrylamide gel, the resulting 50 bp fragment is cut out, isolated from the gel with QIAquick gel extraction kit (Qiagen) and resuspended in 50 μl of 10 mM Tris (pH 8). .. Removal of biotinylated products : The cleaned product is heated to 95°C, and 50 μl of streptavidin-coated magnetic beads were added (SPHERO™ Streptavidin Magnetic Particles from Spherotech, Inc., Libertyville, IL).

    Mutagenesis:

    Article Title: Effects of Diet on Resource Utilization by a Model Human Gut Microbiota Containing Bacteroides cellulosilyticus WH2, a Symbiont with an Extensive Glycobiome
    Article Snippet: The resulting library consisted of 93,458 distinct isogenic mutants, with each mutant strain containing a single randomly inserted modified mariner transposon. .. 500 ng of each fecal DNA extraction was diluted in 15 µL of TE buffer and digested with MmeI (4 U, New England Biolabs) in a 20 µL reaction supplemented with 10 pmoles of 12 bp DNA containing an MmeI restriction site (to improve the efficiency of restriction enzyme digestion) .

    Article Title: Structure of Type IIL Restriction-Modification Enzyme MmeI in Complex with DNA Has Implications for Engineering New Specificities
    Article Snippet: .. DNA Cleavage Assay Endonuclease activity was assayed by incubating various amounts of MmeI (wt or mutant) enzyme for 30 min at 37°C in NEBuffer 4 (20 mM Tris-acetate, pH 7.9, 10 mM magnesium acetate, 50 mM potassium acetate, 1 mM DTT) supplemented with AdoMet at 80 μM, containing 1 μg substrate DNA per 50 μl. .. Reactions were terminated by the addition of loading dye (NEB B7024) and reaction products were analyzed by gel electrophoresis in 1% LE agarose gels.

    Isolation:

    Article Title: Primer Extension Enrichment Reaction (PEER): a new subtraction method for identification of genetic differences between biological specimens
    Article Snippet: .. MmeI digestion : The ligation products are digested with 5 U MmeI (NEB) for 2 h. The cleaved DNA is resolved in 10% polyacrylamide gel, the resulting 50 bp fragment is cut out, isolated from the gel with QIAquick gel extraction kit (Qiagen) and resuspended in 50 μl of 10 mM Tris (pH 8). .. Blocking of MmeI-tagged primers : 25 μl Of the fragment is used as primer with 10 μl Driver bio-dsDNA template in the presence of 2.5 mM each ddNTPs-bio (Biotin-11-ddNTPs, NEN® Life Science Products Inc., Boston, MA), 0.025 mM each dNTPs (Roche) and Thermo Sequenase™ (Amersham Pharmacia Biotech, Inc., Piscataway, NJ).

    Article Title: Genome-wide identification of histone H2A and histone variant H2A.Z-interacting proteins by bPPI-seq
    Article Snippet: Following ligation of a pair of top-Phops-oligo-17bp/T7Mme I-18bp adaptors, fragments between 250 and 650 bp were isolated from agarose gel. .. Then the DNA was amplified by MmeI-SD-1, MmeI-SD-2, MmeI-SD-3 and T7 primers to add a Mme I recognition site at both ends, followed by digestion with Mme I (New England Biolabs).

    Article Title: 5'-Serial Analysis of Gene Expression studies reveal a transcriptomic switch during fruiting body development in Coprinopsis cinerea
    Article Snippet: Ditag formation Total RNA was extracted by TRI® reagent (Molecular Research Center, Inc) and Poly(A)+ mRNA was furthered isolated using the PolyATract® mRNA isolation system (Promega). .. The cDNAs were digested by 10units of Mme I (New England Biolabs) at 37°C for 2 hours.

    Article Title: Zebrafish bmp4 functions during late gastrulation to specify ventroposterior cell fates
    Article Snippet: Genomic DNA was isolated from pools of 40 st37 / st37 , st37 /+, and +/+ embryos at 5dpf with a Qiagen DNeasy kit. .. 10 ug of the genomic DNA was digested with BstXI, PsiI, HpyCHIV, NheI, SmlI, SfcI, MmeI, BspMI, or BssSI (NEB), run on a 1% agarose gel, and then transferred to a charged nylon membrane (Hybond-N+, Amersham Biosciences).

    Article Title: Development and application of a recombination-based library versus library high- throughput yeast two-hybrid (RLL-Y2H) screening system
    Article Snippet: High-throughput DNA library construction Amplify the recombinated bait and prey fragments using the isolated integrated plasmids from the pooled positive colonies and amplify for 18–20 cycles. .. Digest the purified PCR products with MmeI (NEB, CA) which yields a ∼110 bp target band, followed by low-melting gel purification.

    Labeling:

    Article Title: Zebrafish bmp4 functions during late gastrulation to specify ventroposterior cell fates
    Article Snippet: 10 ug of the genomic DNA was digested with BstXI, PsiI, HpyCHIV, NheI, SmlI, SfcI, MmeI, BspMI, or BssSI (NEB), run on a 1% agarose gel, and then transferred to a charged nylon membrane (Hybond-N+, Amersham Biosciences). .. Probes were amplified from genomic DNA (5′ probe: 5′-CCGCTGATAAATAAGAGACTAAGC-3′ and 5′-GCTTTAAGCATAATCTGAAATCACTC-3′, 667bp; 3′probe: 5′-ACACCGTGCGCATCTCTT-3′ and 5′-GGCTGCTAATATGATTTCCCTGT-3′, 579bp) and radioactively labeled with the Rediprime II Random Prime Labelling System (Amersham Biosciences).

    Purification:

    Article Title: Primer Extension Enrichment Reaction (PEER): a new subtraction method for identification of genetic differences between biological specimens
    Article Snippet: The ligation products are purified to remove the T4 ligase and buffer with QIAquick nucleotide removal column and eluted in 55 μl of 10 mM Tris (pH 8). .. MmeI digestion : The ligation products are digested with 5 U MmeI (NEB) for 2 h. The cleaved DNA is resolved in 10% polyacrylamide gel, the resulting 50 bp fragment is cut out, isolated from the gel with QIAquick gel extraction kit (Qiagen) and resuspended in 50 μl of 10 mM Tris (pH 8).

    Article Title: Genome-wide identification of histone H2A and histone variant H2A.Z-interacting proteins by bPPI-seq
    Article Snippet: Purified RNAs were reverse transcribed using PrimeScript Reverse Transcriptase (Takara) with a PolyT primer. .. Then the DNA was amplified by MmeI-SD-1, MmeI-SD-2, MmeI-SD-3 and T7 primers to add a Mme I recognition site at both ends, followed by digestion with Mme I (New England Biolabs).

    Article Title: Targeted and genome-scale methylomics reveals gene body signatures in human cell lines
    Article Snippet: This was incubated at 50°C for 20 min, then 85°C for 20 min. Ethanol precipitation was performed again, and the pellet was resuspended to 50ul with a reaction mixture containing 2 units Mme I (NEB), 50 µM SAM and 1× NEBuffer 4. .. The mixture was run on a 6% non-denaturing TBE polyacrylamide gel (Invitrogen) and the target band at ~140 bp was purified.

    Article Title: 5'-Serial Analysis of Gene Expression studies reveal a transcriptomic switch during fruiting body development in Coprinopsis cinerea
    Article Snippet: Double-stranded cDNA was purified by QIAquick PCR purification kit (Qiagen) and checked by electrophoresis on a 1.5% agarose gel. .. The cDNAs were digested by 10units of Mme I (New England Biolabs) at 37°C for 2 hours.

    Article Title: Effects of Diet on Resource Utilization by a Model Human Gut Microbiota Containing Bacteroides cellulosilyticus WH2, a Symbiont with an Extensive Glycobiome
    Article Snippet: 500 ng of each fecal DNA extraction was diluted in 15 µL of TE buffer and digested with MmeI (4 U, New England Biolabs) in a 20 µL reaction supplemented with 10 pmoles of 12 bp DNA containing an MmeI restriction site (to improve the efficiency of restriction enzyme digestion) . .. MmeI-digested DNA was subsequently purified using 125 µL of AMPure beads (after washing the beads once with 100 µL of sizing solution (1.2 M NaCl and 8.4% PEG 8000)).

    Article Title: Generating high accuracy peptide binding data in high throughput with yeast surface display and SORTCERY
    Article Snippet: .. Zymoprep Yeast Plasmid Miniprep I (Zymo Research) Isopropanole High-Fidelity DNA Polymerase (e.g. Phusion) Thermocycler Gel equipment PCR purification and gel extraction kits (QiaGen) MmeI (New England Biolabs): MmeI restriction enzyme, NEB Cut Smart Buffer, 1 mM SAM T4 Ligase Primers and oligos .. Dilute cells to OD600 of 0.05 in SD + CAA and grow for 8 h at 30 °C.

    Article Title: Development and application of a recombination-based library versus library high- throughput yeast two-hybrid (RLL-Y2H) screening system
    Article Snippet: .. Digest the purified PCR products with MmeI (NEB, CA) which yields a ∼110 bp target band, followed by low-melting gel purification. .. Prepare Illumina P5 and P7 adapters by annealing overhang NN-nucleotides P5: 5′-ACACTCTTTCCCTACACGACGCTCTTCCGATCTNN-3′ and 5′-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT-3′; P7: 5′-GATCGGAAGAGCACACGTCTGAACTCCAGTCAC-3′ and 5′-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCNN-3′, respectively.

    Sequencing:

    Article Title: Genome-wide identification of histone H2A and histone variant H2A.Z-interacting proteins by bPPI-seq
    Article Snippet: Paragraph title: bPPI-seq library preparation and sequencing ... Then the DNA was amplified by MmeI-SD-1, MmeI-SD-2, MmeI-SD-3 and T7 primers to add a Mme I recognition site at both ends, followed by digestion with Mme I (New England Biolabs).

    Article Title: Effects of Diet on Resource Utilization by a Model Human Gut Microbiota Containing Bacteroides cellulosilyticus WH2, a Symbiont with an Extensive Glycobiome
    Article Snippet: Paragraph title: Identification of Diet-Specific Fitness Determinants within the B. cellulosilyticus WH2 Genome Using Insertion Sequencing (INSeq) ... 500 ng of each fecal DNA extraction was diluted in 15 µL of TE buffer and digested with MmeI (4 U, New England Biolabs) in a 20 µL reaction supplemented with 10 pmoles of 12 bp DNA containing an MmeI restriction site (to improve the efficiency of restriction enzyme digestion) .

    Article Title: Generating high accuracy peptide binding data in high throughput with yeast surface display and SORTCERY
    Article Snippet: Paragraph title: 2.3 Deep Sequencing Sample Preparation (see ) ... Zymoprep Yeast Plasmid Miniprep I (Zymo Research) Isopropanole High-Fidelity DNA Polymerase (e.g. Phusion) Thermocycler Gel equipment PCR purification and gel extraction kits (QiaGen) MmeI (New England Biolabs): MmeI restriction enzyme, NEB Cut Smart Buffer, 1 mM SAM T4 Ligase Primers and oligos

    Article Title: Development and application of a recombination-based library versus library high- throughput yeast two-hybrid (RLL-Y2H) screening system
    Article Snippet: Digest the purified PCR products with MmeI (NEB, CA) which yields a ∼110 bp target band, followed by low-melting gel purification. .. Add P5 and P7 adapters to purified 110bp fragments by T4 ligation at 16°C for more than 2 h. Amplify the ligation products using primers (5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ and 5′-CAAGCAGAAGACGGCATACGAGAT(index)GTGACTGGAGTTCAGACGTGTGCTC TTCCGATC-3′) to construct high-throughput sequencing library.

    Quantitative RT-PCR:

    Article Title: 5'-Serial Analysis of Gene Expression studies reveal a transcriptomic switch during fruiting body development in Coprinopsis cinerea
    Article Snippet: First strand cDNA was synthesized using SuperScript™ III First-Strand Synthesis System for qRT-PCR (Invitrogen). .. The cDNAs were digested by 10units of Mme I (New England Biolabs) at 37°C for 2 hours.

    Agarose Gel Electrophoresis:

    Article Title: Genome-wide identification of histone H2A and histone variant H2A.Z-interacting proteins by bPPI-seq
    Article Snippet: Following ligation of a pair of top-Phops-oligo-17bp/T7Mme I-18bp adaptors, fragments between 250 and 650 bp were isolated from agarose gel. .. Then the DNA was amplified by MmeI-SD-1, MmeI-SD-2, MmeI-SD-3 and T7 primers to add a Mme I recognition site at both ends, followed by digestion with Mme I (New England Biolabs).

    Article Title: 5'-Serial Analysis of Gene Expression studies reveal a transcriptomic switch during fruiting body development in Coprinopsis cinerea
    Article Snippet: Double-stranded cDNA was purified by QIAquick PCR purification kit (Qiagen) and checked by electrophoresis on a 1.5% agarose gel. .. The cDNAs were digested by 10units of Mme I (New England Biolabs) at 37°C for 2 hours.

    Article Title: Zebrafish bmp4 functions during late gastrulation to specify ventroposterior cell fates
    Article Snippet: .. 10 ug of the genomic DNA was digested with BstXI, PsiI, HpyCHIV, NheI, SmlI, SfcI, MmeI, BspMI, or BssSI (NEB), run on a 1% agarose gel, and then transferred to a charged nylon membrane (Hybond-N+, Amersham Biosciences). .. Probes were amplified from genomic DNA (5′ probe: 5′-CCGCTGATAAATAAGAGACTAAGC-3′ and 5′-GCTTTAAGCATAATCTGAAATCACTC-3′, 667bp; 3′probe: 5′-ACACCGTGCGCATCTCTT-3′ and 5′-GGCTGCTAATATGATTTCCCTGT-3′, 579bp) and radioactively labeled with the Rediprime II Random Prime Labelling System (Amersham Biosciences).

    Article Title: Development and application of a recombination-based library versus library high- throughput yeast two-hybrid (RLL-Y2H) screening system
    Article Snippet: A smear band should be visible on agarose gel. .. Digest the purified PCR products with MmeI (NEB, CA) which yields a ∼110 bp target band, followed by low-melting gel purification.

    Mouse Assay:

    Article Title: Effects of Diet on Resource Utilization by a Model Human Gut Microbiota Containing Bacteroides cellulosilyticus WH2, a Symbiont with an Extensive Glycobiome
    Article Snippet: At 11 wk of age, male germ-free C57BL/6J mice (individually caged) were fed either a diet low in fat and rich in plant polysaccharides (LF/HPP) or high in fat and simple sugars (HF/HS). .. 500 ng of each fecal DNA extraction was diluted in 15 µL of TE buffer and digested with MmeI (4 U, New England Biolabs) in a 20 µL reaction supplemented with 10 pmoles of 12 bp DNA containing an MmeI restriction site (to improve the efficiency of restriction enzyme digestion) .

    Plasmid Preparation:

    Article Title: Generating high accuracy peptide binding data in high throughput with yeast surface display and SORTCERY
    Article Snippet: .. Zymoprep Yeast Plasmid Miniprep I (Zymo Research) Isopropanole High-Fidelity DNA Polymerase (e.g. Phusion) Thermocycler Gel equipment PCR purification and gel extraction kits (QiaGen) MmeI (New England Biolabs): MmeI restriction enzyme, NEB Cut Smart Buffer, 1 mM SAM T4 Ligase Primers and oligos .. Dilute cells to OD600 of 0.05 in SD + CAA and grow for 8 h at 30 °C.

    Sample Prep:

    Article Title: Genome-wide identification of histone H2A and histone variant H2A.Z-interacting proteins by bPPI-seq
    Article Snippet: Then the DNA was amplified by MmeI-SD-1, MmeI-SD-2, MmeI-SD-3 and T7 primers to add a Mme I recognition site at both ends, followed by digestion with Mme I (New England Biolabs). .. After treatment with Klenow Enzyme (New England Biolabs), indexed libraries were prepared with a Multiplexing Sample Preparation Oligonucleotide Kit (Illumina) according to the user's manual.

    Article Title: Generating high accuracy peptide binding data in high throughput with yeast surface display and SORTCERY
    Article Snippet: Paragraph title: 2.3 Deep Sequencing Sample Preparation (see ) ... Zymoprep Yeast Plasmid Miniprep I (Zymo Research) Isopropanole High-Fidelity DNA Polymerase (e.g. Phusion) Thermocycler Gel equipment PCR purification and gel extraction kits (QiaGen) MmeI (New England Biolabs): MmeI restriction enzyme, NEB Cut Smart Buffer, 1 mM SAM T4 Ligase Primers and oligos

    Ethanol Precipitation:

    Article Title: Targeted and genome-scale methylomics reveals gene body signatures in human cell lines
    Article Snippet: .. This was incubated at 50°C for 20 min, then 85°C for 20 min. Ethanol precipitation was performed again, and the pellet was resuspended to 50ul with a reaction mixture containing 2 units Mme I (NEB), 50 µM SAM and 1× NEBuffer 4. .. This was incubated at 37°C for 2 hours, then 80°C for 20 min. To this was added 1.66 µl of 10 µM adapter B, 6 µl 10mM ATP, and 3 µl T4 DNA ligase, and the mixture was incubated at 16°C for 4 hours, then 65°C for 15 min.

    Article Title: 5'-Serial Analysis of Gene Expression studies reveal a transcriptomic switch during fruiting body development in Coprinopsis cinerea
    Article Snippet: The cDNAs were digested by 10units of Mme I (New England Biolabs) at 37°C for 2 hours. .. Following ethanol precipitation with ammonium acetate at −70°C for 4 h, pellets were collected and resuspended in low-salt TE buffer.

    Next-Generation Sequencing:

    Article Title: Genome-wide identification of histone H2A and histone variant H2A.Z-interacting proteins by bPPI-seq
    Article Snippet: Then the DNA was amplified by MmeI-SD-1, MmeI-SD-2, MmeI-SD-3 and T7 primers to add a Mme I recognition site at both ends, followed by digestion with Mme I (New England Biolabs). .. The fragments between 250 and 500 bp were isolated for sequencing on an Illumina next-generation sequencing platform.

    Construct:

    Article Title: Targeted and genome-scale methylomics reveals gene body signatures in human cell lines
    Article Snippet: To construct the MSCC Hpa II library, 2 µg of PGP 1 lymphocyte gDNA were assembled into a 100 µl reaction with 20 units Hpa II (NEB) in 1× NEBuffer 1, incubated at 37°C 2 hours, then 65°C 20 min. To this was added 1.66 µl of 10 µM adapter A, 12 µl 10 mM ATP, and 120 units T4 DNA ligase (NEB). .. This was incubated at 50°C for 20 min, then 85°C for 20 min. Ethanol precipitation was performed again, and the pellet was resuspended to 50ul with a reaction mixture containing 2 units Mme I (NEB), 50 µM SAM and 1× NEBuffer 4.

    Article Title: Development and application of a recombination-based library versus library high- throughput yeast two-hybrid (RLL-Y2H) screening system
    Article Snippet: Digest the purified PCR products with MmeI (NEB, CA) which yields a ∼110 bp target band, followed by low-melting gel purification. .. Add P5 and P7 adapters to purified 110bp fragments by T4 ligation at 16°C for more than 2 h. Amplify the ligation products using primers (5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ and 5′-CAAGCAGAAGACGGCATACGAGAT(index)GTGACTGGAGTTCAGACGTGTGCTC TTCCGATC-3′) to construct high-throughput sequencing library.

    High Throughput Screening Assay:

    Article Title: Development and application of a recombination-based library versus library high- throughput yeast two-hybrid (RLL-Y2H) screening system
    Article Snippet: Paragraph title: High-throughput DNA library construction ... Digest the purified PCR products with MmeI (NEB, CA) which yields a ∼110 bp target band, followed by low-melting gel purification.

    Gel Extraction:

    Article Title: Primer Extension Enrichment Reaction (PEER): a new subtraction method for identification of genetic differences between biological specimens
    Article Snippet: .. MmeI digestion : The ligation products are digested with 5 U MmeI (NEB) for 2 h. The cleaved DNA is resolved in 10% polyacrylamide gel, the resulting 50 bp fragment is cut out, isolated from the gel with QIAquick gel extraction kit (Qiagen) and resuspended in 50 μl of 10 mM Tris (pH 8). .. Blocking of MmeI-tagged primers : 25 μl Of the fragment is used as primer with 10 μl Driver bio-dsDNA template in the presence of 2.5 mM each ddNTPs-bio (Biotin-11-ddNTPs, NEN® Life Science Products Inc., Boston, MA), 0.025 mM each dNTPs (Roche) and Thermo Sequenase™ (Amersham Pharmacia Biotech, Inc., Piscataway, NJ).

    Article Title: Generating high accuracy peptide binding data in high throughput with yeast surface display and SORTCERY
    Article Snippet: .. Zymoprep Yeast Plasmid Miniprep I (Zymo Research) Isopropanole High-Fidelity DNA Polymerase (e.g. Phusion) Thermocycler Gel equipment PCR purification and gel extraction kits (QiaGen) MmeI (New England Biolabs): MmeI restriction enzyme, NEB Cut Smart Buffer, 1 mM SAM T4 Ligase Primers and oligos .. Dilute cells to OD600 of 0.05 in SD + CAA and grow for 8 h at 30 °C.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs mmei
    Primer Extension Enrichment Reaction (PEER). ( A ) Generation of dsDNA from total Nucleic Acid. (1) Tester NA (white and gray rectangle) is split in two aliquots and denatured; Driver NA (white rectangle) is denatured as well. (2) Single strands are reverse transcribed (RT) by Super Script RT with three different primers—AFMmeIN6 * for the first Tester aliquot, T2N6 (diagonal fill rectangle) for the second aliquot and D0N6 (red rectangle) for the Driver. (3) The reverse transcriptase switches templates and copies the annealed SMART primers (SMART technology, Clontech). (4) The RT products are amplified with Advantage2 Polymerase to yield Tester1 dsDNA with primers AMmeIPCR (black rectangle), Tester23 dsDNA with T3PCR (vertical fill rectangle) and T2PCR (diagonal fill rectangle) and Driver bio-dsDNA with D0bioPCR biotinylated at the 5′ end (red rectangle with red circle). ( B ) Processing of Tester1 dsDNA. (1) The <t>DNA</t> is cleaved by a cocktail of restriction enzymes that leave 3′ GC protruding ends. (2) The ends are treated with the Klenow fragment of DNA Polymerase I in the presence of dCTP only and then ligated to AMmeIAdapter. (3) The tagged fragments are cut to uniform size by <t>MmeI</t> to create multiple AMmeIPrimers. ( C ) Blocking reaction. (1) AMmeIPrimers generated from Tester1 dsDNA are extended on Driver bio-dsDNA template in the presence of biotinylated ddNTPs (red circles) and ThermoSequenase™. (2) Biotinylated molecules are captured with streptavidin-coated magnetic beads (white crescent with gray bar) and removed from the reaction. ( D ) Retrieval of targets of interest from the Tester23 dsDNA. (1) Capture PCR—AMmeIPrimers that were not blocked and removed in the preceding steps are added to Tester23 dsDNA and in the presence of regular dNTP are annealed and extended to capture the targets of interest. (2) Regular PCR amplification of the capture products with different primer combinations. Black rectangles, primers AFMmeIN6, AFMmeISMART, AMmeIPCR, AMmeIAdapter.
    Mmei, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mmei/product/New England Biolabs
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    mmei - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    87
    New England Biolabs mmei site
    <t>MmeI</t> cleaves the two DNA strands at one site simultaneously. ( A ) Time course of MmeI digestion of supercoiled <t>pUC19</t> DNA (2 U/μg) for 10 s, 20 s, 30 s, 1, 3 10, 20, 30 and 60 min. Supercoiled plasmid (sc) is converted directly to linear (lin) DNA, with no accumulation of open circular DNA (oc). ‘A+B cut’ indicates the 184-bp product of MmeI cleavage at both pUC19 sites. ( B ) MmeI digestion of linear pUC19 DNA (previously cut with PstI), in a 2-fold serial dilution from 8 to 0.03 U/μg. MmeI cuts at a one site, forming products from either site A or site B, before forming product from cleavage at both sites (A+B). ‘lin’ indicates linear pUC19, ‘A-R’ and ‘A-L’ indicate the cleavage products from MmeI cutting at the 996 site, ‘B-R’ and ‘B-L’ indicate the cleavage products from MmeI cutting at the 1180 site, while ‘A+B’ indicates the cleavage product from MmeI cutting at both sites.
    Mmei Site, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 87/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mmei site/product/New England Biolabs
    Average 87 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    mmei site - by Bioz Stars, 2020-04
    87/100 stars
      Buy from Supplier

    Image Search Results


    Primer Extension Enrichment Reaction (PEER). ( A ) Generation of dsDNA from total Nucleic Acid. (1) Tester NA (white and gray rectangle) is split in two aliquots and denatured; Driver NA (white rectangle) is denatured as well. (2) Single strands are reverse transcribed (RT) by Super Script RT with three different primers—AFMmeIN6 * for the first Tester aliquot, T2N6 (diagonal fill rectangle) for the second aliquot and D0N6 (red rectangle) for the Driver. (3) The reverse transcriptase switches templates and copies the annealed SMART primers (SMART technology, Clontech). (4) The RT products are amplified with Advantage2 Polymerase to yield Tester1 dsDNA with primers AMmeIPCR (black rectangle), Tester23 dsDNA with T3PCR (vertical fill rectangle) and T2PCR (diagonal fill rectangle) and Driver bio-dsDNA with D0bioPCR biotinylated at the 5′ end (red rectangle with red circle). ( B ) Processing of Tester1 dsDNA. (1) The DNA is cleaved by a cocktail of restriction enzymes that leave 3′ GC protruding ends. (2) The ends are treated with the Klenow fragment of DNA Polymerase I in the presence of dCTP only and then ligated to AMmeIAdapter. (3) The tagged fragments are cut to uniform size by MmeI to create multiple AMmeIPrimers. ( C ) Blocking reaction. (1) AMmeIPrimers generated from Tester1 dsDNA are extended on Driver bio-dsDNA template in the presence of biotinylated ddNTPs (red circles) and ThermoSequenase™. (2) Biotinylated molecules are captured with streptavidin-coated magnetic beads (white crescent with gray bar) and removed from the reaction. ( D ) Retrieval of targets of interest from the Tester23 dsDNA. (1) Capture PCR—AMmeIPrimers that were not blocked and removed in the preceding steps are added to Tester23 dsDNA and in the presence of regular dNTP are annealed and extended to capture the targets of interest. (2) Regular PCR amplification of the capture products with different primer combinations. Black rectangles, primers AFMmeIN6, AFMmeISMART, AMmeIPCR, AMmeIAdapter.

    Journal: Nucleic Acids Research

    Article Title: Primer Extension Enrichment Reaction (PEER): a new subtraction method for identification of genetic differences between biological specimens

    doi: 10.1093/nar/gkl391

    Figure Lengend Snippet: Primer Extension Enrichment Reaction (PEER). ( A ) Generation of dsDNA from total Nucleic Acid. (1) Tester NA (white and gray rectangle) is split in two aliquots and denatured; Driver NA (white rectangle) is denatured as well. (2) Single strands are reverse transcribed (RT) by Super Script RT with three different primers—AFMmeIN6 * for the first Tester aliquot, T2N6 (diagonal fill rectangle) for the second aliquot and D0N6 (red rectangle) for the Driver. (3) The reverse transcriptase switches templates and copies the annealed SMART primers (SMART technology, Clontech). (4) The RT products are amplified with Advantage2 Polymerase to yield Tester1 dsDNA with primers AMmeIPCR (black rectangle), Tester23 dsDNA with T3PCR (vertical fill rectangle) and T2PCR (diagonal fill rectangle) and Driver bio-dsDNA with D0bioPCR biotinylated at the 5′ end (red rectangle with red circle). ( B ) Processing of Tester1 dsDNA. (1) The DNA is cleaved by a cocktail of restriction enzymes that leave 3′ GC protruding ends. (2) The ends are treated with the Klenow fragment of DNA Polymerase I in the presence of dCTP only and then ligated to AMmeIAdapter. (3) The tagged fragments are cut to uniform size by MmeI to create multiple AMmeIPrimers. ( C ) Blocking reaction. (1) AMmeIPrimers generated from Tester1 dsDNA are extended on Driver bio-dsDNA template in the presence of biotinylated ddNTPs (red circles) and ThermoSequenase™. (2) Biotinylated molecules are captured with streptavidin-coated magnetic beads (white crescent with gray bar) and removed from the reaction. ( D ) Retrieval of targets of interest from the Tester23 dsDNA. (1) Capture PCR—AMmeIPrimers that were not blocked and removed in the preceding steps are added to Tester23 dsDNA and in the presence of regular dNTP are annealed and extended to capture the targets of interest. (2) Regular PCR amplification of the capture products with different primer combinations. Black rectangles, primers AFMmeIN6, AFMmeISMART, AMmeIPCR, AMmeIAdapter.

    Article Snippet: MmeI digestion : The ligation products are digested with 5 U MmeI (NEB) for 2 h. The cleaved DNA is resolved in 10% polyacrylamide gel, the resulting 50 bp fragment is cut out, isolated from the gel with QIAquick gel extraction kit (Qiagen) and resuspended in 50 μl of 10 mM Tris (pH 8).

    Techniques: Amplification, Blocking Assay, Generated, Magnetic Beads, Polymerase Chain Reaction

    Schematic overview of droplet Tn-Seq. a A microfluidic device encapsulates single bacterial cells into droplets containing growth medium. Bacteria are allowed to grow within droplets, genomic DNA (gDNA) is isolated at the start of the experiment (t1) and after growth (t2). Importantly, while growth for each transposon mutant takes place in isolation, gDNA is isolated from the pooled population, enabling screening of all mutants simultaneously. b gDNA is then amplified with DNA polymerase phi29, digested with MmeI, an adapter is ligated, a ~180 bp fragment is produced which contains ~16 nucleotides of bacterial gDNA, defining the transposon-insertion location, followed by Illumina sequencing. Reads are demultiplexed based on the barcode in the adapter and a potential second barcode in primer 1, mapped to the genome, and fitness is calculated for each defined region.

    Journal: Nature Communications

    Article Title: Droplet Tn-Seq combines microfluidics with Tn-Seq for identifying complex single-cell phenotypes

    doi: 10.1038/s41467-019-13719-9

    Figure Lengend Snippet: Schematic overview of droplet Tn-Seq. a A microfluidic device encapsulates single bacterial cells into droplets containing growth medium. Bacteria are allowed to grow within droplets, genomic DNA (gDNA) is isolated at the start of the experiment (t1) and after growth (t2). Importantly, while growth for each transposon mutant takes place in isolation, gDNA is isolated from the pooled population, enabling screening of all mutants simultaneously. b gDNA is then amplified with DNA polymerase phi29, digested with MmeI, an adapter is ligated, a ~180 bp fragment is produced which contains ~16 nucleotides of bacterial gDNA, defining the transposon-insertion location, followed by Illumina sequencing. Reads are demultiplexed based on the barcode in the adapter and a potential second barcode in primer 1, mapped to the genome, and fitness is calculated for each defined region.

    Article Snippet: Beads were then dried for 3 min at room temperature, and DNA was eluted off the beads with 12.7 μl of dH2 O. (3) In all, 11.49 μl of phi29 amplified DNA was then added to a MmeI digestion mix (two units NEB MmeI enzyme, 50 μM SAM, 1× CutSmart Buffer) in a total volume of 20 μl, and incubated for 2.5 h at 37 °C followed by 20 min at 65 °C. (4) In all, 1 μl of alkaline phosphatase (NEB - M0290S Calf Intestinal, CIP) was added to the sample and incubated for 1 h at 37 °C. (5) In total, 10 μl of magnetic beads plus 20 μl PEG solution per sample were used to wash the sample followed by elution in 14.3 μl of dH2 O. (6) T4 DNA ligase (NEB M0202L) was used to ligate DNA adapter barcodes by adding 13.12 μl DNA to 1 μl of 1:5 diluted adapter, 1× T4 DNA Ligase Reaction Buffer, and 400 units T4 DNA ligase, followed by incubation at 16 °C for 16 h, 65 °C for 10 min, and held at 10 °C. (7) In all, 10 μl magnetic beads plus 20 μl PEG solution were used to wash the sample followed by elution in 36 μl of dH2 O. (8) Adapter ligated DNA was then PCR amplified using Q5 high-fidelity DNA polymerase (NEB – M0491L) by adding 34 μl of DNA to 1X Q5 reaction buffer, 10 mM dNTPs, 0.45 μM of each primer (P1-M6-GAT-MmeI; P2-ADPT-Tnseq-primer; Supplementary Data ), one unit Q5 DNA polymerase, and incubated at 98 °C for 30 s, and 18–22 cycles of 98 °C for 10 s, 62 °C for 30 s, 72 °C for 15 s, followed by 72 °C for 2 min, and a 10 °C hold. (9) PCR products were gel purified and sequenced on an Illumina NextSeq 500 according to the manufacturer's protocol.

    Techniques: Isolation, Mutagenesis, Amplification, Produced, Sequencing

    Unbiased whole-genome amplification of low-quantity genomic DNA. a , b gDNA was prepared by two different methods for transposon sequencing. For the WGA sample, 10 ng of gDNA was amplified first with DNA polymerase phi29 before MmeI digestion and adapter ligation. For the standard sample, 1 μg of gDNA was digested with MmeI, followed by adapter ligation. There is a strong correlation between fitness values obtained from WGA preparation compared with standard Tn-Seq library preparation a , and WGA preparation is highly reproducible b .

    Journal: Nature Communications

    Article Title: Droplet Tn-Seq combines microfluidics with Tn-Seq for identifying complex single-cell phenotypes

    doi: 10.1038/s41467-019-13719-9

    Figure Lengend Snippet: Unbiased whole-genome amplification of low-quantity genomic DNA. a , b gDNA was prepared by two different methods for transposon sequencing. For the WGA sample, 10 ng of gDNA was amplified first with DNA polymerase phi29 before MmeI digestion and adapter ligation. For the standard sample, 1 μg of gDNA was digested with MmeI, followed by adapter ligation. There is a strong correlation between fitness values obtained from WGA preparation compared with standard Tn-Seq library preparation a , and WGA preparation is highly reproducible b .

    Article Snippet: Beads were then dried for 3 min at room temperature, and DNA was eluted off the beads with 12.7 μl of dH2 O. (3) In all, 11.49 μl of phi29 amplified DNA was then added to a MmeI digestion mix (two units NEB MmeI enzyme, 50 μM SAM, 1× CutSmart Buffer) in a total volume of 20 μl, and incubated for 2.5 h at 37 °C followed by 20 min at 65 °C. (4) In all, 1 μl of alkaline phosphatase (NEB - M0290S Calf Intestinal, CIP) was added to the sample and incubated for 1 h at 37 °C. (5) In total, 10 μl of magnetic beads plus 20 μl PEG solution per sample were used to wash the sample followed by elution in 14.3 μl of dH2 O. (6) T4 DNA ligase (NEB M0202L) was used to ligate DNA adapter barcodes by adding 13.12 μl DNA to 1 μl of 1:5 diluted adapter, 1× T4 DNA Ligase Reaction Buffer, and 400 units T4 DNA ligase, followed by incubation at 16 °C for 16 h, 65 °C for 10 min, and held at 10 °C. (7) In all, 10 μl magnetic beads plus 20 μl PEG solution were used to wash the sample followed by elution in 36 μl of dH2 O. (8) Adapter ligated DNA was then PCR amplified using Q5 high-fidelity DNA polymerase (NEB – M0491L) by adding 34 μl of DNA to 1X Q5 reaction buffer, 10 mM dNTPs, 0.45 μM of each primer (P1-M6-GAT-MmeI; P2-ADPT-Tnseq-primer; Supplementary Data ), one unit Q5 DNA polymerase, and incubated at 98 °C for 30 s, and 18–22 cycles of 98 °C for 10 s, 62 °C for 30 s, 72 °C for 15 s, followed by 72 °C for 2 min, and a 10 °C hold. (9) PCR products were gel purified and sequenced on an Illumina NextSeq 500 according to the manufacturer's protocol.

    Techniques: Whole Genome Amplification, Sequencing, Amplification, Ligation

    Proof-of-principle experiment of RLL-Y2H system. ( A ) Positive control interacting protein pair, murine p53 and SV40 T-antigen were inserted into mBD and mAD of RLL-Y2H system and were transformed into yeast respectively. Only the yeasts containing both p53 and SV40 T-antigen but not the controls can grow on SD/-AHL T selection plates. ( B ) After plasmid extraction from yeast, p53, SV40 T-antigen and their recombinated fragments were amplified by PCR. ( C ) Sanger sequencing of the recombinated p53 and SV40 T-antigen fragments. The linker ATTL and MmeI sites were highlighted. ( D ) The PCR products of the recombinated p53 and SV40 T-antigen fragments before (left panel) and after (right panel) MmeI digestion.

    Journal: Nucleic Acids Research

    Article Title: Development and application of a recombination-based library versus library high- throughput yeast two-hybrid (RLL-Y2H) screening system

    doi: 10.1093/nar/gkx1173

    Figure Lengend Snippet: Proof-of-principle experiment of RLL-Y2H system. ( A ) Positive control interacting protein pair, murine p53 and SV40 T-antigen were inserted into mBD and mAD of RLL-Y2H system and were transformed into yeast respectively. Only the yeasts containing both p53 and SV40 T-antigen but not the controls can grow on SD/-AHL T selection plates. ( B ) After plasmid extraction from yeast, p53, SV40 T-antigen and their recombinated fragments were amplified by PCR. ( C ) Sanger sequencing of the recombinated p53 and SV40 T-antigen fragments. The linker ATTL and MmeI sites were highlighted. ( D ) The PCR products of the recombinated p53 and SV40 T-antigen fragments before (left panel) and after (right panel) MmeI digestion.

    Article Snippet: Digest the purified PCR products with MmeI (NEB, CA) which yields a ∼110 bp target band, followed by low-melting gel purification.

    Techniques: Positive Control, Transformation Assay, Selection, Plasmid Preparation, Amplification, Polymerase Chain Reaction, Sequencing

    MmeI cleaves the two DNA strands at one site simultaneously. ( A ) Time course of MmeI digestion of supercoiled pUC19 DNA (2 U/μg) for 10 s, 20 s, 30 s, 1, 3 10, 20, 30 and 60 min. Supercoiled plasmid (sc) is converted directly to linear (lin) DNA, with no accumulation of open circular DNA (oc). ‘A+B cut’ indicates the 184-bp product of MmeI cleavage at both pUC19 sites. ( B ) MmeI digestion of linear pUC19 DNA (previously cut with PstI), in a 2-fold serial dilution from 8 to 0.03 U/μg. MmeI cuts at a one site, forming products from either site A or site B, before forming product from cleavage at both sites (A+B). ‘lin’ indicates linear pUC19, ‘A-R’ and ‘A-L’ indicate the cleavage products from MmeI cutting at the 996 site, ‘B-R’ and ‘B-L’ indicate the cleavage products from MmeI cutting at the 1180 site, while ‘A+B’ indicates the cleavage product from MmeI cutting at both sites.

    Journal: Nucleic Acids Research

    Article Title: MmeI: a minimal Type II restriction-modification system that only modifies one DNA strand for host protection

    doi: 10.1093/nar/gkn711

    Figure Lengend Snippet: MmeI cleaves the two DNA strands at one site simultaneously. ( A ) Time course of MmeI digestion of supercoiled pUC19 DNA (2 U/μg) for 10 s, 20 s, 30 s, 1, 3 10, 20, 30 and 60 min. Supercoiled plasmid (sc) is converted directly to linear (lin) DNA, with no accumulation of open circular DNA (oc). ‘A+B cut’ indicates the 184-bp product of MmeI cleavage at both pUC19 sites. ( B ) MmeI digestion of linear pUC19 DNA (previously cut with PstI), in a 2-fold serial dilution from 8 to 0.03 U/μg. MmeI cuts at a one site, forming products from either site A or site B, before forming product from cleavage at both sites (A+B). ‘lin’ indicates linear pUC19, ‘A-R’ and ‘A-L’ indicate the cleavage products from MmeI cutting at the 996 site, ‘B-R’ and ‘B-L’ indicate the cleavage products from MmeI cutting at the 1180 site, while ‘A+B’ indicates the cleavage product from MmeI cutting at both sites.

    Article Snippet: The effect of in vitro MmeI methylation was tested using a plasmid substrate, pMMH1, designed to introduce an MmeI site in the pUC19 polylinker region that overlaps a 5′ MboI site (GATC) and a 3′ HinfI site (GANTC): 5′-… cccgggGATCCGACTCcggtcgac …-3′. pMMH1 was formed from pUC19 using the Phusion Site-Directed Mutagenesis Kit (NEB) with primers 6 and 7.

    Techniques: Plasmid Preparation, Serial Dilution

    ( A ) In vivo MmeI Modification. MmeI endonuclease digestion of purified plasmid DNA from the construct expressing active or inactive MmeI. ‘Active’ is the MmeI expression plasmid, pTBMmeI.1. ‘Inactive’ is a plasmid DNA derived from pTBMmeI.1 that carries a single point mutation (N 773 D) that renders MmeI inactive. Addition of PhiX174 DNA verifies that the added MmeI endonuclease is active in the reaction wherein pTBMmeI.1 DNA is not cut. ( B ) In vitro MmeI modification. pMMH1 DNA from a dam-deficient host, either modified in vitro by MmeI or not modified, digested with MmeI, HinfI or MboI. ( C ) pMMH1 DNA from a dam-proficient host digested with MmeI, MboI and DpnI. M: Size standards: Lambda-HindIII, PhiX174-HaeIII.

    Journal: Nucleic Acids Research

    Article Title: MmeI: a minimal Type II restriction-modification system that only modifies one DNA strand for host protection

    doi: 10.1093/nar/gkn711

    Figure Lengend Snippet: ( A ) In vivo MmeI Modification. MmeI endonuclease digestion of purified plasmid DNA from the construct expressing active or inactive MmeI. ‘Active’ is the MmeI expression plasmid, pTBMmeI.1. ‘Inactive’ is a plasmid DNA derived from pTBMmeI.1 that carries a single point mutation (N 773 D) that renders MmeI inactive. Addition of PhiX174 DNA verifies that the added MmeI endonuclease is active in the reaction wherein pTBMmeI.1 DNA is not cut. ( B ) In vitro MmeI modification. pMMH1 DNA from a dam-deficient host, either modified in vitro by MmeI or not modified, digested with MmeI, HinfI or MboI. ( C ) pMMH1 DNA from a dam-proficient host digested with MmeI, MboI and DpnI. M: Size standards: Lambda-HindIII, PhiX174-HaeIII.

    Article Snippet: The effect of in vitro MmeI methylation was tested using a plasmid substrate, pMMH1, designed to introduce an MmeI site in the pUC19 polylinker region that overlaps a 5′ MboI site (GATC) and a 3′ HinfI site (GANTC): 5′-… cccgggGATCCGACTCcggtcgac …-3′. pMMH1 was formed from pUC19 using the Phusion Site-Directed Mutagenesis Kit (NEB) with primers 6 and 7.

    Techniques: In Vivo, Modification, Purification, Plasmid Preparation, Construct, Expressing, Derivative Assay, Mutagenesis, In Vitro

    Endonuclease digestion of MmeI in vitro modified or unmodified DNA (150-bp PCR product across pMMHI polylinker region) containing a HinfI site overlapping the top strand of the MmeI site: 5′-TCC GACTC -3′ and an MboI site overlapping the bottom strand of the MmeI site: 5′-GTCG GATC -3′. The restriction endonucleases were mixed with buffer, aliquoted into three reactions to which were added MmeI modified DNA, unmodified DNA or both DNAs. Size standard: pBR322-MspI.

    Journal: Nucleic Acids Research

    Article Title: MmeI: a minimal Type II restriction-modification system that only modifies one DNA strand for host protection

    doi: 10.1093/nar/gkn711

    Figure Lengend Snippet: Endonuclease digestion of MmeI in vitro modified or unmodified DNA (150-bp PCR product across pMMHI polylinker region) containing a HinfI site overlapping the top strand of the MmeI site: 5′-TCC GACTC -3′ and an MboI site overlapping the bottom strand of the MmeI site: 5′-GTCG GATC -3′. The restriction endonucleases were mixed with buffer, aliquoted into three reactions to which were added MmeI modified DNA, unmodified DNA or both DNAs. Size standard: pBR322-MspI.

    Article Snippet: The effect of in vitro MmeI methylation was tested using a plasmid substrate, pMMH1, designed to introduce an MmeI site in the pUC19 polylinker region that overlaps a 5′ MboI site (GATC) and a 3′ HinfI site (GANTC): 5′-… cccgggGATCCGACTCcggtcgac …-3′. pMMH1 was formed from pUC19 using the Phusion Site-Directed Mutagenesis Kit (NEB) with primers 6 and 7.

    Techniques: In Vitro, Modification, Polymerase Chain Reaction

    Detection of MmeI modification using antibodies specific for N6-methyladenine (m6A) and N4-methylcytosine (m4C). (Top row) unmethylated DNA; (second row) MmeI in vitro modified DNA; (third row) M.EcoRI in vitro modified DNA; (fourth row) M.BamHI in vitro modified DNA. Positive controls: m6A antibody panel; (fifth row) dam (m6A) in vivo methylated pUC19 DNA (400–25 ng dilution), m4C antibody panel; (fifth row) M.EsaBC3I (m4C) in vivo methylated plasmid DNA (400–25 ng dilution).

    Journal: Nucleic Acids Research

    Article Title: MmeI: a minimal Type II restriction-modification system that only modifies one DNA strand for host protection

    doi: 10.1093/nar/gkn711

    Figure Lengend Snippet: Detection of MmeI modification using antibodies specific for N6-methyladenine (m6A) and N4-methylcytosine (m4C). (Top row) unmethylated DNA; (second row) MmeI in vitro modified DNA; (third row) M.EcoRI in vitro modified DNA; (fourth row) M.BamHI in vitro modified DNA. Positive controls: m6A antibody panel; (fifth row) dam (m6A) in vivo methylated pUC19 DNA (400–25 ng dilution), m4C antibody panel; (fifth row) M.EsaBC3I (m4C) in vivo methylated plasmid DNA (400–25 ng dilution).

    Article Snippet: The effect of in vitro MmeI methylation was tested using a plasmid substrate, pMMH1, designed to introduce an MmeI site in the pUC19 polylinker region that overlaps a 5′ MboI site (GATC) and a 3′ HinfI site (GANTC): 5′-… cccgggGATCCGACTCcggtcgac …-3′. pMMH1 was formed from pUC19 using the Phusion Site-Directed Mutagenesis Kit (NEB) with primers 6 and 7.

    Techniques: Modification, In Vitro, In Vivo, Methylation, Plasmid Preparation