mlui  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    MluI
    Description:
    MluI 5 000 units
    Catalog Number:
    r0198l
    Price:
    269
    Size:
    5 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs mlui
    MluI
    MluI 5 000 units
    https://www.bioz.com/result/mlui/product/New England Biolabs
    Average 99 stars, based on 108 article reviews
    Price from $9.99 to $1999.99
    mlui - by Bioz Stars, 2020-07
    99/100 stars

    Images

    1) Product Images from "Diversity of Proteolytic Clostridium botulinum Strains, Determined by a Pulsed-Field Gel Electrophoresis Approach"

    Article Title: Diversity of Proteolytic Clostridium botulinum Strains, Determined by a Pulsed-Field Gel Electrophoresis Approach

    Journal:

    doi: 10.1128/AEM.71.3.1311-1317.2005

    Digestion patterns of type A (ATCC 3502) and type B (FT 243) proteolytic C. botulinum strains using the rare-cutting restriction enzymes ApaI, AscI, MluI, NruI, PmeI, and RsrII. The pulse time ramp was 1 to 22 s, and the running time was 20 h. The outermost
    Figure Legend Snippet: Digestion patterns of type A (ATCC 3502) and type B (FT 243) proteolytic C. botulinum strains using the rare-cutting restriction enzymes ApaI, AscI, MluI, NruI, PmeI, and RsrII. The pulse time ramp was 1 to 22 s, and the running time was 20 h. The outermost

    Techniques Used:

    2) Product Images from "vLIP, a Viral Lipase Homologue, Is a Virulence Factor of Marek's Disease Virus"

    Article Title: vLIP, a Viral Lipase Homologue, Is a Virulence Factor of Marek's Disease Virus

    Journal: Journal of Virology

    doi: 10.1128/JVI.79.11.6984-6996.2005

    Shuttle mutagenesis strategy used to construct vLIP mutant MDVs and revertants in the pRB-1B BAC. A 4.268-kb fragment of the Md5 strain of MDV, containing the vLIP gene and portions of neighboring genes, was cloned into pST76K-SR, a RecA-based shuttle vector. In step 1 (labeled arrow), an in-frame deletion of vLIP amino acids 256 to 426 was incorporated into the pRB-1B BAC by shuttle mutagenesis using a pST76K-SR-based shuttle vector bearing the same deletion (ΔMluI-SpeI), yielding Δ vLIP . In parallel (step 2), an alanine point mutant of the vLIP serine nucleophile position ( vLIP S307A) was incorporated into pRB-1B. As depicted in steps 3 and 4, shuttle mutagenesis was performed on the Δ vLIP BAC to generate C-terminally FLAG tagged vLIP ( vLIP *-rev) and native vLIP ( vLIP -rev) revertants. Relevant features of the DNA fragment used and modified in shuttle mutagenesis procedures are labeled accordingly. A double-headed arrow represents lipase homology in the vLIP ORF, a white X represents the location of the S307A change, a FLAG epitope tag is represented as a labeled asterisk, and the MluI and SpeI sites which were used to remove the lipase homology region of vLIP are labeled accordingly.
    Figure Legend Snippet: Shuttle mutagenesis strategy used to construct vLIP mutant MDVs and revertants in the pRB-1B BAC. A 4.268-kb fragment of the Md5 strain of MDV, containing the vLIP gene and portions of neighboring genes, was cloned into pST76K-SR, a RecA-based shuttle vector. In step 1 (labeled arrow), an in-frame deletion of vLIP amino acids 256 to 426 was incorporated into the pRB-1B BAC by shuttle mutagenesis using a pST76K-SR-based shuttle vector bearing the same deletion (ΔMluI-SpeI), yielding Δ vLIP . In parallel (step 2), an alanine point mutant of the vLIP serine nucleophile position ( vLIP S307A) was incorporated into pRB-1B. As depicted in steps 3 and 4, shuttle mutagenesis was performed on the Δ vLIP BAC to generate C-terminally FLAG tagged vLIP ( vLIP *-rev) and native vLIP ( vLIP -rev) revertants. Relevant features of the DNA fragment used and modified in shuttle mutagenesis procedures are labeled accordingly. A double-headed arrow represents lipase homology in the vLIP ORF, a white X represents the location of the S307A change, a FLAG epitope tag is represented as a labeled asterisk, and the MluI and SpeI sites which were used to remove the lipase homology region of vLIP are labeled accordingly.

    Techniques Used: Mutagenesis, Construct, BAC Assay, Clone Assay, Plasmid Preparation, Labeling, Modification, FLAG-tag

    (a) Location of vLIP relative to other genes in the MDV genome. The vLIP open reading frame is drawn to scale; a bar representing 1 kb is drawn and labeled. The terminal repeat long (TR L ) region, the U L region, and an a-like sequence (double-headed arrow) are also indicated. Several MDV-1-specific ORFs neighboring the vLIP gene are displayed, as are the conserved genes U L 1 to U L 3. The gene organization of the vLIP transcript is shown in more detail below, also drawn to scale. A 500-bp bar is shown, and the TATA box, putatively used to initiate vLIP transcripts, as well as the poly(A) site and poly(A) signal, is labeled. MluI and SpeI restriction sites flanking the lipase homology region, indicated by a double-headed arrow, are also labeled. (b) The vLIP transcript as visualized by Northern blotting. In the left panel, a Northern blot was probed with a single-stranded riboprobe antisense to vLIP mRNA. RNA samples were derived from MSB-1 tumor cells which had been either treated for 24 h in the presence of sodium butyrate to induce virus replication or left untreated, as indicated. PFA was also used where indicated, to show the sensitivity of vLIP transcription to inhibition of DNA replication. To the right, RNA samples used in Northern blotting were separated on denatured agarose gels, stained with ethidium bromide, and imaged to verify that RNA integrity and quantity were comparable across all samples tested. An RNA marker (Ambion) was included to determine molecular weights.
    Figure Legend Snippet: (a) Location of vLIP relative to other genes in the MDV genome. The vLIP open reading frame is drawn to scale; a bar representing 1 kb is drawn and labeled. The terminal repeat long (TR L ) region, the U L region, and an a-like sequence (double-headed arrow) are also indicated. Several MDV-1-specific ORFs neighboring the vLIP gene are displayed, as are the conserved genes U L 1 to U L 3. The gene organization of the vLIP transcript is shown in more detail below, also drawn to scale. A 500-bp bar is shown, and the TATA box, putatively used to initiate vLIP transcripts, as well as the poly(A) site and poly(A) signal, is labeled. MluI and SpeI restriction sites flanking the lipase homology region, indicated by a double-headed arrow, are also labeled. (b) The vLIP transcript as visualized by Northern blotting. In the left panel, a Northern blot was probed with a single-stranded riboprobe antisense to vLIP mRNA. RNA samples were derived from MSB-1 tumor cells which had been either treated for 24 h in the presence of sodium butyrate to induce virus replication or left untreated, as indicated. PFA was also used where indicated, to show the sensitivity of vLIP transcription to inhibition of DNA replication. To the right, RNA samples used in Northern blotting were separated on denatured agarose gels, stained with ethidium bromide, and imaged to verify that RNA integrity and quantity were comparable across all samples tested. An RNA marker (Ambion) was included to determine molecular weights.

    Techniques Used: Labeling, Sequencing, Northern Blot, Derivative Assay, Inhibition, Staining, Marker

    3) Product Images from "Characterization of Genes Encoding for Acquired Bacitracin Resistance in Clostridium perfringens"

    Article Title: Characterization of Genes Encoding for Acquired Bacitracin Resistance in Clostridium perfringens

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0044449

    PFGE and hybridization analysis of I-CeuI and MluI double-digested DNA of the bacitracin resistant C. perfringens strain c1261_A. PFGE analysis of C. perfringens strain c1261_A total DNA (A). Southern blot of C. perfringens isolate c1261_A total DNA probed with rrn (B) and with bcrB (C). Sizes (in kilobases) are indicated on the left.
    Figure Legend Snippet: PFGE and hybridization analysis of I-CeuI and MluI double-digested DNA of the bacitracin resistant C. perfringens strain c1261_A. PFGE analysis of C. perfringens strain c1261_A total DNA (A). Southern blot of C. perfringens isolate c1261_A total DNA probed with rrn (B) and with bcrB (C). Sizes (in kilobases) are indicated on the left.

    Techniques Used: Hybridization, Southern Blot

    4) Product Images from "A Systematic Analysis on DNA Methylation and the Expression of Both mRNA and microRNA in Bladder Cancer"

    Article Title: A Systematic Analysis on DNA Methylation and the Expression of Both mRNA and microRNA in Bladder Cancer

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0028223

    Validation results of BSP for DNA methylation and RT-qPCR for gene expression. A. Validation results of MMSDK with BSP. To compare the BSP-Sanger sequencing data and deep sequencing MMSDK data, the MluI loci that were determined to be differentially methylated on average by deep sequencing were validated using BSP. The height of the columns represents the log2-transformed average fold change (tumor/normal) in methylation level across the 9 patients. B. BSP and RT-qPCR results for four cancer-associated genes examined in 33 bladder cancer patients. The methylation levels of promoters of four selected genes (SLIT2, HIC1, RASRAl1, KRT17) and their expression level were evaluated in a panel of 33 samples. The height of the columns represents the log2 average fold change (tumor/normal) in methylation level (blue) or expression level (red) across all patients. The bars represent the standard error. The number of samples (n) used in the validation assay is indicated beside each standard error bar.
    Figure Legend Snippet: Validation results of BSP for DNA methylation and RT-qPCR for gene expression. A. Validation results of MMSDK with BSP. To compare the BSP-Sanger sequencing data and deep sequencing MMSDK data, the MluI loci that were determined to be differentially methylated on average by deep sequencing were validated using BSP. The height of the columns represents the log2-transformed average fold change (tumor/normal) in methylation level across the 9 patients. B. BSP and RT-qPCR results for four cancer-associated genes examined in 33 bladder cancer patients. The methylation levels of promoters of four selected genes (SLIT2, HIC1, RASRAl1, KRT17) and their expression level were evaluated in a panel of 33 samples. The height of the columns represents the log2 average fold change (tumor/normal) in methylation level (blue) or expression level (red) across all patients. The bars represent the standard error. The number of samples (n) used in the validation assay is indicated beside each standard error bar.

    Techniques Used: DNA Methylation Assay, Quantitative RT-PCR, Expressing, Sequencing, Methylation, Transformation Assay

    5) Product Images from "Novel Human Polyomavirus Noncoding Control Regions Differ in Bidirectional Gene Expression according to Host Cell, Large T-Antigen Expression, and Clinically Occurring Rearrangements"

    Article Title: Novel Human Polyomavirus Noncoding Control Regions Differ in Bidirectional Gene Expression according to Host Cell, Large T-Antigen Expression, and Clinically Occurring Rearrangements

    Journal: Journal of Virology

    doi: 10.1128/JVI.02231-17

    Rearranged BKPyV Dunlop NCCR showed higher EVGR expression than did BKPyVww NCCR in HEK293 cells. (A) Schematic representation of the HPyV genome: noncoding control region (NCCR); early viral gene region (EVGR, in red) encoding large and small T antigens (Tags), alternative spliced Tags; microRNAs (blue arrow); late viral gene region (LVGR) encoding structural proteins (Vp1, Vp2, and Vp3) and the agnoprotein (agno) only in BKPyV and JCPyV. (B) Representation of the bidirectional reporter vector pRG13D12, containing the following: NCCR (in gray) in the early to late orientation cloned via restriction sites MluI and BssHII; the red fluorescence protein dsRed2, used as a marker of EVGR expression; the enhanced green fluorescence protein, EGFP, in the opposite orientation, used as a marker of LVGR expression; SV40 polyadenylation signals [SV40 poly(A)] for the dsRed2 and EGFP expression cassette; E1 ori for bacterial plasmid replication; the ampicillin-resistant gene (Amp) for selecting Escherichia coli transformants. (C) Flow cytometry of HEK293 cells 2 dpt with the pRG13D12 reporter vector alone or containing the NCCR of the archetype BKPyVww, the BKPyV(DUN), or the BKPyV(DUN-R) in the reverse orientation. x axis, EGFP fluorescence; y axis, dsRed2 fluorescence; 10,000 control transfected cells were gated for the live gate, while 5,000 transfected cells were gated for the P3 (Q1, Q2, and Q4) gate. Q1, Q4, and Q2 depict cells expressing red fluorescence, green fluorescence, and both, respectively. Ex, excitation wavelength; Em, emission wavelength. (D) Quantification of cells: red bars, sum of red cells (Q1 + Q2); green bars, sum of green cells (Q2 + Q4); yellow bars, red- and green-fluorescence double-positive cells (Q2); black bars, nonfluorescent cells (Q3, negative). Means with standard deviations (SD) from three independent replicates are shown. (E) Normalized mean fluorescence intensity (MFI). The weighted MFI was calculated for each measurement (see formulas in Materials and Methods); late expression was normalized to BKPyVww NCCR (green MFI was set as 100), while early expression was normalized to BKPyVww NCCR (red MFI was set as 1). Means with SD from three independent replicates are shown.
    Figure Legend Snippet: Rearranged BKPyV Dunlop NCCR showed higher EVGR expression than did BKPyVww NCCR in HEK293 cells. (A) Schematic representation of the HPyV genome: noncoding control region (NCCR); early viral gene region (EVGR, in red) encoding large and small T antigens (Tags), alternative spliced Tags; microRNAs (blue arrow); late viral gene region (LVGR) encoding structural proteins (Vp1, Vp2, and Vp3) and the agnoprotein (agno) only in BKPyV and JCPyV. (B) Representation of the bidirectional reporter vector pRG13D12, containing the following: NCCR (in gray) in the early to late orientation cloned via restriction sites MluI and BssHII; the red fluorescence protein dsRed2, used as a marker of EVGR expression; the enhanced green fluorescence protein, EGFP, in the opposite orientation, used as a marker of LVGR expression; SV40 polyadenylation signals [SV40 poly(A)] for the dsRed2 and EGFP expression cassette; E1 ori for bacterial plasmid replication; the ampicillin-resistant gene (Amp) for selecting Escherichia coli transformants. (C) Flow cytometry of HEK293 cells 2 dpt with the pRG13D12 reporter vector alone or containing the NCCR of the archetype BKPyVww, the BKPyV(DUN), or the BKPyV(DUN-R) in the reverse orientation. x axis, EGFP fluorescence; y axis, dsRed2 fluorescence; 10,000 control transfected cells were gated for the live gate, while 5,000 transfected cells were gated for the P3 (Q1, Q2, and Q4) gate. Q1, Q4, and Q2 depict cells expressing red fluorescence, green fluorescence, and both, respectively. Ex, excitation wavelength; Em, emission wavelength. (D) Quantification of cells: red bars, sum of red cells (Q1 + Q2); green bars, sum of green cells (Q2 + Q4); yellow bars, red- and green-fluorescence double-positive cells (Q2); black bars, nonfluorescent cells (Q3, negative). Means with standard deviations (SD) from three independent replicates are shown. (E) Normalized mean fluorescence intensity (MFI). The weighted MFI was calculated for each measurement (see formulas in Materials and Methods); late expression was normalized to BKPyVww NCCR (green MFI was set as 100), while early expression was normalized to BKPyVww NCCR (red MFI was set as 1). Means with SD from three independent replicates are shown.

    Techniques Used: Expressing, Plasmid Preparation, Clone Assay, Fluorescence, Marker, Flow Cytometry, Cytometry, Transfection

    6) Product Images from "Rapid bacterial artificial chromosome modification for large-scale mouse transgenesis"

    Article Title: Rapid bacterial artificial chromosome modification for large-scale mouse transgenesis

    Journal: Nature protocols

    doi: 10.1038/nprot.2010.131

    Diagrammatic representation of an A-homology (A-box) arm. The example chosen is the gene Chat (encoding choline acetyltransferase). The 5′ primer used in the amplification of the Chat A-box was 5′ GGCGCGCC AAGGTGCTCTAGTGCTCTGATCCCAG 3′. The first eight nucleotides in this sequence do not correspond to the genomic sequence of Chat but represent an added Asc I recognition site sequence 5′-GGCGCGCC-3′. A key step in designing the 5′ primer is the addition of an AscI or MluI enzyme site at the front of the primer. It serves in a later step when the A-homology arm is ligated into an AscI and SwaI-digested pLD53.SC2 vector at its AscI or SwaI cloning sites. If an internal AscI recognition sequence is present within the homology sequence (can be checked with the DNASTAR program), a MluI recognition site, 5′-ACGCGT-3′, should be added to the end of the primer instead. The enzyme MluI is then used in the digestion step. The 3′ primer used for Cha t in the homology amplification step was 5′ CCTAGCGATTCTTAATCCAGAGTAGC 3′. This is the reverse-complement of the 3′ sequence highlighted in the figure.
    Figure Legend Snippet: Diagrammatic representation of an A-homology (A-box) arm. The example chosen is the gene Chat (encoding choline acetyltransferase). The 5′ primer used in the amplification of the Chat A-box was 5′ GGCGCGCC AAGGTGCTCTAGTGCTCTGATCCCAG 3′. The first eight nucleotides in this sequence do not correspond to the genomic sequence of Chat but represent an added Asc I recognition site sequence 5′-GGCGCGCC-3′. A key step in designing the 5′ primer is the addition of an AscI or MluI enzyme site at the front of the primer. It serves in a later step when the A-homology arm is ligated into an AscI and SwaI-digested pLD53.SC2 vector at its AscI or SwaI cloning sites. If an internal AscI recognition sequence is present within the homology sequence (can be checked with the DNASTAR program), a MluI recognition site, 5′-ACGCGT-3′, should be added to the end of the primer instead. The enzyme MluI is then used in the digestion step. The 3′ primer used for Cha t in the homology amplification step was 5′ CCTAGCGATTCTTAATCCAGAGTAGC 3′. This is the reverse-complement of the 3′ sequence highlighted in the figure.

    Techniques Used: Amplification, Sequencing, Plasmid Preparation, Clone Assay

    7) Product Images from "A Systematic Analysis on DNA Methylation and the Expression of Both mRNA and microRNA in Bladder Cancer"

    Article Title: A Systematic Analysis on DNA Methylation and the Expression of Both mRNA and microRNA in Bladder Cancer

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0028223

    Validation results of BSP for DNA methylation and RT-qPCR for gene expression. A. Validation results of MMSDK with BSP. To compare the BSP-Sanger sequencing data and deep sequencing MMSDK data, the MluI loci that were determined to be differentially methylated on average by deep sequencing were validated using BSP. The height of the columns represents the log2-transformed average fold change (tumor/normal) in methylation level across the 9 patients. B. BSP and RT-qPCR results for four cancer-associated genes examined in 33 bladder cancer patients. The methylation levels of promoters of four selected genes (SLIT2, HIC1, RASRAl1, KRT17) and their expression level were evaluated in a panel of 33 samples. The height of the columns represents the log2 average fold change (tumor/normal) in methylation level (blue) or expression level (red) across all patients. The bars represent the standard error. The number of samples (n) used in the validation assay is indicated beside each standard error bar.
    Figure Legend Snippet: Validation results of BSP for DNA methylation and RT-qPCR for gene expression. A. Validation results of MMSDK with BSP. To compare the BSP-Sanger sequencing data and deep sequencing MMSDK data, the MluI loci that were determined to be differentially methylated on average by deep sequencing were validated using BSP. The height of the columns represents the log2-transformed average fold change (tumor/normal) in methylation level across the 9 patients. B. BSP and RT-qPCR results for four cancer-associated genes examined in 33 bladder cancer patients. The methylation levels of promoters of four selected genes (SLIT2, HIC1, RASRAl1, KRT17) and their expression level were evaluated in a panel of 33 samples. The height of the columns represents the log2 average fold change (tumor/normal) in methylation level (blue) or expression level (red) across all patients. The bars represent the standard error. The number of samples (n) used in the validation assay is indicated beside each standard error bar.

    Techniques Used: DNA Methylation Assay, Quantitative RT-PCR, Expressing, Sequencing, Methylation, Transformation Assay

    8) Product Images from "The abundance of Fob1 modulates the efficiency of rRFBs to stall replication forks"

    Article Title: The abundance of Fob1 modulates the efficiency of rRFBs to stall replication forks

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkx655

    Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_MEM_3rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_MEM_3rRFBs+ (8908 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note the insertion of an EcoRI fragment containing the three putative Fob1 binding sites expected to act as RFBs (indicated in red), described by Kobayashi ( 20 ). ( B ) Map of the 3708 bp linear fragment generated by digestion of pYAC_MEM_3rRFBs+ with SwaI and BamHI showing the relative position of the three putative RFBs. ( C ) Map of the 5186 bp linear fragment generated by digestion of pYAC_MEM_3rRFBs+ with EcoRV and MluI showing the relative position of the three putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3708 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5186-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks and the distance separating them.
    Figure Legend Snippet: Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_MEM_3rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_MEM_3rRFBs+ (8908 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note the insertion of an EcoRI fragment containing the three putative Fob1 binding sites expected to act as RFBs (indicated in red), described by Kobayashi ( 20 ). ( B ) Map of the 3708 bp linear fragment generated by digestion of pYAC_MEM_3rRFBs+ with SwaI and BamHI showing the relative position of the three putative RFBs. ( C ) Map of the 5186 bp linear fragment generated by digestion of pYAC_MEM_3rRFBs+ with EcoRV and MluI showing the relative position of the three putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3708 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5186-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks and the distance separating them.

    Techniques Used: Two-Dimensional Gel Electrophoresis, Binding Assay, Activated Clotting Time Assay, Generated

    Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_3′rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_3′rRFBs+ (8175 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the three putative Fob1 binding sites expected to act as RFBs (indicated in red and white), described by Kobayashi ( 20 ), are equally distanced. ( B ) Map of the 3710-bp linear fragment generated by digestion of pYAC_AC_3′rRFBs+ with FspI and BamHI showing the relative position of the three putative RFBs. ( C ) Map of the 4454-bp linear fragment generated by digestion of pYAC_AC_3′rRFBs+ with EcoRV and MluI showing the relative position of the three putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the FspI-BamHI 3710-bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 4454-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks and the distance separating them. For comparison, the densitometric profile corresponding to pYAC_MEM_3rRFBs shown in Figure 4H is presented on top.
    Figure Legend Snippet: Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_3′rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_3′rRFBs+ (8175 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the three putative Fob1 binding sites expected to act as RFBs (indicated in red and white), described by Kobayashi ( 20 ), are equally distanced. ( B ) Map of the 3710-bp linear fragment generated by digestion of pYAC_AC_3′rRFBs+ with FspI and BamHI showing the relative position of the three putative RFBs. ( C ) Map of the 4454-bp linear fragment generated by digestion of pYAC_AC_3′rRFBs+ with EcoRV and MluI showing the relative position of the three putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the FspI-BamHI 3710-bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 4454-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks and the distance separating them. For comparison, the densitometric profile corresponding to pYAC_MEM_3rRFBs shown in Figure 4H is presented on top.

    Techniques Used: Two-Dimensional Gel Electrophoresis, Binding Assay, Activated Clotting Time Assay, Generated

    Genetic map and 2D gel analysis of linear fragments corresponding to pYAC_MEM. ( A ) Genetic map of pYAC_MEM (7966 bp) showing its most relevant features: clockwise starting with the replication origin ARS4 (indicated in green), URA3 gene active in Saccharomyces cerevisiae (indicated in light blue), L1 lambda DNA used for hybridization (indicated in yellow), HIS3 gene active in S. cerevisiae (indicated in light blue), L2 lambda DNA used for hybridization (indicated in yellow), the ColE1 replication origin active only in Escherichia coli (indicated in gray), the ampicillin resistance gene active only in E. coli (indicated in gray) and the budding yeast centromeric sequence CEN6 (indicated in orange). The sites for specific restriction endonucleases are indicated outside the map. In addition, a magenta triangle points the position located 180° apart from the replication origin ARS4. ( B ) Map of the 2764-bp linear fragment generated by digestion of pYAC_MEM with SwaI and BamHI. ( C ) Map of the 4245-bp linear fragment generated by digestion of pYAC_MEM with EcoRV and MluI. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 2764 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 4245-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). De-localized termination signals are indicated in magenta.
    Figure Legend Snippet: Genetic map and 2D gel analysis of linear fragments corresponding to pYAC_MEM. ( A ) Genetic map of pYAC_MEM (7966 bp) showing its most relevant features: clockwise starting with the replication origin ARS4 (indicated in green), URA3 gene active in Saccharomyces cerevisiae (indicated in light blue), L1 lambda DNA used for hybridization (indicated in yellow), HIS3 gene active in S. cerevisiae (indicated in light blue), L2 lambda DNA used for hybridization (indicated in yellow), the ColE1 replication origin active only in Escherichia coli (indicated in gray), the ampicillin resistance gene active only in E. coli (indicated in gray) and the budding yeast centromeric sequence CEN6 (indicated in orange). The sites for specific restriction endonucleases are indicated outside the map. In addition, a magenta triangle points the position located 180° apart from the replication origin ARS4. ( B ) Map of the 2764-bp linear fragment generated by digestion of pYAC_MEM with SwaI and BamHI. ( C ) Map of the 4245-bp linear fragment generated by digestion of pYAC_MEM with EcoRV and MluI. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 2764 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 4245-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). De-localized termination signals are indicated in magenta.

    Techniques Used: Two-Dimensional Gel Electrophoresis, Lambda DNA Preparation, Hybridization, Sequencing, Generated

    Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_10rRFBs+ isolated from cells that overexpress Fob1 and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_10rRFBs+ (8916 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the fragment inserted at the unique SalI site of pYAC_MEM contained the 10 Fob1 binding sites described by Kobayashi ( 20 ) that were confirmed to act as RFBs in vivo (See Figures 4 and 5 ). ( B ) Map of the 3705-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with SwaI and BamHI showing the relative position of the ten putative RFBs. ( C ) Map of the 5194-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with EcoRV and MluI showing the relative position of the 10 putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3705 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5194 bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the six most distal spots observed on the simple-Y arc shown in ( D ) is presented in ( H ) indicating the height of the peaks. For comparison, the densitometric profile corresponding to the 3705-bp SwaI-BamHI of pYAC_AC_10rRFBs isolated from the top2-td strain shown in Figure 4H is presented on top.
    Figure Legend Snippet: Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_10rRFBs+ isolated from cells that overexpress Fob1 and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_10rRFBs+ (8916 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the fragment inserted at the unique SalI site of pYAC_MEM contained the 10 Fob1 binding sites described by Kobayashi ( 20 ) that were confirmed to act as RFBs in vivo (See Figures 4 and 5 ). ( B ) Map of the 3705-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with SwaI and BamHI showing the relative position of the ten putative RFBs. ( C ) Map of the 5194-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with EcoRV and MluI showing the relative position of the 10 putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3705 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5194 bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the six most distal spots observed on the simple-Y arc shown in ( D ) is presented in ( H ) indicating the height of the peaks. For comparison, the densitometric profile corresponding to the 3705-bp SwaI-BamHI of pYAC_AC_10rRFBs isolated from the top2-td strain shown in Figure 4H is presented on top.

    Techniques Used: Two-Dimensional Gel Electrophoresis, Isolation, Binding Assay, Activated Clotting Time Assay, In Vivo, Generated

    Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_10rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_10rRFBs+ (8916 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the fragment inserted at the unique SalI site of pYAC_MEM contained the 10 Fob1 binding sites described by Kobayashi ( 20 ) that were confirmed to act as RFBs in vivo (See Figures 4 and 5 ). ( B ) Map of the 3705-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with SwaI and BamHI showing the relative position of the 10 putative RFBs. ( C ) Map of the 5194-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with EcoRV and MluI showing the relative position of the 10 putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3705-bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5194-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the six most distal spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks.
    Figure Legend Snippet: Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_10rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_10rRFBs+ (8916 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the fragment inserted at the unique SalI site of pYAC_MEM contained the 10 Fob1 binding sites described by Kobayashi ( 20 ) that were confirmed to act as RFBs in vivo (See Figures 4 and 5 ). ( B ) Map of the 3705-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with SwaI and BamHI showing the relative position of the 10 putative RFBs. ( C ) Map of the 5194-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with EcoRV and MluI showing the relative position of the 10 putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3705-bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5194-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the six most distal spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks.

    Techniques Used: Two-Dimensional Gel Electrophoresis, Binding Assay, Activated Clotting Time Assay, In Vivo, Generated

    9) Product Images from "The use of an adeno-associated viral vector for efficient bicistronic expression of two genes in the CNS"

    Article Title: The use of an adeno-associated viral vector for efficient bicistronic expression of two genes in the CNS

    Journal: Methods in molecular biology (Clifton, N.J.)

    doi: 10.1007/978-1-4939-0777-9_16

    (A) psubCMV-2A-WPRE plasmid map showing NheI site for cloning a transgene immediately downstream of the CMV promoter (and upstream of the 2A sequence) and an MluI site for cloning a transgene downstream of the 2A sequence. (B) Nucleotide sequence showing
    Figure Legend Snippet: (A) psubCMV-2A-WPRE plasmid map showing NheI site for cloning a transgene immediately downstream of the CMV promoter (and upstream of the 2A sequence) and an MluI site for cloning a transgene downstream of the 2A sequence. (B) Nucleotide sequence showing

    Techniques Used: Plasmid Preparation, Clone Assay, Sequencing

    10) Product Images from "Introducing undergraduate students to reverse genetics in the laboratory: a case study of a project-oriented learning (POL) system in Taishan Medical University, China"

    Article Title: Introducing undergraduate students to reverse genetics in the laboratory: a case study of a project-oriented learning (POL) system in Taishan Medical University, China

    Journal: bioRxiv

    doi: 10.1101/2020.05.21.108068

    The agarose gel electrophoresis of linearized DNA. The pFK-JFHl-WT and pFK-JFHl-B/WT were digested by MluI for 3hrs at 37 °C, then the 5ul digested products were applied to 1%agarose gel for electrophoresis. M represents DNA ladder (Thermofisher 1Kb plus DNA Marker), WT and B/WT represent JFHl-WT and JFHl-B/WT individually.
    Figure Legend Snippet: The agarose gel electrophoresis of linearized DNA. The pFK-JFHl-WT and pFK-JFHl-B/WT were digested by MluI for 3hrs at 37 °C, then the 5ul digested products were applied to 1%agarose gel for electrophoresis. M represents DNA ladder (Thermofisher 1Kb plus DNA Marker), WT and B/WT represent JFHl-WT and JFHl-B/WT individually.

    Techniques Used: Agarose Gel Electrophoresis, Electrophoresis, Marker

    11) Product Images from "LIGHT elevation enhances immune eradication of colon cancer metastases"

    Article Title: LIGHT elevation enhances immune eradication of colon cancer metastases

    Journal: Cancer research

    doi: 10.1158/0008-5472.CAN-16-1655

    LIGHT expressing colon cancer cell lines maintain wild-type characteristics (A) To construct constitutive and doxycycline inducible(i) expressing LIGHT lentiviral vectors, murine LIGHT cDNA was cloned into MluI/PstI sites of the pHIV-Puro (pHIV-LIGHT) and pLVX-TRE3G (pLVX-LIGHT) parental plasmids. (B) CT26 cell clones constitutively expressing LIGHT (CT26LIGHT) or inducible expressing LIGHT (CT26LIGHT i ) or its empty control (CT26control i ) were established after drug selection and limited dilution, and LIGHT expression was analyzed using FACS after DNA sequencing. (C) LIGHT protein expression was confirmed in CT26LIGHT cells and CT26LIGHT i cells in the presence of doxycycline. The LIGHT expressing murine fibrosarcoma cell line Ag104LIGHT served as a positive control. (D) wtCT26, CT26control (empty vector), CT26control i , CT26LIGHTand CT26LIGHT i ). Cells were seeded in triplicate and MTS/PMS solution was added on days 1 2, 3, 4, and 5 with no difference in cell proliferation or metabolic activity.
    Figure Legend Snippet: LIGHT expressing colon cancer cell lines maintain wild-type characteristics (A) To construct constitutive and doxycycline inducible(i) expressing LIGHT lentiviral vectors, murine LIGHT cDNA was cloned into MluI/PstI sites of the pHIV-Puro (pHIV-LIGHT) and pLVX-TRE3G (pLVX-LIGHT) parental plasmids. (B) CT26 cell clones constitutively expressing LIGHT (CT26LIGHT) or inducible expressing LIGHT (CT26LIGHT i ) or its empty control (CT26control i ) were established after drug selection and limited dilution, and LIGHT expression was analyzed using FACS after DNA sequencing. (C) LIGHT protein expression was confirmed in CT26LIGHT cells and CT26LIGHT i cells in the presence of doxycycline. The LIGHT expressing murine fibrosarcoma cell line Ag104LIGHT served as a positive control. (D) wtCT26, CT26control (empty vector), CT26control i , CT26LIGHTand CT26LIGHT i ). Cells were seeded in triplicate and MTS/PMS solution was added on days 1 2, 3, 4, and 5 with no difference in cell proliferation or metabolic activity.

    Techniques Used: Expressing, Construct, Clone Assay, Selection, FACS, DNA Sequencing, Positive Control, Plasmid Preparation, Activity Assay

    Related Articles

    Clone Assay:

    Article Title: The Role of Neutrophils in Measles Virus–mediated Oncolysis Differs Between B-cell Malignancies and Is Not Always Enhanced by GCSF
    Article Snippet: .. It was then PCR amplified with the following primers, forward primer MluI+hGCSF: 5′- agtattac acgcgt atggctggacctgccacccagagc-3′ and reverse primer: AatII_hGCSF: 5′-tacagtcg gacgtc attcagggctgggcaaggtggcg-3′, and the PCR product was cloned into the MVNSe backbone using AatII and MluI restriction endonucleases (New England Biolab, UK), replacing GFP, upstream of MV M gene. ..

    Article Title: Novel Human Polyomavirus Noncoding Control Regions Differ in Bidirectional Gene Expression according to Host Cell, Large T-Antigen Expression, and Clinically Occurring Rearrangements
    Article Snippet: .. The HPyV NCCRs were chemically synthesized in pUC57 (Eurogentec S.A, Belgium) , excised using the restriction enzymes BssHII and MluI (New England BioLabs, England), and cloned into the corresponding restriction sites of pRG13D12. .. HPyV NCCR constructs were verified by Sanger sequencing for correct NCCR sequences and orientations using the 3130 genetic analyzer (Applied Biosystems, Switzerland).

    Article Title: Multi-transgenic minipig models exhibiting potential for hepatic insulin resistance and pancreatic apoptosis
    Article Snippet: .. The multiple cloning site of pcDNA3.1 (+) was digested using the Mlu I and Not I enzymes (New England Biolabs, Beijing, China), and the cytomegalovirus (CMV) promoter fragment was replaced with this synthesized fragment. .. Thus, the present study successfully generated the pcDNA3.1-PapoE-HSD11B1-PIP-CHOP-IAPP recombinant vector.

    Amplification:

    Article Title: The Role of Neutrophils in Measles Virus–mediated Oncolysis Differs Between B-cell Malignancies and Is Not Always Enhanced by GCSF
    Article Snippet: .. It was then PCR amplified with the following primers, forward primer MluI+hGCSF: 5′- agtattac acgcgt atggctggacctgccacccagagc-3′ and reverse primer: AatII_hGCSF: 5′-tacagtcg gacgtc attcagggctgggcaaggtggcg-3′, and the PCR product was cloned into the MVNSe backbone using AatII and MluI restriction endonucleases (New England Biolab, UK), replacing GFP, upstream of MV M gene. ..

    Synthesized:

    Article Title: Novel Human Polyomavirus Noncoding Control Regions Differ in Bidirectional Gene Expression according to Host Cell, Large T-Antigen Expression, and Clinically Occurring Rearrangements
    Article Snippet: .. The HPyV NCCRs were chemically synthesized in pUC57 (Eurogentec S.A, Belgium) , excised using the restriction enzymes BssHII and MluI (New England BioLabs, England), and cloned into the corresponding restriction sites of pRG13D12. .. HPyV NCCR constructs were verified by Sanger sequencing for correct NCCR sequences and orientations using the 3130 genetic analyzer (Applied Biosystems, Switzerland).

    Article Title: Multi-transgenic minipig models exhibiting potential for hepatic insulin resistance and pancreatic apoptosis
    Article Snippet: .. The multiple cloning site of pcDNA3.1 (+) was digested using the Mlu I and Not I enzymes (New England Biolabs, Beijing, China), and the cytomegalovirus (CMV) promoter fragment was replaced with this synthesized fragment. .. Thus, the present study successfully generated the pcDNA3.1-PapoE-HSD11B1-PIP-CHOP-IAPP recombinant vector.

    Construct:

    Article Title: vLIP, a Viral Lipase Homologue, Is a Virulence Factor of Marek's Disease Virus
    Article Snippet: .. In order to construct a shuttle vector to incorporate an in-frame deletion of amino acids 256 to 428 of the vLIP open reading frame, a 519-bp fragment was released from the pEco4.268 plasmid using MluI and SpeI, and overhangs were filled in using T4 DNA polymerase (NEB). .. Finally, the plasmid was closed using T4 DNA ligase (NEB) and transformed into Escherichia coli .

    Sequencing:

    Article Title: A Systematic Analysis on DNA Methylation and the Expression of Both mRNA and microRNA in Bladder Cancer
    Article Snippet: .. Briefly, 3 µg of genomic DNA was digested with MluI (recognition sequence: ACGCGT ) (NEB, US). .. The MluI -digested genomic DNA was ligated to biotinylated linkers and fragmented by NlaIII cleavage (NEB, US).

    Polymerase Chain Reaction:

    Article Title: The Role of Neutrophils in Measles Virus–mediated Oncolysis Differs Between B-cell Malignancies and Is Not Always Enhanced by GCSF
    Article Snippet: .. It was then PCR amplified with the following primers, forward primer MluI+hGCSF: 5′- agtattac acgcgt atggctggacctgccacccagagc-3′ and reverse primer: AatII_hGCSF: 5′-tacagtcg gacgtc attcagggctgggcaaggtggcg-3′, and the PCR product was cloned into the MVNSe backbone using AatII and MluI restriction endonucleases (New England Biolab, UK), replacing GFP, upstream of MV M gene. ..

    Article Title: Role of N-Linked Glycans in a Human Immunodeficiency Virus Envelope Glycoprotein: Effects on Protein Function and the Neutralizing Antibody Response
    Article Snippet: .. The PCR product was digested with Mlu I and Nhe I restriction enzymes (New England Biolabs) and ligated to pVSVΔG-JRFLG-GFP , which had previously been digested with Mlu I and Nhe I to remove the JRFLG insert. ..

    Plasmid Preparation:

    Article Title: vLIP, a Viral Lipase Homologue, Is a Virulence Factor of Marek's Disease Virus
    Article Snippet: .. In order to construct a shuttle vector to incorporate an in-frame deletion of amino acids 256 to 428 of the vLIP open reading frame, a 519-bp fragment was released from the pEco4.268 plasmid using MluI and SpeI, and overhangs were filled in using T4 DNA polymerase (NEB). .. Finally, the plasmid was closed using T4 DNA ligase (NEB) and transformed into Escherichia coli .

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs methylation sensitive mapping enzyme mlui
    The methylation profile, gene expression profile and <t>DNA</t> copy number variation of loci on Chromosome 1 . Chromosome 1 was selected as a representative of the chromosome set. Similar information for the other chromosomes is presented in Additional file 8 . A diagram of chromosome 1 is located in the middle. The common fragile sites are symmetrically indicated with thin solid black lines (the rare fragile sites marked with blue). The corresponding data for MCF-7 and MDA-MB-231 are presented to the left and the right sides of the chromosome, respectively. The DNA copy number variation, gene expression and methylation status are shown consecutively. For DNA copy number variation, green, red and mild yellow mean amplification, deletion and no change, respectively. The length of the red bars that are vertical to the chromosome indicates the expression level for the corresponding genes. The length of bars located the most outside of the figure represents the methylation extent for the corresponding <t>MluI</t> sites on the chromosome. Blue indicates tags mapped with high confidence (mapping quality more than 20) and yellow represents all mapped tags.
    Methylation Sensitive Mapping Enzyme Mlui, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 149 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/methylation sensitive mapping enzyme mlui/product/New England Biolabs
    Average 99 stars, based on 149 article reviews
    Price from $9.99 to $1999.99
    methylation sensitive mapping enzyme mlui - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    95
    New England Biolabs mlui aatii
    Schematic representation of MV-GFP and human λ light immunoglobulin chain displaying MV-λ genomes. ( a ) Human λ chain gene was inserted by exchanging the GFP using a <t>MluI/AatII</t> cleavage site upstream of the N protein. Growth kinetics
    Mlui Aatii, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mlui aatii/product/New England Biolabs
    Average 95 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    mlui aatii - by Bioz Stars, 2020-07
    95/100 stars
      Buy from Supplier

    Image Search Results


    The methylation profile, gene expression profile and DNA copy number variation of loci on Chromosome 1 . Chromosome 1 was selected as a representative of the chromosome set. Similar information for the other chromosomes is presented in Additional file 8 . A diagram of chromosome 1 is located in the middle. The common fragile sites are symmetrically indicated with thin solid black lines (the rare fragile sites marked with blue). The corresponding data for MCF-7 and MDA-MB-231 are presented to the left and the right sides of the chromosome, respectively. The DNA copy number variation, gene expression and methylation status are shown consecutively. For DNA copy number variation, green, red and mild yellow mean amplification, deletion and no change, respectively. The length of the red bars that are vertical to the chromosome indicates the expression level for the corresponding genes. The length of bars located the most outside of the figure represents the methylation extent for the corresponding MluI sites on the chromosome. Blue indicates tags mapped with high confidence (mapping quality more than 20) and yellow represents all mapped tags.

    Journal: BMC Genomics

    Article Title: An improved method for genome wide DNA methylation profiling correlated to transcription and genomic instability in two breast cancer cell lines

    doi: 10.1186/1471-2164-10-223

    Figure Lengend Snippet: The methylation profile, gene expression profile and DNA copy number variation of loci on Chromosome 1 . Chromosome 1 was selected as a representative of the chromosome set. Similar information for the other chromosomes is presented in Additional file 8 . A diagram of chromosome 1 is located in the middle. The common fragile sites are symmetrically indicated with thin solid black lines (the rare fragile sites marked with blue). The corresponding data for MCF-7 and MDA-MB-231 are presented to the left and the right sides of the chromosome, respectively. The DNA copy number variation, gene expression and methylation status are shown consecutively. For DNA copy number variation, green, red and mild yellow mean amplification, deletion and no change, respectively. The length of the red bars that are vertical to the chromosome indicates the expression level for the corresponding genes. The length of bars located the most outside of the figure represents the methylation extent for the corresponding MluI sites on the chromosome. Blue indicates tags mapped with high confidence (mapping quality more than 20) and yellow represents all mapped tags.

    Article Snippet: Genomic DNA was digested with methylation-sensitive mapping enzyme MluI (New England Biolabs).

    Techniques: Methylation, Expressing, Multiple Displacement Amplification, Amplification

    Correlations between gene expression and DNA methylation . Figure A and B present the plots of the relationships between the gene expression and the methylation of promoters with CGI, promoters without CGI, exons, and introns for MCF-7 and MDA-MB-231 cells, respectively. On the X-axis scale, the degree of methylation for each spot is calculated as the number of tags for a given site divided by the average number of tags for all MluI sites. Similarly, the degree of gene expression on the Y-axis scale is calculated as the expression value for a given gene divided by the average expression value for all genes. Both the methylation and expression values are log-transformed.

    Journal: BMC Genomics

    Article Title: An improved method for genome wide DNA methylation profiling correlated to transcription and genomic instability in two breast cancer cell lines

    doi: 10.1186/1471-2164-10-223

    Figure Lengend Snippet: Correlations between gene expression and DNA methylation . Figure A and B present the plots of the relationships between the gene expression and the methylation of promoters with CGI, promoters without CGI, exons, and introns for MCF-7 and MDA-MB-231 cells, respectively. On the X-axis scale, the degree of methylation for each spot is calculated as the number of tags for a given site divided by the average number of tags for all MluI sites. Similarly, the degree of gene expression on the Y-axis scale is calculated as the expression value for a given gene divided by the average expression value for all genes. Both the methylation and expression values are log-transformed.

    Article Snippet: Genomic DNA was digested with methylation-sensitive mapping enzyme MluI (New England Biolabs).

    Techniques: Expressing, DNA Methylation Assay, Methylation, Multiple Displacement Amplification, Transformation Assay

    Generation and identification of multi-transgenic PFFs and minipigs. (A) Schematic structure of tissue-specific polycistronic system (8,840 bp). The head-to-head arrows represent the primers for transgenic recognition, copy number measurement and gene expression analysis. The fragment between the two restriction sites comprises two cassettes isolated by an insulator: ( 1 ) 11β-HSD1 driven by the liver-specific PapoE; ( 2 ) hIAPP and CHOP linked to the F-2A peptide driven by the PIP. (B) PCR screening of multi-transgenic PFFs. Amplification of the PapoE-11b, PIP-CHOP, CHOP-IAPP and IAPP-pA fragments is shown, respectively. Lanes 42–44, three representative PFFs transfected by the vector. (C) Multi-transgenic piglets produced by somatic cell nuclear transfer. (D) Genomic DNA PCR identification of piglet 1 # , 2 # and negative control. F1–F3 indicate the three anticipated bands corresponding to PapoE-11b, PIP-CHOP and CHOP-IAPP, respectively. Tg, transgenic; 11β-HSD1, 11-β-hydroxysteroid dehydrogenase 1; PapoE; hIAPP; human islet amyloid polypeptide; PIP, porcine pancreas-specific insulin promoter; CHOP; C/EBP homologous protein; PCR, polymerase chain reaction; V, positive vector; N, negative control; M, 100 bp DNA ladder; W, ddH2O. MluI, Mlu I restriction enzyme site; NotI, Not I restriction enzyme site; PFFs, porcine fetal fibroblasts.

    Journal: Molecular Medicine Reports

    Article Title: Multi-transgenic minipig models exhibiting potential for hepatic insulin resistance and pancreatic apoptosis

    doi: 10.3892/mmr.2015.4582

    Figure Lengend Snippet: Generation and identification of multi-transgenic PFFs and minipigs. (A) Schematic structure of tissue-specific polycistronic system (8,840 bp). The head-to-head arrows represent the primers for transgenic recognition, copy number measurement and gene expression analysis. The fragment between the two restriction sites comprises two cassettes isolated by an insulator: ( 1 ) 11β-HSD1 driven by the liver-specific PapoE; ( 2 ) hIAPP and CHOP linked to the F-2A peptide driven by the PIP. (B) PCR screening of multi-transgenic PFFs. Amplification of the PapoE-11b, PIP-CHOP, CHOP-IAPP and IAPP-pA fragments is shown, respectively. Lanes 42–44, three representative PFFs transfected by the vector. (C) Multi-transgenic piglets produced by somatic cell nuclear transfer. (D) Genomic DNA PCR identification of piglet 1 # , 2 # and negative control. F1–F3 indicate the three anticipated bands corresponding to PapoE-11b, PIP-CHOP and CHOP-IAPP, respectively. Tg, transgenic; 11β-HSD1, 11-β-hydroxysteroid dehydrogenase 1; PapoE; hIAPP; human islet amyloid polypeptide; PIP, porcine pancreas-specific insulin promoter; CHOP; C/EBP homologous protein; PCR, polymerase chain reaction; V, positive vector; N, negative control; M, 100 bp DNA ladder; W, ddH2O. MluI, Mlu I restriction enzyme site; NotI, Not I restriction enzyme site; PFFs, porcine fetal fibroblasts.

    Article Snippet: The multiple cloning site of pcDNA3.1 (+) was digested using the Mlu I and Not I enzymes (New England Biolabs, Beijing, China), and the cytomegalovirus (CMV) promoter fragment was replaced with this synthesized fragment.

    Techniques: Transgenic Assay, Expressing, Isolation, Polymerase Chain Reaction, Amplification, Transfection, Plasmid Preparation, Produced, Negative Control

    Digestion patterns of type A (ATCC 3502) and type B (FT 243) proteolytic C. botulinum strains using the rare-cutting restriction enzymes ApaI, AscI, MluI, NruI, PmeI, and RsrII. The pulse time ramp was 1 to 22 s, and the running time was 20 h. The outermost

    Journal:

    Article Title: Diversity of Proteolytic Clostridium botulinum Strains, Determined by a Pulsed-Field Gel Electrophoresis Approach

    doi: 10.1128/AEM.71.3.1311-1317.2005

    Figure Lengend Snippet: Digestion patterns of type A (ATCC 3502) and type B (FT 243) proteolytic C. botulinum strains using the rare-cutting restriction enzymes ApaI, AscI, MluI, NruI, PmeI, and RsrII. The pulse time ramp was 1 to 22 s, and the running time was 20 h. The outermost

    Article Snippet: Nine rare-cutting restriction enzymes, ApaI, AscI, MluI, NruI, PmeI, RsrII, SacII, SmaI, and XhoI (New England Biolabs), were chosen for testing the cleavage of DNA of proteolytic C. botulinum .

    Techniques:

    Schematic representation of MV-GFP and human λ light immunoglobulin chain displaying MV-λ genomes. ( a ) Human λ chain gene was inserted by exchanging the GFP using a MluI/AatII cleavage site upstream of the N protein. Growth kinetics

    Journal: Molecular Therapy: the Journal of the American Society of Gene Therapy

    Article Title: Converting Tumor-specific Markers Into Reporters of Oncolytic Virus Infection

    doi: 10.1038/mt.2009.92

    Figure Lengend Snippet: Schematic representation of MV-GFP and human λ light immunoglobulin chain displaying MV-λ genomes. ( a ) Human λ chain gene was inserted by exchanging the GFP using a MluI/AatII cleavage site upstream of the N protein. Growth kinetics

    Article Snippet: MluI/AatII (New England BioLabs, Ipswich, MA) digested fragment was subcloned into the full-length infectious clone MV Edmonston vaccine strain p(+)MVeGFP plasmid (kindly provided by Cattaneo, Mayo Clinic, Rochester, MN), replacing the GFP gene.

    Techniques: