Structured Review

Illumina Inc miseq
Miseq, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 372 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/miseq/product/Illumina Inc
Average 99 stars, based on 372 article reviews
Price from $9.99 to $1999.99
miseq - by Bioz Stars, 2020-02
99/100 stars

Images

Related Articles

Amplification:

Article Title: Primary progressive multiple sclerosis in a Russian cohort: relationship with gut bacterial diversity
Article Snippet: PCR amplification was performed as described earlier [ ]. .. The obtained libraries were sequenced with 2 × 300 bp paired-ends reagents on MiSeq (Illumina, USA) in SB RAS Genomics Core Facility (ICBFM SB RAS, Novosibirsk, Russia).

Article Title: Modulation of Gut Microbiota by Glucosamine and Chondroitin in a Randomized, Double-Blind Pilot Trial in Humans
Article Snippet: Fecal Microbiome Measures Stool samples collected in RNAlater were thawed and homogenized, and DNA was extracted and amplified and sequenced for the V4 region of the 16S rRNA gene, as described previously [ ]. .. Paired-end sequencing was performed on the MiSeq using MiSeq Reagent Kit v3 following the manufacturer’s guidelines to obtain 2 × 300 bp paired-end reads (Illumina, San Diego, CA, USA).

Article Title: Atypical Dermatophytosis in 12 North American Porcupines (Erethizon dorsatum) from the Northeastern United States 2010–2017
Article Snippet: Primers NL1 (5′-GCATATCAATAAGCGGAGGAAAAG-3′) and NL4 (5′-GGTCCGTGTTTCAAGACGG-3′) were used for amplification [ ]. .. Library preparations for metagenomic sequencing were performed using the Nextera XT library preparation kit and sequenced using MiSeq 2 × 250 bp chemistry (Illumina, San Diego, CA, USA).

Article Title: One in three highly selected Greek patients with breast cancer carries a loss-of-function variant in a cancer susceptibility gene
Article Snippet: 10.1136/jmedgenet-2019-106189.supp3 Supplementary data Amplified libraries were evaluated qualitatively and quantitatively using Fragment Analyzer (Advanced Analytical Technologies, Heidelberg, Germany). .. Indexed libraries were sequenced on MiSeq using the Standard V2 kit performing 150 base paired-end reads, while FASTQ, BAM and VCF files were generated through Illumina MiSeq Reporter; annotation was performed against the human reference genome GRCh38 using VariantStudio V.3 (Illumina).

Article Title: Korean Society for Genetic Diagnostics Guidelines for Validation of Next-Generation Sequencing-Based Somatic Variant Detection in Hematologic Malignancies
Article Snippet: Currently, the two main platforms used in Korean clinical laboratories are MiSeq or NextSeq (Illumina, San Diego, CA, USA) and Ion Torrent (Thermo Fisher Scientific, Waltham, MA, USA). .. These platforms use hybrid capture or amplicon-based methods in the target enrichment process.

Article Title: Scorzonera sensu lato ( Asteraceae, Cichorieae) – taxonomic reassessment in the light of new molecular phylogenetic and carpological analyses
Article Snippet: Paragraph title: DNA extraction, amplification and sequencing ... The nrITS region was sequenced on the MiSeq (Illumina, USA).

Scaffolding:

Article Title: Multifaceted Hi-C benchmarking: what makes a difference in chromosome-scale genome scaffolding?
Article Snippet: For evaluating the effects of variable duration of the restriction digestion and ligation reactions, sequencing was performed on a MiSeq (Illumina) using the MiSeq Reagent Kit v3 to obtain 300 nt-long paired-end reads. .. Large-scale sequencing for Hi-C scaffolding was performed to obtain 151 nt-long paired-end reads on a HiSeq X (Illumina).

Cytometry:

Article Title: A Novel cis Element Achieves the Same Solution as an Ancestral cis Element During Thiamine Starvation in Candida glabrata
Article Snippet: .. We monitored fluorescence by flow cytometry and observed the frequency of cells that were highly fluorescent jump from 6 to > 90% in 24 h. We collected three independently grown cultures (in medium lacking thiamine) to purify DNA and amplify the CgPMU3 promoter for next generation sequencing on a MiSeq (Illumina, San Diego, CA). ..

Article Title: Generating quantitative binding landscapes through fractional binding selections combined with deep sequencing and data normalization
Article Snippet: Finally, the cells were washed with ice-cold PBS, and the fluorescence intensity was analyzed by dual-color flow cytometry (Accuri C6, BD Biosciences). .. Sorted cells were then grown in a selective medium, the plasmidic DNA was extracted for each of the sorted population and the naive library and submitted to NGS by MiSeq, Illumina (service provided by Hylabs, Rechovot, IL).

Construct:

Article Title: Prolonged Zika Virus RNA Detection in Semen of Immunosuppressed Patient
Article Snippet: We constructed sequencing libraries from total seminal plasma-extracted RNA enriched by using a panel of oligonucleotide probes, 120 nt in length, designed to capture all known Asian Zika virus strains, according to previously described methods ( ). .. We did the same for the day 515 sample and sequenced it using MiSeq (Illumina, https://www.illumina.com ).

Incubation:

Article Title: Generating quantitative binding landscapes through fractional binding selections combined with deep sequencing and data normalization
Article Snippet: Thereafter, cells were washed with ice-cold 1×PBS, followed by incubation with a 1:50 dilution of phycoerythrin (PE)-conjugated anti mouse secondary antibody (Sigma-Aldrich, St. Louis, MO, Catalog number: P9670) and 1:800 dilution of NeutrAvidin (Thermo Fisher Scientific, Waltham, MA, Catalog Number: A2662) conjugated with FITC in 1×PBS with 1% BSA for 20 min on ice. .. Sorted cells were then grown in a selective medium, the plasmidic DNA was extracted for each of the sorted population and the naive library and submitted to NGS by MiSeq, Illumina (service provided by Hylabs, Rechovot, IL).

Formalin-fixed Paraffin-Embedded:

Article Title: New insights into intranuclear inclusions in thyroid carcinoma: Association with autophagy and with BRAFV600E mutation
Article Snippet: After deparaffinization of FFPE tissue, DNA was extracted using an automated system and kit (Maxwell/RSC DNA FFPE Kit, Promega, Fitchburg, WI, USA) according to the manufacturer’s instructions. .. The pooled library was sequenced on MiSeq (Illumina; 2 × 150 bases paired-end run) and analyzed by Biomedical Genomics Workbench (CLC Bio, Qiagen, USA).

Article Title: Atypical Dermatophytosis in 12 North American Porcupines (Erethizon dorsatum) from the Northeastern United States 2010–2017
Article Snippet: ITS metagenomic sequencing was additionally performed using primers CTTGGTCATTTAGAGGAAGTAA and GCTGCGTTC TTCATCGATGC on FFPE samples from cases 1 and 7 and cultures from cases 9 and 11. .. Library preparations for metagenomic sequencing were performed using the Nextera XT library preparation kit and sequenced using MiSeq 2 × 250 bp chemistry (Illumina, San Diego, CA, USA).

Activity Assay:

Article Title: G6PD genetic variations in neonatal Hyperbilirubinemia in Indonesian Deutromalay population
Article Snippet: All infants underwent the following laboratory examinations: routine hematologic evaluation, Coombs test, G6PD activity measurement using the Randox kit method, and serum total bilirubin level. .. All exons of the G6PD gene were targeted for deep sequencing using MiSeq (Illumina).

Expressing:

Article Title: A Novel cis Element Achieves the Same Solution as an Ancestral cis Element During Thiamine Starvation in Candida glabrata
Article Snippet: Approximately, 5% of transformants were judged as highly expressing during thiamine starvation (based on YFP expression). .. We monitored fluorescence by flow cytometry and observed the frequency of cells that were highly fluorescent jump from 6 to > 90% in 24 h. We collected three independently grown cultures (in medium lacking thiamine) to purify DNA and amplify the CgPMU3 promoter for next generation sequencing on a MiSeq (Illumina, San Diego, CA).

Article Title: Generating quantitative binding landscapes through fractional binding selections combined with deep sequencing and data normalization
Article Snippet: BPTI expression and binding to individual proteases were detected by incubating approximately 1 × 106 yeast cells with a 1:50 dilution of mouse anti-cMyc antibody (9E10, Abcam, Catalog number: AB-ab32, Cambridge, UK) in 1× Phosphate buffered saline (PBS) supplemented with 1% bovine serum albumin (BSA, Thermo Fisher Scientific, Waltham, MA) for 1 h at room temperature, washed with ice-cold 1xPBS and then incubated with different concentrations of biotinylated BT (biotin and biotinylation protocol from Thermo Fisher Scientific, Waltham, MA) in 1×PBS with 1% BSA for 1 h at room temperature. .. Sorted cells were then grown in a selective medium, the plasmidic DNA was extracted for each of the sorted population and the naive library and submitted to NGS by MiSeq, Illumina (service provided by Hylabs, Rechovot, IL).

Hybridization:

Article Title: Next-Generation Sequencing on Insectivorous Bat Guano: An Accurate Tool to Identify Arthropod Viruses of Potential Agricultural Concern
Article Snippet: Library Sequencing The library was denatured using NaOH and diluted to 12 pM with 5% of PhiX before loading on a MiSeq (Illumina, San Diego, CA USA). .. Cluster formation, primer hybridization, and sequencing of 300 cycles in the paired-end read were performed with a reagent kit v3 (600 cycles).

Flow Cytometry:

Article Title: A Novel cis Element Achieves the Same Solution as an Ancestral cis Element During Thiamine Starvation in Candida glabrata
Article Snippet: .. We monitored fluorescence by flow cytometry and observed the frequency of cells that were highly fluorescent jump from 6 to > 90% in 24 h. We collected three independently grown cultures (in medium lacking thiamine) to purify DNA and amplify the CgPMU3 promoter for next generation sequencing on a MiSeq (Illumina, San Diego, CA). ..

Article Title: Generating quantitative binding landscapes through fractional binding selections combined with deep sequencing and data normalization
Article Snippet: Finally, the cells were washed with ice-cold PBS, and the fluorescence intensity was analyzed by dual-color flow cytometry (Accuri C6, BD Biosciences). .. Sorted cells were then grown in a selective medium, the plasmidic DNA was extracted for each of the sorted population and the naive library and submitted to NGS by MiSeq, Illumina (service provided by Hylabs, Rechovot, IL).

Ligation:

Article Title: Multifaceted Hi-C benchmarking: what makes a difference in chromosome-scale genome scaffolding?
Article Snippet: .. For evaluating the effects of variable duration of the restriction digestion and ligation reactions, sequencing was performed on a MiSeq (Illumina) using the MiSeq Reagent Kit v3 to obtain 300 nt-long paired-end reads. .. Large-scale sequencing for Hi-C scaffolding was performed to obtain 151 nt-long paired-end reads on a HiSeq X (Illumina).

Infection:

Article Title: Prolonged Zika Virus RNA Detection in Semen of Immunosuppressed Patient
Article Snippet: We did the same for the day 515 sample and sequenced it using MiSeq (Illumina, https://www.illumina.com ). .. We also prepared 90 plasma samples from patients infected with hepatitis C, collected for a separate study, in parallel with the day 515 sample.

Generated:

Article Title: One in three highly selected Greek patients with breast cancer carries a loss-of-function variant in a cancer susceptibility gene
Article Snippet: .. Indexed libraries were sequenced on MiSeq using the Standard V2 kit performing 150 base paired-end reads, while FASTQ, BAM and VCF files were generated through Illumina MiSeq Reporter; annotation was performed against the human reference genome GRCh38 using VariantStudio V.3 (Illumina). .. The minimum base and amplicon coverage were 50×, and 100×, respectively, while the mean read depth was 182×.

DNA Sequencing:

Article Title: Multifaceted Hi-C benchmarking: what makes a difference in chromosome-scale genome scaffolding?
Article Snippet: Paragraph title: DNA sequencing ... For evaluating the effects of variable duration of the restriction digestion and ligation reactions, sequencing was performed on a MiSeq (Illumina) using the MiSeq Reagent Kit v3 to obtain 300 nt-long paired-end reads.

Polymerase Chain Reaction:

Article Title: Prolonged Zika Virus RNA Detection in Semen of Immunosuppressed Patient
Article Snippet: ¶Confirmed on reextraction and repeat PCR testing. .. We did the same for the day 515 sample and sequenced it using MiSeq (Illumina, https://www.illumina.com ).

Article Title: Primary progressive multiple sclerosis in a Russian cohort: relationship with gut bacterial diversity
Article Snippet: Then the triplicates were pooled, and a total of 200 ng PCR product for each sample was pooled together and purified through MinElute Gel Extraction Kit (Qiagen, Germany). .. The obtained libraries were sequenced with 2 × 300 bp paired-ends reagents on MiSeq (Illumina, USA) in SB RAS Genomics Core Facility (ICBFM SB RAS, Novosibirsk, Russia).

Article Title: A Novel cis Element Achieves the Same Solution as an Ancestral cis Element During Thiamine Starvation in Candida glabrata
Article Snippet: The three PCR products – two CgPMU3 promoter PCR products and the ScTHI5 open reading frame (Table S1) – were gap repaired ( ) into a strain lacking the wild-type CgPMU3 promoter (Cgpmu1-3∆NATMX6 described above) and we collected 131,000 independent transformants. .. We monitored fluorescence by flow cytometry and observed the frequency of cells that were highly fluorescent jump from 6 to > 90% in 24 h. We collected three independently grown cultures (in medium lacking thiamine) to purify DNA and amplify the CgPMU3 promoter for next generation sequencing on a MiSeq (Illumina, San Diego, CA).

Article Title: New insights into intranuclear inclusions in thyroid carcinoma: Association with autophagy and with BRAFV600E mutation
Article Snippet: Multiplex PCR and purification were performed with the GeneRead DNAseq Custom Panel V2, GeneRead DNAseq Panel PCR Kit V2 (Qiagen, USA) and Agencourt® AMPure® XP Beads (Beckmann, USA), followed by measurement of total DNA amount by Qubit® 2.0 Fluorometer dsDNA HS assay kit. .. The pooled library was sequenced on MiSeq (Illumina; 2 × 150 bases paired-end run) and analyzed by Biomedical Genomics Workbench (CLC Bio, Qiagen, USA).

Article Title: Atypical Dermatophytosis in 12 North American Porcupines (Erethizon dorsatum) from the Northeastern United States 2010–2017
Article Snippet: The D1–D2 region of the large subunit RNA gene was amplified by PCR, purified, and sequenced for speciation. .. Library preparations for metagenomic sequencing were performed using the Nextera XT library preparation kit and sequenced using MiSeq 2 × 250 bp chemistry (Illumina, San Diego, CA, USA).

Article Title: Scorzonera sensu lato ( Asteraceae, Cichorieae) – taxonomic reassessment in the light of new molecular phylogenetic and carpological analyses
Article Snippet: Then 5 µl (50 ng) of each normalised sample was used for PCR and library preparation. .. The nrITS region was sequenced on the MiSeq (Illumina, USA).

Binding Assay:

Article Title: Generating quantitative binding landscapes through fractional binding selections combined with deep sequencing and data normalization
Article Snippet: BPTI expression and binding to individual proteases were detected by incubating approximately 1 × 106 yeast cells with a 1:50 dilution of mouse anti-cMyc antibody (9E10, Abcam, Catalog number: AB-ab32, Cambridge, UK) in 1× Phosphate buffered saline (PBS) supplemented with 1% bovine serum albumin (BSA, Thermo Fisher Scientific, Waltham, MA) for 1 h at room temperature, washed with ice-cold 1xPBS and then incubated with different concentrations of biotinylated BT (biotin and biotinylation protocol from Thermo Fisher Scientific, Waltham, MA) in 1×PBS with 1% BSA for 1 h at room temperature. .. Sorted cells were then grown in a selective medium, the plasmidic DNA was extracted for each of the sorted population and the naive library and submitted to NGS by MiSeq, Illumina (service provided by Hylabs, Rechovot, IL).

Hi-C:

Article Title: Multifaceted Hi-C benchmarking: what makes a difference in chromosome-scale genome scaffolding?
Article Snippet: For evaluating the effects of variable duration of the restriction digestion and ligation reactions, sequencing was performed on a MiSeq (Illumina) using the MiSeq Reagent Kit v3 to obtain 300 nt-long paired-end reads. .. Large-scale sequencing for Hi-C scaffolding was performed to obtain 151 nt-long paired-end reads on a HiSeq X (Illumina).

DNA Extraction:

Article Title: Primary progressive multiple sclerosis in a Russian cohort: relationship with gut bacterial diversity
Article Snippet: Paragraph title: DNA extraction and sequencing ... The obtained libraries were sequenced with 2 × 300 bp paired-ends reagents on MiSeq (Illumina, USA) in SB RAS Genomics Core Facility (ICBFM SB RAS, Novosibirsk, Russia).

Article Title: A Mesophilic Aeromonas salmonicida Strain Isolated from an Unsuspected Host, the Migratory Bird Pied Avocet
Article Snippet: Paragraph title: 2.2. DNA Extraction and Sequencing ... Sequencing was performed using a MiSeq (Illumina, San Diego, CA, USA) system at the Plateforme d’Analyse Génomique of the Institut de Biologie Intégrative et des Systèmes (Université Laval, Quebec City, QC, Canada).

Article Title: Genomic insights into Vibrio cholerae O1 responsible for cholera epidemics in Tanzania between 1993 and 2017
Article Snippet: .. DNA extraction, whole genome sequencing and genome assembly DNA from the 22 V . cholerae O1 isolates was extracted using the automated Maxwell DNA extraction machine (Promega Maxwell RSC, Wisconsin, USA) and sequencing was performed on a Miseq (Illumina, Inc., San Diego, CA, USA) as previously described [ ] at the University of Copenhagen, Denmark. ..

Article Title: Scorzonera sensu lato ( Asteraceae, Cichorieae) – taxonomic reassessment in the light of new molecular phylogenetic and carpological analyses
Article Snippet: Paragraph title: DNA extraction, amplification and sequencing ... The nrITS region was sequenced on the MiSeq (Illumina, USA).

Fluorescence:

Article Title: A Novel cis Element Achieves the Same Solution as an Ancestral cis Element During Thiamine Starvation in Candida glabrata
Article Snippet: .. We monitored fluorescence by flow cytometry and observed the frequency of cells that were highly fluorescent jump from 6 to > 90% in 24 h. We collected three independently grown cultures (in medium lacking thiamine) to purify DNA and amplify the CgPMU3 promoter for next generation sequencing on a MiSeq (Illumina, San Diego, CA). ..

Article Title: Generating quantitative binding landscapes through fractional binding selections combined with deep sequencing and data normalization
Article Snippet: Finally, the cells were washed with ice-cold PBS, and the fluorescence intensity was analyzed by dual-color flow cytometry (Accuri C6, BD Biosciences). .. Sorted cells were then grown in a selective medium, the plasmidic DNA was extracted for each of the sorted population and the naive library and submitted to NGS by MiSeq, Illumina (service provided by Hylabs, Rechovot, IL).

Isolation:

Article Title: G6PD genetic variations in neonatal Hyperbilirubinemia in Indonesian Deutromalay population
Article Snippet: Deoxyribose Nucleic Acid (DNA) was isolated from peripheral blood of 116 and 115 healthy term neonates with and without hyperbilirubinemia. .. All exons of the G6PD gene were targeted for deep sequencing using MiSeq (Illumina).

Labeling:

Article Title: Korean Society for Genetic Diagnostics Guidelines for Validation of Next-Generation Sequencing-Based Somatic Variant Detection in Hematologic Malignancies
Article Snippet: Currently, the two main platforms used in Korean clinical laboratories are MiSeq or NextSeq (Illumina, San Diego, CA, USA) and Ion Torrent (Thermo Fisher Scientific, Waltham, MA, USA). .. Illumina platforms use reversible terminator-based sequencing with optical detection of fluorescently labeled nucleotides [ ].

Purification:

Article Title: Primary progressive multiple sclerosis in a Russian cohort: relationship with gut bacterial diversity
Article Snippet: Then the triplicates were pooled, and a total of 200 ng PCR product for each sample was pooled together and purified through MinElute Gel Extraction Kit (Qiagen, Germany). .. The obtained libraries were sequenced with 2 × 300 bp paired-ends reagents on MiSeq (Illumina, USA) in SB RAS Genomics Core Facility (ICBFM SB RAS, Novosibirsk, Russia).

Article Title: New insights into intranuclear inclusions in thyroid carcinoma: Association with autophagy and with BRAFV600E mutation
Article Snippet: Multiplex PCR and purification were performed with the GeneRead DNAseq Custom Panel V2, GeneRead DNAseq Panel PCR Kit V2 (Qiagen, USA) and Agencourt® AMPure® XP Beads (Beckmann, USA), followed by measurement of total DNA amount by Qubit® 2.0 Fluorometer dsDNA HS assay kit. .. The pooled library was sequenced on MiSeq (Illumina; 2 × 150 bases paired-end run) and analyzed by Biomedical Genomics Workbench (CLC Bio, Qiagen, USA).

Article Title: Atypical Dermatophytosis in 12 North American Porcupines (Erethizon dorsatum) from the Northeastern United States 2010–2017
Article Snippet: The D1–D2 region of the large subunit RNA gene was amplified by PCR, purified, and sequenced for speciation. .. Library preparations for metagenomic sequencing were performed using the Nextera XT library preparation kit and sequenced using MiSeq 2 × 250 bp chemistry (Illumina, San Diego, CA, USA).

Sequencing:

Article Title: Prolonged Zika Virus RNA Detection in Semen of Immunosuppressed Patient
Article Snippet: We constructed sequencing libraries from total seminal plasma-extracted RNA enriched by using a panel of oligonucleotide probes, 120 nt in length, designed to capture all known Asian Zika virus strains, according to previously described methods ( ). .. We did the same for the day 515 sample and sequenced it using MiSeq (Illumina, https://www.illumina.com ).

Article Title: Primary progressive multiple sclerosis in a Russian cohort: relationship with gut bacterial diversity
Article Snippet: Paragraph title: DNA extraction and sequencing ... The obtained libraries were sequenced with 2 × 300 bp paired-ends reagents on MiSeq (Illumina, USA) in SB RAS Genomics Core Facility (ICBFM SB RAS, Novosibirsk, Russia).

Article Title: A Mesophilic Aeromonas salmonicida Strain Isolated from an Unsuspected Host, the Migratory Bird Pied Avocet
Article Snippet: .. Sequencing was performed using a MiSeq (Illumina, San Diego, CA, USA) system at the Plateforme d’Analyse Génomique of the Institut de Biologie Intégrative et des Systèmes (Université Laval, Quebec City, QC, Canada). .. Sequence Assembly and Analyses The sequencing reads were de novo assembled using A5-miseq version 20160825 [ ].

Article Title: A Novel cis Element Achieves the Same Solution as an Ancestral cis Element During Thiamine Starvation in Candida glabrata
Article Snippet: Paragraph title: SEL-seq sequencing ... We monitored fluorescence by flow cytometry and observed the frequency of cells that were highly fluorescent jump from 6 to > 90% in 24 h. We collected three independently grown cultures (in medium lacking thiamine) to purify DNA and amplify the CgPMU3 promoter for next generation sequencing on a MiSeq (Illumina, San Diego, CA).

Article Title: Modulation of Gut Microbiota by Glucosamine and Chondroitin in a Randomized, Double-Blind Pilot Trial in Humans
Article Snippet: .. Paired-end sequencing was performed on the MiSeq using MiSeq Reagent Kit v3 following the manufacturer’s guidelines to obtain 2 × 300 bp paired-end reads (Illumina, San Diego, CA, USA). .. FastQ files were exported (Molecular Research, Shallowater, TX, USA) and securely transferred to Fred Hutch (BaseSpace, Illumina, San Diego, CA, USA) for bioinformatic analysis.

Article Title: New insights into intranuclear inclusions in thyroid carcinoma: Association with autophagy and with BRAFV600E mutation
Article Snippet: The pooled library was sequenced on MiSeq (Illumina; 2 × 150 bases paired-end run) and analyzed by Biomedical Genomics Workbench (CLC Bio, Qiagen, USA). .. For targeted sequencing a customized thyroid-panel was designed containing regions of interest.

Article Title: G6PD genetic variations in neonatal Hyperbilirubinemia in Indonesian Deutromalay population
Article Snippet: .. All exons of the G6PD gene were targeted for deep sequencing using MiSeq (Illumina). ..

Article Title: Genomic insights into Vibrio cholerae O1 responsible for cholera epidemics in Tanzania between 1993 and 2017
Article Snippet: .. DNA extraction, whole genome sequencing and genome assembly DNA from the 22 V . cholerae O1 isolates was extracted using the automated Maxwell DNA extraction machine (Promega Maxwell RSC, Wisconsin, USA) and sequencing was performed on a Miseq (Illumina, Inc., San Diego, CA, USA) as previously described [ ] at the University of Copenhagen, Denmark. ..

Article Title: Multifaceted Hi-C benchmarking: what makes a difference in chromosome-scale genome scaffolding?
Article Snippet: .. For evaluating the effects of variable duration of the restriction digestion and ligation reactions, sequencing was performed on a MiSeq (Illumina) using the MiSeq Reagent Kit v3 to obtain 300 nt-long paired-end reads. .. Large-scale sequencing for Hi-C scaffolding was performed to obtain 151 nt-long paired-end reads on a HiSeq X (Illumina).

Article Title: Atypical Dermatophytosis in 12 North American Porcupines (Erethizon dorsatum) from the Northeastern United States 2010–2017
Article Snippet: .. Library preparations for metagenomic sequencing were performed using the Nextera XT library preparation kit and sequenced using MiSeq 2 × 250 bp chemistry (Illumina, San Diego, CA, USA). .. Bioinformatics analyses: Reads from the Sanger sequencing were quality trimmed and blasted against the nt database using BLASTn [ ] to obtain the top three blast hits at an e-value of ≤ 1e-6.

Article Title: One in three highly selected Greek patients with breast cancer carries a loss-of-function variant in a cancer susceptibility gene
Article Snippet: Paragraph title: Genomic capture and massively parallel sequencing using Trusight cancer panel ... Indexed libraries were sequenced on MiSeq using the Standard V2 kit performing 150 base paired-end reads, while FASTQ, BAM and VCF files were generated through Illumina MiSeq Reporter; annotation was performed against the human reference genome GRCh38 using VariantStudio V.3 (Illumina).

Article Title: Next-Generation Sequencing on Insectivorous Bat Guano: An Accurate Tool to Identify Arthropod Viruses of Potential Agricultural Concern
Article Snippet: .. Library Sequencing The library was denatured using NaOH and diluted to 12 pM with 5% of PhiX before loading on a MiSeq (Illumina, San Diego, CA USA). .. Cluster formation, primer hybridization, and sequencing of 300 cycles in the paired-end read were performed with a reagent kit v3 (600 cycles).

Article Title: Korean Society for Genetic Diagnostics Guidelines for Validation of Next-Generation Sequencing-Based Somatic Variant Detection in Hematologic Malignancies
Article Snippet: Currently, the two main platforms used in Korean clinical laboratories are MiSeq or NextSeq (Illumina, San Diego, CA, USA) and Ion Torrent (Thermo Fisher Scientific, Waltham, MA, USA). .. Illumina platforms use reversible terminator-based sequencing with optical detection of fluorescently labeled nucleotides [ ].

Article Title: Scorzonera sensu lato ( Asteraceae, Cichorieae) – taxonomic reassessment in the light of new molecular phylogenetic and carpological analyses
Article Snippet: Paragraph title: DNA extraction, amplification and sequencing ... The nrITS region was sequenced on the MiSeq (Illumina, USA).

Multiplex Assay:

Article Title: New insights into intranuclear inclusions in thyroid carcinoma: Association with autophagy and with BRAFV600E mutation
Article Snippet: Multiplex PCR and purification were performed with the GeneRead DNAseq Custom Panel V2, GeneRead DNAseq Panel PCR Kit V2 (Qiagen, USA) and Agencourt® AMPure® XP Beads (Beckmann, USA), followed by measurement of total DNA amount by Qubit® 2.0 Fluorometer dsDNA HS assay kit. .. The pooled library was sequenced on MiSeq (Illumina; 2 × 150 bases paired-end run) and analyzed by Biomedical Genomics Workbench (CLC Bio, Qiagen, USA).

Selection:

Article Title: Korean Society for Genetic Diagnostics Guidelines for Validation of Next-Generation Sequencing-Based Somatic Variant Detection in Hematologic Malignancies
Article Snippet: Paragraph title: Platform selection ... Currently, the two main platforms used in Korean clinical laboratories are MiSeq or NextSeq (Illumina, San Diego, CA, USA) and Ion Torrent (Thermo Fisher Scientific, Waltham, MA, USA).

Next-Generation Sequencing:

Article Title: A Novel cis Element Achieves the Same Solution as an Ancestral cis Element During Thiamine Starvation in Candida glabrata
Article Snippet: .. We monitored fluorescence by flow cytometry and observed the frequency of cells that were highly fluorescent jump from 6 to > 90% in 24 h. We collected three independently grown cultures (in medium lacking thiamine) to purify DNA and amplify the CgPMU3 promoter for next generation sequencing on a MiSeq (Illumina, San Diego, CA). ..

Article Title: New insights into intranuclear inclusions in thyroid carcinoma: Association with autophagy and with BRAFV600E mutation
Article Snippet: Paragraph title: Next generation sequencing (NGS) ... The pooled library was sequenced on MiSeq (Illumina; 2 × 150 bases paired-end run) and analyzed by Biomedical Genomics Workbench (CLC Bio, Qiagen, USA).

Article Title: Generating quantitative binding landscapes through fractional binding selections combined with deep sequencing and data normalization
Article Snippet: .. Sorted cells were then grown in a selective medium, the plasmidic DNA was extracted for each of the sorted population and the naive library and submitted to NGS by MiSeq, Illumina (service provided by Hylabs, Rechovot, IL). .. NGS analysis The paired-end reads from the NGS experiments were merged and their quality scores were calculated in the FastQC tool ( https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ ).

Article Title: Korean Society for Genetic Diagnostics Guidelines for Validation of Next-Generation Sequencing-Based Somatic Variant Detection in Hematologic Malignancies
Article Snippet: Platform selection The platform used to perform NGS tests should be chosen considering all aspects, including cost, user accessibility, turnaround time, test performance, data quality, expected errors, available bioinformatics tools, and commercial gene panels of interest. .. Currently, the two main platforms used in Korean clinical laboratories are MiSeq or NextSeq (Illumina, San Diego, CA, USA) and Ion Torrent (Thermo Fisher Scientific, Waltham, MA, USA).

Concentration Assay:

Article Title: Scorzonera sensu lato ( Asteraceae, Cichorieae) – taxonomic reassessment in the light of new molecular phylogenetic and carpological analyses
Article Snippet: Concentration and purity of DNA samples were assessed by OD 260/280 and OD 260/230 ratios on the NanoPhotometer N60-Touch (Implen, Germany). .. The nrITS region was sequenced on the MiSeq (Illumina, USA).

Gel Extraction:

Article Title: Primary progressive multiple sclerosis in a Russian cohort: relationship with gut bacterial diversity
Article Snippet: Then the triplicates were pooled, and a total of 200 ng PCR product for each sample was pooled together and purified through MinElute Gel Extraction Kit (Qiagen, Germany). .. The obtained libraries were sequenced with 2 × 300 bp paired-ends reagents on MiSeq (Illumina, USA) in SB RAS Genomics Core Facility (ICBFM SB RAS, Novosibirsk, Russia).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Illumina Inc illumina miseq data
    Evaluation of the MIRU-profiler on the genome assemblies based on <t>Illumina</t> <t>Miseq</t> reads. (A) A summary of the evaluation results is presented in the boxplot where number of matched, mismatched and indeterminate loci (unknown allele number or not detected) per sample are shown. (B) Percentage agreement between MIRU-profiler and experimental results for each locus is shown. (C) The effect of average sequencing depth on the number of loci that could be detected by the MIRU-profiler is shown. The analysis was performed by down sampling reads from one of the samples to 5×, 10×, 15×, 20×, 25× and 30×.
    Illumina Miseq Data, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/illumina miseq data/product/Illumina Inc
    Average 99 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    illumina miseq data - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    Illumina Inc illumina miseq platform
    Forward and reverse read quality profiles for 300 cycles on the <t>Illumina</t> HiSeq (1,536 samples) and <t>MiSeq</t> (444 samples) platforms. Amplicon libraries were prepared using a 2-step PCR method. Shown for each cycle are the mean quality score (green line), the median quality score (solid purple line), and the quartiles of the quality score distribution (dotted purple lines).
    Illumina Miseq Platform, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 2160 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/illumina miseq platform/product/Illumina Inc
    Average 99 stars, based on 2160 article reviews
    Price from $9.99 to $1999.99
    illumina miseq platform - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    Image Search Results


    Evaluation of the MIRU-profiler on the genome assemblies based on Illumina Miseq reads. (A) A summary of the evaluation results is presented in the boxplot where number of matched, mismatched and indeterminate loci (unknown allele number or not detected) per sample are shown. (B) Percentage agreement between MIRU-profiler and experimental results for each locus is shown. (C) The effect of average sequencing depth on the number of loci that could be detected by the MIRU-profiler is shown. The analysis was performed by down sampling reads from one of the samples to 5×, 10×, 15×, 20×, 25× and 30×.

    Journal: PeerJ

    Article Title: MIRU-profiler: a rapid tool for determination of 24-loci MIRU-VNTR profiles from assembled genomes of Mycobacterium tuberculosis

    doi: 10.7717/peerj.5090

    Figure Lengend Snippet: Evaluation of the MIRU-profiler on the genome assemblies based on Illumina Miseq reads. (A) A summary of the evaluation results is presented in the boxplot where number of matched, mismatched and indeterminate loci (unknown allele number or not detected) per sample are shown. (B) Percentage agreement between MIRU-profiler and experimental results for each locus is shown. (C) The effect of average sequencing depth on the number of loci that could be detected by the MIRU-profiler is shown. The analysis was performed by down sampling reads from one of the samples to 5×, 10×, 15×, 20×, 25× and 30×.

    Article Snippet: Evaluation on the genome assemblies based on the Illumina MiSeq data The results of the MIRU-profiler evaluation on the genome assemblies based on 250 bp paired-end reads from the Illumina MiSeq machine are detailed in and illustrated in .

    Techniques: Sequencing, Sampling

    Comparison between Illumina MiSeq (green bars) and Ion Torrent sequencing (gray bars) in reflecting OTU richness (A,B) and evenness (C,D) across the four treatment levels: Lepeophtheirus salmonis (LeSa), Paramoeba perurans (PaPe), algal mix (AlgMix) containing the three algal species, and Mix containing all the five species together. Within each panel the two different methods are compared.

    Journal: Frontiers in Microbiology

    Article Title: Environmental DNA: A New Low-Cost Monitoring Tool for Pathogens in Salmonid Aquaculture

    doi: 10.3389/fmicb.2018.03009

    Figure Lengend Snippet: Comparison between Illumina MiSeq (green bars) and Ion Torrent sequencing (gray bars) in reflecting OTU richness (A,B) and evenness (C,D) across the four treatment levels: Lepeophtheirus salmonis (LeSa), Paramoeba perurans (PaPe), algal mix (AlgMix) containing the three algal species, and Mix containing all the five species together. Within each panel the two different methods are compared.

    Article Snippet: The Illumina MiSeq data consisted of fewer raw reads (6,115,810 paired reads) across all samples compared with the Ion Torrent output (9,350,400 single reads).

    Techniques: Sequencing

    Experimental design aiming to test the efficiency of two sequencing methods, namely Illumina MiSeq and IonTorrent, in reflecting the species composition and abundance in different incubations. Each incubation contained four aquaculture related risk agents either in isolation or combined: Lepeophtheirus salmonis (LeSa), Paramoeba perurans (PaPe), algal mix (AlgMix) containing Prymnesium parvum, Pseudonitzschia delicaticima, and P. seriata , and Mix containing all the species together. Each of these incubations was performed at three abundance levels representing triplings of the initial abundance (i.e., 2, 6, and 18). The experiment aimed to control for the effect of background noise in these treatments thus we deployed these using both filtered and unfiltered seawater medium.

    Journal: Frontiers in Microbiology

    Article Title: Environmental DNA: A New Low-Cost Monitoring Tool for Pathogens in Salmonid Aquaculture

    doi: 10.3389/fmicb.2018.03009

    Figure Lengend Snippet: Experimental design aiming to test the efficiency of two sequencing methods, namely Illumina MiSeq and IonTorrent, in reflecting the species composition and abundance in different incubations. Each incubation contained four aquaculture related risk agents either in isolation or combined: Lepeophtheirus salmonis (LeSa), Paramoeba perurans (PaPe), algal mix (AlgMix) containing Prymnesium parvum, Pseudonitzschia delicaticima, and P. seriata , and Mix containing all the species together. Each of these incubations was performed at three abundance levels representing triplings of the initial abundance (i.e., 2, 6, and 18). The experiment aimed to control for the effect of background noise in these treatments thus we deployed these using both filtered and unfiltered seawater medium.

    Article Snippet: The Illumina MiSeq data consisted of fewer raw reads (6,115,810 paired reads) across all samples compared with the Ion Torrent output (9,350,400 single reads).

    Techniques: Sequencing, Incubation, Isolation

    Variability in the read numbers of the three target microalgal species namely the two Pseudo-nitzschia species that were assigned as P. cuspidata and P. australis , but which were in fact P. delicatissima and P. seriata (A–D) and Prymnesium parvum (E,F) across the different treatments (see Figure 1 for treatment abbreviations). Within each treatment, the reads of each species were compared between the two sequencing methods Illumina MiSeq and Ion Torrent and between filtered and unfiltered marine plankton samples. For the non-prefiltered seawater samples, increasing relative abundances of reads for the target organisms is evident as their concentration is increased in the original sample for every organism except P. australis . A similar pattern is not observed in prefiltered seawater samples. Low levels of cross contamination between the target species ( P. perurans an L. salmonis reads in algal samples) is also observed.

    Journal: Frontiers in Microbiology

    Article Title: Environmental DNA: A New Low-Cost Monitoring Tool for Pathogens in Salmonid Aquaculture

    doi: 10.3389/fmicb.2018.03009

    Figure Lengend Snippet: Variability in the read numbers of the three target microalgal species namely the two Pseudo-nitzschia species that were assigned as P. cuspidata and P. australis , but which were in fact P. delicatissima and P. seriata (A–D) and Prymnesium parvum (E,F) across the different treatments (see Figure 1 for treatment abbreviations). Within each treatment, the reads of each species were compared between the two sequencing methods Illumina MiSeq and Ion Torrent and between filtered and unfiltered marine plankton samples. For the non-prefiltered seawater samples, increasing relative abundances of reads for the target organisms is evident as their concentration is increased in the original sample for every organism except P. australis . A similar pattern is not observed in prefiltered seawater samples. Low levels of cross contamination between the target species ( P. perurans an L. salmonis reads in algal samples) is also observed.

    Article Snippet: The Illumina MiSeq data consisted of fewer raw reads (6,115,810 paired reads) across all samples compared with the Ion Torrent output (9,350,400 single reads).

    Techniques: Sequencing, Concentration Assay

    MetaPORE analysis of Illumina MiSeq data from samples containing CHIKV and EBOV. Taxonomic donut charts were generated from Illumina MiSeq data corresponding to the Chik1 run ( a ) and Ebola1 run ( b ) using the MetaPORE bioinformatics analysis pipeline. The total number of MiSeq reads analyzed is shown in the center of the donut. Note that given computational time constraints, only a subset of reads (n = 100,000) was analyzed using MetaPORE. Coverage and pairwise identity plots were generated from MiSeq CHIKV reads from the Chik1 sample (248,677 of 3,235,099 reads, 7.7 %) ( c ), or EBOV reads from the Ebola1 sample (20,820 of 2,743,589 reads, 0.76 %) ( d ), identified using SURPI analysis and LASTZ mapping {Harris, 2007 #34} at an e-value of 10-5 to the closest matching reference genome. Data were analyzed in MetaPORE on a 64-core Ubuntu Linux server using the June 2014 and January 2015 NT databases as the reference databases for the CHIKV and EBOV samples, respectively.

    Journal: Genome Medicine

    Article Title: Rapid metagenomic identification of viral pathogens in clinical samples by real-time nanopore sequencing analysis

    doi: 10.1186/s13073-015-0220-9

    Figure Lengend Snippet: MetaPORE analysis of Illumina MiSeq data from samples containing CHIKV and EBOV. Taxonomic donut charts were generated from Illumina MiSeq data corresponding to the Chik1 run ( a ) and Ebola1 run ( b ) using the MetaPORE bioinformatics analysis pipeline. The total number of MiSeq reads analyzed is shown in the center of the donut. Note that given computational time constraints, only a subset of reads (n = 100,000) was analyzed using MetaPORE. Coverage and pairwise identity plots were generated from MiSeq CHIKV reads from the Chik1 sample (248,677 of 3,235,099 reads, 7.7 %) ( c ), or EBOV reads from the Ebola1 sample (20,820 of 2,743,589 reads, 0.76 %) ( d ), identified using SURPI analysis and LASTZ mapping {Harris, 2007 #34} at an e-value of 10-5 to the closest matching reference genome. Data were analyzed in MetaPORE on a 64-core Ubuntu Linux server using the June 2014 and January 2015 NT databases as the reference databases for the CHIKV and EBOV samples, respectively.

    Article Snippet: For comparison, the MetaPORE pipeline was also run on a subset of 100,000 reads from parallel Illumina MiSeq data corresponding to the Chik1, Ebola1, and Ebola2 samples.

    Techniques: Generated

    Metagenomic sequencing workflow for MinION nanopore sequencing compared to Illumina MiSeq sequencing. a Overall workflow. b Steps in the MetaPORE real-time analysis pipeline. The turnaround time for sample-to-detection nanopore sequencing, defined here as the cumulative time taken for nucleic acid extraction, reverse transcription, library preparation, sequencing, MetaPORE bioinformatics analysis, and pathogen detection, was under 6 hr, while Illumina sequencing took over 20 hr. The time differential is accounted for by increased times for library quantitation, sequencing, and bioinformatics analysis with the Illumina protocol. *Assumes a 12-hr 50-bp single-end MiSeq run of ~12–15 million reads, with 50 bp the minimum estimated read length needed for accurate pathogen identification. **Denotes estimated average SURPI bioinformatics analysis run length for MiSeq data [ 19 ]. The stopwatch is depicted as a 12-hr clock

    Journal: Genome Medicine

    Article Title: Rapid metagenomic identification of viral pathogens in clinical samples by real-time nanopore sequencing analysis

    doi: 10.1186/s13073-015-0220-9

    Figure Lengend Snippet: Metagenomic sequencing workflow for MinION nanopore sequencing compared to Illumina MiSeq sequencing. a Overall workflow. b Steps in the MetaPORE real-time analysis pipeline. The turnaround time for sample-to-detection nanopore sequencing, defined here as the cumulative time taken for nucleic acid extraction, reverse transcription, library preparation, sequencing, MetaPORE bioinformatics analysis, and pathogen detection, was under 6 hr, while Illumina sequencing took over 20 hr. The time differential is accounted for by increased times for library quantitation, sequencing, and bioinformatics analysis with the Illumina protocol. *Assumes a 12-hr 50-bp single-end MiSeq run of ~12–15 million reads, with 50 bp the minimum estimated read length needed for accurate pathogen identification. **Denotes estimated average SURPI bioinformatics analysis run length for MiSeq data [ 19 ]. The stopwatch is depicted as a 12-hr clock

    Article Snippet: For comparison, the MetaPORE pipeline was also run on a subset of 100,000 reads from parallel Illumina MiSeq data corresponding to the Chik1, Ebola1, and Ebola2 samples.

    Techniques: Sequencing, Nanopore Sequencing, Quantitation Assay

    Metagenomic identification of EBOV from a clinical blood sample by nanopore sequencing and MetaPORE real-time bioinformatics analysis. Nanopore data generated from the Ebola2 library and sequenced on flow cell #3 were analyzed in real time using the MetaPORE bioinformatics analysis pipeline, and compared to corresponding Illumina MiSeq data. a Time line of nanopore sequencing runs on flow cell #3 with sample reloading, plotted as a function of elapsed time in hours since the start of flow cell sequencing. b Cumulative numbers of all sequenced reads (black line) and target viral reads (red line) from the nanopore run (left panel) or MiSeq run (right panel), plotted as a function of individual sequencing run time in minutes. c Taxonomic donut charts generated by real-time MetaPORE analysis of the nanopore reads (left panel) and post-run analysis of the MiSeq reads (right panel). The total number of reads analyzed is shown in the center of the donut. Note that given computational time constraints, only a subset of MiSeq reads (n = 100,000) was analyzed using MetaPORE. d Coverage and pairwise identity plots generated from nanopore (left panel) or MiSeq data (right panel) by mapping reads aligning to EBOV to the closest matching reference genome ((e), asterisk). e Whole-genome phylogeny of EBOV. Representative EBOV genome sequences, including those from the 2014-2015 West Africa outbreak (tan) and 2014 DRC outbreak (pink), are included. Branch lengths are drawn proportionally to the number of nucleotide substitutions per position, and support values are shown for each node. Data were analyzed in MetaPORE on a 64-core Ubuntu Linux server using the January 2015 NT reference database.

    Journal: Genome Medicine

    Article Title: Rapid metagenomic identification of viral pathogens in clinical samples by real-time nanopore sequencing analysis

    doi: 10.1186/s13073-015-0220-9

    Figure Lengend Snippet: Metagenomic identification of EBOV from a clinical blood sample by nanopore sequencing and MetaPORE real-time bioinformatics analysis. Nanopore data generated from the Ebola2 library and sequenced on flow cell #3 were analyzed in real time using the MetaPORE bioinformatics analysis pipeline, and compared to corresponding Illumina MiSeq data. a Time line of nanopore sequencing runs on flow cell #3 with sample reloading, plotted as a function of elapsed time in hours since the start of flow cell sequencing. b Cumulative numbers of all sequenced reads (black line) and target viral reads (red line) from the nanopore run (left panel) or MiSeq run (right panel), plotted as a function of individual sequencing run time in minutes. c Taxonomic donut charts generated by real-time MetaPORE analysis of the nanopore reads (left panel) and post-run analysis of the MiSeq reads (right panel). The total number of reads analyzed is shown in the center of the donut. Note that given computational time constraints, only a subset of MiSeq reads (n = 100,000) was analyzed using MetaPORE. d Coverage and pairwise identity plots generated from nanopore (left panel) or MiSeq data (right panel) by mapping reads aligning to EBOV to the closest matching reference genome ((e), asterisk). e Whole-genome phylogeny of EBOV. Representative EBOV genome sequences, including those from the 2014-2015 West Africa outbreak (tan) and 2014 DRC outbreak (pink), are included. Branch lengths are drawn proportionally to the number of nucleotide substitutions per position, and support values are shown for each node. Data were analyzed in MetaPORE on a 64-core Ubuntu Linux server using the January 2015 NT reference database.

    Article Snippet: For comparison, the MetaPORE pipeline was also run on a subset of 100,000 reads from parallel Illumina MiSeq data corresponding to the Chik1, Ebola1, and Ebola2 samples.

    Techniques: Nanopore Sequencing, Generated, Flow Cytometry, Sequencing

    Forward and reverse read quality profiles for 300 cycles on the Illumina HiSeq (1,536 samples) and MiSeq (444 samples) platforms. Amplicon libraries were prepared using a 2-step PCR method. Shown for each cycle are the mean quality score (green line), the median quality score (solid purple line), and the quartiles of the quality score distribution (dotted purple lines).

    Journal: mSystems

    Article Title: Ultrahigh-Throughput Multiplexing and Sequencing of > 500-Base-Pair Amplicon Regions on the Illumina HiSeq 2500 Platform

    doi: 10.1128/mSystems.00029-19

    Figure Lengend Snippet: Forward and reverse read quality profiles for 300 cycles on the Illumina HiSeq (1,536 samples) and MiSeq (444 samples) platforms. Amplicon libraries were prepared using a 2-step PCR method. Shown for each cycle are the mean quality score (green line), the median quality score (solid purple line), and the quartiles of the quality score distribution (dotted purple lines).

    Article Snippet: Here, modifications to the Illumina HiSeq 2500 platform are described which produce greater multiplexing capabilities and 300-bp paired-end reads of higher quality than those produced by the current Illumina MiSeq platform.

    Techniques: Amplification, Polymerase Chain Reaction