mlui  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    MluI
    Description:
    MluI 5 000 units
    Catalog Number:
    R0198L
    Price:
    264
    Size:
    5 000 units
    Category:
    Restriction Enzymes
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs mlui
    MluI
    MluI 5 000 units
    https://www.bioz.com/result/mlui/product/New England Biolabs
    Average 99 stars, based on 84 article reviews
    Price from $9.99 to $1999.99
    mlui - by Bioz Stars, 2019-10
    99/100 stars

    Images

    1) Product Images from "The abundance of Fob1 modulates the efficiency of rRFBs to stall replication forks"

    Article Title: The abundance of Fob1 modulates the efficiency of rRFBs to stall replication forks

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkx655

    Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_MEM_3rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_MEM_3rRFBs+ (8908 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note the insertion of an EcoRI fragment containing the three putative Fob1 binding sites expected to act as RFBs (indicated in red), described by Kobayashi ( 20 ). ( B ) Map of the 3708 bp linear fragment generated by digestion of pYAC_MEM_3rRFBs+ with SwaI and BamHI showing the relative position of the three putative RFBs. ( C ) Map of the 5186 bp linear fragment generated by digestion of pYAC_MEM_3rRFBs+ with EcoRV and MluI showing the relative position of the three putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3708 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5186-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks and the distance separating them.
    Figure Legend Snippet: Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_MEM_3rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_MEM_3rRFBs+ (8908 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note the insertion of an EcoRI fragment containing the three putative Fob1 binding sites expected to act as RFBs (indicated in red), described by Kobayashi ( 20 ). ( B ) Map of the 3708 bp linear fragment generated by digestion of pYAC_MEM_3rRFBs+ with SwaI and BamHI showing the relative position of the three putative RFBs. ( C ) Map of the 5186 bp linear fragment generated by digestion of pYAC_MEM_3rRFBs+ with EcoRV and MluI showing the relative position of the three putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3708 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5186-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks and the distance separating them.

    Techniques Used: Two-Dimensional Gel Electrophoresis, Binding Assay, Activated Clotting Time Assay, Generated

    Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_3′rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_3′rRFBs+ (8175 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the three putative Fob1 binding sites expected to act as RFBs (indicated in red and white), described by Kobayashi ( 20 ), are equally distanced. ( B ) Map of the 3710-bp linear fragment generated by digestion of pYAC_AC_3′rRFBs+ with FspI and BamHI showing the relative position of the three putative RFBs. ( C ) Map of the 4454-bp linear fragment generated by digestion of pYAC_AC_3′rRFBs+ with EcoRV and MluI showing the relative position of the three putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the FspI-BamHI 3710-bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 4454-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks and the distance separating them. For comparison, the densitometric profile corresponding to pYAC_MEM_3rRFBs shown in Figure 4H is presented on top.
    Figure Legend Snippet: Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_3′rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_3′rRFBs+ (8175 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the three putative Fob1 binding sites expected to act as RFBs (indicated in red and white), described by Kobayashi ( 20 ), are equally distanced. ( B ) Map of the 3710-bp linear fragment generated by digestion of pYAC_AC_3′rRFBs+ with FspI and BamHI showing the relative position of the three putative RFBs. ( C ) Map of the 4454-bp linear fragment generated by digestion of pYAC_AC_3′rRFBs+ with EcoRV and MluI showing the relative position of the three putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the FspI-BamHI 3710-bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 4454-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks and the distance separating them. For comparison, the densitometric profile corresponding to pYAC_MEM_3rRFBs shown in Figure 4H is presented on top.

    Techniques Used: Two-Dimensional Gel Electrophoresis, Binding Assay, Activated Clotting Time Assay, Generated

    Genetic map and 2D gel analysis of linear fragments corresponding to pYAC_MEM. ( A ) Genetic map of pYAC_MEM (7966 bp) showing its most relevant features: clockwise starting with the replication origin ARS4 (indicated in green), URA3 gene active in Saccharomyces cerevisiae (indicated in light blue), L1 lambda DNA used for hybridization (indicated in yellow), HIS3 gene active in S. cerevisiae (indicated in light blue), L2 lambda DNA used for hybridization (indicated in yellow), the ColE1 replication origin active only in Escherichia coli (indicated in gray), the ampicillin resistance gene active only in E. coli (indicated in gray) and the budding yeast centromeric sequence CEN6 (indicated in orange). The sites for specific restriction endonucleases are indicated outside the map. In addition, a magenta triangle points the position located 180° apart from the replication origin ARS4. ( B ) Map of the 2764-bp linear fragment generated by digestion of pYAC_MEM with SwaI and BamHI. ( C ) Map of the 4245-bp linear fragment generated by digestion of pYAC_MEM with EcoRV and MluI. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 2764 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 4245-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). De-localized termination signals are indicated in magenta.
    Figure Legend Snippet: Genetic map and 2D gel analysis of linear fragments corresponding to pYAC_MEM. ( A ) Genetic map of pYAC_MEM (7966 bp) showing its most relevant features: clockwise starting with the replication origin ARS4 (indicated in green), URA3 gene active in Saccharomyces cerevisiae (indicated in light blue), L1 lambda DNA used for hybridization (indicated in yellow), HIS3 gene active in S. cerevisiae (indicated in light blue), L2 lambda DNA used for hybridization (indicated in yellow), the ColE1 replication origin active only in Escherichia coli (indicated in gray), the ampicillin resistance gene active only in E. coli (indicated in gray) and the budding yeast centromeric sequence CEN6 (indicated in orange). The sites for specific restriction endonucleases are indicated outside the map. In addition, a magenta triangle points the position located 180° apart from the replication origin ARS4. ( B ) Map of the 2764-bp linear fragment generated by digestion of pYAC_MEM with SwaI and BamHI. ( C ) Map of the 4245-bp linear fragment generated by digestion of pYAC_MEM with EcoRV and MluI. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 2764 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 4245-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). De-localized termination signals are indicated in magenta.

    Techniques Used: Two-Dimensional Gel Electrophoresis, Lambda DNA Preparation, Hybridization, Sequencing, Generated

    Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_10rRFBs+ isolated from cells that overexpress Fob1 and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_10rRFBs+ (8916 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the fragment inserted at the unique SalI site of pYAC_MEM contained the 10 Fob1 binding sites described by Kobayashi ( 20 ) that were confirmed to act as RFBs in vivo (See Figures 4 and 5 ). ( B ) Map of the 3705-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with SwaI and BamHI showing the relative position of the ten putative RFBs. ( C ) Map of the 5194-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with EcoRV and MluI showing the relative position of the 10 putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3705 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5194 bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the six most distal spots observed on the simple-Y arc shown in ( D ) is presented in ( H ) indicating the height of the peaks. For comparison, the densitometric profile corresponding to the 3705-bp SwaI-BamHI of pYAC_AC_10rRFBs isolated from the top2-td strain shown in Figure 4H is presented on top.
    Figure Legend Snippet: Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_10rRFBs+ isolated from cells that overexpress Fob1 and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_10rRFBs+ (8916 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the fragment inserted at the unique SalI site of pYAC_MEM contained the 10 Fob1 binding sites described by Kobayashi ( 20 ) that were confirmed to act as RFBs in vivo (See Figures 4 and 5 ). ( B ) Map of the 3705-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with SwaI and BamHI showing the relative position of the ten putative RFBs. ( C ) Map of the 5194-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with EcoRV and MluI showing the relative position of the 10 putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3705 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5194 bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the six most distal spots observed on the simple-Y arc shown in ( D ) is presented in ( H ) indicating the height of the peaks. For comparison, the densitometric profile corresponding to the 3705-bp SwaI-BamHI of pYAC_AC_10rRFBs isolated from the top2-td strain shown in Figure 4H is presented on top.

    Techniques Used: Two-Dimensional Gel Electrophoresis, Isolation, Binding Assay, Activated Clotting Time Assay, In Vivo, Generated

    Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_10rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_10rRFBs+ (8916 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the fragment inserted at the unique SalI site of pYAC_MEM contained the 10 Fob1 binding sites described by Kobayashi ( 20 ) that were confirmed to act as RFBs in vivo (See Figures 4 and 5 ). ( B ) Map of the 3705-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with SwaI and BamHI showing the relative position of the 10 putative RFBs. ( C ) Map of the 5194-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with EcoRV and MluI showing the relative position of the 10 putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3705-bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5194-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the six most distal spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks.
    Figure Legend Snippet: Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_10rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_10rRFBs+ (8916 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the fragment inserted at the unique SalI site of pYAC_MEM contained the 10 Fob1 binding sites described by Kobayashi ( 20 ) that were confirmed to act as RFBs in vivo (See Figures 4 and 5 ). ( B ) Map of the 3705-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with SwaI and BamHI showing the relative position of the 10 putative RFBs. ( C ) Map of the 5194-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with EcoRV and MluI showing the relative position of the 10 putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3705-bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5194-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the six most distal spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks.

    Techniques Used: Two-Dimensional Gel Electrophoresis, Binding Assay, Activated Clotting Time Assay, In Vivo, Generated

    2) Product Images from "A Systematic Analysis on DNA Methylation and the Expression of Both mRNA and microRNA in Bladder Cancer"

    Article Title: A Systematic Analysis on DNA Methylation and the Expression of Both mRNA and microRNA in Bladder Cancer

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0028223

    Validation results of BSP for DNA methylation and RT-qPCR for gene expression. A. Validation results of MMSDK with BSP. To compare the BSP-Sanger sequencing data and deep sequencing MMSDK data, the MluI loci that were determined to be differentially methylated on average by deep sequencing were validated using BSP. The height of the columns represents the log2-transformed average fold change (tumor/normal) in methylation level across the 9 patients. B. BSP and RT-qPCR results for four cancer-associated genes examined in 33 bladder cancer patients. The methylation levels of promoters of four selected genes (SLIT2, HIC1, RASRAl1, KRT17) and their expression level were evaluated in a panel of 33 samples. The height of the columns represents the log2 average fold change (tumor/normal) in methylation level (blue) or expression level (red) across all patients. The bars represent the standard error. The number of samples (n) used in the validation assay is indicated beside each standard error bar.
    Figure Legend Snippet: Validation results of BSP for DNA methylation and RT-qPCR for gene expression. A. Validation results of MMSDK with BSP. To compare the BSP-Sanger sequencing data and deep sequencing MMSDK data, the MluI loci that were determined to be differentially methylated on average by deep sequencing were validated using BSP. The height of the columns represents the log2-transformed average fold change (tumor/normal) in methylation level across the 9 patients. B. BSP and RT-qPCR results for four cancer-associated genes examined in 33 bladder cancer patients. The methylation levels of promoters of four selected genes (SLIT2, HIC1, RASRAl1, KRT17) and their expression level were evaluated in a panel of 33 samples. The height of the columns represents the log2 average fold change (tumor/normal) in methylation level (blue) or expression level (red) across all patients. The bars represent the standard error. The number of samples (n) used in the validation assay is indicated beside each standard error bar.

    Techniques Used: DNA Methylation Assay, Quantitative RT-PCR, Expressing, Sequencing, Methylation, Transformation Assay

    3) Product Images from "The use of an adeno-associated viral vector for efficient bicistronic expression of two genes in the CNS"

    Article Title: The use of an adeno-associated viral vector for efficient bicistronic expression of two genes in the CNS

    Journal:

    doi: 10.1007/978-1-4939-0777-9_16

    (A) psubCMV-2A-WPRE plasmid map showing NheI site for cloning a transgene immediately downstream of the CMV promoter (and upstream of the 2A sequence) and an MluI site for cloning a transgene downstream of the 2A sequence. (B) Nucleotide sequence showing
    Figure Legend Snippet: (A) psubCMV-2A-WPRE plasmid map showing NheI site for cloning a transgene immediately downstream of the CMV promoter (and upstream of the 2A sequence) and an MluI site for cloning a transgene downstream of the 2A sequence. (B) Nucleotide sequence showing

    Techniques Used: Plasmid Preparation, Clone Assay, Sequencing

    4) Product Images from "Diversity of Proteolytic Clostridium botulinum Strains, Determined by a Pulsed-Field Gel Electrophoresis Approach"

    Article Title: Diversity of Proteolytic Clostridium botulinum Strains, Determined by a Pulsed-Field Gel Electrophoresis Approach

    Journal:

    doi: 10.1128/AEM.71.3.1311-1317.2005

    Digestion patterns of type A (ATCC 3502) and type B (FT 243) proteolytic C. botulinum strains using the rare-cutting restriction enzymes ApaI, AscI, MluI, NruI, PmeI, and RsrII. The pulse time ramp was 1 to 22 s, and the running time was 20 h. The outermost
    Figure Legend Snippet: Digestion patterns of type A (ATCC 3502) and type B (FT 243) proteolytic C. botulinum strains using the rare-cutting restriction enzymes ApaI, AscI, MluI, NruI, PmeI, and RsrII. The pulse time ramp was 1 to 22 s, and the running time was 20 h. The outermost

    Techniques Used:

    5) Product Images from "Characterization of Genes Encoding for Acquired Bacitracin Resistance in Clostridium perfringens"

    Article Title: Characterization of Genes Encoding for Acquired Bacitracin Resistance in Clostridium perfringens

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0044449

    PFGE and hybridization analysis of I-CeuI and MluI double-digested DNA of the bacitracin resistant C. perfringens strain c1261_A. PFGE analysis of C. perfringens strain c1261_A total DNA (A). Southern blot of C. perfringens isolate c1261_A total DNA probed with rrn (B) and with bcrB (C). Sizes (in kilobases) are indicated on the left.
    Figure Legend Snippet: PFGE and hybridization analysis of I-CeuI and MluI double-digested DNA of the bacitracin resistant C. perfringens strain c1261_A. PFGE analysis of C. perfringens strain c1261_A total DNA (A). Southern blot of C. perfringens isolate c1261_A total DNA probed with rrn (B) and with bcrB (C). Sizes (in kilobases) are indicated on the left.

    Techniques Used: Hybridization, Southern Blot

    6) Product Images from "Novel Human Polyomavirus Noncoding Control Regions Differ in Bidirectional Gene Expression according to Host Cell, Large T-Antigen Expression, and Clinically Occurring Rearrangements"

    Article Title: Novel Human Polyomavirus Noncoding Control Regions Differ in Bidirectional Gene Expression according to Host Cell, Large T-Antigen Expression, and Clinically Occurring Rearrangements

    Journal:

    doi: 10.1128/JVI.02231-17

    Rearranged BKPyV Dunlop NCCR showed higher EVGR expression than did BKPyVww NCCR in HEK293 cells. (A) Schematic representation of the HPyV genome: noncoding control region (NCCR); early viral gene region (EVGR, in red) encoding large and small T antigens (Tags), alternative spliced Tags; microRNAs (blue arrow); late viral gene region (LVGR) encoding structural proteins (Vp1, Vp2, and Vp3) and the agnoprotein (agno) only in BKPyV and JCPyV. (B) Representation of the bidirectional reporter vector pRG13D12, containing the following: NCCR (in gray) in the early to late orientation cloned via restriction sites MluI and BssHII; the red fluorescence protein dsRed2, used as a marker of EVGR expression; the enhanced green fluorescence protein, EGFP, in the opposite orientation, used as a marker of LVGR expression; SV40 polyadenylation signals [SV40 poly(A)] for the dsRed2 and EGFP expression cassette; E1 ori for bacterial plasmid replication; the ampicillin-resistant gene (Amp) for selecting Escherichia coli transformants. (C) Flow cytometry of HEK293 cells 2 dpt with the pRG13D12 reporter vector alone or containing the NCCR of the archetype BKPyVww, the BKPyV(DUN), or the BKPyV(DUN-R) in the reverse orientation. x axis, EGFP fluorescence; y axis, dsRed2 fluorescence; 10,000 control transfected cells were gated for the live gate, while 5,000 transfected cells were gated for the P3 (Q1, Q2, and Q4) gate. Q1, Q4, and Q2 depict cells expressing red fluorescence, green fluorescence, and both, respectively. Ex, excitation wavelength; Em, emission wavelength. (D) Quantification of cells: red bars, sum of red cells (Q1 + Q2); green bars, sum of green cells (Q2 + Q4); yellow bars, red- and green-fluorescence double-positive cells (Q2); black bars, nonfluorescent cells (Q3, negative). Means with standard deviations (SD) from three independent replicates are shown. (E) Normalized mean fluorescence intensity (MFI). The weighted MFI was calculated for each measurement (see formulas in Materials and Methods); late expression was normalized to BKPyVww NCCR (green MFI was set as 100), while early expression was normalized to BKPyVww NCCR (red MFI was set as 1). Means with SD from three independent replicates are shown.
    Figure Legend Snippet: Rearranged BKPyV Dunlop NCCR showed higher EVGR expression than did BKPyVww NCCR in HEK293 cells. (A) Schematic representation of the HPyV genome: noncoding control region (NCCR); early viral gene region (EVGR, in red) encoding large and small T antigens (Tags), alternative spliced Tags; microRNAs (blue arrow); late viral gene region (LVGR) encoding structural proteins (Vp1, Vp2, and Vp3) and the agnoprotein (agno) only in BKPyV and JCPyV. (B) Representation of the bidirectional reporter vector pRG13D12, containing the following: NCCR (in gray) in the early to late orientation cloned via restriction sites MluI and BssHII; the red fluorescence protein dsRed2, used as a marker of EVGR expression; the enhanced green fluorescence protein, EGFP, in the opposite orientation, used as a marker of LVGR expression; SV40 polyadenylation signals [SV40 poly(A)] for the dsRed2 and EGFP expression cassette; E1 ori for bacterial plasmid replication; the ampicillin-resistant gene (Amp) for selecting Escherichia coli transformants. (C) Flow cytometry of HEK293 cells 2 dpt with the pRG13D12 reporter vector alone or containing the NCCR of the archetype BKPyVww, the BKPyV(DUN), or the BKPyV(DUN-R) in the reverse orientation. x axis, EGFP fluorescence; y axis, dsRed2 fluorescence; 10,000 control transfected cells were gated for the live gate, while 5,000 transfected cells were gated for the P3 (Q1, Q2, and Q4) gate. Q1, Q4, and Q2 depict cells expressing red fluorescence, green fluorescence, and both, respectively. Ex, excitation wavelength; Em, emission wavelength. (D) Quantification of cells: red bars, sum of red cells (Q1 + Q2); green bars, sum of green cells (Q2 + Q4); yellow bars, red- and green-fluorescence double-positive cells (Q2); black bars, nonfluorescent cells (Q3, negative). Means with standard deviations (SD) from three independent replicates are shown. (E) Normalized mean fluorescence intensity (MFI). The weighted MFI was calculated for each measurement (see formulas in Materials and Methods); late expression was normalized to BKPyVww NCCR (green MFI was set as 100), while early expression was normalized to BKPyVww NCCR (red MFI was set as 1). Means with SD from three independent replicates are shown.

    Techniques Used: Expressing, Plasmid Preparation, Clone Assay, Fluorescence, Marker, Flow Cytometry, Cytometry, Transfection, Electron Microscopy

    Related Articles

    Clone Assay:

    Article Title: The association of XRCC1 polymorphism with osteosarcoma risk, clinicopathologic features, and prognosis in a Chinese Han population
    Article Snippet: A fragment (from −818 to −22) in the XRCC1 promoter region from the subjects homozygous for rs3213245 T or C allele was amplified using the following primers: 5′-AAACGCGTTT-GCGTAGAATCCAGGTTCC-3′ and 5′-AAAGATCTTGGC-CAGAAGGATGAGGTAG-3′. .. Both the amplified fragments and pGL3-basic vector were digested with Mlu I (A^CGCGT/TGCGC^A) and Bgl II (A^GATCT/TCTAG^A) enzymes (New England BioLabs Inc., Ipswich, MA, USA), and the amplified fragments were cloned into pGL3-basic vector. .. Subsequently, the vectors were sequenced to validate the orientation and integrity of plasmid construct.

    Article Title: The ets-Related Transcription Factor GABP Directs Bidirectional Transcription
    Article Snippet: The 241 general promoters tested for GABP ChIP enrichment were previously cloned into the plasmid pGL3 Basic (Promega) and verified to be functional promoters as part of the ENCODE project [ ]. .. We amplified these promoters, consisting of the sequence from approximately −500 to +50 bp relative to the start of transcription, by using common primers flanking the MCS (Forward 5′-CATACGCTCTCCATCAAAACAAA-3′, Reverse 5′-TTTATGTTTTTGGCGTCTTCCAT-3′), digested them with Mlu I and Bgl II (New England BioLabs), and then recloned them into a pGL3 Basic vector with a reversed MCS, yielding a luciferase reporter plasmid with a reversed promoter sequence.

    Article Title: Identification and characterization of the Non-race specific Disease Resistance 1 (NDR1) orthologous protein in coffee
    Article Snippet: To get directional cloning, the underlined nucleotide sequence was added to the forward primers. .. Selected clones were digested with Mlu -I restriction enzyme (R0198L, NEB, OZYME, Saint Quentin Yvelines, France) before overnight recombination with the binary vector pMDC32 [ ] using the LR Clonase II kit (Invitrogen). .. The N-terminally GFP6-tagged version was produced to examine the subcellular localization of CaNDR1a.

    Article Title: H19 non coding RNA-derived miR-675 enhances tumorigenesis and metastasis of breast cancer cells by downregulating c-Cbl and Cbl-b
    Article Snippet: All fragments of Cbl-b and 3′UTR of c-Cbl were cloned between Spe I and Hin dIII enzyme site. .. CDS1 of c-Cbl was cloned between Spe I and Pme I and CDS2 between Spe I and Mlu I (New England Biolabs). .. Fragments were generated by PCR (primers are listed in ).

    Article Title: Efficient method for site-directed mutagenesis in large plasmids without subcloning
    Article Snippet: Successful mutagenesis was confirmed by restriction analysis using NdeI and MluI restriction enzymes (New England Biolabs, Ipswich, MA): 2 μl of Linear Modified DNA for each mutation type was incubated with or without 5 units of restriction enzymes for 30 min at 37°C. .. Successful mutagenesis was confirmed by restriction analysis using NdeI and MluI restriction enzymes (New England Biolabs, Ipswich, MA): 2 μl of Linear Modified DNA for each mutation type was incubated with or without 5 units of restriction enzymes for 30 min at 37°C.

    Article Title: Quorum-Sensing and BvrR/BvrS Regulation, the Type IV Secretion System, Cyclic Glucans, and BacA in the Virulence of Brucella ovis: Similarities to and Differences from Smooth Brucellae
    Article Snippet: The EcoRI insert of the resulting recombinant plasmid was cloned, in the direction opposite that of lacZ , in pGEM-7Zf, and then the SacI-XbaI insert was cloned in pUC19 to obtain plasmid pNVvirPA03. .. The Kanr gene was PCR amplified from pUC4K with primers KanF-MluI and KanR-EcoNI, cloned into pGEM-T, extracted by digestion with MluI (NEB) and partial digestion with EcoNI (NEB), and ligated to pNVvirPA03 cut with the same restriction enzymes. .. The SacI-XbaI insert DNA of the resulting plasmid, bearing inactivated virB2 and virB3 , was ligated to SacI-XbaI-digested pCVD442 to afford pNVvirPA05.

    Article Title: A Diagnostic HIV-1 Tropism System Based on Sequence Relatedness
    Article Snippet: After primer annealing at 65°C for 5 min, 42°C for 2 min, and 25°C for 10 min, reverse transcription was conducted at 45°C for 30 min, 92°C for 1 min, followed by PCR at 40 cycles of 92°C for 20 s, 55°C for 20 s, and 68°C for 3 min, and then extension was at 68°C for 5 min. For the 2nd, nested, PCR for envelope and for introducing the cloning sites MluI and NgoMIV, the Pfu -ultraII Fusion HS DNA polymerase was used (Agilent Technologies, Basel, Switzerland). .. Primers were F_6435M (CYA CCA ACG CGT GTG TAC CCA C) and R_8319N (TGA RTA TCC CTG CCG GCC TCT ATT YAY TAT AGA AA); cycling conditions were 95°C for 2 min, 35 cycles of 95°C for 20 s, 50°C for 20 s, and 72°C for 1 min and 20 s, followed by an extension at 72°C for 3 min. Products were cut with MluI and NgoMIV (New England Biolabs; Bioconcept, Allschwil, Switzerland) and purified over a 0.8% agarose gel.

    Article Title: Role of N-Linked Glycans in a Human Immunodeficiency Virus Envelope Glycoprotein: Effects on Protein Function and the Neutralizing Antibody Response
    Article Snippet: To generate plasmids for recovery of VSV recombinants expressing Env glycosylation mutants, pBS-89.6G, pBS-89.6G(4), pBS-89.6G(4-7), and pBS-89.6G(2-7) were digested with Xho I and Nhe I restriction enzymes (New England Biolabs) and cloned into Xho I and Nhe I sites between the VSV G and L genes of pVSV-XN2, which encodes the entire VSV antigenome ( ). .. The PCR product was digested with Mlu I and Nhe I restriction enzymes (New England Biolabs) and ligated to pVSVΔG-JRFLG-GFP , which had previously been digested with Mlu I and Nhe I to remove the JRFLG insert.

    Article Title: Regulation of miR-146a by RelA/NFkB and p53 in STHdhQ111/HdhQ111 Cells, a Cell Model of Huntington's Disease
    Article Snippet: For luciferase reporter assays, we cloned two fragments of the 3′ UTR of human p53 into pmiR-Report vector (Ambion, USA), one comprising of 150 bp (position 733–739) containing miR-125b recognition site and the other comprising of 136 bp (position 234–256) containing miR-150 recognition site. .. These regions were amplified by PCR from human genomic DNA and cloned in vector using the MluI and HindIII (NEB, USA) sites. .. The constructs were named p53-UTR1 and p53-UTR2 respectively.

    Article Title: Development of human-like scFv-Fc antibodies neutralizing Botulinum toxin serotype B
    Article Snippet: The library construction consisted of the cloning of the VL fragments into pHAL35 (BoNT/B2-LC library) or pHAL32 vector (BoNT/B2-HC library), and then the cloning of the VH fragments into the same vector, containing the VL repertoire. .. For this, the pHAL35 or pHAL32 vector and the VL fragments were digested with MluI and NotI (New England Biolabs, Frankfurt, Germany), the enzymes were inactivated, pHAL35 or pHAL32 was dephosphorylated using calf intestinal phosphatase (MBI, Fermentas), and the DNA was purified.

    Article Title: Lym-1 Chimeric Antigen Receptor T Cells Exhibit Potent Anti-Tumor Effects against B-Cell Lymphoma
    Article Snippet: For comparison purposes, a second generation CD19 CAR comprised of a CD19 specific targeting scFv derived from antibody FMC63, a CD8α leader sequence, a (G4S)3 linker between the VH and the VL domains, a CD8α hinge, a CD8α transmembrane domain followed by 4-1BB co-stimulatory domain, and intact intracellular CD3ζ, were cloned between the EcoRI and MluI restriction sites into the lentiviral vector pLVX-EF1α-IRES-Zsgreen (Clontech, Mountain View, CA, USA). .. For this study, the IRES-ZsGreen moiety was removed by restriction enzyme digestion with EcoRI and MluI (NEB, Ipswich, MA, USA), prior to insertion of the CAR encoding gene.

    Article Title: Post-Exposure Protection in Mice against Sudan Virus by a Two Antibody Cocktail
    Article Snippet: [ ] Second, the VH PCR fragments were cloned. .. A total of 5 µg pHAL35 and 2 µg VL were digested using 50 U MluI and 50 U NotI (NEB, Frankfurt, Germany) in a 100 µL reaction volume for 2 h at 37 °C.

    Article Title: THE ROLE OF CYTOKINES IN UBD PROMOTER REGULATION AND MALLORY-DENK BODY-LIKE AGGRESOMES
    Article Snippet: The sequence used to design the primers is named: in the mouse genome, in the NIH website. .. The different promoters were cloned in the pGL3Luc+ in the cloning site (Promega, Madison, WI): XhoI and MLUI for the IIL, and SacI for D1, D2, and D3 promoter (New England Biolabs, Ipswich, MA). .. PCR was performed using mouse genomic DNA from mouse liver and primers ( ): PCR was done with Phusion® Flash High-Fidelity PCR (Finnzymes, Woburn, Massachusetts) on 10 ng of mouse genomic DNA or 2 ng of mouse cDNA, with the following conditions for PCR: 98°C for 30 s, and then 40 cycles at 98°C for 15 s, 60°C for 30 s, 72°C 30 s, and finally 5 min at 72°C.

    Amplification:

    Article Title: The association of XRCC1 polymorphism with osteosarcoma risk, clinicopathologic features, and prognosis in a Chinese Han population
    Article Snippet: A fragment (from −818 to −22) in the XRCC1 promoter region from the subjects homozygous for rs3213245 T or C allele was amplified using the following primers: 5′-AAACGCGTTT-GCGTAGAATCCAGGTTCC-3′ and 5′-AAAGATCTTGGC-CAGAAGGATGAGGTAG-3′. .. Both the amplified fragments and pGL3-basic vector were digested with Mlu I (A^CGCGT/TGCGC^A) and Bgl II (A^GATCT/TCTAG^A) enzymes (New England BioLabs Inc., Ipswich, MA, USA), and the amplified fragments were cloned into pGL3-basic vector. .. Subsequently, the vectors were sequenced to validate the orientation and integrity of plasmid construct.

    Article Title: The ets-Related Transcription Factor GABP Directs Bidirectional Transcription
    Article Snippet: The 241 general promoters tested for GABP ChIP enrichment were previously cloned into the plasmid pGL3 Basic (Promega) and verified to be functional promoters as part of the ENCODE project [ ]. .. We amplified these promoters, consisting of the sequence from approximately −500 to +50 bp relative to the start of transcription, by using common primers flanking the MCS (Forward 5′-CATACGCTCTCCATCAAAACAAA-3′, Reverse 5′-TTTATGTTTTTGGCGTCTTCCAT-3′), digested them with Mlu I and Bgl II (New England BioLabs), and then recloned them into a pGL3 Basic vector with a reversed MCS, yielding a luciferase reporter plasmid with a reversed promoter sequence. .. A total of 50 ng of each promoter construct was cotransfected with 5 ng of pRLTK (Promega), a Renilla luciferase-expressing transfection control, using FuGene (Roche).

    Article Title: Identification and characterization of the Non-race specific Disease Resistance 1 (NDR1) orthologous protein in coffee
    Article Snippet: CaNDR1a was amplified by PCR using a high fidelity DNA polymerase according to the manufacturer's instructions (PfuTurbo , Stratagene, La Jolla, CA, USA). .. Selected clones were digested with Mlu -I restriction enzyme (R0198L, NEB, OZYME, Saint Quentin Yvelines, France) before overnight recombination with the binary vector pMDC32 [ ] using the LR Clonase II kit (Invitrogen).

    Article Title: Mafb lineage tracing to distinguish macrophages from other immune lineages reveals dual identity of Langerhans cells
    Article Snippet: Both the amplified 3′-UTR fragment and pMSCV MafB-P2A-FLAG-mCherry-T2A-Cre retroviral overexpression vector were digested using EcoRI and ClaI and then ligated together. .. A MafB-P2A-FLAG-mCherry-T2A-Cre-UTR fragment was released from the resulting vector by restriction digest using SacII, MluI, and Antarctic phosphatase (New England Biolabs, Inc.), and an ∼3-kb fragment containing Mafb 5′-UTR and upstream sequences was amplified from 129S6 genomic DNA and digested using MluI. .. The primers used to amplify the latter fragment were: 5′-ATTAAGATCTGGGGACAACTTTGTATAGAAAAGTTGCGGAGTGTGGTGTTCTCTCT-3′ and 5′-CGTCTTCTCGTTCTCCAGGT-3′.

    Article Title: Efficient method for site-directed mutagenesis in large plasmids without subcloning
    Article Snippet: All PCRs were carried out using 100 pg pUC18 as a template and 75 pmol of Starter Primers 1 and 2 ( ) in a total volume of 25 μl containing 1 unit Pfu DNA polymerase (Agilent Technologies, Santa Clara, CA) and the appropriate amplification buffer unless otherwise stated. .. Successful mutagenesis was confirmed by restriction analysis using NdeI and MluI restriction enzymes (New England Biolabs, Ipswich, MA): 2 μl of Linear Modified DNA for each mutation type was incubated with or without 5 units of restriction enzymes for 30 min at 37°C.

    Article Title: Quorum-Sensing and BvrR/BvrS Regulation, the Type IV Secretion System, Cyclic Glucans, and BacA in the Virulence of Brucella ovis: Similarities to and Differences from Smooth Brucellae
    Article Snippet: The EcoRI insert of the resulting recombinant plasmid was cloned, in the direction opposite that of lacZ , in pGEM-7Zf, and then the SacI-XbaI insert was cloned in pUC19 to obtain plasmid pNVvirPA03. .. The Kanr gene was PCR amplified from pUC4K with primers KanF-MluI and KanR-EcoNI, cloned into pGEM-T, extracted by digestion with MluI (NEB) and partial digestion with EcoNI (NEB), and ligated to pNVvirPA03 cut with the same restriction enzymes. .. The SacI-XbaI insert DNA of the resulting plasmid, bearing inactivated virB2 and virB3 , was ligated to SacI-XbaI-digested pCVD442 to afford pNVvirPA05.

    Article Title: A Diagnostic HIV-1 Tropism System Based on Sequence Relatedness
    Article Snippet: The HIV-1 envelope was amplified using the AffinityScript One-Step RT-PCR kit (Agilent Technologies, Basel, Switzerland) on a Biometra T3000 cycler (Biometra, Goettingen, Germany); primers matched nucleotide positions as indicated by their numbers: F_5700, GAA ACT TAT GGG GAT ACT TGG; R_8494, AGC TGA AGA GGC ACA GGC TCC. .. Primers were F_6435M (CYA CCA ACG CGT GTG TAC CCA C) and R_8319N (TGA RTA TCC CTG CCG GCC TCT ATT YAY TAT AGA AA); cycling conditions were 95°C for 2 min, 35 cycles of 95°C for 20 s, 50°C for 20 s, and 72°C for 1 min and 20 s, followed by an extension at 72°C for 3 min. Products were cut with MluI and NgoMIV (New England Biolabs; Bioconcept, Allschwil, Switzerland) and purified over a 0.8% agarose gel.

    Article Title: Role of N-Linked Glycans in a Human Immunodeficiency Virus Envelope Glycoprotein: Effects on Protein Function and the Neutralizing Antibody Response
    Article Snippet: To generate plasmids for recovery of VSVΔG recombinants expressing Env glycosylation mutants, the sequences of DNA encoding constructs 89.6G(4-7) and 89.6G(3-7) were amplified by PCR using Vent polymerase (New England Biolabs). .. The PCR product was digested with Mlu I and Nhe I restriction enzymes (New England Biolabs) and ligated to pVSVΔG-JRFLG-GFP , which had previously been digested with Mlu I and Nhe I to remove the JRFLG insert.

    Article Title: Control of Human T-Cell Leukemia Virus Type 1 (HTLV-1) Infection by Eliminating Envelope Protein-Positive Cells with Recombinant Vesicular Stomatitis Viruses Encoding HTLV-1 Primary Receptor
    Article Snippet: All rVSV plasmids were generated according to traditional recombination techniques as described previously ( , ). .. Briefly, amplified products were excised with restriction enzymes MluI and XhoI (New England BioLabs, Hitchin, United Kingdom) and ligated into G-deleted pVSV-XN2 (a VSV Indiana wild-type vector) digested with the same enzymes using Ligation High version 2 (Toyobo, Osaka, Japan), yielding plasmid vectors of rVSV. .. The primers containing restriction sites and/or VSV transcription stop-start signal sequences used in this study are listed in Table S2 in the supplemental material.

    Article Title: A Systematic Analysis on DNA Methylation and the Expression of Both mRNA and microRNA in Bladder Cancer
    Article Snippet: Briefly, 3 µg of genomic DNA was digested with MluI (recognition sequence: ACGCGT ) (NEB, US). .. Bounded DNA was then digested with MmeI (NEB, US), which generated a 17–18 nt library, followed by ligating to the P7 adapter.

    Article Title: Regulation of miR-146a by RelA/NFkB and p53 in STHdhQ111/HdhQ111 Cells, a Cell Model of Huntington's Disease
    Article Snippet: For luciferase reporter assays, we cloned two fragments of the 3′ UTR of human p53 into pmiR-Report vector (Ambion, USA), one comprising of 150 bp (position 733–739) containing miR-125b recognition site and the other comprising of 136 bp (position 234–256) containing miR-150 recognition site. .. These regions were amplified by PCR from human genomic DNA and cloned in vector using the MluI and HindIII (NEB, USA) sites. .. The constructs were named p53-UTR1 and p53-UTR2 respectively.

    Article Title: Development of human-like scFv-Fc antibodies neutralizing Botulinum toxin serotype B
    Article Snippet: The DNA encoding the VL and VH regions were amplified, with 2 oligonucleotide primer sets introducing restriction sites. .. For this, the pHAL35 or pHAL32 vector and the VL fragments were digested with MluI and NotI (New England Biolabs, Frankfurt, Germany), the enzymes were inactivated, pHAL35 or pHAL32 was dephosphorylated using calf intestinal phosphatase (MBI, Fermentas), and the DNA was purified.

    Cotransfection:

    Article Title: Lym-1 Chimeric Antigen Receptor T Cells Exhibit Potent Anti-Tumor Effects against B-Cell Lymphoma
    Article Snippet: For this study, the IRES-ZsGreen moiety was removed by restriction enzyme digestion with EcoRI and MluI (NEB, Ipswich, MA, USA), prior to insertion of the CAR encoding gene. .. The pLVX-EF1α-Lym-1 construct was made by substituting a scFv derived from Lym-1 for the FMC63 scFv in the CD19 vector (described above).

    Construct:

    Article Title: The association of XRCC1 polymorphism with osteosarcoma risk, clinicopathologic features, and prognosis in a Chinese Han population
    Article Snippet: Paragraph title: Plasmid constructs ... Both the amplified fragments and pGL3-basic vector were digested with Mlu I (A^CGCGT/TGCGC^A) and Bgl II (A^GATCT/TCTAG^A) enzymes (New England BioLabs Inc., Ipswich, MA, USA), and the amplified fragments were cloned into pGL3-basic vector.

    Article Title: Identification and characterization of the Non-race specific Disease Resistance 1 (NDR1) orthologous protein in coffee
    Article Snippet: Paragraph title: Constructs ... Selected clones were digested with Mlu -I restriction enzyme (R0198L, NEB, OZYME, Saint Quentin Yvelines, France) before overnight recombination with the binary vector pMDC32 [ ] using the LR Clonase II kit (Invitrogen).

    Article Title: Role of N-Linked Glycans in a Human Immunodeficiency Virus Envelope Glycoprotein: Effects on Protein Function and the Neutralizing Antibody Response
    Article Snippet: To generate plasmids for recovery of VSVΔG recombinants expressing Env glycosylation mutants, the sequences of DNA encoding constructs 89.6G(4-7) and 89.6G(3-7) were amplified by PCR using Vent polymerase (New England Biolabs). .. The PCR product was digested with Mlu I and Nhe I restriction enzymes (New England Biolabs) and ligated to pVSVΔG-JRFLG-GFP , which had previously been digested with Mlu I and Nhe I to remove the JRFLG insert.

    Article Title: Control of Human T-Cell Leukemia Virus Type 1 (HTLV-1) Infection by Eliminating Envelope Protein-Positive Cells with Recombinant Vesicular Stomatitis Viruses Encoding HTLV-1 Primary Receptor
    Article Snippet: To construct rVSV plasmids lacking the G gene and encoding human GLUT1, NRP1, and SDC1, genes encoding these proteins were initially amplified by PCR with the expression vectors for GLUT1 and SDC1 (kindly provided by A. Tanaka, Gunma University) ( ) and NRP1 (purchased from OriGene Technologies, Rockville, MD). .. Briefly, amplified products were excised with restriction enzymes MluI and XhoI (New England BioLabs, Hitchin, United Kingdom) and ligated into G-deleted pVSV-XN2 (a VSV Indiana wild-type vector) digested with the same enzymes using Ligation High version 2 (Toyobo, Osaka, Japan), yielding plasmid vectors of rVSV.

    Article Title: Regulation of miR-146a by RelA/NFkB and p53 in STHdhQ111/HdhQ111 Cells, a Cell Model of Huntington's Disease
    Article Snippet: Paragraph title: DNA constructs ... These regions were amplified by PCR from human genomic DNA and cloned in vector using the MluI and HindIII (NEB, USA) sites.

    Nested PCR:

    Article Title: A Diagnostic HIV-1 Tropism System Based on Sequence Relatedness
    Article Snippet: After primer annealing at 65°C for 5 min, 42°C for 2 min, and 25°C for 10 min, reverse transcription was conducted at 45°C for 30 min, 92°C for 1 min, followed by PCR at 40 cycles of 92°C for 20 s, 55°C for 20 s, and 68°C for 3 min, and then extension was at 68°C for 5 min. For the 2nd, nested, PCR for envelope and for introducing the cloning sites MluI and NgoMIV, the Pfu -ultraII Fusion HS DNA polymerase was used (Agilent Technologies, Basel, Switzerland). .. Primers were F_6435M (CYA CCA ACG CGT GTG TAC CCA C) and R_8319N (TGA RTA TCC CTG CCG GCC TCT ATT YAY TAT AGA AA); cycling conditions were 95°C for 2 min, 35 cycles of 95°C for 20 s, 50°C for 20 s, and 72°C for 1 min and 20 s, followed by an extension at 72°C for 3 min. Products were cut with MluI and NgoMIV (New England Biolabs; Bioconcept, Allschwil, Switzerland) and purified over a 0.8% agarose gel.

    Incubation:

    Article Title: Mafb lineage tracing to distinguish macrophages from other immune lineages reveals dual identity of Langerhans cells
    Article Snippet: A MafB-P2A-FLAG-mCherry-T2A-Cre-UTR fragment was released from the resulting vector by restriction digest using SacII, MluI, and Antarctic phosphatase (New England Biolabs, Inc.), and an ∼3-kb fragment containing Mafb 5′-UTR and upstream sequences was amplified from 129S6 genomic DNA and digested using MluI. .. A MafB-P2A-FLAG-mCherry-T2A-Cre-UTR fragment was released from the resulting vector by restriction digest using SacII, MluI, and Antarctic phosphatase (New England Biolabs, Inc.), and an ∼3-kb fragment containing Mafb 5′-UTR and upstream sequences was amplified from 129S6 genomic DNA and digested using MluI.

    Article Title: Efficient method for site-directed mutagenesis in large plasmids without subcloning
    Article Snippet: 2.5 μl of these products were self-ligated with T4 DNA ligase as above and 1 μl of a 1:200 dilution of the Closed Intermediate DNA product was used as a template for the final PCR reaction to create the Linear Modified DNA . .. Successful mutagenesis was confirmed by restriction analysis using NdeI and MluI restriction enzymes (New England Biolabs, Ipswich, MA): 2 μl of Linear Modified DNA for each mutation type was incubated with or without 5 units of restriction enzymes for 30 min at 37°C. .. 5 μl of each reaction was resolved by electrophoresis on a 1% agarose gel.

    Article Title: Control of Human T-Cell Leukemia Virus Type 1 (HTLV-1) Infection by Eliminating Envelope Protein-Positive Cells with Recombinant Vesicular Stomatitis Viruses Encoding HTLV-1 Primary Receptor
    Article Snippet: Briefly, amplified products were excised with restriction enzymes MluI and XhoI (New England BioLabs, Hitchin, United Kingdom) and ligated into G-deleted pVSV-XN2 (a VSV Indiana wild-type vector) digested with the same enzymes using Ligation High version 2 (Toyobo, Osaka, Japan), yielding plasmid vectors of rVSV. .. Briefly, 1 × 106 BHK-21 cells were dispensed into a 10-cm-diameter dish and infected with vTF7-3 at an MOI of 10 to induce T7 RNA polymerase.

    Luciferase:

    Article Title: The association of XRCC1 polymorphism with osteosarcoma risk, clinicopathologic features, and prognosis in a Chinese Han population
    Article Snippet: According to the previously described methods, we constructed a luciferase reporter plasmid using the pGL3-Basic reporter vector (Promega, Madison, WI, USA). .. Both the amplified fragments and pGL3-basic vector were digested with Mlu I (A^CGCGT/TGCGC^A) and Bgl II (A^GATCT/TCTAG^A) enzymes (New England BioLabs Inc., Ipswich, MA, USA), and the amplified fragments were cloned into pGL3-basic vector.

    Article Title: The ets-Related Transcription Factor GABP Directs Bidirectional Transcription
    Article Snippet: The 241 general promoters tested for GABP ChIP enrichment were previously cloned into the plasmid pGL3 Basic (Promega) and verified to be functional promoters as part of the ENCODE project [ ]. .. We amplified these promoters, consisting of the sequence from approximately −500 to +50 bp relative to the start of transcription, by using common primers flanking the MCS (Forward 5′-CATACGCTCTCCATCAAAACAAA-3′, Reverse 5′-TTTATGTTTTTGGCGTCTTCCAT-3′), digested them with Mlu I and Bgl II (New England BioLabs), and then recloned them into a pGL3 Basic vector with a reversed MCS, yielding a luciferase reporter plasmid with a reversed promoter sequence. .. A total of 50 ng of each promoter construct was cotransfected with 5 ng of pRLTK (Promega), a Renilla luciferase-expressing transfection control, using FuGene (Roche).

    Article Title: H19 non coding RNA-derived miR-675 enhances tumorigenesis and metastasis of breast cancer cells by downregulating c-Cbl and Cbl-b
    Article Snippet: Coding DNA Sequence (CDS) and 3′UTR of c-Cbl and Cbl-b mRNA were cloned in the pMIR-REPORT luciferase vector (Ambion). .. CDS1 of c-Cbl was cloned between Spe I and Pme I and CDS2 between Spe I and Mlu I (New England Biolabs).

    Article Title: Regulation of miR-146a by RelA/NFkB and p53 in STHdhQ111/HdhQ111 Cells, a Cell Model of Huntington's Disease
    Article Snippet: For luciferase reporter assays, we cloned two fragments of the 3′ UTR of human p53 into pmiR-Report vector (Ambion, USA), one comprising of 150 bp (position 733–739) containing miR-125b recognition site and the other comprising of 136 bp (position 234–256) containing miR-150 recognition site. .. These regions were amplified by PCR from human genomic DNA and cloned in vector using the MluI and HindIII (NEB, USA) sites.

    Activity Assay:

    Article Title: The ets-Related Transcription Factor GABP Directs Bidirectional Transcription
    Article Snippet: Paragraph title: Bidirectional promoter activity assay. ... We amplified these promoters, consisting of the sequence from approximately −500 to +50 bp relative to the start of transcription, by using common primers flanking the MCS (Forward 5′-CATACGCTCTCCATCAAAACAAA-3′, Reverse 5′-TTTATGTTTTTGGCGTCTTCCAT-3′), digested them with Mlu I and Bgl II (New England BioLabs), and then recloned them into a pGL3 Basic vector with a reversed MCS, yielding a luciferase reporter plasmid with a reversed promoter sequence.

    Article Title: THE ROLE OF CYTOKINES IN UBD PROMOTER REGULATION AND MALLORY-DENK BODY-LIKE AGGRESOMES
    Article Snippet: Upstream regions of the UbD gene were cloned from -4260 bases, including the 250 first bases in the first exon to test promoter activity after different treatments. .. The different promoters were cloned in the pGL3Luc+ in the cloning site (Promega, Madison, WI): XhoI and MLUI for the IIL, and SacI for D1, D2, and D3 promoter (New England Biolabs, Ipswich, MA).

    Expressing:

    Article Title: Identification and characterization of the Non-race specific Disease Resistance 1 (NDR1) orthologous protein in coffee
    Article Snippet: Selected clones were digested with Mlu -I restriction enzyme (R0198L, NEB, OZYME, Saint Quentin Yvelines, France) before overnight recombination with the binary vector pMDC32 [ ] using the LR Clonase II kit (Invitrogen). .. Primers used for the initial PCR step were as follows: CaNDR1-Forward 1, 5'- CACC ATG TCA GAC CCC AGC AGC AGT-3' and CaNDR1-Reverse 2.

    Article Title: H19 non coding RNA-derived miR-675 enhances tumorigenesis and metastasis of breast cancer cells by downregulating c-Cbl and Cbl-b
    Article Snippet: CDS1 of c-Cbl was cloned between Spe I and Pme I and CDS2 between Spe I and Mlu I (New England Biolabs). .. H19 gene was cloned in pcDNA3.1 (−) (Invitrogen) between Not I and Bam HI (New England Biolabs).

    Article Title: Role of N-Linked Glycans in a Human Immunodeficiency Virus Envelope Glycoprotein: Effects on Protein Function and the Neutralizing Antibody Response
    Article Snippet: To generate plasmids for recovery of VSVΔG recombinants expressing Env glycosylation mutants, the sequences of DNA encoding constructs 89.6G(4-7) and 89.6G(3-7) were amplified by PCR using Vent polymerase (New England Biolabs). .. The PCR product was digested with Mlu I and Nhe I restriction enzymes (New England Biolabs) and ligated to pVSVΔG-JRFLG-GFP , which had previously been digested with Mlu I and Nhe I to remove the JRFLG insert.

    Article Title: Substrate Recognition by the Human Fatty-acid Synthase
    Article Snippet: Oligonucleotides were from Integrated DNA Technologies (Coralville, IA). .. Pfu polymerase, the BAC-to-BAC baculovirus expression system, Escherichia coli maximum efficiency DH10 Bac competent cells, and Spodoptera frugiperda ( Sf9 ) insect cells were obtained from Invitrogen. pBluescript and E. coli XL-1 Blue competent cells were from Stratagene (La Jolla, CA), and the AatII, MluI, HindIII, EcoRI, and BamHI restriction enzymes were from New England Biolabs (Beverly, MA). .. ABI Prism Big Dye Terminator Cycle Sequencing was carried out on an MJ Research PTC-100 Programmable Thermal Controller from Global Medical Instrumentation, Inc. (Ramsey, MN).

    Article Title: Control of Human T-Cell Leukemia Virus Type 1 (HTLV-1) Infection by Eliminating Envelope Protein-Positive Cells with Recombinant Vesicular Stomatitis Viruses Encoding HTLV-1 Primary Receptor
    Article Snippet: To construct rVSV plasmids lacking the G gene and encoding human GLUT1, NRP1, and SDC1, genes encoding these proteins were initially amplified by PCR with the expression vectors for GLUT1 and SDC1 (kindly provided by A. Tanaka, Gunma University) ( ) and NRP1 (purchased from OriGene Technologies, Rockville, MD). .. Briefly, amplified products were excised with restriction enzymes MluI and XhoI (New England BioLabs, Hitchin, United Kingdom) and ligated into G-deleted pVSV-XN2 (a VSV Indiana wild-type vector) digested with the same enzymes using Ligation High version 2 (Toyobo, Osaka, Japan), yielding plasmid vectors of rVSV.

    Modification:

    Article Title: Mafb lineage tracing to distinguish macrophages from other immune lineages reveals dual identity of Langerhans cells
    Article Snippet: P2A-FLAG-mCherry, T2A-Cre, and mouse MafB coding sequences were ligated serially into the pMSCV T2A-GFP retroviral overexpression vector, which was modified from the pMSCV IRES-GFP retroviral overexpression vector , to yield the pMSCV MafB-P2A-FLAG-mCherry-T2A-Cre retroviral overexpression vector. .. A MafB-P2A-FLAG-mCherry-T2A-Cre-UTR fragment was released from the resulting vector by restriction digest using SacII, MluI, and Antarctic phosphatase (New England Biolabs, Inc.), and an ∼3-kb fragment containing Mafb 5′-UTR and upstream sequences was amplified from 129S6 genomic DNA and digested using MluI.

    Article Title: Efficient method for site-directed mutagenesis in large plasmids without subcloning
    Article Snippet: 2.5 μl of these products were self-ligated with T4 DNA ligase as above and 1 μl of a 1:200 dilution of the Closed Intermediate DNA product was used as a template for the final PCR reaction to create the Linear Modified DNA . .. Successful mutagenesis was confirmed by restriction analysis using NdeI and MluI restriction enzymes (New England Biolabs, Ipswich, MA): 2 μl of Linear Modified DNA for each mutation type was incubated with or without 5 units of restriction enzymes for 30 min at 37°C. .. 5 μl of each reaction was resolved by electrophoresis on a 1% agarose gel.

    Transformation Assay:

    Article Title: A Diagnostic HIV-1 Tropism System Based on Sequence Relatedness
    Article Snippet: Primers were F_6435M (CYA CCA ACG CGT GTG TAC CCA C) and R_8319N (TGA RTA TCC CTG CCG GCC TCT ATT YAY TAT AGA AA); cycling conditions were 95°C for 2 min, 35 cycles of 95°C for 20 s, 50°C for 20 s, and 72°C for 1 min and 20 s, followed by an extension at 72°C for 3 min. Products were cut with MluI and NgoMIV (New England Biolabs; Bioconcept, Allschwil, Switzerland) and purified over a 0.8% agarose gel. .. Then the respective fragments of 1.9 kbp were ligated into an NL4-3 backbone to reconstitute fully functional proviruses.

    Over Expression:

    Article Title: Mafb lineage tracing to distinguish macrophages from other immune lineages reveals dual identity of Langerhans cells
    Article Snippet: Both the amplified 3′-UTR fragment and pMSCV MafB-P2A-FLAG-mCherry-T2A-Cre retroviral overexpression vector were digested using EcoRI and ClaI and then ligated together. .. A MafB-P2A-FLAG-mCherry-T2A-Cre-UTR fragment was released from the resulting vector by restriction digest using SacII, MluI, and Antarctic phosphatase (New England Biolabs, Inc.), and an ∼3-kb fragment containing Mafb 5′-UTR and upstream sequences was amplified from 129S6 genomic DNA and digested using MluI.

    Derivative Assay:

    Article Title: Lym-1 Chimeric Antigen Receptor T Cells Exhibit Potent Anti-Tumor Effects against B-Cell Lymphoma
    Article Snippet: For comparison purposes, a second generation CD19 CAR comprised of a CD19 specific targeting scFv derived from antibody FMC63, a CD8α leader sequence, a (G4S)3 linker between the VH and the VL domains, a CD8α hinge, a CD8α transmembrane domain followed by 4-1BB co-stimulatory domain, and intact intracellular CD3ζ, were cloned between the EcoRI and MluI restriction sites into the lentiviral vector pLVX-EF1α-IRES-Zsgreen (Clontech, Mountain View, CA, USA). .. For this study, the IRES-ZsGreen moiety was removed by restriction enzyme digestion with EcoRI and MluI (NEB, Ipswich, MA, USA), prior to insertion of the CAR encoding gene.

    Countercurrent Chromatography:

    Article Title: Identification and characterization of the Non-race specific Disease Resistance 1 (NDR1) orthologous protein in coffee
    Article Snippet: The following primer couple was used for directly adding haemaglutinin (HA) and poly-histidine (His) sequences to the 5'- and 3'-ends of the PCR products, respectively: CaNDR1-Forward 4, 5'- CACC ATG TAT CCC TAC GAC GTA CCA GAT TAT ATG TC AGA CCC CAG CAG CAG TGC-3' and CaNDR1-Reverse 3, 5'-CTA ATG GTG ATG GTG ATG GTG CAA CAG CAG AAC CAA GAA A-3'. .. Selected clones were digested with Mlu -I restriction enzyme (R0198L, NEB, OZYME, Saint Quentin Yvelines, France) before overnight recombination with the binary vector pMDC32 [ ] using the LR Clonase II kit (Invitrogen).

    Electroporation:

    Article Title: Quorum-Sensing and BvrR/BvrS Regulation, the Type IV Secretion System, Cyclic Glucans, and BacA in the Virulence of Brucella ovis: Similarities to and Differences from Smooth Brucellae
    Article Snippet: The Kanr gene was PCR amplified from pUC4K with primers KanF-MluI and KanR-EcoNI, cloned into pGEM-T, extracted by digestion with MluI (NEB) and partial digestion with EcoNI (NEB), and ligated to pNVvirPA03 cut with the same restriction enzymes. .. The SacI-XbaI insert DNA of the resulting plasmid, bearing inactivated virB2 and virB3 , was ligated to SacI-XbaI-digested pCVD442 to afford pNVvirPA05.

    Article Title: Development of human-like scFv-Fc antibodies neutralizing Botulinum toxin serotype B
    Article Snippet: For this, the pHAL35 or pHAL32 vector and the VL fragments were digested with MluI and NotI (New England Biolabs, Frankfurt, Germany), the enzymes were inactivated, pHAL35 or pHAL32 was dephosphorylated using calf intestinal phosphatase (MBI, Fermentas), and the DNA was purified. .. VL PCR products (270 ng) were inserted into 1 μg of the dephosphorylated pHAL35 or pHAL32 preparation in 4 separate ligation reactions.

    Transfection:

    Article Title: The ets-Related Transcription Factor GABP Directs Bidirectional Transcription
    Article Snippet: We amplified these promoters, consisting of the sequence from approximately −500 to +50 bp relative to the start of transcription, by using common primers flanking the MCS (Forward 5′-CATACGCTCTCCATCAAAACAAA-3′, Reverse 5′-TTTATGTTTTTGGCGTCTTCCAT-3′), digested them with Mlu I and Bgl II (New England BioLabs), and then recloned them into a pGL3 Basic vector with a reversed MCS, yielding a luciferase reporter plasmid with a reversed promoter sequence. .. A total of 50 ng of each promoter construct was cotransfected with 5 ng of pRLTK (Promega), a Renilla luciferase-expressing transfection control, using FuGene (Roche).

    Article Title: A Diagnostic HIV-1 Tropism System Based on Sequence Relatedness
    Article Snippet: Primers were F_6435M (CYA CCA ACG CGT GTG TAC CCA C) and R_8319N (TGA RTA TCC CTG CCG GCC TCT ATT YAY TAT AGA AA); cycling conditions were 95°C for 2 min, 35 cycles of 95°C for 20 s, 50°C for 20 s, and 72°C for 1 min and 20 s, followed by an extension at 72°C for 3 min. Products were cut with MluI and NgoMIV (New England Biolabs; Bioconcept, Allschwil, Switzerland) and purified over a 0.8% agarose gel. .. Primers were F_6435M (CYA CCA ACG CGT GTG TAC CCA C) and R_8319N (TGA RTA TCC CTG CCG GCC TCT ATT YAY TAT AGA AA); cycling conditions were 95°C for 2 min, 35 cycles of 95°C for 20 s, 50°C for 20 s, and 72°C for 1 min and 20 s, followed by an extension at 72°C for 3 min. Products were cut with MluI and NgoMIV (New England Biolabs; Bioconcept, Allschwil, Switzerland) and purified over a 0.8% agarose gel.

    Article Title: Control of Human T-Cell Leukemia Virus Type 1 (HTLV-1) Infection by Eliminating Envelope Protein-Positive Cells with Recombinant Vesicular Stomatitis Viruses Encoding HTLV-1 Primary Receptor
    Article Snippet: Briefly, amplified products were excised with restriction enzymes MluI and XhoI (New England BioLabs, Hitchin, United Kingdom) and ligated into G-deleted pVSV-XN2 (a VSV Indiana wild-type vector) digested with the same enzymes using Ligation High version 2 (Toyobo, Osaka, Japan), yielding plasmid vectors of rVSV. .. Briefly, 1 × 106 BHK-21 cells were dispensed into a 10-cm-diameter dish and infected with vTF7-3 at an MOI of 10 to induce T7 RNA polymerase.

    Article Title: Lym-1 Chimeric Antigen Receptor T Cells Exhibit Potent Anti-Tumor Effects against B-Cell Lymphoma
    Article Snippet: For this study, the IRES-ZsGreen moiety was removed by restriction enzyme digestion with EcoRI and MluI (NEB, Ipswich, MA, USA), prior to insertion of the CAR encoding gene. .. Lentivirus was produced by transient co-transfection of the CAR transfer vectors (pLVX-EF1α-CD19 or pLVX-EF1α-Lym1) with packaging plasmids, psPAX2 and pMD2.G (Addgene) using HEK-293LTV cells.

    Sequencing:

    Article Title: The ets-Related Transcription Factor GABP Directs Bidirectional Transcription
    Article Snippet: The 241 general promoters tested for GABP ChIP enrichment were previously cloned into the plasmid pGL3 Basic (Promega) and verified to be functional promoters as part of the ENCODE project [ ]. .. We amplified these promoters, consisting of the sequence from approximately −500 to +50 bp relative to the start of transcription, by using common primers flanking the MCS (Forward 5′-CATACGCTCTCCATCAAAACAAA-3′, Reverse 5′-TTTATGTTTTTGGCGTCTTCCAT-3′), digested them with Mlu I and Bgl II (New England BioLabs), and then recloned them into a pGL3 Basic vector with a reversed MCS, yielding a luciferase reporter plasmid with a reversed promoter sequence. .. A total of 50 ng of each promoter construct was cotransfected with 5 ng of pRLTK (Promega), a Renilla luciferase-expressing transfection control, using FuGene (Roche).

    Article Title: Identification and characterization of the Non-race specific Disease Resistance 1 (NDR1) orthologous protein in coffee
    Article Snippet: Selected clones were digested with Mlu -I restriction enzyme (R0198L, NEB, OZYME, Saint Quentin Yvelines, France) before overnight recombination with the binary vector pMDC32 [ ] using the LR Clonase II kit (Invitrogen). .. Selected clones were digested with Mlu -I restriction enzyme (R0198L, NEB, OZYME, Saint Quentin Yvelines, France) before overnight recombination with the binary vector pMDC32 [ ] using the LR Clonase II kit (Invitrogen).

    Article Title: H19 non coding RNA-derived miR-675 enhances tumorigenesis and metastasis of breast cancer cells by downregulating c-Cbl and Cbl-b
    Article Snippet: Coding DNA Sequence (CDS) and 3′UTR of c-Cbl and Cbl-b mRNA were cloned in the pMIR-REPORT luciferase vector (Ambion). .. CDS1 of c-Cbl was cloned between Spe I and Pme I and CDS2 between Spe I and Mlu I (New England Biolabs).

    Article Title: Mafb lineage tracing to distinguish macrophages from other immune lineages reveals dual identity of Langerhans cells
    Article Snippet: The Mafb 3′–untranslated region (UTR) sequence was amplified from 129S6 genomic DNA using the following primers: 5′-ATTAGAATTCTTTCTGTGAGTCCTGGCGG-3′ and 5′-ATTAATCGATGGGGACTGCTTTTTTGTACAAACTTGTTGCCAGAGAATGTCCCAAAC-3′. .. A MafB-P2A-FLAG-mCherry-T2A-Cre-UTR fragment was released from the resulting vector by restriction digest using SacII, MluI, and Antarctic phosphatase (New England Biolabs, Inc.), and an ∼3-kb fragment containing Mafb 5′-UTR and upstream sequences was amplified from 129S6 genomic DNA and digested using MluI.

    Article Title: A Systematic Analysis on DNA Methylation and the Expression of Both mRNA and microRNA in Bladder Cancer
    Article Snippet: MMSDK combines the use of methylation-sensitive restriction enzyme digestion and the second generation sequencing technique (Illumina Genome Analyzer IIx) . .. Briefly, 3 µg of genomic DNA was digested with MluI (recognition sequence: ACGCGT ) (NEB, US). .. The MluI -digested genomic DNA was ligated to biotinylated linkers and fragmented by NlaIII cleavage (NEB, US).

    Article Title: Regulation of miR-146a by RelA/NFkB and p53 in STHdhQ111/HdhQ111 Cells, a Cell Model of Huntington's Disease
    Article Snippet: These regions were amplified by PCR from human genomic DNA and cloned in vector using the MluI and HindIII (NEB, USA) sites. .. The following primers were used to generate the UTR constructs: p53-UTR1-F: 5′- CGACGCGT AAGGAAATCTCACCCCATCC-3′ and p53-UTR1-R: 5′- CCCAAGCTT AAGCGAGACCCAGTCTCAAA-3′ ; p53-UTR2-F: 5′- CGACGCGT GAGGAGGATGGGGAGTAGGA-3′ and p53-UTR2-R: 5′- CCCAAGCTT AAGTGGGCCCCTACCTAGAA-3′ ; p50-UTR-F: 5′- GGACTAGT TTGGCTTCCTTTCTTGGTTC-3′ and p50-UTR-R: 5′- CGACGC GTGGCGACCGTGATACCTTTAAT-3′ .

    Article Title: Lym-1 Chimeric Antigen Receptor T Cells Exhibit Potent Anti-Tumor Effects against B-Cell Lymphoma
    Article Snippet: For comparison purposes, a second generation CD19 CAR comprised of a CD19 specific targeting scFv derived from antibody FMC63, a CD8α leader sequence, a (G4S)3 linker between the VH and the VL domains, a CD8α hinge, a CD8α transmembrane domain followed by 4-1BB co-stimulatory domain, and intact intracellular CD3ζ, were cloned between the EcoRI and MluI restriction sites into the lentiviral vector pLVX-EF1α-IRES-Zsgreen (Clontech, Mountain View, CA, USA). .. For this study, the IRES-ZsGreen moiety was removed by restriction enzyme digestion with EcoRI and MluI (NEB, Ipswich, MA, USA), prior to insertion of the CAR encoding gene.

    Article Title: THE ROLE OF CYTOKINES IN UBD PROMOTER REGULATION AND MALLORY-DENK BODY-LIKE AGGRESOMES
    Article Snippet: The sequence used to design the primers is named: in the mouse genome, in the NIH website. .. The different promoters were cloned in the pGL3Luc+ in the cloning site (Promega, Madison, WI): XhoI and MLUI for the IIL, and SacI for D1, D2, and D3 promoter (New England Biolabs, Ipswich, MA).

    Chromatography:

    Article Title: Substrate Recognition by the Human Fatty-acid Synthase
    Article Snippet: Pfu polymerase, the BAC-to-BAC baculovirus expression system, Escherichia coli maximum efficiency DH10 Bac competent cells, and Spodoptera frugiperda ( Sf9 ) insect cells were obtained from Invitrogen. pBluescript and E. coli XL-1 Blue competent cells were from Stratagene (La Jolla, CA), and the AatII, MluI, HindIII, EcoRI, and BamHI restriction enzymes were from New England Biolabs (Beverly, MA). .. Pfu polymerase, the BAC-to-BAC baculovirus expression system, Escherichia coli maximum efficiency DH10 Bac competent cells, and Spodoptera frugiperda ( Sf9 ) insect cells were obtained from Invitrogen. pBluescript and E. coli XL-1 Blue competent cells were from Stratagene (La Jolla, CA), and the AatII, MluI, HindIII, EcoRI, and BamHI restriction enzymes were from New England Biolabs (Beverly, MA).

    Ligation:

    Article Title: Control of Human T-Cell Leukemia Virus Type 1 (HTLV-1) Infection by Eliminating Envelope Protein-Positive Cells with Recombinant Vesicular Stomatitis Viruses Encoding HTLV-1 Primary Receptor
    Article Snippet: All rVSV plasmids were generated according to traditional recombination techniques as described previously ( , ). .. Briefly, amplified products were excised with restriction enzymes MluI and XhoI (New England BioLabs, Hitchin, United Kingdom) and ligated into G-deleted pVSV-XN2 (a VSV Indiana wild-type vector) digested with the same enzymes using Ligation High version 2 (Toyobo, Osaka, Japan), yielding plasmid vectors of rVSV. .. The primers containing restriction sites and/or VSV transcription stop-start signal sequences used in this study are listed in Table S2 in the supplemental material.

    Article Title: Development of human-like scFv-Fc antibodies neutralizing Botulinum toxin serotype B
    Article Snippet: For this, the pHAL35 or pHAL32 vector and the VL fragments were digested with MluI and NotI (New England Biolabs, Frankfurt, Germany), the enzymes were inactivated, pHAL35 or pHAL32 was dephosphorylated using calf intestinal phosphatase (MBI, Fermentas), and the DNA was purified. .. For this, the pHAL35 or pHAL32 vector and the VL fragments were digested with MluI and NotI (New England Biolabs, Frankfurt, Germany), the enzymes were inactivated, pHAL35 or pHAL32 was dephosphorylated using calf intestinal phosphatase (MBI, Fermentas), and the DNA was purified.

    Methylation:

    Article Title: A Systematic Analysis on DNA Methylation and the Expression of Both mRNA and microRNA in Bladder Cancer
    Article Snippet: MMSDK combines the use of methylation-sensitive restriction enzyme digestion and the second generation sequencing technique (Illumina Genome Analyzer IIx) . .. Briefly, 3 µg of genomic DNA was digested with MluI (recognition sequence: ACGCGT ) (NEB, US).

    Infection:

    Article Title: Control of Human T-Cell Leukemia Virus Type 1 (HTLV-1) Infection by Eliminating Envelope Protein-Positive Cells with Recombinant Vesicular Stomatitis Viruses Encoding HTLV-1 Primary Receptor
    Article Snippet: Briefly, amplified products were excised with restriction enzymes MluI and XhoI (New England BioLabs, Hitchin, United Kingdom) and ligated into G-deleted pVSV-XN2 (a VSV Indiana wild-type vector) digested with the same enzymes using Ligation High version 2 (Toyobo, Osaka, Japan), yielding plasmid vectors of rVSV. .. The rVSVs expressing HTLV-1 receptor molecule(s) complemented with or without G protein were recovered from the plasmid vectors by established methods ( , ).

    Hemagglutination Assay:

    Article Title: Identification and characterization of the Non-race specific Disease Resistance 1 (NDR1) orthologous protein in coffee
    Article Snippet: The primers used for obtaining the single HA-tagged version were CaNDR1-Forward 4 and CaNDR1-Reverse 2 (5'-CTA CAA CAG CAG AAC CAA GA-3'). .. Selected clones were digested with Mlu -I restriction enzyme (R0198L, NEB, OZYME, Saint Quentin Yvelines, France) before overnight recombination with the binary vector pMDC32 [ ] using the LR Clonase II kit (Invitrogen).

    Drug Susceptibility Assay:

    Article Title: A Diagnostic HIV-1 Tropism System Based on Sequence Relatedness
    Article Snippet: Primers were F_6435M (CYA CCA ACG CGT GTG TAC CCA C) and R_8319N (TGA RTA TCC CTG CCG GCC TCT ATT YAY TAT AGA AA); cycling conditions were 95°C for 2 min, 35 cycles of 95°C for 20 s, 50°C for 20 s, and 72°C for 1 min and 20 s, followed by an extension at 72°C for 3 min. Products were cut with MluI and NgoMIV (New England Biolabs; Bioconcept, Allschwil, Switzerland) and purified over a 0.8% agarose gel. .. Plasmid DNA was purified (DNA MiniPrep kit; Macherey-Nagel AG, Oensingen, Switzerland) and directly used for cell transfection.

    Generated:

    Article Title: H19 non coding RNA-derived miR-675 enhances tumorigenesis and metastasis of breast cancer cells by downregulating c-Cbl and Cbl-b
    Article Snippet: CDS1 of c-Cbl was cloned between Spe I and Pme I and CDS2 between Spe I and Mlu I (New England Biolabs). .. CDS1 of c-Cbl was cloned between Spe I and Pme I and CDS2 between Spe I and Mlu I (New England Biolabs).

    Article Title: Mafb lineage tracing to distinguish macrophages from other immune lineages reveals dual identity of Langerhans cells
    Article Snippet: A MafB-P2A-FLAG-mCherry-T2A-Cre-UTR fragment was released from the resulting vector by restriction digest using SacII, MluI, and Antarctic phosphatase (New England Biolabs, Inc.), and an ∼3-kb fragment containing Mafb 5′-UTR and upstream sequences was amplified from 129S6 genomic DNA and digested using MluI. .. The digested fragments were inserted into the pDONR (P4-P1R) plasmid (Invitrogen) by a modified BP recombination reaction in which incubation at room temperature was followed by addition of a supplemental buffer (10 mM MgCl2 and 1 mM ATP) and T4 DNA ligase (New England Biolabs, Inc.) and incubation at 16°C for 5.5 h before addition of proteinase K solution to terminate the reaction.

    Article Title: Control of Human T-Cell Leukemia Virus Type 1 (HTLV-1) Infection by Eliminating Envelope Protein-Positive Cells with Recombinant Vesicular Stomatitis Viruses Encoding HTLV-1 Primary Receptor
    Article Snippet: All rVSV plasmids were generated according to traditional recombination techniques as described previously ( , ). .. Briefly, amplified products were excised with restriction enzymes MluI and XhoI (New England BioLabs, Hitchin, United Kingdom) and ligated into G-deleted pVSV-XN2 (a VSV Indiana wild-type vector) digested with the same enzymes using Ligation High version 2 (Toyobo, Osaka, Japan), yielding plasmid vectors of rVSV.

    Article Title: A Systematic Analysis on DNA Methylation and the Expression of Both mRNA and microRNA in Bladder Cancer
    Article Snippet: Briefly, 3 µg of genomic DNA was digested with MluI (recognition sequence: ACGCGT ) (NEB, US). .. DNA fragments were captured with streptavidin-conjugated magnetic beads and then bound to the first adapter, which contains a MmeI restriction enzyme recognition site.

    DNA Sequencing:

    Article Title: Substrate Recognition by the Human Fatty-acid Synthase
    Article Snippet: Pfu polymerase, the BAC-to-BAC baculovirus expression system, Escherichia coli maximum efficiency DH10 Bac competent cells, and Spodoptera frugiperda ( Sf9 ) insect cells were obtained from Invitrogen. pBluescript and E. coli XL-1 Blue competent cells were from Stratagene (La Jolla, CA), and the AatII, MluI, HindIII, EcoRI, and BamHI restriction enzymes were from New England Biolabs (Beverly, MA). .. ABI Prism Big Dye Terminator Cycle Sequencing was carried out on an MJ Research PTC-100 Programmable Thermal Controller from Global Medical Instrumentation, Inc. (Ramsey, MN).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: A Diagnostic HIV-1 Tropism System Based on Sequence Relatedness
    Article Snippet: The HIV-1 envelope was amplified using the AffinityScript One-Step RT-PCR kit (Agilent Technologies, Basel, Switzerland) on a Biometra T3000 cycler (Biometra, Goettingen, Germany); primers matched nucleotide positions as indicated by their numbers: F_5700, GAA ACT TAT GGG GAT ACT TGG; R_8494, AGC TGA AGA GGC ACA GGC TCC. .. Primers were F_6435M (CYA CCA ACG CGT GTG TAC CCA C) and R_8319N (TGA RTA TCC CTG CCG GCC TCT ATT YAY TAT AGA AA); cycling conditions were 95°C for 2 min, 35 cycles of 95°C for 20 s, 50°C for 20 s, and 72°C for 1 min and 20 s, followed by an extension at 72°C for 3 min. Products were cut with MluI and NgoMIV (New England Biolabs; Bioconcept, Allschwil, Switzerland) and purified over a 0.8% agarose gel.

    Injection:

    Article Title: Restoration of SMN in Schwann cells reverses myelination defects and improves neuromuscular function in spinal muscular atrophy
    Article Snippet: The intermediate SMN1 -containing plasmid and the Mpz -promoter plasmid were digested using Asc I and Aat II (New England Biolabs) and ligated using T4 DNA ligase. pMpz -SMN1 constructs were confirmed by restriction digestion and sequencing. .. Pronuclear injection Fifty micrograms of pMpz -SMN1 were digested with MluI and NotI (New England Biolabs), to release the 5.8 kb transgene cassette. .. Transgenic injections were performed as previously described ( ).

    Recombinant:

    Article Title: Quorum-Sensing and BvrR/BvrS Regulation, the Type IV Secretion System, Cyclic Glucans, and BacA in the Virulence of Brucella ovis: Similarities to and Differences from Smooth Brucellae
    Article Snippet: The EcoRI insert of the resulting recombinant plasmid was cloned, in the direction opposite that of lacZ , in pGEM-7Zf, and then the SacI-XbaI insert was cloned in pUC19 to obtain plasmid pNVvirPA03. .. The Kanr gene was PCR amplified from pUC4K with primers KanF-MluI and KanR-EcoNI, cloned into pGEM-T, extracted by digestion with MluI (NEB) and partial digestion with EcoNI (NEB), and ligated to pNVvirPA03 cut with the same restriction enzymes.

    Cellular Antioxidant Activity Assay:

    Article Title: Identification and characterization of the Non-race specific Disease Resistance 1 (NDR1) orthologous protein in coffee
    Article Snippet: The primers used for obtaining the single HA-tagged version were CaNDR1-Forward 4 and CaNDR1-Reverse 2 (5'-CTA CAA CAG CAG AAC CAA GA-3'). .. Selected clones were digested with Mlu -I restriction enzyme (R0198L, NEB, OZYME, Saint Quentin Yvelines, France) before overnight recombination with the binary vector pMDC32 [ ] using the LR Clonase II kit (Invitrogen).

    Nucleic Acid Electrophoresis:

    Article Title: Efficient method for site-directed mutagenesis in large plasmids without subcloning
    Article Snippet: PCRs were performed using the following thermocycling conditions: denaturation at 94°C for 2 min followed by 25 cycles of 94°C, 20 sec; 60°C, 30 sec; 68°C, 1 min, and a final extension at 68°C for 5 min. DNA electrophoresis on 1% agarose gel confirmed that the Starter DNA had been produced ( ). .. Successful mutagenesis was confirmed by restriction analysis using NdeI and MluI restriction enzymes (New England Biolabs, Ipswich, MA): 2 μl of Linear Modified DNA for each mutation type was incubated with or without 5 units of restriction enzymes for 30 min at 37°C.

    Magnetic Beads:

    Article Title: A Systematic Analysis on DNA Methylation and the Expression of Both mRNA and microRNA in Bladder Cancer
    Article Snippet: Briefly, 3 µg of genomic DNA was digested with MluI (recognition sequence: ACGCGT ) (NEB, US). .. Briefly, 3 µg of genomic DNA was digested with MluI (recognition sequence: ACGCGT ) (NEB, US).

    Mutagenesis:

    Article Title: Mafb lineage tracing to distinguish macrophages from other immune lineages reveals dual identity of Langerhans cells
    Article Snippet: Paragraph title: Generation of the MafB-mCherry-Cre targeted mutation ... A MafB-P2A-FLAG-mCherry-T2A-Cre-UTR fragment was released from the resulting vector by restriction digest using SacII, MluI, and Antarctic phosphatase (New England Biolabs, Inc.), and an ∼3-kb fragment containing Mafb 5′-UTR and upstream sequences was amplified from 129S6 genomic DNA and digested using MluI.

    Article Title: Efficient method for site-directed mutagenesis in large plasmids without subcloning
    Article Snippet: 2.5 μl of these products were self-ligated with T4 DNA ligase as above and 1 μl of a 1:200 dilution of the Closed Intermediate DNA product was used as a template for the final PCR reaction to create the Linear Modified DNA . .. Successful mutagenesis was confirmed by restriction analysis using NdeI and MluI restriction enzymes (New England Biolabs, Ipswich, MA): 2 μl of Linear Modified DNA for each mutation type was incubated with or without 5 units of restriction enzymes for 30 min at 37°C. .. 5 μl of each reaction was resolved by electrophoresis on a 1% agarose gel.

    Article Title: Quorum-Sensing and BvrR/BvrS Regulation, the Type IV Secretion System, Cyclic Glucans, and BacA in the Virulence of Brucella ovis: Similarities to and Differences from Smooth Brucellae
    Article Snippet: Paragraph title: Generation of mutant strains. ... The Kanr gene was PCR amplified from pUC4K with primers KanF-MluI and KanR-EcoNI, cloned into pGEM-T, extracted by digestion with MluI (NEB) and partial digestion with EcoNI (NEB), and ligated to pNVvirPA03 cut with the same restriction enzymes.

    Isolation:

    Article Title: A Diagnostic HIV-1 Tropism System Based on Sequence Relatedness
    Article Snippet: Amplification of the HIV-1 Env gene isolated from clinical samples was successfully performed when virus loads were greater than 500 copies/ml ( ). .. Primers were F_6435M (CYA CCA ACG CGT GTG TAC CCA C) and R_8319N (TGA RTA TCC CTG CCG GCC TCT ATT YAY TAT AGA AA); cycling conditions were 95°C for 2 min, 35 cycles of 95°C for 20 s, 50°C for 20 s, and 72°C for 1 min and 20 s, followed by an extension at 72°C for 3 min. Products were cut with MluI and NgoMIV (New England Biolabs; Bioconcept, Allschwil, Switzerland) and purified over a 0.8% agarose gel.

    Article Title: Development of human-like scFv-Fc antibodies neutralizing Botulinum toxin serotype B
    Article Snippet: For this, the pHAL35 or pHAL32 vector and the VL fragments were digested with MluI and NotI (New England Biolabs, Frankfurt, Germany), the enzymes were inactivated, pHAL35 or pHAL32 was dephosphorylated using calf intestinal phosphatase (MBI, Fermentas), and the DNA was purified. .. DNA was precipitated from the reaction mixes with ethanol and sodium acetate, the pellet was washed twice with 70% ethanol, and then 4 aliquots (25 μL) of XL1-Blue MRF' (Stratagene, Amsterdam, the Netherlands) were used for electroporation.

    Marker:

    Article Title: Identification and characterization of the Non-race specific Disease Resistance 1 (NDR1) orthologous protein in coffee
    Article Snippet: Selected clones were digested with Mlu -I restriction enzyme (R0198L, NEB, OZYME, Saint Quentin Yvelines, France) before overnight recombination with the binary vector pMDC32 [ ] using the LR Clonase II kit (Invitrogen). .. Primers used for the initial PCR step were as follows: CaNDR1-Forward 1, 5'- CACC ATG TCA GAC CCC AGC AGC AGT-3' and CaNDR1-Reverse 2.

    Article Title: Rapid bacterial artificial chromosome modification for large-scale mouse transgenesis
    Article Snippet: Transgene-containing vectors: pLD53.SC2, which contains EGFP, or pLD53.SC296, which contains EGFP-L10a. .. Both available from the laboratory of Nathaniel Heintz, The Rockefeller University, through Judy Walsh ( ) pSV.RecA vector: available from the laboratory of Nathaniel Heintz, The Rockefeller University, through Judy Walsh ( ) Swiss Webster female mice (Taconic) Bacterial artificial chromosomes (BACs in DH10B host bacteria; Invitrogen Corporation, BACPAC Resources at CHORI or Riken Bioresources Center) PIR1 chemically competent E. coli (Invitrogen, cat. no. C1010-10) PIR2 chemically competent E. coli (Invitrogen, cat. no. C1111-10) MAX efficiency DH5α-competent cells (Invitrogen, cat. no. 18258-012) PCR primers (Invitrogen and Biosynthesis; see REAGENT SETUP) AscI restriction endonuclease (New England Biolabs, cat. no. R0558L) EcoRI restriction endonuclease (New England Biolabs, cat. no. R0101L) MluI restriction endonuclease (New England Biolabs, cat. no. R0198L) SwaI restriction endonuclease (New England Biolabs, cat. no. R0604L) T4 DNA ligase (New England Biolabs, cat. no. M0202L) XmaI restriction endonuclease (New England Biolabs, cat. no. R0180L) PI-SceI endonuclease (New England Biolabs, cat. no. R0696S) λ-DNA-HindIII Digest (New England Biolabs, cat. no. N3012S) Low-range PFG marker DNA ladder (New England Biolabs, cat. no. NO350S) 2-log DNA ladder (New England Biolabs, cat. no. N3200L) 1-Butanol (Fisher Scientific, cat. no. A399) 2-Propanol (Isopropanol, Fisher Scientific, cat. no. A416) Ammonium acetate (Fisher Scientific, cat. no. A637) Ampicillin (amp; Sigma-Aldrich, cat. no. A9518; see REAGENT SETUP) Calcium chloride dihydrate (CaCl2 , Fisher Scientific, cat. no. C70–500) Cesium chloride (CsCl, Fischer Scientific, cat. no. BP1595-500) Chloramphenicol (chlor; Sigma-Aldrich, cat. no. C0378; see REAGENT SETUP) Chloroform (Fisher Scientific, cat. no. C298–500) Ethidium bromide solution (10 mg ml−1 ; Sigma-Aldrich, cat. no. E1510) ! .. Ethanol (Pharmco-AAPER) EDTA (Sigma-Aldrich, cat. no. E5134) FailSafe PCR System (Epicentre, cat. no. FS99250) Glacial acetic acid (Fisher Scientific, cat. no. A38S) !

    Size-exclusion Chromatography:

    Article Title: Efficient method for site-directed mutagenesis in large plasmids without subcloning
    Article Snippet: PCRs were performed using the following thermocycling conditions: denaturation at 94°C for 2 min followed by 25 cycles of 94°C, 20 sec; 60°C, 30 sec; 68°C, 1 min, and a final extension at 68°C for 5 min. DNA electrophoresis on 1% agarose gel confirmed that the Starter DNA had been produced ( ). .. Successful mutagenesis was confirmed by restriction analysis using NdeI and MluI restriction enzymes (New England Biolabs, Ipswich, MA): 2 μl of Linear Modified DNA for each mutation type was incubated with or without 5 units of restriction enzymes for 30 min at 37°C.

    Purification:

    Article Title: A Diagnostic HIV-1 Tropism System Based on Sequence Relatedness
    Article Snippet: After primer annealing at 65°C for 5 min, 42°C for 2 min, and 25°C for 10 min, reverse transcription was conducted at 45°C for 30 min, 92°C for 1 min, followed by PCR at 40 cycles of 92°C for 20 s, 55°C for 20 s, and 68°C for 3 min, and then extension was at 68°C for 5 min. For the 2nd, nested, PCR for envelope and for introducing the cloning sites MluI and NgoMIV, the Pfu -ultraII Fusion HS DNA polymerase was used (Agilent Technologies, Basel, Switzerland). .. Primers were F_6435M (CYA CCA ACG CGT GTG TAC CCA C) and R_8319N (TGA RTA TCC CTG CCG GCC TCT ATT YAY TAT AGA AA); cycling conditions were 95°C for 2 min, 35 cycles of 95°C for 20 s, 50°C for 20 s, and 72°C for 1 min and 20 s, followed by an extension at 72°C for 3 min. Products were cut with MluI and NgoMIV (New England Biolabs; Bioconcept, Allschwil, Switzerland) and purified over a 0.8% agarose gel. .. Then the respective fragments of 1.9 kbp were ligated into an NL4-3 backbone to reconstitute fully functional proviruses.

    Article Title: Development of human-like scFv-Fc antibodies neutralizing Botulinum toxin serotype B
    Article Snippet: The library construction consisted of the cloning of the VL fragments into pHAL35 (BoNT/B2-LC library) or pHAL32 vector (BoNT/B2-HC library), and then the cloning of the VH fragments into the same vector, containing the VL repertoire. .. For this, the pHAL35 or pHAL32 vector and the VL fragments were digested with MluI and NotI (New England Biolabs, Frankfurt, Germany), the enzymes were inactivated, pHAL35 or pHAL32 was dephosphorylated using calf intestinal phosphatase (MBI, Fermentas), and the DNA was purified. .. VL PCR products (270 ng) were inserted into 1 μg of the dephosphorylated pHAL35 or pHAL32 preparation in 4 separate ligation reactions.

    Article Title: Post-Exposure Protection in Mice against Sudan Virus by a Two Antibody Cocktail
    Article Snippet: The PCR products were separated by 1.5% (w/v) agarose gel, cut out and purified using Nucleospin Extract II Kit (Macherey-Nagel, Düren, Germany) according to the manufacturer’s instructions. .. A total of 5 µg pHAL35 and 2 µg VL were digested using 50 U MluI and 50 U NotI (NEB, Frankfurt, Germany) in a 100 µL reaction volume for 2 h at 37 °C.

    Polymerase Chain Reaction:

    Article Title: Identification and characterization of the Non-race specific Disease Resistance 1 (NDR1) orthologous protein in coffee
    Article Snippet: PCR fragments were then subcloned into the pENTR-D/TOPO vector (Invitrogen, Cergy Pontoise, France) and sequenced. .. Selected clones were digested with Mlu -I restriction enzyme (R0198L, NEB, OZYME, Saint Quentin Yvelines, France) before overnight recombination with the binary vector pMDC32 [ ] using the LR Clonase II kit (Invitrogen).

    Article Title: H19 non coding RNA-derived miR-675 enhances tumorigenesis and metastasis of breast cancer cells by downregulating c-Cbl and Cbl-b
    Article Snippet: CDS1 of c-Cbl was cloned between Spe I and Pme I and CDS2 between Spe I and Mlu I (New England Biolabs). .. CDS1 of c-Cbl was cloned between Spe I and Pme I and CDS2 between Spe I and Mlu I (New England Biolabs).

    Article Title: Mafb lineage tracing to distinguish macrophages from other immune lineages reveals dual identity of Langerhans cells
    Article Snippet: A MafB-P2A-FLAG-mCherry-T2A-Cre-UTR fragment was released from the resulting vector by restriction digest using SacII, MluI, and Antarctic phosphatase (New England Biolabs, Inc.), and an ∼3-kb fragment containing Mafb 5′-UTR and upstream sequences was amplified from 129S6 genomic DNA and digested using MluI. .. A MafB-P2A-FLAG-mCherry-T2A-Cre-UTR fragment was released from the resulting vector by restriction digest using SacII, MluI, and Antarctic phosphatase (New England Biolabs, Inc.), and an ∼3-kb fragment containing Mafb 5′-UTR and upstream sequences was amplified from 129S6 genomic DNA and digested using MluI.

    Article Title: Efficient method for site-directed mutagenesis in large plasmids without subcloning
    Article Snippet: 2.5 μl of these products were self-ligated with T4 DNA ligase as above and 1 μl of a 1:200 dilution of the Closed Intermediate DNA product was used as a template for the final PCR reaction to create the Linear Modified DNA . .. Successful mutagenesis was confirmed by restriction analysis using NdeI and MluI restriction enzymes (New England Biolabs, Ipswich, MA): 2 μl of Linear Modified DNA for each mutation type was incubated with or without 5 units of restriction enzymes for 30 min at 37°C.

    Article Title: Quorum-Sensing and BvrR/BvrS Regulation, the Type IV Secretion System, Cyclic Glucans, and BacA in the Virulence of Brucella ovis: Similarities to and Differences from Smooth Brucellae
    Article Snippet: The EcoRI insert of the resulting recombinant plasmid was cloned, in the direction opposite that of lacZ , in pGEM-7Zf, and then the SacI-XbaI insert was cloned in pUC19 to obtain plasmid pNVvirPA03. .. The Kanr gene was PCR amplified from pUC4K with primers KanF-MluI and KanR-EcoNI, cloned into pGEM-T, extracted by digestion with MluI (NEB) and partial digestion with EcoNI (NEB), and ligated to pNVvirPA03 cut with the same restriction enzymes. .. The SacI-XbaI insert DNA of the resulting plasmid, bearing inactivated virB2 and virB3 , was ligated to SacI-XbaI-digested pCVD442 to afford pNVvirPA05.

    Article Title: A Diagnostic HIV-1 Tropism System Based on Sequence Relatedness
    Article Snippet: After primer annealing at 65°C for 5 min, 42°C for 2 min, and 25°C for 10 min, reverse transcription was conducted at 45°C for 30 min, 92°C for 1 min, followed by PCR at 40 cycles of 92°C for 20 s, 55°C for 20 s, and 68°C for 3 min, and then extension was at 68°C for 5 min. For the 2nd, nested, PCR for envelope and for introducing the cloning sites MluI and NgoMIV, the Pfu -ultraII Fusion HS DNA polymerase was used (Agilent Technologies, Basel, Switzerland). .. Primers were F_6435M (CYA CCA ACG CGT GTG TAC CCA C) and R_8319N (TGA RTA TCC CTG CCG GCC TCT ATT YAY TAT AGA AA); cycling conditions were 95°C for 2 min, 35 cycles of 95°C for 20 s, 50°C for 20 s, and 72°C for 1 min and 20 s, followed by an extension at 72°C for 3 min. Products were cut with MluI and NgoMIV (New England Biolabs; Bioconcept, Allschwil, Switzerland) and purified over a 0.8% agarose gel.

    Article Title: Role of N-Linked Glycans in a Human Immunodeficiency Virus Envelope Glycoprotein: Effects on Protein Function and the Neutralizing Antibody Response
    Article Snippet: The reverse primer, 5′ GATCGGATCCGCGGCCGC GCTAGC GGTATCACAAGTTGATTTGG 3′, contained an Nhe I site (underlined). .. The PCR product was digested with Mlu I and Nhe I restriction enzymes (New England Biolabs) and ligated to pVSVΔG-JRFLG-GFP , which had previously been digested with Mlu I and Nhe I to remove the JRFLG insert. .. The resulting plasmids were designated pVSVΔG-89.6G(4-7)-GFP and pVSVΔG-89.6G(3-7)-GFP.

    Article Title: Control of Human T-Cell Leukemia Virus Type 1 (HTLV-1) Infection by Eliminating Envelope Protein-Positive Cells with Recombinant Vesicular Stomatitis Viruses Encoding HTLV-1 Primary Receptor
    Article Snippet: To construct rVSV plasmids lacking the G gene and encoding human GLUT1, NRP1, and SDC1, genes encoding these proteins were initially amplified by PCR with the expression vectors for GLUT1 and SDC1 (kindly provided by A. Tanaka, Gunma University) ( ) and NRP1 (purchased from OriGene Technologies, Rockville, MD). .. Briefly, amplified products were excised with restriction enzymes MluI and XhoI (New England BioLabs, Hitchin, United Kingdom) and ligated into G-deleted pVSV-XN2 (a VSV Indiana wild-type vector) digested with the same enzymes using Ligation High version 2 (Toyobo, Osaka, Japan), yielding plasmid vectors of rVSV.

    Article Title: A Systematic Analysis on DNA Methylation and the Expression of Both mRNA and microRNA in Bladder Cancer
    Article Snippet: Briefly, 3 µg of genomic DNA was digested with MluI (recognition sequence: ACGCGT ) (NEB, US). .. Bounded DNA was then digested with MmeI (NEB, US), which generated a 17–18 nt library, followed by ligating to the P7 adapter.

    Article Title: Regulation of miR-146a by RelA/NFkB and p53 in STHdhQ111/HdhQ111 Cells, a Cell Model of Huntington's Disease
    Article Snippet: For luciferase reporter assays, we cloned two fragments of the 3′ UTR of human p53 into pmiR-Report vector (Ambion, USA), one comprising of 150 bp (position 733–739) containing miR-125b recognition site and the other comprising of 136 bp (position 234–256) containing miR-150 recognition site. .. These regions were amplified by PCR from human genomic DNA and cloned in vector using the MluI and HindIII (NEB, USA) sites. .. The constructs were named p53-UTR1 and p53-UTR2 respectively.

    Article Title: Development of human-like scFv-Fc antibodies neutralizing Botulinum toxin serotype B
    Article Snippet: The PCR products corresponding to the retro-amplification of the RNA coding Fd fragments and the γ chain and к light chains were separately pooled to generate 2 sub-libraries in pGEM®-T vector (Promega, Madison, Wisconsin, USA): one for the antibody variable region of the light chain (VL) and one for the antibody variable region of the heavy chain (VH). .. For this, the pHAL35 or pHAL32 vector and the VL fragments were digested with MluI and NotI (New England Biolabs, Frankfurt, Germany), the enzymes were inactivated, pHAL35 or pHAL32 was dephosphorylated using calf intestinal phosphatase (MBI, Fermentas), and the DNA was purified.

    Article Title: Post-Exposure Protection in Mice against Sudan Virus by a Two Antibody Cocktail
    Article Snippet: [ ] Second, the VH PCR fragments were cloned. .. A total of 5 µg pHAL35 and 2 µg VL were digested using 50 U MluI and 50 U NotI (NEB, Frankfurt, Germany) in a 100 µL reaction volume for 2 h at 37 °C.

    Article Title: Rapid bacterial artificial chromosome modification for large-scale mouse transgenesis
    Article Snippet: Transgene-containing vectors: pLD53.SC2, which contains EGFP, or pLD53.SC296, which contains EGFP-L10a. .. Both available from the laboratory of Nathaniel Heintz, The Rockefeller University, through Judy Walsh ( ) pSV.RecA vector: available from the laboratory of Nathaniel Heintz, The Rockefeller University, through Judy Walsh ( ) Swiss Webster female mice (Taconic) Bacterial artificial chromosomes (BACs in DH10B host bacteria; Invitrogen Corporation, BACPAC Resources at CHORI or Riken Bioresources Center) PIR1 chemically competent E. coli (Invitrogen, cat. no. C1010-10) PIR2 chemically competent E. coli (Invitrogen, cat. no. C1111-10) MAX efficiency DH5α-competent cells (Invitrogen, cat. no. 18258-012) PCR primers (Invitrogen and Biosynthesis; see REAGENT SETUP) AscI restriction endonuclease (New England Biolabs, cat. no. R0558L) EcoRI restriction endonuclease (New England Biolabs, cat. no. R0101L) MluI restriction endonuclease (New England Biolabs, cat. no. R0198L) SwaI restriction endonuclease (New England Biolabs, cat. no. R0604L) T4 DNA ligase (New England Biolabs, cat. no. M0202L) XmaI restriction endonuclease (New England Biolabs, cat. no. R0180L) PI-SceI endonuclease (New England Biolabs, cat. no. R0696S) λ-DNA-HindIII Digest (New England Biolabs, cat. no. N3012S) Low-range PFG marker DNA ladder (New England Biolabs, cat. no. NO350S) 2-log DNA ladder (New England Biolabs, cat. no. N3200L) 1-Butanol (Fisher Scientific, cat. no. A399) 2-Propanol (Isopropanol, Fisher Scientific, cat. no. A416) Ammonium acetate (Fisher Scientific, cat. no. A637) Ampicillin (amp; Sigma-Aldrich, cat. no. A9518; see REAGENT SETUP) Calcium chloride dihydrate (CaCl2 , Fisher Scientific, cat. no. C70–500) Cesium chloride (CsCl, Fischer Scientific, cat. no. BP1595-500) Chloramphenicol (chlor; Sigma-Aldrich, cat. no. C0378; see REAGENT SETUP) Chloroform (Fisher Scientific, cat. no. C298–500) Ethidium bromide solution (10 mg ml−1 ; Sigma-Aldrich, cat. no. E1510) ! .. Ethanol (Pharmco-AAPER) EDTA (Sigma-Aldrich, cat. no. E5134) FailSafe PCR System (Epicentre, cat. no. FS99250) Glacial acetic acid (Fisher Scientific, cat. no. A38S) !

    De-Phosphorylation Assay:

    Article Title: Post-Exposure Protection in Mice against Sudan Virus by a Two Antibody Cocktail
    Article Snippet: A total of 5 µg pHAL35 and 2 µg VL were digested using 50 U MluI and 50 U NotI (NEB, Frankfurt, Germany) in a 100 µL reaction volume for 2 h at 37 °C. .. A total of 5 µg pHAL35 and 2 µg VL were digested using 50 U MluI and 50 U NotI (NEB, Frankfurt, Germany) in a 100 µL reaction volume for 2 h at 37 °C.

    IA:

    Article Title: Substrate Recognition by the Human Fatty-acid Synthase
    Article Snippet: Pfu polymerase, the BAC-to-BAC baculovirus expression system, Escherichia coli maximum efficiency DH10 Bac competent cells, and Spodoptera frugiperda ( Sf9 ) insect cells were obtained from Invitrogen. pBluescript and E. coli XL-1 Blue competent cells were from Stratagene (La Jolla, CA), and the AatII, MluI, HindIII, EcoRI, and BamHI restriction enzymes were from New England Biolabs (Beverly, MA). .. Pfu polymerase, the BAC-to-BAC baculovirus expression system, Escherichia coli maximum efficiency DH10 Bac competent cells, and Spodoptera frugiperda ( Sf9 ) insect cells were obtained from Invitrogen. pBluescript and E. coli XL-1 Blue competent cells were from Stratagene (La Jolla, CA), and the AatII, MluI, HindIII, EcoRI, and BamHI restriction enzymes were from New England Biolabs (Beverly, MA).

    Activated Clotting Time Assay:

    Article Title: A Diagnostic HIV-1 Tropism System Based on Sequence Relatedness
    Article Snippet: The HIV-1 envelope was amplified using the AffinityScript One-Step RT-PCR kit (Agilent Technologies, Basel, Switzerland) on a Biometra T3000 cycler (Biometra, Goettingen, Germany); primers matched nucleotide positions as indicated by their numbers: F_5700, GAA ACT TAT GGG GAT ACT TGG; R_8494, AGC TGA AGA GGC ACA GGC TCC. .. Primers were F_6435M (CYA CCA ACG CGT GTG TAC CCA C) and R_8319N (TGA RTA TCC CTG CCG GCC TCT ATT YAY TAT AGA AA); cycling conditions were 95°C for 2 min, 35 cycles of 95°C for 20 s, 50°C for 20 s, and 72°C for 1 min and 20 s, followed by an extension at 72°C for 3 min. Products were cut with MluI and NgoMIV (New England Biolabs; Bioconcept, Allschwil, Switzerland) and purified over a 0.8% agarose gel.

    Mouse Assay:

    Article Title: Rapid bacterial artificial chromosome modification for large-scale mouse transgenesis
    Article Snippet: Transgene-containing vectors: pLD53.SC2, which contains EGFP, or pLD53.SC296, which contains EGFP-L10a. .. Both available from the laboratory of Nathaniel Heintz, The Rockefeller University, through Judy Walsh ( ) pSV.RecA vector: available from the laboratory of Nathaniel Heintz, The Rockefeller University, through Judy Walsh ( ) Swiss Webster female mice (Taconic) Bacterial artificial chromosomes (BACs in DH10B host bacteria; Invitrogen Corporation, BACPAC Resources at CHORI or Riken Bioresources Center) PIR1 chemically competent E. coli (Invitrogen, cat. no. C1010-10) PIR2 chemically competent E. coli (Invitrogen, cat. no. C1111-10) MAX efficiency DH5α-competent cells (Invitrogen, cat. no. 18258-012) PCR primers (Invitrogen and Biosynthesis; see REAGENT SETUP) AscI restriction endonuclease (New England Biolabs, cat. no. R0558L) EcoRI restriction endonuclease (New England Biolabs, cat. no. R0101L) MluI restriction endonuclease (New England Biolabs, cat. no. R0198L) SwaI restriction endonuclease (New England Biolabs, cat. no. R0604L) T4 DNA ligase (New England Biolabs, cat. no. M0202L) XmaI restriction endonuclease (New England Biolabs, cat. no. R0180L) PI-SceI endonuclease (New England Biolabs, cat. no. R0696S) λ-DNA-HindIII Digest (New England Biolabs, cat. no. N3012S) Low-range PFG marker DNA ladder (New England Biolabs, cat. no. NO350S) 2-log DNA ladder (New England Biolabs, cat. no. N3200L) 1-Butanol (Fisher Scientific, cat. no. A399) 2-Propanol (Isopropanol, Fisher Scientific, cat. no. A416) Ammonium acetate (Fisher Scientific, cat. no. A637) Ampicillin (amp; Sigma-Aldrich, cat. no. A9518; see REAGENT SETUP) Calcium chloride dihydrate (CaCl2 , Fisher Scientific, cat. no. C70–500) Cesium chloride (CsCl, Fischer Scientific, cat. no. BP1595-500) Chloramphenicol (chlor; Sigma-Aldrich, cat. no. C0378; see REAGENT SETUP) Chloroform (Fisher Scientific, cat. no. C298–500) Ethidium bromide solution (10 mg ml−1 ; Sigma-Aldrich, cat. no. E1510) ! .. Ethanol (Pharmco-AAPER) EDTA (Sigma-Aldrich, cat. no. E5134) FailSafe PCR System (Epicentre, cat. no. FS99250) Glacial acetic acid (Fisher Scientific, cat. no. A38S) !

    Chromatin Immunoprecipitation:

    Article Title: The ets-Related Transcription Factor GABP Directs Bidirectional Transcription
    Article Snippet: The 241 general promoters tested for GABP ChIP enrichment were previously cloned into the plasmid pGL3 Basic (Promega) and verified to be functional promoters as part of the ENCODE project [ ]. .. We amplified these promoters, consisting of the sequence from approximately −500 to +50 bp relative to the start of transcription, by using common primers flanking the MCS (Forward 5′-CATACGCTCTCCATCAAAACAAA-3′, Reverse 5′-TTTATGTTTTTGGCGTCTTCCAT-3′), digested them with Mlu I and Bgl II (New England BioLabs), and then recloned them into a pGL3 Basic vector with a reversed MCS, yielding a luciferase reporter plasmid with a reversed promoter sequence.

    Plasmid Preparation:

    Article Title: The association of XRCC1 polymorphism with osteosarcoma risk, clinicopathologic features, and prognosis in a Chinese Han population
    Article Snippet: A fragment (from −818 to −22) in the XRCC1 promoter region from the subjects homozygous for rs3213245 T or C allele was amplified using the following primers: 5′-AAACGCGTTT-GCGTAGAATCCAGGTTCC-3′ and 5′-AAAGATCTTGGC-CAGAAGGATGAGGTAG-3′. .. Both the amplified fragments and pGL3-basic vector were digested with Mlu I (A^CGCGT/TGCGC^A) and Bgl II (A^GATCT/TCTAG^A) enzymes (New England BioLabs Inc., Ipswich, MA, USA), and the amplified fragments were cloned into pGL3-basic vector. .. Subsequently, the vectors were sequenced to validate the orientation and integrity of plasmid construct.

    Article Title: The ets-Related Transcription Factor GABP Directs Bidirectional Transcription
    Article Snippet: The 241 general promoters tested for GABP ChIP enrichment were previously cloned into the plasmid pGL3 Basic (Promega) and verified to be functional promoters as part of the ENCODE project [ ]. .. We amplified these promoters, consisting of the sequence from approximately −500 to +50 bp relative to the start of transcription, by using common primers flanking the MCS (Forward 5′-CATACGCTCTCCATCAAAACAAA-3′, Reverse 5′-TTTATGTTTTTGGCGTCTTCCAT-3′), digested them with Mlu I and Bgl II (New England BioLabs), and then recloned them into a pGL3 Basic vector with a reversed MCS, yielding a luciferase reporter plasmid with a reversed promoter sequence. .. A total of 50 ng of each promoter construct was cotransfected with 5 ng of pRLTK (Promega), a Renilla luciferase-expressing transfection control, using FuGene (Roche).

    Article Title: Identification and characterization of the Non-race specific Disease Resistance 1 (NDR1) orthologous protein in coffee
    Article Snippet: To get directional cloning, the underlined nucleotide sequence was added to the forward primers. .. Selected clones were digested with Mlu -I restriction enzyme (R0198L, NEB, OZYME, Saint Quentin Yvelines, France) before overnight recombination with the binary vector pMDC32 [ ] using the LR Clonase II kit (Invitrogen). .. The N-terminally GFP6-tagged version was produced to examine the subcellular localization of CaNDR1a.

    Article Title: H19 non coding RNA-derived miR-675 enhances tumorigenesis and metastasis of breast cancer cells by downregulating c-Cbl and Cbl-b
    Article Snippet: Coding DNA Sequence (CDS) and 3′UTR of c-Cbl and Cbl-b mRNA were cloned in the pMIR-REPORT luciferase vector (Ambion). .. CDS1 of c-Cbl was cloned between Spe I and Pme I and CDS2 between Spe I and Mlu I (New England Biolabs).

    Article Title: Mafb lineage tracing to distinguish macrophages from other immune lineages reveals dual identity of Langerhans cells
    Article Snippet: Both the amplified 3′-UTR fragment and pMSCV MafB-P2A-FLAG-mCherry-T2A-Cre retroviral overexpression vector were digested using EcoRI and ClaI and then ligated together. .. A MafB-P2A-FLAG-mCherry-T2A-Cre-UTR fragment was released from the resulting vector by restriction digest using SacII, MluI, and Antarctic phosphatase (New England Biolabs, Inc.), and an ∼3-kb fragment containing Mafb 5′-UTR and upstream sequences was amplified from 129S6 genomic DNA and digested using MluI. .. The primers used to amplify the latter fragment were: 5′-ATTAAGATCTGGGGACAACTTTGTATAGAAAAGTTGCGGAGTGTGGTGTTCTCTCT-3′ and 5′-CGTCTTCTCGTTCTCCAGGT-3′.

    Article Title: Efficient method for site-directed mutagenesis in large plasmids without subcloning
    Article Snippet: Successful mutagenesis was confirmed by restriction analysis using NdeI and MluI restriction enzymes (New England Biolabs, Ipswich, MA): 2 μl of Linear Modified DNA for each mutation type was incubated with or without 5 units of restriction enzymes for 30 min at 37°C. .. Successful mutagenesis was confirmed by restriction analysis using NdeI and MluI restriction enzymes (New England Biolabs, Ipswich, MA): 2 μl of Linear Modified DNA for each mutation type was incubated with or without 5 units of restriction enzymes for 30 min at 37°C.

    Article Title: Coronaviruses: Propagation, Quantification, Storage, and Construction of Recombinant Mouse Hepatitis Virus
    Article Snippet: Although many of the plasmid vectors used to propagate these cDNAs were chosen to increase stability (see ), to minimize problems it is necessary to grow the, plasmids at 30°C in Top 10 cells (Invitrogen). .. LB plates (50 μg/ml ampicillin or 30 μg/ml kanamycin) 2xYT Broth Autoclaved glycerol Plasmid Miniprep kit (Genscript Cat. No. ) Plasmid Midriprep kit (Biorad Cat. No. 732-6120) Top 10 cells (Invitrogen Cat. No. C4040-03) Restriction enzymes AdhI, BglI, BsmBI, MluI, and SfiI from New England Biolabs .. Bacteria containing the desired plasmids are streaked from either glycerated stocks or from prior plates less than 6 weeks old, on LB-agar plate containing the appropriate antibiotic (see ; 50 μg/ml ampicillin or 30 μg/ml kanamycin, depending upon the plasmid) and incubated at 30°C for 24–36 hours.

    Article Title: Quorum-Sensing and BvrR/BvrS Regulation, the Type IV Secretion System, Cyclic Glucans, and BacA in the Virulence of Brucella ovis: Similarities to and Differences from Smooth Brucellae
    Article Snippet: The EcoRI insert of the resulting recombinant plasmid was cloned, in the direction opposite that of lacZ , in pGEM-7Zf, and then the SacI-XbaI insert was cloned in pUC19 to obtain plasmid pNVvirPA03. .. The Kanr gene was PCR amplified from pUC4K with primers KanF-MluI and KanR-EcoNI, cloned into pGEM-T, extracted by digestion with MluI (NEB) and partial digestion with EcoNI (NEB), and ligated to pNVvirPA03 cut with the same restriction enzymes.

    Article Title: A Diagnostic HIV-1 Tropism System Based on Sequence Relatedness
    Article Snippet: Primers were F_6435M (CYA CCA ACG CGT GTG TAC CCA C) and R_8319N (TGA RTA TCC CTG CCG GCC TCT ATT YAY TAT AGA AA); cycling conditions were 95°C for 2 min, 35 cycles of 95°C for 20 s, 50°C for 20 s, and 72°C for 1 min and 20 s, followed by an extension at 72°C for 3 min. Products were cut with MluI and NgoMIV (New England Biolabs; Bioconcept, Allschwil, Switzerland) and purified over a 0.8% agarose gel. .. After transformation of Top10 bacteria (Life Technologies), 4 ml of standard LB broth-Amp was directly inoculated without plating in order to retain viral diversity.

    Article Title: Role of N-Linked Glycans in a Human Immunodeficiency Virus Envelope Glycoprotein: Effects on Protein Function and the Neutralizing Antibody Response
    Article Snippet: Paragraph title: Plasmid construction. ... The PCR product was digested with Mlu I and Nhe I restriction enzymes (New England Biolabs) and ligated to pVSVΔG-JRFLG-GFP , which had previously been digested with Mlu I and Nhe I to remove the JRFLG insert.

    Article Title: Control of Human T-Cell Leukemia Virus Type 1 (HTLV-1) Infection by Eliminating Envelope Protein-Positive Cells with Recombinant Vesicular Stomatitis Viruses Encoding HTLV-1 Primary Receptor
    Article Snippet: All rVSV plasmids were generated according to traditional recombination techniques as described previously ( , ). .. Briefly, amplified products were excised with restriction enzymes MluI and XhoI (New England BioLabs, Hitchin, United Kingdom) and ligated into G-deleted pVSV-XN2 (a VSV Indiana wild-type vector) digested with the same enzymes using Ligation High version 2 (Toyobo, Osaka, Japan), yielding plasmid vectors of rVSV. .. The primers containing restriction sites and/or VSV transcription stop-start signal sequences used in this study are listed in Table S2 in the supplemental material.

    Article Title: Regulation of miR-146a by RelA/NFkB and p53 in STHdhQ111/HdhQ111 Cells, a Cell Model of Huntington's Disease
    Article Snippet: For luciferase reporter assays, we cloned two fragments of the 3′ UTR of human p53 into pmiR-Report vector (Ambion, USA), one comprising of 150 bp (position 733–739) containing miR-125b recognition site and the other comprising of 136 bp (position 234–256) containing miR-150 recognition site. .. These regions were amplified by PCR from human genomic DNA and cloned in vector using the MluI and HindIII (NEB, USA) sites. .. The constructs were named p53-UTR1 and p53-UTR2 respectively.

    Article Title: Development of human-like scFv-Fc antibodies neutralizing Botulinum toxin serotype B
    Article Snippet: The library construction consisted of the cloning of the VL fragments into pHAL35 (BoNT/B2-LC library) or pHAL32 vector (BoNT/B2-HC library), and then the cloning of the VH fragments into the same vector, containing the VL repertoire. .. For this, the pHAL35 or pHAL32 vector and the VL fragments were digested with MluI and NotI (New England Biolabs, Frankfurt, Germany), the enzymes were inactivated, pHAL35 or pHAL32 was dephosphorylated using calf intestinal phosphatase (MBI, Fermentas), and the DNA was purified. .. VL PCR products (270 ng) were inserted into 1 μg of the dephosphorylated pHAL35 or pHAL32 preparation in 4 separate ligation reactions.

    Article Title: Lym-1 Chimeric Antigen Receptor T Cells Exhibit Potent Anti-Tumor Effects against B-Cell Lymphoma
    Article Snippet: Paragraph title: 4.3. Vector Construction and Preparation of Lentivirus ... For this study, the IRES-ZsGreen moiety was removed by restriction enzyme digestion with EcoRI and MluI (NEB, Ipswich, MA, USA), prior to insertion of the CAR encoding gene.

    Article Title: Post-Exposure Protection in Mice against Sudan Virus by a Two Antibody Cocktail
    Article Snippet: A total of 5 µg pHAL35 and 2 µg VL were digested using 50 U MluI and 50 U NotI (NEB, Frankfurt, Germany) in a 100 µL reaction volume for 2 h at 37 °C. .. This dephosphorylation step was repeated once.

    Article Title: Rapid bacterial artificial chromosome modification for large-scale mouse transgenesis
    Article Snippet: Transgene-containing vectors: pLD53.SC2, which contains EGFP, or pLD53.SC296, which contains EGFP-L10a. .. Both available from the laboratory of Nathaniel Heintz, The Rockefeller University, through Judy Walsh ( ) pSV.RecA vector: available from the laboratory of Nathaniel Heintz, The Rockefeller University, through Judy Walsh ( ) Swiss Webster female mice (Taconic) Bacterial artificial chromosomes (BACs in DH10B host bacteria; Invitrogen Corporation, BACPAC Resources at CHORI or Riken Bioresources Center) PIR1 chemically competent E. coli (Invitrogen, cat. no. C1010-10) PIR2 chemically competent E. coli (Invitrogen, cat. no. C1111-10) MAX efficiency DH5α-competent cells (Invitrogen, cat. no. 18258-012) PCR primers (Invitrogen and Biosynthesis; see REAGENT SETUP) AscI restriction endonuclease (New England Biolabs, cat. no. R0558L) EcoRI restriction endonuclease (New England Biolabs, cat. no. R0101L) MluI restriction endonuclease (New England Biolabs, cat. no. R0198L) SwaI restriction endonuclease (New England Biolabs, cat. no. R0604L) T4 DNA ligase (New England Biolabs, cat. no. M0202L) XmaI restriction endonuclease (New England Biolabs, cat. no. R0180L) PI-SceI endonuclease (New England Biolabs, cat. no. R0696S) λ-DNA-HindIII Digest (New England Biolabs, cat. no. N3012S) Low-range PFG marker DNA ladder (New England Biolabs, cat. no. NO350S) 2-log DNA ladder (New England Biolabs, cat. no. N3200L) 1-Butanol (Fisher Scientific, cat. no. A399) 2-Propanol (Isopropanol, Fisher Scientific, cat. no. A416) Ammonium acetate (Fisher Scientific, cat. no. A637) Ampicillin (amp; Sigma-Aldrich, cat. no. A9518; see REAGENT SETUP) Calcium chloride dihydrate (CaCl2 , Fisher Scientific, cat. no. C70–500) Cesium chloride (CsCl, Fischer Scientific, cat. no. BP1595-500) Chloramphenicol (chlor; Sigma-Aldrich, cat. no. C0378; see REAGENT SETUP) Chloroform (Fisher Scientific, cat. no. C298–500) Ethidium bromide solution (10 mg ml−1 ; Sigma-Aldrich, cat. no. E1510) ! .. Ethanol (Pharmco-AAPER) EDTA (Sigma-Aldrich, cat. no. E5134) FailSafe PCR System (Epicentre, cat. no. FS99250) Glacial acetic acid (Fisher Scientific, cat. no. A38S) !

    Functional Assay:

    Article Title: The ets-Related Transcription Factor GABP Directs Bidirectional Transcription
    Article Snippet: The 241 general promoters tested for GABP ChIP enrichment were previously cloned into the plasmid pGL3 Basic (Promega) and verified to be functional promoters as part of the ENCODE project [ ]. .. We amplified these promoters, consisting of the sequence from approximately −500 to +50 bp relative to the start of transcription, by using common primers flanking the MCS (Forward 5′-CATACGCTCTCCATCAAAACAAA-3′, Reverse 5′-TTTATGTTTTTGGCGTCTTCCAT-3′), digested them with Mlu I and Bgl II (New England BioLabs), and then recloned them into a pGL3 Basic vector with a reversed MCS, yielding a luciferase reporter plasmid with a reversed promoter sequence.

    Article Title: Regulation of miR-146a by RelA/NFkB and p53 in STHdhQ111/HdhQ111 Cells, a Cell Model of Huntington's Disease
    Article Snippet: These regions were amplified by PCR from human genomic DNA and cloned in vector using the MluI and HindIII (NEB, USA) sites. .. The following primers were used to generate the UTR constructs: p53-UTR1-F: 5′- CGACGCGT AAGGAAATCTCACCCCATCC-3′ and p53-UTR1-R: 5′- CCCAAGCTT AAGCGAGACCCAGTCTCAAA-3′ ; p53-UTR2-F: 5′- CGACGCGT GAGGAGGATGGGGAGTAGGA-3′ and p53-UTR2-R: 5′- CCCAAGCTT AAGTGGGCCCCTACCTAGAA-3′ ; p50-UTR-F: 5′- GGACTAGT TTGGCTTCCTTTCTTGGTTC-3′ and p50-UTR-R: 5′- CGACGC GTGGCGACCGTGATACCTTTAAT-3′ .

    Agarose Gel Electrophoresis:

    Article Title: Efficient method for site-directed mutagenesis in large plasmids without subcloning
    Article Snippet: PCRs were performed using the following thermocycling conditions: denaturation at 94°C for 2 min followed by 25 cycles of 94°C, 20 sec; 60°C, 30 sec; 68°C, 1 min, and a final extension at 68°C for 5 min. DNA electrophoresis on 1% agarose gel confirmed that the Starter DNA had been produced ( ). .. Successful mutagenesis was confirmed by restriction analysis using NdeI and MluI restriction enzymes (New England Biolabs, Ipswich, MA): 2 μl of Linear Modified DNA for each mutation type was incubated with or without 5 units of restriction enzymes for 30 min at 37°C.

    Article Title: A Diagnostic HIV-1 Tropism System Based on Sequence Relatedness
    Article Snippet: After primer annealing at 65°C for 5 min, 42°C for 2 min, and 25°C for 10 min, reverse transcription was conducted at 45°C for 30 min, 92°C for 1 min, followed by PCR at 40 cycles of 92°C for 20 s, 55°C for 20 s, and 68°C for 3 min, and then extension was at 68°C for 5 min. For the 2nd, nested, PCR for envelope and for introducing the cloning sites MluI and NgoMIV, the Pfu -ultraII Fusion HS DNA polymerase was used (Agilent Technologies, Basel, Switzerland). .. Primers were F_6435M (CYA CCA ACG CGT GTG TAC CCA C) and R_8319N (TGA RTA TCC CTG CCG GCC TCT ATT YAY TAT AGA AA); cycling conditions were 95°C for 2 min, 35 cycles of 95°C for 20 s, 50°C for 20 s, and 72°C for 1 min and 20 s, followed by an extension at 72°C for 3 min. Products were cut with MluI and NgoMIV (New England Biolabs; Bioconcept, Allschwil, Switzerland) and purified over a 0.8% agarose gel. .. Then the respective fragments of 1.9 kbp were ligated into an NL4-3 backbone to reconstitute fully functional proviruses.

    Article Title: Post-Exposure Protection in Mice against Sudan Virus by a Two Antibody Cocktail
    Article Snippet: The PCR products were separated by 1.5% (w/v) agarose gel, cut out and purified using Nucleospin Extract II Kit (Macherey-Nagel, Düren, Germany) according to the manufacturer’s instructions. .. A total of 5 µg pHAL35 and 2 µg VL were digested using 50 U MluI and 50 U NotI (NEB, Frankfurt, Germany) in a 100 µL reaction volume for 2 h at 37 °C.

    Produced:

    Article Title: Efficient method for site-directed mutagenesis in large plasmids without subcloning
    Article Snippet: PCRs were performed using the following thermocycling conditions: denaturation at 94°C for 2 min followed by 25 cycles of 94°C, 20 sec; 60°C, 30 sec; 68°C, 1 min, and a final extension at 68°C for 5 min. DNA electrophoresis on 1% agarose gel confirmed that the Starter DNA had been produced ( ). .. Successful mutagenesis was confirmed by restriction analysis using NdeI and MluI restriction enzymes (New England Biolabs, Ipswich, MA): 2 μl of Linear Modified DNA for each mutation type was incubated with or without 5 units of restriction enzymes for 30 min at 37°C.

    Article Title: Lym-1 Chimeric Antigen Receptor T Cells Exhibit Potent Anti-Tumor Effects against B-Cell Lymphoma
    Article Snippet: For this study, the IRES-ZsGreen moiety was removed by restriction enzyme digestion with EcoRI and MluI (NEB, Ipswich, MA, USA), prior to insertion of the CAR encoding gene. .. The pLVX-EF1α-Lym-1 construct was made by substituting a scFv derived from Lym-1 for the FMC63 scFv in the CD19 vector (described above).

    cDNA Library Assay:

    Article Title: Regulation of miR-146a by RelA/NFkB and p53 in STHdhQ111/HdhQ111 Cells, a Cell Model of Huntington's Disease
    Article Snippet: Full-length human p53 cDNA was obtained by PCR from human brain cDNA library and cloned into CFP vector using BamH1 and Sal1 sites. .. These regions were amplified by PCR from human genomic DNA and cloned in vector using the MluI and HindIII (NEB, USA) sites.

    BAC Assay:

    Article Title: Substrate Recognition by the Human Fatty-acid Synthase
    Article Snippet: Oligonucleotides were from Integrated DNA Technologies (Coralville, IA). .. Pfu polymerase, the BAC-to-BAC baculovirus expression system, Escherichia coli maximum efficiency DH10 Bac competent cells, and Spodoptera frugiperda ( Sf9 ) insect cells were obtained from Invitrogen. pBluescript and E. coli XL-1 Blue competent cells were from Stratagene (La Jolla, CA), and the AatII, MluI, HindIII, EcoRI, and BamHI restriction enzymes were from New England Biolabs (Beverly, MA). .. ABI Prism Big Dye Terminator Cycle Sequencing was carried out on an MJ Research PTC-100 Programmable Thermal Controller from Global Medical Instrumentation, Inc. (Ramsey, MN).

    CTG Assay:

    Article Title: A Diagnostic HIV-1 Tropism System Based on Sequence Relatedness
    Article Snippet: After primer annealing at 65°C for 5 min, 42°C for 2 min, and 25°C for 10 min, reverse transcription was conducted at 45°C for 30 min, 92°C for 1 min, followed by PCR at 40 cycles of 92°C for 20 s, 55°C for 20 s, and 68°C for 3 min, and then extension was at 68°C for 5 min. For the 2nd, nested, PCR for envelope and for introducing the cloning sites MluI and NgoMIV, the Pfu -ultraII Fusion HS DNA polymerase was used (Agilent Technologies, Basel, Switzerland). .. Primers were F_6435M (CYA CCA ACG CGT GTG TAC CCA C) and R_8319N (TGA RTA TCC CTG CCG GCC TCT ATT YAY TAT AGA AA); cycling conditions were 95°C for 2 min, 35 cycles of 95°C for 20 s, 50°C for 20 s, and 72°C for 1 min and 20 s, followed by an extension at 72°C for 3 min. Products were cut with MluI and NgoMIV (New England Biolabs; Bioconcept, Allschwil, Switzerland) and purified over a 0.8% agarose gel. .. Then the respective fragments of 1.9 kbp were ligated into an NL4-3 backbone to reconstitute fully functional proviruses.

    Gel Extraction:

    Article Title: Efficient method for site-directed mutagenesis in large plasmids without subcloning
    Article Snippet: Successful mutagenesis was confirmed by restriction analysis using NdeI and MluI restriction enzymes (New England Biolabs, Ipswich, MA): 2 μl of Linear Modified DNA for each mutation type was incubated with or without 5 units of restriction enzymes for 30 min at 37°C. .. For cloning the modified DNA into the parental DNA, a standard protocol was used, briefly, both the fragment and the plasmid were digested with 5 units of PfoI and EcoRI separately.

    Homologous Recombination:

    Article Title: Quorum-Sensing and BvrR/BvrS Regulation, the Type IV Secretion System, Cyclic Glucans, and BacA in the Virulence of Brucella ovis: Similarities to and Differences from Smooth Brucellae
    Article Snippet: The Kanr gene was PCR amplified from pUC4K with primers KanF-MluI and KanR-EcoNI, cloned into pGEM-T, extracted by digestion with MluI (NEB) and partial digestion with EcoNI (NEB), and ligated to pNVvirPA03 cut with the same restriction enzymes. .. Plasmid pNVvirPA05 was introduced into B. ovis PA by electroporation with a Micropulser (Bio-Rad, Hercules, CA), and the recombinant bacteria were selected by plating on TSA-YE-HS-Kan plates.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs mlui
    Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_MEM_3rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_MEM_3rRFBs+ (8908 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note the insertion of an EcoRI fragment containing the three putative Fob1 binding sites expected to act as RFBs (indicated in red), described by Kobayashi ( 20 ). ( B ) Map of the 3708 bp linear fragment generated by digestion of pYAC_MEM_3rRFBs+ with SwaI and <t>BamHI</t> showing the relative position of the three putative RFBs. ( C ) Map of the 5186 bp linear fragment generated by digestion of pYAC_MEM_3rRFBs+ with EcoRV and <t>MluI</t> showing the relative position of the three putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3708 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5186-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks and the distance separating them.
    Mlui, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 88 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mlui/product/New England Biolabs
    Average 99 stars, based on 88 article reviews
    Price from $9.99 to $1999.99
    mlui - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier


    Image Search Results


    Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_MEM_3rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_MEM_3rRFBs+ (8908 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note the insertion of an EcoRI fragment containing the three putative Fob1 binding sites expected to act as RFBs (indicated in red), described by Kobayashi ( 20 ). ( B ) Map of the 3708 bp linear fragment generated by digestion of pYAC_MEM_3rRFBs+ with SwaI and BamHI showing the relative position of the three putative RFBs. ( C ) Map of the 5186 bp linear fragment generated by digestion of pYAC_MEM_3rRFBs+ with EcoRV and MluI showing the relative position of the three putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3708 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5186-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks and the distance separating them.

    Journal: Nucleic Acids Research

    Article Title: The abundance of Fob1 modulates the efficiency of rRFBs to stall replication forks

    doi: 10.1093/nar/gkx655

    Figure Lengend Snippet: Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_MEM_3rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_MEM_3rRFBs+ (8908 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note the insertion of an EcoRI fragment containing the three putative Fob1 binding sites expected to act as RFBs (indicated in red), described by Kobayashi ( 20 ). ( B ) Map of the 3708 bp linear fragment generated by digestion of pYAC_MEM_3rRFBs+ with SwaI and BamHI showing the relative position of the three putative RFBs. ( C ) Map of the 5186 bp linear fragment generated by digestion of pYAC_MEM_3rRFBs+ with EcoRV and MluI showing the relative position of the three putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3708 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5186-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks and the distance separating them.

    Article Snippet: DNA was digested with the restriction endonucleases BamHI, EcoRV, SwaI, FspI and MluI (New England Biolabs) for at least 2 h at 37°C except for SwaI that was digested at 25°C.

    Techniques: Two-Dimensional Gel Electrophoresis, Binding Assay, Activated Clotting Time Assay, Generated

    Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_3′rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_3′rRFBs+ (8175 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the three putative Fob1 binding sites expected to act as RFBs (indicated in red and white), described by Kobayashi ( 20 ), are equally distanced. ( B ) Map of the 3710-bp linear fragment generated by digestion of pYAC_AC_3′rRFBs+ with FspI and BamHI showing the relative position of the three putative RFBs. ( C ) Map of the 4454-bp linear fragment generated by digestion of pYAC_AC_3′rRFBs+ with EcoRV and MluI showing the relative position of the three putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the FspI-BamHI 3710-bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 4454-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks and the distance separating them. For comparison, the densitometric profile corresponding to pYAC_MEM_3rRFBs shown in Figure 4H is presented on top.

    Journal: Nucleic Acids Research

    Article Title: The abundance of Fob1 modulates the efficiency of rRFBs to stall replication forks

    doi: 10.1093/nar/gkx655

    Figure Lengend Snippet: Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_3′rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_3′rRFBs+ (8175 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the three putative Fob1 binding sites expected to act as RFBs (indicated in red and white), described by Kobayashi ( 20 ), are equally distanced. ( B ) Map of the 3710-bp linear fragment generated by digestion of pYAC_AC_3′rRFBs+ with FspI and BamHI showing the relative position of the three putative RFBs. ( C ) Map of the 4454-bp linear fragment generated by digestion of pYAC_AC_3′rRFBs+ with EcoRV and MluI showing the relative position of the three putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the FspI-BamHI 3710-bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 4454-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks and the distance separating them. For comparison, the densitometric profile corresponding to pYAC_MEM_3rRFBs shown in Figure 4H is presented on top.

    Article Snippet: DNA was digested with the restriction endonucleases BamHI, EcoRV, SwaI, FspI and MluI (New England Biolabs) for at least 2 h at 37°C except for SwaI that was digested at 25°C.

    Techniques: Two-Dimensional Gel Electrophoresis, Binding Assay, Activated Clotting Time Assay, Generated

    Genetic map and 2D gel analysis of linear fragments corresponding to pYAC_MEM. ( A ) Genetic map of pYAC_MEM (7966 bp) showing its most relevant features: clockwise starting with the replication origin ARS4 (indicated in green), URA3 gene active in Saccharomyces cerevisiae (indicated in light blue), L1 lambda DNA used for hybridization (indicated in yellow), HIS3 gene active in S. cerevisiae (indicated in light blue), L2 lambda DNA used for hybridization (indicated in yellow), the ColE1 replication origin active only in Escherichia coli (indicated in gray), the ampicillin resistance gene active only in E. coli (indicated in gray) and the budding yeast centromeric sequence CEN6 (indicated in orange). The sites for specific restriction endonucleases are indicated outside the map. In addition, a magenta triangle points the position located 180° apart from the replication origin ARS4. ( B ) Map of the 2764-bp linear fragment generated by digestion of pYAC_MEM with SwaI and BamHI. ( C ) Map of the 4245-bp linear fragment generated by digestion of pYAC_MEM with EcoRV and MluI. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 2764 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 4245-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). De-localized termination signals are indicated in magenta.

    Journal: Nucleic Acids Research

    Article Title: The abundance of Fob1 modulates the efficiency of rRFBs to stall replication forks

    doi: 10.1093/nar/gkx655

    Figure Lengend Snippet: Genetic map and 2D gel analysis of linear fragments corresponding to pYAC_MEM. ( A ) Genetic map of pYAC_MEM (7966 bp) showing its most relevant features: clockwise starting with the replication origin ARS4 (indicated in green), URA3 gene active in Saccharomyces cerevisiae (indicated in light blue), L1 lambda DNA used for hybridization (indicated in yellow), HIS3 gene active in S. cerevisiae (indicated in light blue), L2 lambda DNA used for hybridization (indicated in yellow), the ColE1 replication origin active only in Escherichia coli (indicated in gray), the ampicillin resistance gene active only in E. coli (indicated in gray) and the budding yeast centromeric sequence CEN6 (indicated in orange). The sites for specific restriction endonucleases are indicated outside the map. In addition, a magenta triangle points the position located 180° apart from the replication origin ARS4. ( B ) Map of the 2764-bp linear fragment generated by digestion of pYAC_MEM with SwaI and BamHI. ( C ) Map of the 4245-bp linear fragment generated by digestion of pYAC_MEM with EcoRV and MluI. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 2764 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 4245-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). De-localized termination signals are indicated in magenta.

    Article Snippet: DNA was digested with the restriction endonucleases BamHI, EcoRV, SwaI, FspI and MluI (New England Biolabs) for at least 2 h at 37°C except for SwaI that was digested at 25°C.

    Techniques: Two-Dimensional Gel Electrophoresis, Lambda DNA Preparation, Hybridization, Sequencing, Generated

    Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_10rRFBs+ isolated from cells that overexpress Fob1 and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_10rRFBs+ (8916 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the fragment inserted at the unique SalI site of pYAC_MEM contained the 10 Fob1 binding sites described by Kobayashi ( 20 ) that were confirmed to act as RFBs in vivo (See Figures 4 and 5 ). ( B ) Map of the 3705-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with SwaI and BamHI showing the relative position of the ten putative RFBs. ( C ) Map of the 5194-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with EcoRV and MluI showing the relative position of the 10 putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3705 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5194 bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the six most distal spots observed on the simple-Y arc shown in ( D ) is presented in ( H ) indicating the height of the peaks. For comparison, the densitometric profile corresponding to the 3705-bp SwaI-BamHI of pYAC_AC_10rRFBs isolated from the top2-td strain shown in Figure 4H is presented on top.

    Journal: Nucleic Acids Research

    Article Title: The abundance of Fob1 modulates the efficiency of rRFBs to stall replication forks

    doi: 10.1093/nar/gkx655

    Figure Lengend Snippet: Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_10rRFBs+ isolated from cells that overexpress Fob1 and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_10rRFBs+ (8916 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the fragment inserted at the unique SalI site of pYAC_MEM contained the 10 Fob1 binding sites described by Kobayashi ( 20 ) that were confirmed to act as RFBs in vivo (See Figures 4 and 5 ). ( B ) Map of the 3705-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with SwaI and BamHI showing the relative position of the ten putative RFBs. ( C ) Map of the 5194-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with EcoRV and MluI showing the relative position of the 10 putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3705 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5194 bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the six most distal spots observed on the simple-Y arc shown in ( D ) is presented in ( H ) indicating the height of the peaks. For comparison, the densitometric profile corresponding to the 3705-bp SwaI-BamHI of pYAC_AC_10rRFBs isolated from the top2-td strain shown in Figure 4H is presented on top.

    Article Snippet: DNA was digested with the restriction endonucleases BamHI, EcoRV, SwaI, FspI and MluI (New England Biolabs) for at least 2 h at 37°C except for SwaI that was digested at 25°C.

    Techniques: Two-Dimensional Gel Electrophoresis, Isolation, Binding Assay, Activated Clotting Time Assay, In Vivo, Generated

    Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_10rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_10rRFBs+ (8916 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the fragment inserted at the unique SalI site of pYAC_MEM contained the 10 Fob1 binding sites described by Kobayashi ( 20 ) that were confirmed to act as RFBs in vivo (See Figures 4 and 5 ). ( B ) Map of the 3705-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with SwaI and BamHI showing the relative position of the 10 putative RFBs. ( C ) Map of the 5194-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with EcoRV and MluI showing the relative position of the 10 putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3705-bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5194-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the six most distal spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks.

    Journal: Nucleic Acids Research

    Article Title: The abundance of Fob1 modulates the efficiency of rRFBs to stall replication forks

    doi: 10.1093/nar/gkx655

    Figure Lengend Snippet: Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_10rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_10rRFBs+ (8916 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the fragment inserted at the unique SalI site of pYAC_MEM contained the 10 Fob1 binding sites described by Kobayashi ( 20 ) that were confirmed to act as RFBs in vivo (See Figures 4 and 5 ). ( B ) Map of the 3705-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with SwaI and BamHI showing the relative position of the 10 putative RFBs. ( C ) Map of the 5194-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with EcoRV and MluI showing the relative position of the 10 putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3705-bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5194-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the six most distal spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks.

    Article Snippet: DNA was digested with the restriction endonucleases BamHI, EcoRV, SwaI, FspI and MluI (New England Biolabs) for at least 2 h at 37°C except for SwaI that was digested at 25°C.

    Techniques: Two-Dimensional Gel Electrophoresis, Binding Assay, Activated Clotting Time Assay, In Vivo, Generated

    The methylation profile, gene expression profile and DNA copy number variation of loci on Chromosome 1 . Chromosome 1 was selected as a representative of the chromosome set. Similar information for the other chromosomes is presented in Additional file 8 . A diagram of chromosome 1 is located in the middle. The common fragile sites are symmetrically indicated with thin solid black lines (the rare fragile sites marked with blue). The corresponding data for MCF-7 and MDA-MB-231 are presented to the left and the right sides of the chromosome, respectively. The DNA copy number variation, gene expression and methylation status are shown consecutively. For DNA copy number variation, green, red and mild yellow mean amplification, deletion and no change, respectively. The length of the red bars that are vertical to the chromosome indicates the expression level for the corresponding genes. The length of bars located the most outside of the figure represents the methylation extent for the corresponding MluI sites on the chromosome. Blue indicates tags mapped with high confidence (mapping quality more than 20) and yellow represents all mapped tags.

    Journal: BMC Genomics

    Article Title: An improved method for genome wide DNA methylation profiling correlated to transcription and genomic instability in two breast cancer cell lines

    doi: 10.1186/1471-2164-10-223

    Figure Lengend Snippet: The methylation profile, gene expression profile and DNA copy number variation of loci on Chromosome 1 . Chromosome 1 was selected as a representative of the chromosome set. Similar information for the other chromosomes is presented in Additional file 8 . A diagram of chromosome 1 is located in the middle. The common fragile sites are symmetrically indicated with thin solid black lines (the rare fragile sites marked with blue). The corresponding data for MCF-7 and MDA-MB-231 are presented to the left and the right sides of the chromosome, respectively. The DNA copy number variation, gene expression and methylation status are shown consecutively. For DNA copy number variation, green, red and mild yellow mean amplification, deletion and no change, respectively. The length of the red bars that are vertical to the chromosome indicates the expression level for the corresponding genes. The length of bars located the most outside of the figure represents the methylation extent for the corresponding MluI sites on the chromosome. Blue indicates tags mapped with high confidence (mapping quality more than 20) and yellow represents all mapped tags.

    Article Snippet: Genomic DNA was digested with methylation-sensitive mapping enzyme MluI (New England Biolabs).

    Techniques: Methylation, Expressing, Multiple Displacement Amplification, Amplification

    Correlations between gene expression and DNA methylation . Figure A and B present the plots of the relationships between the gene expression and the methylation of promoters with CGI, promoters without CGI, exons, and introns for MCF-7 and MDA-MB-231 cells, respectively. On the X-axis scale, the degree of methylation for each spot is calculated as the number of tags for a given site divided by the average number of tags for all MluI sites. Similarly, the degree of gene expression on the Y-axis scale is calculated as the expression value for a given gene divided by the average expression value for all genes. Both the methylation and expression values are log-transformed.

    Journal: BMC Genomics

    Article Title: An improved method for genome wide DNA methylation profiling correlated to transcription and genomic instability in two breast cancer cell lines

    doi: 10.1186/1471-2164-10-223

    Figure Lengend Snippet: Correlations between gene expression and DNA methylation . Figure A and B present the plots of the relationships between the gene expression and the methylation of promoters with CGI, promoters without CGI, exons, and introns for MCF-7 and MDA-MB-231 cells, respectively. On the X-axis scale, the degree of methylation for each spot is calculated as the number of tags for a given site divided by the average number of tags for all MluI sites. Similarly, the degree of gene expression on the Y-axis scale is calculated as the expression value for a given gene divided by the average expression value for all genes. Both the methylation and expression values are log-transformed.

    Article Snippet: Genomic DNA was digested with methylation-sensitive mapping enzyme MluI (New England Biolabs).

    Techniques: Expressing, DNA Methylation Assay, Methylation, Multiple Displacement Amplification, Transformation Assay

    Rearranged BKPyV Dunlop NCCR showed higher EVGR expression than did BKPyVww NCCR in HEK293 cells. (A) Schematic representation of the HPyV genome: noncoding control region (NCCR); early viral gene region (EVGR, in red) encoding large and small T antigens (Tags), alternative spliced Tags; microRNAs (blue arrow); late viral gene region (LVGR) encoding structural proteins (Vp1, Vp2, and Vp3) and the agnoprotein (agno) only in BKPyV and JCPyV. (B) Representation of the bidirectional reporter vector pRG13D12, containing the following: NCCR (in gray) in the early to late orientation cloned via restriction sites MluI and BssHII; the red fluorescence protein dsRed2, used as a marker of EVGR expression; the enhanced green fluorescence protein, EGFP, in the opposite orientation, used as a marker of LVGR expression; SV40 polyadenylation signals [SV40 poly(A)] for the dsRed2 and EGFP expression cassette; E1 ori for bacterial plasmid replication; the ampicillin-resistant gene (Amp) for selecting Escherichia coli transformants. (C) Flow cytometry of HEK293 cells 2 dpt with the pRG13D12 reporter vector alone or containing the NCCR of the archetype BKPyVww, the BKPyV(DUN), or the BKPyV(DUN-R) in the reverse orientation. x axis, EGFP fluorescence; y axis, dsRed2 fluorescence; 10,000 control transfected cells were gated for the live gate, while 5,000 transfected cells were gated for the P3 (Q1, Q2, and Q4) gate. Q1, Q4, and Q2 depict cells expressing red fluorescence, green fluorescence, and both, respectively. Ex, excitation wavelength; Em, emission wavelength. (D) Quantification of cells: red bars, sum of red cells (Q1 + Q2); green bars, sum of green cells (Q2 + Q4); yellow bars, red- and green-fluorescence double-positive cells (Q2); black bars, nonfluorescent cells (Q3, negative). Means with standard deviations (SD) from three independent replicates are shown. (E) Normalized mean fluorescence intensity (MFI). The weighted MFI was calculated for each measurement (see formulas in Materials and Methods); late expression was normalized to BKPyVww NCCR (green MFI was set as 100), while early expression was normalized to BKPyVww NCCR (red MFI was set as 1). Means with SD from three independent replicates are shown.

    Journal:

    Article Title: Novel Human Polyomavirus Noncoding Control Regions Differ in Bidirectional Gene Expression according to Host Cell, Large T-Antigen Expression, and Clinically Occurring Rearrangements

    doi: 10.1128/JVI.02231-17

    Figure Lengend Snippet: Rearranged BKPyV Dunlop NCCR showed higher EVGR expression than did BKPyVww NCCR in HEK293 cells. (A) Schematic representation of the HPyV genome: noncoding control region (NCCR); early viral gene region (EVGR, in red) encoding large and small T antigens (Tags), alternative spliced Tags; microRNAs (blue arrow); late viral gene region (LVGR) encoding structural proteins (Vp1, Vp2, and Vp3) and the agnoprotein (agno) only in BKPyV and JCPyV. (B) Representation of the bidirectional reporter vector pRG13D12, containing the following: NCCR (in gray) in the early to late orientation cloned via restriction sites MluI and BssHII; the red fluorescence protein dsRed2, used as a marker of EVGR expression; the enhanced green fluorescence protein, EGFP, in the opposite orientation, used as a marker of LVGR expression; SV40 polyadenylation signals [SV40 poly(A)] for the dsRed2 and EGFP expression cassette; E1 ori for bacterial plasmid replication; the ampicillin-resistant gene (Amp) for selecting Escherichia coli transformants. (C) Flow cytometry of HEK293 cells 2 dpt with the pRG13D12 reporter vector alone or containing the NCCR of the archetype BKPyVww, the BKPyV(DUN), or the BKPyV(DUN-R) in the reverse orientation. x axis, EGFP fluorescence; y axis, dsRed2 fluorescence; 10,000 control transfected cells were gated for the live gate, while 5,000 transfected cells were gated for the P3 (Q1, Q2, and Q4) gate. Q1, Q4, and Q2 depict cells expressing red fluorescence, green fluorescence, and both, respectively. Ex, excitation wavelength; Em, emission wavelength. (D) Quantification of cells: red bars, sum of red cells (Q1 + Q2); green bars, sum of green cells (Q2 + Q4); yellow bars, red- and green-fluorescence double-positive cells (Q2); black bars, nonfluorescent cells (Q3, negative). Means with standard deviations (SD) from three independent replicates are shown. (E) Normalized mean fluorescence intensity (MFI). The weighted MFI was calculated for each measurement (see formulas in Materials and Methods); late expression was normalized to BKPyVww NCCR (green MFI was set as 100), while early expression was normalized to BKPyVww NCCR (red MFI was set as 1). Means with SD from three independent replicates are shown.

    Article Snippet: The HPyV NCCRs were chemically synthesized in pUC57 (Eurogentec S.A, Belgium) , excised using the restriction enzymes BssHII and MluI (New England BioLabs, England), and cloned into the corresponding restriction sites of pRG13D12.

    Techniques: Expressing, Plasmid Preparation, Clone Assay, Fluorescence, Marker, Flow Cytometry, Cytometry, Transfection, Electron Microscopy

    Validation of the URMAC method by insertion (I), substitution (S), or deletion (D) of some restriction sites in pUC18 plasmid. (A) Illustration of the Modification Target (NdeI restriction site) relative to the flanking restriction sites and location of the Starter Primers SP1 and SP2. After the first PCR, the Starter DNA migrated as expected, 532 bp on a 1% agarose gel (photo, arrow at right). A 100 bp DNA size ladder is shown in left lane for comparison. (B) Diagram of the strategy for I, S, or D using the Closed Starter DNA circularized from the PCR product in (A) as template and the Opener/Mutagenic Primers . The top photo shows the PCR product, Intermediate DNA , which contained the mutations. The bottom photo shows the Modified DNA after enrichment PCR step using SP1 and SP2. (C) Validation of URMAC mutagenesis for the three different types of mutations by restriction analysis. Fig 2C shows bands of expected DNA fragment size after digestion with respective restriction enzymes. In the control Starter PCR lane, only DNA treated with NdeI enzyme, cut the DNA into two fragments of 382 150 bp. Untreated DNA or DNA treated with MluI remained at the full size of 532 bp. In the Insertion lane, both NdeI and MluI cut the DNA at the expected sizes of 382 150 for NdeI and 383 149 for MluI. In the Substitution lane, only MluI cut the DNA producing the expected 383 149 bp bands. In the Deletion lane, none of the enzymes cut the DNA, leaving the bands at their original Modified DNA size.

    Journal: PLoS ONE

    Article Title: Efficient method for site-directed mutagenesis in large plasmids without subcloning

    doi: 10.1371/journal.pone.0177788

    Figure Lengend Snippet: Validation of the URMAC method by insertion (I), substitution (S), or deletion (D) of some restriction sites in pUC18 plasmid. (A) Illustration of the Modification Target (NdeI restriction site) relative to the flanking restriction sites and location of the Starter Primers SP1 and SP2. After the first PCR, the Starter DNA migrated as expected, 532 bp on a 1% agarose gel (photo, arrow at right). A 100 bp DNA size ladder is shown in left lane for comparison. (B) Diagram of the strategy for I, S, or D using the Closed Starter DNA circularized from the PCR product in (A) as template and the Opener/Mutagenic Primers . The top photo shows the PCR product, Intermediate DNA , which contained the mutations. The bottom photo shows the Modified DNA after enrichment PCR step using SP1 and SP2. (C) Validation of URMAC mutagenesis for the three different types of mutations by restriction analysis. Fig 2C shows bands of expected DNA fragment size after digestion with respective restriction enzymes. In the control Starter PCR lane, only DNA treated with NdeI enzyme, cut the DNA into two fragments of 382 150 bp. Untreated DNA or DNA treated with MluI remained at the full size of 532 bp. In the Insertion lane, both NdeI and MluI cut the DNA at the expected sizes of 382 150 for NdeI and 383 149 for MluI. In the Substitution lane, only MluI cut the DNA producing the expected 383 149 bp bands. In the Deletion lane, none of the enzymes cut the DNA, leaving the bands at their original Modified DNA size.

    Article Snippet: Successful mutagenesis was confirmed by restriction analysis using NdeI and MluI restriction enzymes (New England Biolabs, Ipswich, MA): 2 μl of Linear Modified DNA for each mutation type was incubated with or without 5 units of restriction enzymes for 30 min at 37°C.

    Techniques: Plasmid Preparation, Modification, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Mutagenesis