mme i  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    MmeI
    Description:
    MmeI 500 units
    Catalog Number:
    r0637l
    Price:
    282
    Size:
    500 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs mme i
    MmeI
    MmeI 500 units
    https://www.bioz.com/result/mme i/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mme i - by Bioz Stars, 2020-02
    95/100 stars

    Images

    1) Product Images from "Distributed probing of chromatin structure in vivo reveals pervasive chromatin accessibility for expressed and non-expressed genes during tissue differentiation in C. elegans"

    Article Title: Distributed probing of chromatin structure in vivo reveals pervasive chromatin accessibility for expressed and non-expressed genes during tissue differentiation in C. elegans

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-11-465

    Schematic of DALEC . Brown and green represent priming regions for Solexa bridge amplification primers. Blue indicates the primer binding region for the Solexa sequencing reaction. TCCGAC is the Mme I recognition sequence and the sequence immediately upstream of it (black) is the variable region. The inset gives detailed information for linkers A and B.
    Figure Legend Snippet: Schematic of DALEC . Brown and green represent priming regions for Solexa bridge amplification primers. Blue indicates the primer binding region for the Solexa sequencing reaction. TCCGAC is the Mme I recognition sequence and the sequence immediately upstream of it (black) is the variable region. The inset gives detailed information for linkers A and B.

    Techniques Used: Amplification, Binding Assay, Sequencing

    2) Product Images from "Distributed probing of chromatin structure in vivo reveals pervasive chromatin accessibility for expressed and non-expressed genes during tissue differentiation in C. elegans"

    Article Title: Distributed probing of chromatin structure in vivo reveals pervasive chromatin accessibility for expressed and non-expressed genes during tissue differentiation in C. elegans

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-11-465

    Schematic of DALEC . Brown and green represent priming regions for Solexa bridge amplification primers. Blue indicates the primer binding region for the Solexa sequencing reaction. TCCGAC is the Mme I recognition sequence and the sequence immediately upstream of it (black) is the variable region. The inset gives detailed information for linkers A and B.
    Figure Legend Snippet: Schematic of DALEC . Brown and green represent priming regions for Solexa bridge amplification primers. Blue indicates the primer binding region for the Solexa sequencing reaction. TCCGAC is the Mme I recognition sequence and the sequence immediately upstream of it (black) is the variable region. The inset gives detailed information for linkers A and B.

    Techniques Used: Amplification, Binding Assay, Sequencing

    Related Articles

    Clone Assay:

    Article Title: A comparative analysis of the information content in long and short SAGE libraries
    Article Snippet: Individual SAGE library clones were selected and PCR amplified using 96-well format Qiagen Real minipreps, and sequenced with ABI 3700 capillary sequencer using BigDye chemistry. .. We used the MmeI type IIS restriction endonuclease (New England Biolab) to release the linker tag molecules from the cDNA.

    Amplification:

    Article Title: A comparative analysis of the information content in long and short SAGE libraries
    Article Snippet: Individual SAGE library clones were selected and PCR amplified using 96-well format Qiagen Real minipreps, and sequenced with ABI 3700 capillary sequencer using BigDye chemistry. .. We used the MmeI type IIS restriction endonuclease (New England Biolab) to release the linker tag molecules from the cDNA.

    Article Title: Genome-wide identification of histone H2A and histone variant H2A.Z-interacting proteins by bPPI-seq
    Article Snippet: .. Then the DNA was amplified by MmeI-SD-1, MmeI-SD-2, MmeI-SD-3 and T7 primers to add a Mme I recognition site at both ends, followed by digestion with Mme I (New England Biolabs). .. After treatment with Klenow Enzyme (New England Biolabs), indexed libraries were prepared with a Multiplexing Sample Preparation Oligonucleotide Kit (Illumina) according to the user's manual.

    Article Title: Droplet Tn-Seq combines microfluidics with Tn-Seq for identifying complex single-cell phenotypes
    Article Snippet: .. Beads were then dried for 3 min at room temperature, and DNA was eluted off the beads with 12.7 μl of dH2 O. (3) In all, 11.49 μl of phi29 amplified DNA was then added to a MmeI digestion mix (two units NEB MmeI enzyme, 50 μM SAM, 1× CutSmart Buffer) in a total volume of 20 μl, and incubated for 2.5 h at 37 °C followed by 20 min at 65 °C. (4) In all, 1 μl of alkaline phosphatase (NEB - M0290S Calf Intestinal, CIP) was added to the sample and incubated for 1 h at 37 °C. (5) In total, 10 μl of magnetic beads plus 20 μl PEG solution per sample were used to wash the sample followed by elution in 14.3 μl of dH2 O. (6) T4 DNA ligase (NEB M0202L) was used to ligate DNA adapter barcodes by adding 13.12 μl DNA to 1 μl of 1:5 diluted adapter, 1× T4 DNA Ligase Reaction Buffer, and 400 units T4 DNA ligase, followed by incubation at 16 °C for 16 h, 65 °C for 10 min, and held at 10 °C. (7) In all, 10 μl magnetic beads plus 20 μl PEG solution were used to wash the sample followed by elution in 36 μl of dH2 O. (8) Adapter ligated DNA was then PCR amplified using Q5 high-fidelity DNA polymerase (NEB – M0491L) by adding 34 μl of DNA to 1X Q5 reaction buffer, 10 mM dNTPs, 0.45 μM of each primer (P1-M6-GAT-MmeI; P2-ADPT-Tnseq-primer; Supplementary Data ), one unit Q5 DNA polymerase, and incubated at 98 °C for 30 s, and 18–22 cycles of 98 °C for 10 s, 62 °C for 30 s, 72 °C for 15 s, followed by 72 °C for 2 min, and a 10 °C hold. (9) PCR products were gel purified and sequenced on an Illumina NextSeq 500 according to the manufacturer's protocol. .. Sequence analysis was performed with a series of in-house scripts , , .

    Article Title: Large-scale production of SAGE libraries from microdissected tissues, flow-sorted cells, and cell lines
    Article Snippet: The adapter–cDNA ligation products were digested with the type IIS tagging enzyme MmeI (NEB), releasing adapter-tag products with 2-nucleotide (nt) overhangs. .. Scale-up PCR used 23–39 amplification cycles with 1/20 to 1/80 dilutions of template material and 48 50-μL reactions.

    Article Title: Zebrafish bmp4 functions during late gastrulation to specify ventroposterior cell fates
    Article Snippet: 10 ug of the genomic DNA was digested with BstXI, PsiI, HpyCHIV, NheI, SmlI, SfcI, MmeI, BspMI, or BssSI (NEB), run on a 1% agarose gel, and then transferred to a charged nylon membrane (Hybond-N+, Amersham Biosciences). .. Probes were amplified from genomic DNA (5′ probe: 5′-CCGCTGATAAATAAGAGACTAAGC-3′ and 5′-GCTTTAAGCATAATCTGAAATCACTC-3′, 667bp; 3′probe: 5′-ACACCGTGCGCATCTCTT-3′ and 5′-GGCTGCTAATATGATTTCCCTGT-3′, 579bp) and radioactively labeled with the Rediprime II Random Prime Labelling System (Amersham Biosciences).

    Whole Genome Amplification:

    Article Title: Droplet Tn-Seq combines microfluidics with Tn-Seq for identifying complex single-cell phenotypes
    Article Snippet: Low gDNA input amounts (10–100 ng) were prepared by first performing whole-genome amplification (WGA) on the gDNA sample using phi29 DNA polymerase (NEB - M0269S). .. Beads were then dried for 3 min at room temperature, and DNA was eluted off the beads with 12.7 μl of dH2 O. (3) In all, 11.49 μl of phi29 amplified DNA was then added to a MmeI digestion mix (two units NEB MmeI enzyme, 50 μM SAM, 1× CutSmart Buffer) in a total volume of 20 μl, and incubated for 2.5 h at 37 °C followed by 20 min at 65 °C. (4) In all, 1 μl of alkaline phosphatase (NEB - M0290S Calf Intestinal, CIP) was added to the sample and incubated for 1 h at 37 °C. (5) In total, 10 μl of magnetic beads plus 20 μl PEG solution per sample were used to wash the sample followed by elution in 14.3 μl of dH2 O. (6) T4 DNA ligase (NEB M0202L) was used to ligate DNA adapter barcodes by adding 13.12 μl DNA to 1 μl of 1:5 diluted adapter, 1× T4 DNA Ligase Reaction Buffer, and 400 units T4 DNA ligase, followed by incubation at 16 °C for 16 h, 65 °C for 10 min, and held at 10 °C. (7) In all, 10 μl magnetic beads plus 20 μl PEG solution were used to wash the sample followed by elution in 36 μl of dH2 O. (8) Adapter ligated DNA was then PCR amplified using Q5 high-fidelity DNA polymerase (NEB – M0491L) by adding 34 μl of DNA to 1X Q5 reaction buffer, 10 mM dNTPs, 0.45 μM of each primer (P1-M6-GAT-MmeI; P2-ADPT-Tnseq-primer; Supplementary Data ), one unit Q5 DNA polymerase, and incubated at 98 °C for 30 s, and 18–22 cycles of 98 °C for 10 s, 62 °C for 30 s, 72 °C for 15 s, followed by 72 °C for 2 min, and a 10 °C hold. (9) PCR products were gel purified and sequenced on an Illumina NextSeq 500 according to the manufacturer's protocol.

    Synthesized:

    Article Title: 5'-Serial Analysis of Gene Expression studies reveal a transcriptomic switch during fruiting body development in Coprinopsis cinerea
    Article Snippet: Second strand cDNA was then synthesized by low cycle primer extension using Advantage® 2 polymerase (Clontech). .. The cDNAs were digested by 10units of Mme I (New England Biolabs) at 37°C for 2 hours.

    Blocking Assay:

    Article Title: Primer Extension Enrichment Reaction (PEER): a new subtraction method for identification of genetic differences between biological specimens
    Article Snippet: MmeI digestion : The ligation products are digested with 5 U MmeI (NEB) for 2 h. The cleaved DNA is resolved in 10% polyacrylamide gel, the resulting 50 bp fragment is cut out, isolated from the gel with QIAquick gel extraction kit (Qiagen) and resuspended in 50 μl of 10 mM Tris (pH 8). .. Blocking of MmeI-tagged primers : 25 μl Of the fragment is used as primer with 10 μl Driver bio-dsDNA template in the presence of 2.5 mM each ddNTPs-bio (Biotin-11-ddNTPs, NEN® Life Science Products Inc., Boston, MA), 0.025 mM each dNTPs (Roche) and Thermo Sequenase™ (Amersham Pharmacia Biotech, Inc., Piscataway, NJ).

    Electrophoresis:

    Article Title: 5'-Serial Analysis of Gene Expression studies reveal a transcriptomic switch during fruiting body development in Coprinopsis cinerea
    Article Snippet: Double-stranded cDNA was purified by QIAquick PCR purification kit (Qiagen) and checked by electrophoresis on a 1.5% agarose gel. .. The cDNAs were digested by 10units of Mme I (New England Biolabs) at 37°C for 2 hours.

    Incubation:

    Article Title: Droplet Tn-Seq combines microfluidics with Tn-Seq for identifying complex single-cell phenotypes
    Article Snippet: .. Beads were then dried for 3 min at room temperature, and DNA was eluted off the beads with 12.7 μl of dH2 O. (3) In all, 11.49 μl of phi29 amplified DNA was then added to a MmeI digestion mix (two units NEB MmeI enzyme, 50 μM SAM, 1× CutSmart Buffer) in a total volume of 20 μl, and incubated for 2.5 h at 37 °C followed by 20 min at 65 °C. (4) In all, 1 μl of alkaline phosphatase (NEB - M0290S Calf Intestinal, CIP) was added to the sample and incubated for 1 h at 37 °C. (5) In total, 10 μl of magnetic beads plus 20 μl PEG solution per sample were used to wash the sample followed by elution in 14.3 μl of dH2 O. (6) T4 DNA ligase (NEB M0202L) was used to ligate DNA adapter barcodes by adding 13.12 μl DNA to 1 μl of 1:5 diluted adapter, 1× T4 DNA Ligase Reaction Buffer, and 400 units T4 DNA ligase, followed by incubation at 16 °C for 16 h, 65 °C for 10 min, and held at 10 °C. (7) In all, 10 μl magnetic beads plus 20 μl PEG solution were used to wash the sample followed by elution in 36 μl of dH2 O. (8) Adapter ligated DNA was then PCR amplified using Q5 high-fidelity DNA polymerase (NEB – M0491L) by adding 34 μl of DNA to 1X Q5 reaction buffer, 10 mM dNTPs, 0.45 μM of each primer (P1-M6-GAT-MmeI; P2-ADPT-Tnseq-primer; Supplementary Data ), one unit Q5 DNA polymerase, and incubated at 98 °C for 30 s, and 18–22 cycles of 98 °C for 10 s, 62 °C for 30 s, 72 °C for 15 s, followed by 72 °C for 2 min, and a 10 °C hold. (9) PCR products were gel purified and sequenced on an Illumina NextSeq 500 according to the manufacturer's protocol. .. Sequence analysis was performed with a series of in-house scripts , , .

    Article Title: Targeted and genome-scale methylomics reveals gene body signatures in human cell lines
    Article Snippet: .. This was incubated at 50°C for 20 min, then 85°C for 20 min. Ethanol precipitation was performed again, and the pellet was resuspended to 50ul with a reaction mixture containing 2 units Mme I (NEB), 50 µM SAM and 1× NEBuffer 4. .. This was incubated at 37°C for 2 hours, then 80°C for 20 min. To this was added 1.66 µl of 10 µM adapter B, 6 µl 10mM ATP, and 3 µl T4 DNA ligase, and the mixture was incubated at 16°C for 4 hours, then 65°C for 15 min.

    Article Title: Effects of Diet on Resource Utilization by a Model Human Gut Microbiota Containing Bacteroides cellulosilyticus WH2, a Symbiont with an Extensive Glycobiome
    Article Snippet: 500 ng of each fecal DNA extraction was diluted in 15 µL of TE buffer and digested with MmeI (4 U, New England Biolabs) in a 20 µL reaction supplemented with 10 pmoles of 12 bp DNA containing an MmeI restriction site (to improve the efficiency of restriction enzyme digestion) . .. The digested DNA was added to the beads and the solution incubated at room temperature for 5 min. Beads were pelleted with a magnetic particle collector (MPC), washed twice (each time using a mixture composed of 20 µL TE buffer (pH 7.0) and 100 µL sizing solution, with bead recovery via MPC after each wash), followed by two ethanol washes (180 µL 70% ethanol/wash) and air-drying for 10 min.

    Activity Assay:

    Article Title: Structure of Type IIL Restriction-Modification Enzyme MmeI in Complex with DNA Has Implications for Engineering New Specificities
    Article Snippet: .. DNA Cleavage Assay Endonuclease activity was assayed by incubating various amounts of MmeI (wt or mutant) enzyme for 30 min at 37°C in NEBuffer 4 (20 mM Tris-acetate, pH 7.9, 10 mM magnesium acetate, 50 mM potassium acetate, 1 mM DTT) supplemented with AdoMet at 80 μM, containing 1 μg substrate DNA per 50 μl. .. Reactions were terminated by the addition of loading dye (NEB B7024) and reaction products were analyzed by gel electrophoresis in 1% LE agarose gels.

    Standard Deviation:

    Article Title: Droplet Tn-Seq combines microfluidics with Tn-Seq for identifying complex single-cell phenotypes
    Article Snippet: Beads were then dried for 3 min at room temperature, and DNA was eluted off the beads with 12.7 μl of dH2 O. (3) In all, 11.49 μl of phi29 amplified DNA was then added to a MmeI digestion mix (two units NEB MmeI enzyme, 50 μM SAM, 1× CutSmart Buffer) in a total volume of 20 μl, and incubated for 2.5 h at 37 °C followed by 20 min at 65 °C. (4) In all, 1 μl of alkaline phosphatase (NEB - M0290S Calf Intestinal, CIP) was added to the sample and incubated for 1 h at 37 °C. (5) In total, 10 μl of magnetic beads plus 20 μl PEG solution per sample were used to wash the sample followed by elution in 14.3 μl of dH2 O. (6) T4 DNA ligase (NEB M0202L) was used to ligate DNA adapter barcodes by adding 13.12 μl DNA to 1 μl of 1:5 diluted adapter, 1× T4 DNA Ligase Reaction Buffer, and 400 units T4 DNA ligase, followed by incubation at 16 °C for 16 h, 65 °C for 10 min, and held at 10 °C. (7) In all, 10 μl magnetic beads plus 20 μl PEG solution were used to wash the sample followed by elution in 36 μl of dH2 O. (8) Adapter ligated DNA was then PCR amplified using Q5 high-fidelity DNA polymerase (NEB – M0491L) by adding 34 μl of DNA to 1X Q5 reaction buffer, 10 mM dNTPs, 0.45 μM of each primer (P1-M6-GAT-MmeI; P2-ADPT-Tnseq-primer; Supplementary Data ), one unit Q5 DNA polymerase, and incubated at 98 °C for 30 s, and 18–22 cycles of 98 °C for 10 s, 62 °C for 30 s, 72 °C for 15 s, followed by 72 °C for 2 min, and a 10 °C hold. (9) PCR products were gel purified and sequenced on an Illumina NextSeq 500 according to the manufacturer's protocol. .. The final average fitness, standard deviation, and standard error are calculated across all insertions within a gene, and since fitness is calculated using the expansion factor of the population, W i becomes independent of time, therefore allowing comparisons between different strains and conditions across different experiments.

    Modification:

    Article Title: Effects of Diet on Resource Utilization by a Model Human Gut Microbiota Containing Bacteroides cellulosilyticus WH2, a Symbiont with an Extensive Glycobiome
    Article Snippet: The resulting library consisted of 93,458 distinct isogenic mutants, with each mutant strain containing a single randomly inserted modified mariner transposon. .. 500 ng of each fecal DNA extraction was diluted in 15 µL of TE buffer and digested with MmeI (4 U, New England Biolabs) in a 20 µL reaction supplemented with 10 pmoles of 12 bp DNA containing an MmeI restriction site (to improve the efficiency of restriction enzyme digestion) .

    Transformation Assay:

    Article Title: A comparative analysis of the information content in long and short SAGE libraries
    Article Snippet: Purified concatemers were subsequently cloned in the Sph I site of pZero-1 (Invitrogen) and transformed in competent ElectroMax DH10B cells (Invitrogen) using a 0.1 cm cuvette and the Gene Pulser II (BioRad). .. We used the MmeI type IIS restriction endonuclease (New England Biolab) to release the linker tag molecules from the cDNA.

    Gel Purification:

    Article Title: Development and application of a recombination-based library versus library high- throughput yeast two-hybrid (RLL-Y2H) screening system
    Article Snippet: .. Digest the purified PCR products with MmeI (NEB, CA) which yields a ∼110 bp target band, followed by low-melting gel purification. .. Prepare Illumina P5 and P7 adapters by annealing overhang NN-nucleotides P5: 5′-ACACTCTTTCCCTACACGACGCTCTTCCGATCTNN-3′ and 5′-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT-3′; P7: 5′-GATCGGAAGAGCACACGTCTGAACTCCAGTCAC-3′ and 5′-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCNN-3′, respectively.

    Ligation:

    Article Title: Primer Extension Enrichment Reaction (PEER): a new subtraction method for identification of genetic differences between biological specimens
    Article Snippet: .. MmeI digestion : The ligation products are digested with 5 U MmeI (NEB) for 2 h. The cleaved DNA is resolved in 10% polyacrylamide gel, the resulting 50 bp fragment is cut out, isolated from the gel with QIAquick gel extraction kit (Qiagen) and resuspended in 50 μl of 10 mM Tris (pH 8). .. Blocking of MmeI-tagged primers : 25 μl Of the fragment is used as primer with 10 μl Driver bio-dsDNA template in the presence of 2.5 mM each ddNTPs-bio (Biotin-11-ddNTPs, NEN® Life Science Products Inc., Boston, MA), 0.025 mM each dNTPs (Roche) and Thermo Sequenase™ (Amersham Pharmacia Biotech, Inc., Piscataway, NJ).

    Article Title: Genome-wide identification of histone H2A and histone variant H2A.Z-interacting proteins by bPPI-seq
    Article Snippet: Following ligation of a pair of top-Phops-oligo-17bp/T7Mme I-18bp adaptors, fragments between 250 and 650 bp were isolated from agarose gel. .. Then the DNA was amplified by MmeI-SD-1, MmeI-SD-2, MmeI-SD-3 and T7 primers to add a Mme I recognition site at both ends, followed by digestion with Mme I (New England Biolabs).

    Article Title: Large-scale production of SAGE libraries from microdissected tissues, flow-sorted cells, and cell lines
    Article Snippet: .. The adapter–cDNA ligation products were digested with the type IIS tagging enzyme MmeI (NEB), releasing adapter-tag products with 2-nucleotide (nt) overhangs. .. The two adapter–tag fractions were then ligated to form ∼131-bp adapter–ditag–adapter products that served as template for scale-up PCR.

    Article Title: Distributed probing of chromatin structure in vivo reveals pervasive chromatin accessibility for expressed and non-expressed genes during tissue differentiation in C. elegans
    Article Snippet: .. Ligation to Linker B Linker B was purchased as two separate oligonucleotides (5'P-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCGGTGGTCGCCGTATCATT-OH3', 5'OH-TCATCTTTCCCTACACGACGCTCTTCCGATCTNN-OH3') and hybridized using the same procedure as described for Linker A. Mme I products were ligated to Linker B using the following 50 μl reaction mix: 10.0 μl Mme I product, 1.0 μl of 0.05 mM Linker B, 5.0 μl 10× ligase buffer, 3.0 μl T4 DNA ligase (2,000 U/μl; NEB #M0202), 31.0 μl dH2 O. Ligations were performed overnight using a PCR machine. ..

    Article Title: Development and application of a recombination-based library versus library high- throughput yeast two-hybrid (RLL-Y2H) screening system
    Article Snippet: Digest the purified PCR products with MmeI (NEB, CA) which yields a ∼110 bp target band, followed by low-melting gel purification. .. Add P5 and P7 adapters to purified 110bp fragments by T4 ligation at 16°C for more than 2 h. Amplify the ligation products using primers (5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ and 5′-CAAGCAGAAGACGGCATACGAGAT(index)GTGACTGGAGTTCAGACGTGTGCTC TTCCGATC-3′) to construct high-throughput sequencing library.

    other:

    Article Title: Distributed probing of chromatin structure in vivo reveals pervasive chromatin accessibility for expressed and non-expressed genes during tissue differentiation in C. elegans
    Article Snippet: Mme I digestion Linker A-ligated molecules were subjected to Mme I digestion using the following 200 μl reaction mix: 20 μl Linker A-ligated product, 20.0 μl 10× NEB 4, 0.3 μl 32 mM S-adenosyl methionine, 2.0 μl Mme I (2 U/μl; NEB R0637), 157.7 μl dH2 O.

    Article Title: MmeI: a minimal Type II restriction-modification system that only modifies one DNA strand for host protection
    Article Snippet: MATERIALS AND METHODS MmeI, AdoMet, all restriction endonucleases, T4 DNA Ligase, Phusion DNA polymerase, DNA size standards and competent cells were obtained from New England Biolabs (Ipswich, MA).

    Sequencing:

    Article Title: Genome-wide identification of histone H2A and histone variant H2A.Z-interacting proteins by bPPI-seq
    Article Snippet: Paragraph title: bPPI-seq library preparation and sequencing ... Then the DNA was amplified by MmeI-SD-1, MmeI-SD-2, MmeI-SD-3 and T7 primers to add a Mme I recognition site at both ends, followed by digestion with Mme I (New England Biolabs).

    Article Title: Droplet Tn-Seq combines microfluidics with Tn-Seq for identifying complex single-cell phenotypes
    Article Snippet: Paragraph title: Sample preparation, sequencing, and fitness calculations ... Beads were then dried for 3 min at room temperature, and DNA was eluted off the beads with 12.7 μl of dH2 O. (3) In all, 11.49 μl of phi29 amplified DNA was then added to a MmeI digestion mix (two units NEB MmeI enzyme, 50 μM SAM, 1× CutSmart Buffer) in a total volume of 20 μl, and incubated for 2.5 h at 37 °C followed by 20 min at 65 °C. (4) In all, 1 μl of alkaline phosphatase (NEB - M0290S Calf Intestinal, CIP) was added to the sample and incubated for 1 h at 37 °C. (5) In total, 10 μl of magnetic beads plus 20 μl PEG solution per sample were used to wash the sample followed by elution in 14.3 μl of dH2 O. (6) T4 DNA ligase (NEB M0202L) was used to ligate DNA adapter barcodes by adding 13.12 μl DNA to 1 μl of 1:5 diluted adapter, 1× T4 DNA Ligase Reaction Buffer, and 400 units T4 DNA ligase, followed by incubation at 16 °C for 16 h, 65 °C for 10 min, and held at 10 °C. (7) In all, 10 μl magnetic beads plus 20 μl PEG solution were used to wash the sample followed by elution in 36 μl of dH2 O. (8) Adapter ligated DNA was then PCR amplified using Q5 high-fidelity DNA polymerase (NEB – M0491L) by adding 34 μl of DNA to 1X Q5 reaction buffer, 10 mM dNTPs, 0.45 μM of each primer (P1-M6-GAT-MmeI; P2-ADPT-Tnseq-primer; Supplementary Data ), one unit Q5 DNA polymerase, and incubated at 98 °C for 30 s, and 18–22 cycles of 98 °C for 10 s, 62 °C for 30 s, 72 °C for 15 s, followed by 72 °C for 2 min, and a 10 °C hold. (9) PCR products were gel purified and sequenced on an Illumina NextSeq 500 according to the manufacturer's protocol.

    Article Title: Effects of Diet on Resource Utilization by a Model Human Gut Microbiota Containing Bacteroides cellulosilyticus WH2, a Symbiont with an Extensive Glycobiome
    Article Snippet: Paragraph title: Identification of Diet-Specific Fitness Determinants within the B. cellulosilyticus WH2 Genome Using Insertion Sequencing (INSeq) ... 500 ng of each fecal DNA extraction was diluted in 15 µL of TE buffer and digested with MmeI (4 U, New England Biolabs) in a 20 µL reaction supplemented with 10 pmoles of 12 bp DNA containing an MmeI restriction site (to improve the efficiency of restriction enzyme digestion) .

    Article Title: Generating high accuracy peptide binding data in high throughput with yeast surface display and SORTCERY
    Article Snippet: Paragraph title: 2.3 Deep Sequencing Sample Preparation (see ) ... Zymoprep Yeast Plasmid Miniprep I (Zymo Research) Isopropanole High-Fidelity DNA Polymerase (e.g. Phusion) Thermocycler Gel equipment PCR purification and gel extraction kits (QiaGen) MmeI (New England Biolabs): MmeI restriction enzyme, NEB Cut Smart Buffer, 1 mM SAM T4 Ligase Primers and oligos

    Article Title: Development and application of a recombination-based library versus library high- throughput yeast two-hybrid (RLL-Y2H) screening system
    Article Snippet: Digest the purified PCR products with MmeI (NEB, CA) which yields a ∼110 bp target band, followed by low-melting gel purification. .. Add P5 and P7 adapters to purified 110bp fragments by T4 ligation at 16°C for more than 2 h. Amplify the ligation products using primers (5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ and 5′-CAAGCAGAAGACGGCATACGAGAT(index)GTGACTGGAGTTCAGACGTGTGCTC TTCCGATC-3′) to construct high-throughput sequencing library.

    Sonication:

    Article Title: Genome-wide identification of histone H2A and histone variant H2A.Z-interacting proteins by bPPI-seq
    Article Snippet: The cDNAs were amplified by a GFPC-specific (VNC primer) and T7 primers, and fragmented to 200 to 500 bp by sonication. .. Then the DNA was amplified by MmeI-SD-1, MmeI-SD-2, MmeI-SD-3 and T7 primers to add a Mme I recognition site at both ends, followed by digestion with Mme I (New England Biolabs).

    Hybridization:

    Article Title: Zebrafish bmp4 functions during late gastrulation to specify ventroposterior cell fates
    Article Snippet: 10 ug of the genomic DNA was digested with BstXI, PsiI, HpyCHIV, NheI, SmlI, SfcI, MmeI, BspMI, or BssSI (NEB), run on a 1% agarose gel, and then transferred to a charged nylon membrane (Hybond-N+, Amersham Biosciences). .. Hybridization of the probes to the nylon membrane was performed with Rapid-hyb buffer (Amersham Biosciences) following the supplied protocol.

    Multiplexing:

    Article Title: Genome-wide identification of histone H2A and histone variant H2A.Z-interacting proteins by bPPI-seq
    Article Snippet: Then the DNA was amplified by MmeI-SD-1, MmeI-SD-2, MmeI-SD-3 and T7 primers to add a Mme I recognition site at both ends, followed by digestion with Mme I (New England Biolabs). .. After treatment with Klenow Enzyme (New England Biolabs), indexed libraries were prepared with a Multiplexing Sample Preparation Oligonucleotide Kit (Illumina) according to the user's manual.

    Nucleic Acid Electrophoresis:

    Article Title: Structure of Type IIL Restriction-Modification Enzyme MmeI in Complex with DNA Has Implications for Engineering New Specificities
    Article Snippet: DNA Cleavage Assay Endonuclease activity was assayed by incubating various amounts of MmeI (wt or mutant) enzyme for 30 min at 37°C in NEBuffer 4 (20 mM Tris-acetate, pH 7.9, 10 mM magnesium acetate, 50 mM potassium acetate, 1 mM DTT) supplemented with AdoMet at 80 μM, containing 1 μg substrate DNA per 50 μl. .. Reactions were terminated by the addition of loading dye (NEB B7024) and reaction products were analyzed by gel electrophoresis in 1% LE agarose gels.

    DNA Cleavage Assay:

    Article Title: Structure of Type IIL Restriction-Modification Enzyme MmeI in Complex with DNA Has Implications for Engineering New Specificities
    Article Snippet: .. DNA Cleavage Assay Endonuclease activity was assayed by incubating various amounts of MmeI (wt or mutant) enzyme for 30 min at 37°C in NEBuffer 4 (20 mM Tris-acetate, pH 7.9, 10 mM magnesium acetate, 50 mM potassium acetate, 1 mM DTT) supplemented with AdoMet at 80 μM, containing 1 μg substrate DNA per 50 μl. .. Reactions were terminated by the addition of loading dye (NEB B7024) and reaction products were analyzed by gel electrophoresis in 1% LE agarose gels.

    Magnetic Beads:

    Article Title: Primer Extension Enrichment Reaction (PEER): a new subtraction method for identification of genetic differences between biological specimens
    Article Snippet: MmeI digestion : The ligation products are digested with 5 U MmeI (NEB) for 2 h. The cleaved DNA is resolved in 10% polyacrylamide gel, the resulting 50 bp fragment is cut out, isolated from the gel with QIAquick gel extraction kit (Qiagen) and resuspended in 50 μl of 10 mM Tris (pH 8). .. Removal of biotinylated products : The cleaned product is heated to 95°C, and 50 μl of streptavidin-coated magnetic beads were added (SPHERO™ Streptavidin Magnetic Particles from Spherotech, Inc., Libertyville, IL).

    Article Title: Droplet Tn-Seq combines microfluidics with Tn-Seq for identifying complex single-cell phenotypes
    Article Snippet: .. Beads were then dried for 3 min at room temperature, and DNA was eluted off the beads with 12.7 μl of dH2 O. (3) In all, 11.49 μl of phi29 amplified DNA was then added to a MmeI digestion mix (two units NEB MmeI enzyme, 50 μM SAM, 1× CutSmart Buffer) in a total volume of 20 μl, and incubated for 2.5 h at 37 °C followed by 20 min at 65 °C. (4) In all, 1 μl of alkaline phosphatase (NEB - M0290S Calf Intestinal, CIP) was added to the sample and incubated for 1 h at 37 °C. (5) In total, 10 μl of magnetic beads plus 20 μl PEG solution per sample were used to wash the sample followed by elution in 14.3 μl of dH2 O. (6) T4 DNA ligase (NEB M0202L) was used to ligate DNA adapter barcodes by adding 13.12 μl DNA to 1 μl of 1:5 diluted adapter, 1× T4 DNA Ligase Reaction Buffer, and 400 units T4 DNA ligase, followed by incubation at 16 °C for 16 h, 65 °C for 10 min, and held at 10 °C. (7) In all, 10 μl magnetic beads plus 20 μl PEG solution were used to wash the sample followed by elution in 36 μl of dH2 O. (8) Adapter ligated DNA was then PCR amplified using Q5 high-fidelity DNA polymerase (NEB – M0491L) by adding 34 μl of DNA to 1X Q5 reaction buffer, 10 mM dNTPs, 0.45 μM of each primer (P1-M6-GAT-MmeI; P2-ADPT-Tnseq-primer; Supplementary Data ), one unit Q5 DNA polymerase, and incubated at 98 °C for 30 s, and 18–22 cycles of 98 °C for 10 s, 62 °C for 30 s, 72 °C for 15 s, followed by 72 °C for 2 min, and a 10 °C hold. (9) PCR products were gel purified and sequenced on an Illumina NextSeq 500 according to the manufacturer's protocol. .. Sequence analysis was performed with a series of in-house scripts , , .

    Article Title: Large-scale production of SAGE libraries from microdissected tissues, flow-sorted cells, and cell lines
    Article Snippet: Construction of “standard” libraries initially required 2–50 μg of DNase-treated total RNA. mRNA was captured using oligo(dT) magnetic beads followed by synthesis of double-stranded cDNA using SuperScript II reverse transcriptase (Invitrogen), RNAseH, and Escherichia coli DNA polymerase (Invitrogen). .. The adapter–cDNA ligation products were digested with the type IIS tagging enzyme MmeI (NEB), releasing adapter-tag products with 2-nucleotide (nt) overhangs.

    Mutagenesis:

    Article Title: Droplet Tn-Seq combines microfluidics with Tn-Seq for identifying complex single-cell phenotypes
    Article Snippet: Beads were then dried for 3 min at room temperature, and DNA was eluted off the beads with 12.7 μl of dH2 O. (3) In all, 11.49 μl of phi29 amplified DNA was then added to a MmeI digestion mix (two units NEB MmeI enzyme, 50 μM SAM, 1× CutSmart Buffer) in a total volume of 20 μl, and incubated for 2.5 h at 37 °C followed by 20 min at 65 °C. (4) In all, 1 μl of alkaline phosphatase (NEB - M0290S Calf Intestinal, CIP) was added to the sample and incubated for 1 h at 37 °C. (5) In total, 10 μl of magnetic beads plus 20 μl PEG solution per sample were used to wash the sample followed by elution in 14.3 μl of dH2 O. (6) T4 DNA ligase (NEB M0202L) was used to ligate DNA adapter barcodes by adding 13.12 μl DNA to 1 μl of 1:5 diluted adapter, 1× T4 DNA Ligase Reaction Buffer, and 400 units T4 DNA ligase, followed by incubation at 16 °C for 16 h, 65 °C for 10 min, and held at 10 °C. (7) In all, 10 μl magnetic beads plus 20 μl PEG solution were used to wash the sample followed by elution in 36 μl of dH2 O. (8) Adapter ligated DNA was then PCR amplified using Q5 high-fidelity DNA polymerase (NEB – M0491L) by adding 34 μl of DNA to 1X Q5 reaction buffer, 10 mM dNTPs, 0.45 μM of each primer (P1-M6-GAT-MmeI; P2-ADPT-Tnseq-primer; Supplementary Data ), one unit Q5 DNA polymerase, and incubated at 98 °C for 30 s, and 18–22 cycles of 98 °C for 10 s, 62 °C for 30 s, 72 °C for 15 s, followed by 72 °C for 2 min, and a 10 °C hold. (9) PCR products were gel purified and sequenced on an Illumina NextSeq 500 according to the manufacturer's protocol. .. The fitness of a single mutant (W i ) is calculated by comparing the fold expansion of the mutant to the fold expansion of the population and is determined by the following equation , : \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$W_i = \frac{{\ln \left( {N_i\left( {t_2} \right) \times d/N_i\left( {t_1} \right)} \right)}}{{{\mathrm{ln}}((1 - N_i\left( {t_2} \right)) \times d/(1 - N_i\left( {t_1} \right)))}},$$\end{document} W i = ln N i t 2 × d ∕ N i t 1 ln ( ( 1 − N i t 2 ) × d ∕ ( 1 − N i t 1 ) ) , in which N i (t 1 ) and N i (t 2 ) are the mutant frequency at the beginning and end of the experiment, respectively, and d is the population expansion.

    Article Title: Effects of Diet on Resource Utilization by a Model Human Gut Microbiota Containing Bacteroides cellulosilyticus WH2, a Symbiont with an Extensive Glycobiome
    Article Snippet: The resulting library consisted of 93,458 distinct isogenic mutants, with each mutant strain containing a single randomly inserted modified mariner transposon. .. 500 ng of each fecal DNA extraction was diluted in 15 µL of TE buffer and digested with MmeI (4 U, New England Biolabs) in a 20 µL reaction supplemented with 10 pmoles of 12 bp DNA containing an MmeI restriction site (to improve the efficiency of restriction enzyme digestion) .

    Article Title: Structure of Type IIL Restriction-Modification Enzyme MmeI in Complex with DNA Has Implications for Engineering New Specificities
    Article Snippet: .. DNA Cleavage Assay Endonuclease activity was assayed by incubating various amounts of MmeI (wt or mutant) enzyme for 30 min at 37°C in NEBuffer 4 (20 mM Tris-acetate, pH 7.9, 10 mM magnesium acetate, 50 mM potassium acetate, 1 mM DTT) supplemented with AdoMet at 80 μM, containing 1 μg substrate DNA per 50 μl. .. Reactions were terminated by the addition of loading dye (NEB B7024) and reaction products were analyzed by gel electrophoresis in 1% LE agarose gels.

    Isolation:

    Article Title: Primer Extension Enrichment Reaction (PEER): a new subtraction method for identification of genetic differences between biological specimens
    Article Snippet: .. MmeI digestion : The ligation products are digested with 5 U MmeI (NEB) for 2 h. The cleaved DNA is resolved in 10% polyacrylamide gel, the resulting 50 bp fragment is cut out, isolated from the gel with QIAquick gel extraction kit (Qiagen) and resuspended in 50 μl of 10 mM Tris (pH 8). .. Blocking of MmeI-tagged primers : 25 μl Of the fragment is used as primer with 10 μl Driver bio-dsDNA template in the presence of 2.5 mM each ddNTPs-bio (Biotin-11-ddNTPs, NEN® Life Science Products Inc., Boston, MA), 0.025 mM each dNTPs (Roche) and Thermo Sequenase™ (Amersham Pharmacia Biotech, Inc., Piscataway, NJ).

    Article Title: Genome-wide identification of histone H2A and histone variant H2A.Z-interacting proteins by bPPI-seq
    Article Snippet: Following ligation of a pair of top-Phops-oligo-17bp/T7Mme I-18bp adaptors, fragments between 250 and 650 bp were isolated from agarose gel. .. Then the DNA was amplified by MmeI-SD-1, MmeI-SD-2, MmeI-SD-3 and T7 primers to add a Mme I recognition site at both ends, followed by digestion with Mme I (New England Biolabs).

    Article Title: 5'-Serial Analysis of Gene Expression studies reveal a transcriptomic switch during fruiting body development in Coprinopsis cinerea
    Article Snippet: Ditag formation Total RNA was extracted by TRI® reagent (Molecular Research Center, Inc) and Poly(A)+ mRNA was furthered isolated using the PolyATract® mRNA isolation system (Promega). .. The cDNAs were digested by 10units of Mme I (New England Biolabs) at 37°C for 2 hours.

    Article Title: Zebrafish bmp4 functions during late gastrulation to specify ventroposterior cell fates
    Article Snippet: Genomic DNA was isolated from pools of 40 st37 / st37 , st37 /+, and +/+ embryos at 5dpf with a Qiagen DNeasy kit. .. 10 ug of the genomic DNA was digested with BstXI, PsiI, HpyCHIV, NheI, SmlI, SfcI, MmeI, BspMI, or BssSI (NEB), run on a 1% agarose gel, and then transferred to a charged nylon membrane (Hybond-N+, Amersham Biosciences).

    Article Title: Development and application of a recombination-based library versus library high- throughput yeast two-hybrid (RLL-Y2H) screening system
    Article Snippet: High-throughput DNA library construction Amplify the recombinated bait and prey fragments using the isolated integrated plasmids from the pooled positive colonies and amplify for 18–20 cycles. .. Digest the purified PCR products with MmeI (NEB, CA) which yields a ∼110 bp target band, followed by low-melting gel purification.

    Labeling:

    Article Title: Zebrafish bmp4 functions during late gastrulation to specify ventroposterior cell fates
    Article Snippet: 10 ug of the genomic DNA was digested with BstXI, PsiI, HpyCHIV, NheI, SmlI, SfcI, MmeI, BspMI, or BssSI (NEB), run on a 1% agarose gel, and then transferred to a charged nylon membrane (Hybond-N+, Amersham Biosciences). .. Probes were amplified from genomic DNA (5′ probe: 5′-CCGCTGATAAATAAGAGACTAAGC-3′ and 5′-GCTTTAAGCATAATCTGAAATCACTC-3′, 667bp; 3′probe: 5′-ACACCGTGCGCATCTCTT-3′ and 5′-GGCTGCTAATATGATTTCCCTGT-3′, 579bp) and radioactively labeled with the Rediprime II Random Prime Labelling System (Amersham Biosciences).

    Purification:

    Article Title: A comparative analysis of the information content in long and short SAGE libraries
    Article Snippet: Purified concatemers were subsequently cloned in the Sph I site of pZero-1 (Invitrogen) and transformed in competent ElectroMax DH10B cells (Invitrogen) using a 0.1 cm cuvette and the Gene Pulser II (BioRad). .. We used the MmeI type IIS restriction endonuclease (New England Biolab) to release the linker tag molecules from the cDNA.

    Article Title: Primer Extension Enrichment Reaction (PEER): a new subtraction method for identification of genetic differences between biological specimens
    Article Snippet: The ligation products are purified to remove the T4 ligase and buffer with QIAquick nucleotide removal column and eluted in 55 μl of 10 mM Tris (pH 8). .. MmeI digestion : The ligation products are digested with 5 U MmeI (NEB) for 2 h. The cleaved DNA is resolved in 10% polyacrylamide gel, the resulting 50 bp fragment is cut out, isolated from the gel with QIAquick gel extraction kit (Qiagen) and resuspended in 50 μl of 10 mM Tris (pH 8).

    Article Title: Genome-wide identification of histone H2A and histone variant H2A.Z-interacting proteins by bPPI-seq
    Article Snippet: Purified RNAs were reverse transcribed using PrimeScript Reverse Transcriptase (Takara) with a PolyT primer. .. Then the DNA was amplified by MmeI-SD-1, MmeI-SD-2, MmeI-SD-3 and T7 primers to add a Mme I recognition site at both ends, followed by digestion with Mme I (New England Biolabs).

    Article Title: Droplet Tn-Seq combines microfluidics with Tn-Seq for identifying complex single-cell phenotypes
    Article Snippet: .. Beads were then dried for 3 min at room temperature, and DNA was eluted off the beads with 12.7 μl of dH2 O. (3) In all, 11.49 μl of phi29 amplified DNA was then added to a MmeI digestion mix (two units NEB MmeI enzyme, 50 μM SAM, 1× CutSmart Buffer) in a total volume of 20 μl, and incubated for 2.5 h at 37 °C followed by 20 min at 65 °C. (4) In all, 1 μl of alkaline phosphatase (NEB - M0290S Calf Intestinal, CIP) was added to the sample and incubated for 1 h at 37 °C. (5) In total, 10 μl of magnetic beads plus 20 μl PEG solution per sample were used to wash the sample followed by elution in 14.3 μl of dH2 O. (6) T4 DNA ligase (NEB M0202L) was used to ligate DNA adapter barcodes by adding 13.12 μl DNA to 1 μl of 1:5 diluted adapter, 1× T4 DNA Ligase Reaction Buffer, and 400 units T4 DNA ligase, followed by incubation at 16 °C for 16 h, 65 °C for 10 min, and held at 10 °C. (7) In all, 10 μl magnetic beads plus 20 μl PEG solution were used to wash the sample followed by elution in 36 μl of dH2 O. (8) Adapter ligated DNA was then PCR amplified using Q5 high-fidelity DNA polymerase (NEB – M0491L) by adding 34 μl of DNA to 1X Q5 reaction buffer, 10 mM dNTPs, 0.45 μM of each primer (P1-M6-GAT-MmeI; P2-ADPT-Tnseq-primer; Supplementary Data ), one unit Q5 DNA polymerase, and incubated at 98 °C for 30 s, and 18–22 cycles of 98 °C for 10 s, 62 °C for 30 s, 72 °C for 15 s, followed by 72 °C for 2 min, and a 10 °C hold. (9) PCR products were gel purified and sequenced on an Illumina NextSeq 500 according to the manufacturer's protocol. .. Sequence analysis was performed with a series of in-house scripts , , .

    Article Title: Targeted and genome-scale methylomics reveals gene body signatures in human cell lines
    Article Snippet: This was incubated at 50°C for 20 min, then 85°C for 20 min. Ethanol precipitation was performed again, and the pellet was resuspended to 50ul with a reaction mixture containing 2 units Mme I (NEB), 50 µM SAM and 1× NEBuffer 4. .. The mixture was run on a 6% non-denaturing TBE polyacrylamide gel (Invitrogen) and the target band at ~140 bp was purified.

    Article Title: 5'-Serial Analysis of Gene Expression studies reveal a transcriptomic switch during fruiting body development in Coprinopsis cinerea
    Article Snippet: Double-stranded cDNA was purified by QIAquick PCR purification kit (Qiagen) and checked by electrophoresis on a 1.5% agarose gel. .. The cDNAs were digested by 10units of Mme I (New England Biolabs) at 37°C for 2 hours.

    Article Title: Effects of Diet on Resource Utilization by a Model Human Gut Microbiota Containing Bacteroides cellulosilyticus WH2, a Symbiont with an Extensive Glycobiome
    Article Snippet: 500 ng of each fecal DNA extraction was diluted in 15 µL of TE buffer and digested with MmeI (4 U, New England Biolabs) in a 20 µL reaction supplemented with 10 pmoles of 12 bp DNA containing an MmeI restriction site (to improve the efficiency of restriction enzyme digestion) . .. MmeI-digested DNA was subsequently purified using 125 µL of AMPure beads (after washing the beads once with 100 µL of sizing solution (1.2 M NaCl and 8.4% PEG 8000)).

    Article Title: Generating high accuracy peptide binding data in high throughput with yeast surface display and SORTCERY
    Article Snippet: .. Zymoprep Yeast Plasmid Miniprep I (Zymo Research) Isopropanole High-Fidelity DNA Polymerase (e.g. Phusion) Thermocycler Gel equipment PCR purification and gel extraction kits (QiaGen) MmeI (New England Biolabs): MmeI restriction enzyme, NEB Cut Smart Buffer, 1 mM SAM T4 Ligase Primers and oligos .. Dilute cells to OD600 of 0.05 in SD + CAA and grow for 8 h at 30 °C.

    Article Title: Development and application of a recombination-based library versus library high- throughput yeast two-hybrid (RLL-Y2H) screening system
    Article Snippet: .. Digest the purified PCR products with MmeI (NEB, CA) which yields a ∼110 bp target band, followed by low-melting gel purification. .. Prepare Illumina P5 and P7 adapters by annealing overhang NN-nucleotides P5: 5′-ACACTCTTTCCCTACACGACGCTCTTCCGATCTNN-3′ and 5′-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT-3′; P7: 5′-GATCGGAAGAGCACACGTCTGAACTCCAGTCAC-3′ and 5′-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCNN-3′, respectively.

    Polymerase Chain Reaction:

    Article Title: A comparative analysis of the information content in long and short SAGE libraries
    Article Snippet: Individual SAGE library clones were selected and PCR amplified using 96-well format Qiagen Real minipreps, and sequenced with ABI 3700 capillary sequencer using BigDye chemistry. .. We used the MmeI type IIS restriction endonuclease (New England Biolab) to release the linker tag molecules from the cDNA.

    Article Title: Droplet Tn-Seq combines microfluidics with Tn-Seq for identifying complex single-cell phenotypes
    Article Snippet: .. Beads were then dried for 3 min at room temperature, and DNA was eluted off the beads with 12.7 μl of dH2 O. (3) In all, 11.49 μl of phi29 amplified DNA was then added to a MmeI digestion mix (two units NEB MmeI enzyme, 50 μM SAM, 1× CutSmart Buffer) in a total volume of 20 μl, and incubated for 2.5 h at 37 °C followed by 20 min at 65 °C. (4) In all, 1 μl of alkaline phosphatase (NEB - M0290S Calf Intestinal, CIP) was added to the sample and incubated for 1 h at 37 °C. (5) In total, 10 μl of magnetic beads plus 20 μl PEG solution per sample were used to wash the sample followed by elution in 14.3 μl of dH2 O. (6) T4 DNA ligase (NEB M0202L) was used to ligate DNA adapter barcodes by adding 13.12 μl DNA to 1 μl of 1:5 diluted adapter, 1× T4 DNA Ligase Reaction Buffer, and 400 units T4 DNA ligase, followed by incubation at 16 °C for 16 h, 65 °C for 10 min, and held at 10 °C. (7) In all, 10 μl magnetic beads plus 20 μl PEG solution were used to wash the sample followed by elution in 36 μl of dH2 O. (8) Adapter ligated DNA was then PCR amplified using Q5 high-fidelity DNA polymerase (NEB – M0491L) by adding 34 μl of DNA to 1X Q5 reaction buffer, 10 mM dNTPs, 0.45 μM of each primer (P1-M6-GAT-MmeI; P2-ADPT-Tnseq-primer; Supplementary Data ), one unit Q5 DNA polymerase, and incubated at 98 °C for 30 s, and 18–22 cycles of 98 °C for 10 s, 62 °C for 30 s, 72 °C for 15 s, followed by 72 °C for 2 min, and a 10 °C hold. (9) PCR products were gel purified and sequenced on an Illumina NextSeq 500 according to the manufacturer's protocol. .. Sequence analysis was performed with a series of in-house scripts , , .

    Article Title: Targeted and genome-scale methylomics reveals gene body signatures in human cell lines
    Article Snippet: This was incubated at 50°C for 20 min, then 85°C for 20 min. Ethanol precipitation was performed again, and the pellet was resuspended to 50ul with a reaction mixture containing 2 units Mme I (NEB), 50 µM SAM and 1× NEBuffer 4. .. PCR was then performed on ~80% of this purified sample using primers matching the sequences of adapter A and adapter B.

    Article Title: 5'-Serial Analysis of Gene Expression studies reveal a transcriptomic switch during fruiting body development in Coprinopsis cinerea
    Article Snippet: Double-stranded cDNA was purified by QIAquick PCR purification kit (Qiagen) and checked by electrophoresis on a 1.5% agarose gel. .. The cDNAs were digested by 10units of Mme I (New England Biolabs) at 37°C for 2 hours.

    Article Title: Large-scale production of SAGE libraries from microdissected tissues, flow-sorted cells, and cell lines
    Article Snippet: The adapter–cDNA ligation products were digested with the type IIS tagging enzyme MmeI (NEB), releasing adapter-tag products with 2-nucleotide (nt) overhangs. .. The two adapter–tag fractions were then ligated to form ∼131-bp adapter–ditag–adapter products that served as template for scale-up PCR.

    Article Title: Generating high accuracy peptide binding data in high throughput with yeast surface display and SORTCERY
    Article Snippet: .. Zymoprep Yeast Plasmid Miniprep I (Zymo Research) Isopropanole High-Fidelity DNA Polymerase (e.g. Phusion) Thermocycler Gel equipment PCR purification and gel extraction kits (QiaGen) MmeI (New England Biolabs): MmeI restriction enzyme, NEB Cut Smart Buffer, 1 mM SAM T4 Ligase Primers and oligos .. Dilute cells to OD600 of 0.05 in SD + CAA and grow for 8 h at 30 °C.

    Article Title: Distributed probing of chromatin structure in vivo reveals pervasive chromatin accessibility for expressed and non-expressed genes during tissue differentiation in C. elegans
    Article Snippet: .. Ligation to Linker B Linker B was purchased as two separate oligonucleotides (5'P-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCGGTGGTCGCCGTATCATT-OH3', 5'OH-TCATCTTTCCCTACACGACGCTCTTCCGATCTNN-OH3') and hybridized using the same procedure as described for Linker A. Mme I products were ligated to Linker B using the following 50 μl reaction mix: 10.0 μl Mme I product, 1.0 μl of 0.05 mM Linker B, 5.0 μl 10× ligase buffer, 3.0 μl T4 DNA ligase (2,000 U/μl; NEB #M0202), 31.0 μl dH2 O. Ligations were performed overnight using a PCR machine. ..

    Article Title: Development and application of a recombination-based library versus library high- throughput yeast two-hybrid (RLL-Y2H) screening system
    Article Snippet: .. Digest the purified PCR products with MmeI (NEB, CA) which yields a ∼110 bp target band, followed by low-melting gel purification. .. Prepare Illumina P5 and P7 adapters by annealing overhang NN-nucleotides P5: 5′-ACACTCTTTCCCTACACGACGCTCTTCCGATCTNN-3′ and 5′-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT-3′; P7: 5′-GATCGGAAGAGCACACGTCTGAACTCCAGTCAC-3′ and 5′-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCNN-3′, respectively.

    Quantitative RT-PCR:

    Article Title: 5'-Serial Analysis of Gene Expression studies reveal a transcriptomic switch during fruiting body development in Coprinopsis cinerea
    Article Snippet: First strand cDNA was synthesized using SuperScript™ III First-Strand Synthesis System for qRT-PCR (Invitrogen). .. The cDNAs were digested by 10units of Mme I (New England Biolabs) at 37°C for 2 hours.

    Agarose Gel Electrophoresis:

    Article Title: Genome-wide identification of histone H2A and histone variant H2A.Z-interacting proteins by bPPI-seq
    Article Snippet: Following ligation of a pair of top-Phops-oligo-17bp/T7Mme I-18bp adaptors, fragments between 250 and 650 bp were isolated from agarose gel. .. Then the DNA was amplified by MmeI-SD-1, MmeI-SD-2, MmeI-SD-3 and T7 primers to add a Mme I recognition site at both ends, followed by digestion with Mme I (New England Biolabs).

    Article Title: 5'-Serial Analysis of Gene Expression studies reveal a transcriptomic switch during fruiting body development in Coprinopsis cinerea
    Article Snippet: Double-stranded cDNA was purified by QIAquick PCR purification kit (Qiagen) and checked by electrophoresis on a 1.5% agarose gel. .. The cDNAs were digested by 10units of Mme I (New England Biolabs) at 37°C for 2 hours.

    Article Title: Zebrafish bmp4 functions during late gastrulation to specify ventroposterior cell fates
    Article Snippet: .. 10 ug of the genomic DNA was digested with BstXI, PsiI, HpyCHIV, NheI, SmlI, SfcI, MmeI, BspMI, or BssSI (NEB), run on a 1% agarose gel, and then transferred to a charged nylon membrane (Hybond-N+, Amersham Biosciences). .. Probes were amplified from genomic DNA (5′ probe: 5′-CCGCTGATAAATAAGAGACTAAGC-3′ and 5′-GCTTTAAGCATAATCTGAAATCACTC-3′, 667bp; 3′probe: 5′-ACACCGTGCGCATCTCTT-3′ and 5′-GGCTGCTAATATGATTTCCCTGT-3′, 579bp) and radioactively labeled with the Rediprime II Random Prime Labelling System (Amersham Biosciences).

    Article Title: Development and application of a recombination-based library versus library high- throughput yeast two-hybrid (RLL-Y2H) screening system
    Article Snippet: A smear band should be visible on agarose gel. .. Digest the purified PCR products with MmeI (NEB, CA) which yields a ∼110 bp target band, followed by low-melting gel purification.

    Mouse Assay:

    Article Title: Effects of Diet on Resource Utilization by a Model Human Gut Microbiota Containing Bacteroides cellulosilyticus WH2, a Symbiont with an Extensive Glycobiome
    Article Snippet: At 11 wk of age, male germ-free C57BL/6J mice (individually caged) were fed either a diet low in fat and rich in plant polysaccharides (LF/HPP) or high in fat and simple sugars (HF/HS). .. 500 ng of each fecal DNA extraction was diluted in 15 µL of TE buffer and digested with MmeI (4 U, New England Biolabs) in a 20 µL reaction supplemented with 10 pmoles of 12 bp DNA containing an MmeI restriction site (to improve the efficiency of restriction enzyme digestion) .

    Paired-end Tag:

    Article Title: Large-scale production of SAGE libraries from microdissected tissues, flow-sorted cells, and cell lines
    Article Snippet: The adapter–cDNA ligation products were digested with the type IIS tagging enzyme MmeI (NEB), releasing adapter-tag products with 2-nucleotide (nt) overhangs. .. Gel-purified scale-up PCR products were digested with the anchoring enzyme NlaIII, yielding tail-to-tail ligated ∼36-bp cDNA ditags with CATG overhangs.

    Plasmid Preparation:

    Article Title: Generating high accuracy peptide binding data in high throughput with yeast surface display and SORTCERY
    Article Snippet: .. Zymoprep Yeast Plasmid Miniprep I (Zymo Research) Isopropanole High-Fidelity DNA Polymerase (e.g. Phusion) Thermocycler Gel equipment PCR purification and gel extraction kits (QiaGen) MmeI (New England Biolabs): MmeI restriction enzyme, NEB Cut Smart Buffer, 1 mM SAM T4 Ligase Primers and oligos .. Dilute cells to OD600 of 0.05 in SD + CAA and grow for 8 h at 30 °C.

    Sample Prep:

    Article Title: Genome-wide identification of histone H2A and histone variant H2A.Z-interacting proteins by bPPI-seq
    Article Snippet: Then the DNA was amplified by MmeI-SD-1, MmeI-SD-2, MmeI-SD-3 and T7 primers to add a Mme I recognition site at both ends, followed by digestion with Mme I (New England Biolabs). .. After treatment with Klenow Enzyme (New England Biolabs), indexed libraries were prepared with a Multiplexing Sample Preparation Oligonucleotide Kit (Illumina) according to the user's manual.

    Article Title: Droplet Tn-Seq combines microfluidics with Tn-Seq for identifying complex single-cell phenotypes
    Article Snippet: Paragraph title: Sample preparation, sequencing, and fitness calculations ... Beads were then dried for 3 min at room temperature, and DNA was eluted off the beads with 12.7 μl of dH2 O. (3) In all, 11.49 μl of phi29 amplified DNA was then added to a MmeI digestion mix (two units NEB MmeI enzyme, 50 μM SAM, 1× CutSmart Buffer) in a total volume of 20 μl, and incubated for 2.5 h at 37 °C followed by 20 min at 65 °C. (4) In all, 1 μl of alkaline phosphatase (NEB - M0290S Calf Intestinal, CIP) was added to the sample and incubated for 1 h at 37 °C. (5) In total, 10 μl of magnetic beads plus 20 μl PEG solution per sample were used to wash the sample followed by elution in 14.3 μl of dH2 O. (6) T4 DNA ligase (NEB M0202L) was used to ligate DNA adapter barcodes by adding 13.12 μl DNA to 1 μl of 1:5 diluted adapter, 1× T4 DNA Ligase Reaction Buffer, and 400 units T4 DNA ligase, followed by incubation at 16 °C for 16 h, 65 °C for 10 min, and held at 10 °C. (7) In all, 10 μl magnetic beads plus 20 μl PEG solution were used to wash the sample followed by elution in 36 μl of dH2 O. (8) Adapter ligated DNA was then PCR amplified using Q5 high-fidelity DNA polymerase (NEB – M0491L) by adding 34 μl of DNA to 1X Q5 reaction buffer, 10 mM dNTPs, 0.45 μM of each primer (P1-M6-GAT-MmeI; P2-ADPT-Tnseq-primer; Supplementary Data ), one unit Q5 DNA polymerase, and incubated at 98 °C for 30 s, and 18–22 cycles of 98 °C for 10 s, 62 °C for 30 s, 72 °C for 15 s, followed by 72 °C for 2 min, and a 10 °C hold. (9) PCR products were gel purified and sequenced on an Illumina NextSeq 500 according to the manufacturer's protocol.

    Article Title: Generating high accuracy peptide binding data in high throughput with yeast surface display and SORTCERY
    Article Snippet: Paragraph title: 2.3 Deep Sequencing Sample Preparation (see ) ... Zymoprep Yeast Plasmid Miniprep I (Zymo Research) Isopropanole High-Fidelity DNA Polymerase (e.g. Phusion) Thermocycler Gel equipment PCR purification and gel extraction kits (QiaGen) MmeI (New England Biolabs): MmeI restriction enzyme, NEB Cut Smart Buffer, 1 mM SAM T4 Ligase Primers and oligos

    Ethanol Precipitation:

    Article Title: Targeted and genome-scale methylomics reveals gene body signatures in human cell lines
    Article Snippet: .. This was incubated at 50°C for 20 min, then 85°C for 20 min. Ethanol precipitation was performed again, and the pellet was resuspended to 50ul with a reaction mixture containing 2 units Mme I (NEB), 50 µM SAM and 1× NEBuffer 4. .. This was incubated at 37°C for 2 hours, then 80°C for 20 min. To this was added 1.66 µl of 10 µM adapter B, 6 µl 10mM ATP, and 3 µl T4 DNA ligase, and the mixture was incubated at 16°C for 4 hours, then 65°C for 15 min.

    Article Title: 5'-Serial Analysis of Gene Expression studies reveal a transcriptomic switch during fruiting body development in Coprinopsis cinerea
    Article Snippet: The cDNAs were digested by 10units of Mme I (New England Biolabs) at 37°C for 2 hours. .. Following ethanol precipitation with ammonium acetate at −70°C for 4 h, pellets were collected and resuspended in low-salt TE buffer.

    Next-Generation Sequencing:

    Article Title: Genome-wide identification of histone H2A and histone variant H2A.Z-interacting proteins by bPPI-seq
    Article Snippet: Then the DNA was amplified by MmeI-SD-1, MmeI-SD-2, MmeI-SD-3 and T7 primers to add a Mme I recognition site at both ends, followed by digestion with Mme I (New England Biolabs). .. The fragments between 250 and 500 bp were isolated for sequencing on an Illumina next-generation sequencing platform.

    DNA Extraction:

    Article Title: Effects of Diet on Resource Utilization by a Model Human Gut Microbiota Containing Bacteroides cellulosilyticus WH2, a Symbiont with an Extensive Glycobiome
    Article Snippet: .. 500 ng of each fecal DNA extraction was diluted in 15 µL of TE buffer and digested with MmeI (4 U, New England Biolabs) in a 20 µL reaction supplemented with 10 pmoles of 12 bp DNA containing an MmeI restriction site (to improve the efficiency of restriction enzyme digestion) . .. MmeI-digested DNA was subsequently purified using 125 µL of AMPure beads (after washing the beads once with 100 µL of sizing solution (1.2 M NaCl and 8.4% PEG 8000)).

    Construct:

    Article Title: Targeted and genome-scale methylomics reveals gene body signatures in human cell lines
    Article Snippet: To construct the MSCC Hpa II library, 2 µg of PGP 1 lymphocyte gDNA were assembled into a 100 µl reaction with 20 units Hpa II (NEB) in 1× NEBuffer 1, incubated at 37°C 2 hours, then 65°C 20 min. To this was added 1.66 µl of 10 µM adapter A, 12 µl 10 mM ATP, and 120 units T4 DNA ligase (NEB). .. This was incubated at 50°C for 20 min, then 85°C for 20 min. Ethanol precipitation was performed again, and the pellet was resuspended to 50ul with a reaction mixture containing 2 units Mme I (NEB), 50 µM SAM and 1× NEBuffer 4.

    Article Title: Development and application of a recombination-based library versus library high- throughput yeast two-hybrid (RLL-Y2H) screening system
    Article Snippet: Digest the purified PCR products with MmeI (NEB, CA) which yields a ∼110 bp target band, followed by low-melting gel purification. .. Add P5 and P7 adapters to purified 110bp fragments by T4 ligation at 16°C for more than 2 h. Amplify the ligation products using primers (5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ and 5′-CAAGCAGAAGACGGCATACGAGAT(index)GTGACTGGAGTTCAGACGTGTGCTC TTCCGATC-3′) to construct high-throughput sequencing library.

    High Throughput Screening Assay:

    Article Title: Development and application of a recombination-based library versus library high- throughput yeast two-hybrid (RLL-Y2H) screening system
    Article Snippet: Paragraph title: High-throughput DNA library construction ... Digest the purified PCR products with MmeI (NEB, CA) which yields a ∼110 bp target band, followed by low-melting gel purification.

    Gel Extraction:

    Article Title: Primer Extension Enrichment Reaction (PEER): a new subtraction method for identification of genetic differences between biological specimens
    Article Snippet: .. MmeI digestion : The ligation products are digested with 5 U MmeI (NEB) for 2 h. The cleaved DNA is resolved in 10% polyacrylamide gel, the resulting 50 bp fragment is cut out, isolated from the gel with QIAquick gel extraction kit (Qiagen) and resuspended in 50 μl of 10 mM Tris (pH 8). .. Blocking of MmeI-tagged primers : 25 μl Of the fragment is used as primer with 10 μl Driver bio-dsDNA template in the presence of 2.5 mM each ddNTPs-bio (Biotin-11-ddNTPs, NEN® Life Science Products Inc., Boston, MA), 0.025 mM each dNTPs (Roche) and Thermo Sequenase™ (Amersham Pharmacia Biotech, Inc., Piscataway, NJ).

    Article Title: Generating high accuracy peptide binding data in high throughput with yeast surface display and SORTCERY
    Article Snippet: .. Zymoprep Yeast Plasmid Miniprep I (Zymo Research) Isopropanole High-Fidelity DNA Polymerase (e.g. Phusion) Thermocycler Gel equipment PCR purification and gel extraction kits (QiaGen) MmeI (New England Biolabs): MmeI restriction enzyme, NEB Cut Smart Buffer, 1 mM SAM T4 Ligase Primers and oligos .. Dilute cells to OD600 of 0.05 in SD + CAA and grow for 8 h at 30 °C.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs mme i
    Schematic of DALEC . Brown and green represent priming regions for Solexa bridge amplification primers. Blue indicates the primer binding region for the Solexa sequencing reaction. TCCGAC is the <t>Mme</t> I recognition sequence and the sequence immediately upstream of it (black) is the variable region. The inset gives detailed information for linkers A and B.
    Mme I, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mme i/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mme i - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    77
    New England Biolabs mme i gene
    Purified wild-type <t>Mme</t> I in twofold serial dilutions from 16 to 1 µg on a 10–20% Tris–glycine gel (1 mm × 12 wells; Invitrogen, catalog No. EC61352) with an NEB 10–250 kDa protein ladder (NEB,
    Mme I Gene, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 77/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mme i gene/product/New England Biolabs
    Average 77 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mme i gene - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    77
    New England Biolabs mme i enzyme
    Purified wild-type <t>Mme</t> I in twofold serial dilutions from 16 to 1 µg on a 10–20% Tris–glycine gel (1 mm × 12 wells; Invitrogen, catalog No. EC61352) with an NEB 10–250 kDa protein ladder (NEB,
    Mme I Enzyme, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 77/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mme i enzyme/product/New England Biolabs
    Average 77 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mme i enzyme - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    Image Search Results


    Schematic of DALEC . Brown and green represent priming regions for Solexa bridge amplification primers. Blue indicates the primer binding region for the Solexa sequencing reaction. TCCGAC is the Mme I recognition sequence and the sequence immediately upstream of it (black) is the variable region. The inset gives detailed information for linkers A and B.

    Journal: BMC Genomics

    Article Title: Distributed probing of chromatin structure in vivo reveals pervasive chromatin accessibility for expressed and non-expressed genes during tissue differentiation in C. elegans

    doi: 10.1186/1471-2164-11-465

    Figure Lengend Snippet: Schematic of DALEC . Brown and green represent priming regions for Solexa bridge amplification primers. Blue indicates the primer binding region for the Solexa sequencing reaction. TCCGAC is the Mme I recognition sequence and the sequence immediately upstream of it (black) is the variable region. The inset gives detailed information for linkers A and B.

    Article Snippet: Ligation to Linker B Linker B was purchased as two separate oligonucleotides (5'P-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCGGTGGTCGCCGTATCATT-OH3', 5'OH-TCATCTTTCCCTACACGACGCTCTTCCGATCTNN-OH3') and hybridized using the same procedure as described for Linker A. Mme I products were ligated to Linker B using the following 50 μl reaction mix: 10.0 μl Mme I product, 1.0 μl of 0.05 mM Linker B, 5.0 μl 10× ligase buffer, 3.0 μl T4 DNA ligase (2,000 U/μl; NEB #M0202), 31.0 μl dH2 O. Ligations were performed overnight using a PCR machine.

    Techniques: Amplification, Binding Assay, Sequencing

    Purified wild-type Mme I in twofold serial dilutions from 16 to 1 µg on a 10–20% Tris–glycine gel (1 mm × 12 wells; Invitrogen, catalog No. EC61352) with an NEB 10–250 kDa protein ladder (NEB,

    Journal: Acta Crystallographica Section F: Structural Biology and Crystallization Communications

    Article Title: Crystallization and preliminary crystallographic analysis of the type IIL restriction enzyme MmeI in complex with DNA

    doi: 10.1107/S1744309111028041

    Figure Lengend Snippet: Purified wild-type Mme I in twofold serial dilutions from 16 to 1 µg on a 10–20% Tris–glycine gel (1 mm × 12 wells; Invitrogen, catalog No. EC61352) with an NEB 10–250 kDa protein ladder (NEB,

    Article Snippet: The Mme I gene was placed under T7 promoter control in the vector pSapv6 and transformed into the methionine-auxotroph strain T7 Express Crystal C3022 cells (NEB).

    Techniques: Purification

    ( a ) Typical crystals of Mme I in complex with 5-bromouracil-substituted DNA. The red scale bar is 100 µm in length. ( b ) The best X-ray diffraction pattern of the Mme I–brominated DNA complex recorded on APS NE-CAT 24ID-C with 1°

    Journal: Acta Crystallographica Section F: Structural Biology and Crystallization Communications

    Article Title: Crystallization and preliminary crystallographic analysis of the type IIL restriction enzyme MmeI in complex with DNA

    doi: 10.1107/S1744309111028041

    Figure Lengend Snippet: ( a ) Typical crystals of Mme I in complex with 5-bromouracil-substituted DNA. The red scale bar is 100 µm in length. ( b ) The best X-ray diffraction pattern of the Mme I–brominated DNA complex recorded on APS NE-CAT 24ID-C with 1°

    Article Snippet: The Mme I gene was placed under T7 promoter control in the vector pSapv6 and transformed into the methionine-auxotroph strain T7 Express Crystal C3022 cells (NEB).

    Techniques: