mirvana mirna isolation kit  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    MIRVANA MIRNA MIMICS AND INHIBITORS
    Description:

    Catalog Number:
    mirvana
    Price:
    None
    Buy from Supplier


    Structured Review

    Thermo Fisher mirvana mirna isolation kit
    ]. (D) The relative expression of <t>miRNA-23a,</t> miR-218 and miR-708 during breast cancer metastasis. Samples were prepared by either mirRICH or <t>mirVana</t> kit and the quantification of each miRNAs were measured by qPCR analysis.

    https://www.bioz.com/result/mirvana mirna isolation kit/product/Thermo Fisher
    Average 99 stars, based on 588 article reviews
    Price from $9.99 to $1999.99
    mirvana mirna isolation kit - by Bioz Stars, 2020-07
    99/100 stars

    Images

    1) Product Images from "mirRICH, a simple method to enrich the small RNA fraction from over-dried RNA pellets"

    Article Title: mirRICH, a simple method to enrich the small RNA fraction from over-dried RNA pellets

    Journal: RNA Biology

    doi: 10.1080/15476286.2018.1451723

    ]. (D) The relative expression of miRNA-23a, miR-218 and miR-708 during breast cancer metastasis. Samples were prepared by either mirRICH or mirVana kit and the quantification of each miRNAs were measured by qPCR analysis.
    Figure Legend Snippet: ]. (D) The relative expression of miRNA-23a, miR-218 and miR-708 during breast cancer metastasis. Samples were prepared by either mirRICH or mirVana kit and the quantification of each miRNAs were measured by qPCR analysis.

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction

    2) Product Images from "Dietary Immunostimulant CpG Modulates MicroRNA Biomarkers Associated with Immune Responses in Atlantic Salmon (Salmo salar)"

    Article Title: Dietary Immunostimulant CpG Modulates MicroRNA Biomarkers Associated with Immune Responses in Atlantic Salmon (Salmo salar)

    Journal: Cells

    doi: 10.3390/cells8121592

    Overview of experimental design. Following 7 weeks of feeding trial, fish fed both diets were subjected to immune challenge by an intraperitoneal (IP) injection of sterile phosphate-buffered saline (PBS), bacterial antigen Aeromonas salmonicida (ASAL), or viral mimic polyriboinosinic polyribocytidylic acid (pIC). mirVana -prepared head kidney (HK) templates from three of each PBS-, pIC-, and ASAL-injected fish (control diet only) were selected for deep sequencing based on the qPCR assessed expression of known pIC (i.e., isg15a , mxb , irf7b ) and ASAL (i.e., campb , tlr5a , il1b ) immune biomarker transcripts. Selected pIC- and/or ASAL-responsive miRNAs were studied by qPCR using all samples from both dietary groups. *mRNA qPCR analyses were conducted using DNase-treated and column-purified total RNA.
    Figure Legend Snippet: Overview of experimental design. Following 7 weeks of feeding trial, fish fed both diets were subjected to immune challenge by an intraperitoneal (IP) injection of sterile phosphate-buffered saline (PBS), bacterial antigen Aeromonas salmonicida (ASAL), or viral mimic polyriboinosinic polyribocytidylic acid (pIC). mirVana -prepared head kidney (HK) templates from three of each PBS-, pIC-, and ASAL-injected fish (control diet only) were selected for deep sequencing based on the qPCR assessed expression of known pIC (i.e., isg15a , mxb , irf7b ) and ASAL (i.e., campb , tlr5a , il1b ) immune biomarker transcripts. Selected pIC- and/or ASAL-responsive miRNAs were studied by qPCR using all samples from both dietary groups. *mRNA qPCR analyses were conducted using DNase-treated and column-purified total RNA.

    Techniques Used: Fluorescence In Situ Hybridization, Injection, Sequencing, Real-time Polymerase Chain Reaction, Expressing, Biomarker Assay, Purification

    3) Product Images from "MicroRNA-186 targets Yes-associated protein 1 to inhibit Hippo signaling and tumorigenesis in hepatocellular carcinoma"

    Article Title: MicroRNA-186 targets Yes-associated protein 1 to inhibit Hippo signaling and tumorigenesis in hepatocellular carcinoma

    Journal: Oncology Letters

    doi: 10.3892/ol.2016.4312

    Transfection of miR-186 inhibits hepatocellular carcinoma (HCC) cell migration, invasion and proliferation. (A) Wound-healing assay for three human HCC cell lines (HepG2, Hep3B and SNU398) following transfection with either mirVana miRNA mimic negative
    Figure Legend Snippet: Transfection of miR-186 inhibits hepatocellular carcinoma (HCC) cell migration, invasion and proliferation. (A) Wound-healing assay for three human HCC cell lines (HepG2, Hep3B and SNU398) following transfection with either mirVana miRNA mimic negative

    Techniques Used: Transfection, Migration, Wound Healing Assay

    4) Product Images from "Positive Regulation of Hepatitis E Virus Replication by MicroRNA-122"

    Article Title: Positive Regulation of Hepatitis E Virus Replication by MicroRNA-122

    Journal: Journal of Virology

    doi: 10.1128/JVI.01999-17

    Differential basal expression of miR-122 in the cell lines used. Cells were harvested, and RNA was isolated using a mirVana miRNA isolation kit. miRNA was reverse transcribed using has–miR-122-5p- and U6 snRNA-specific stem-loop primers. miR-122 levels were measured using a TaqMan-based quantitative PCR (qPCR) assay. U6 snRNA served as an endogenous control for normalization. *, P
    Figure Legend Snippet: Differential basal expression of miR-122 in the cell lines used. Cells were harvested, and RNA was isolated using a mirVana miRNA isolation kit. miRNA was reverse transcribed using has–miR-122-5p- and U6 snRNA-specific stem-loop primers. miR-122 levels were measured using a TaqMan-based quantitative PCR (qPCR) assay. U6 snRNA served as an endogenous control for normalization. *, P

    Techniques Used: Expressing, Isolation, Real-time Polymerase Chain Reaction

    5) Product Images from "mirRICH, a simple method to enrich the small RNA fraction from over-dried RNA pellets"

    Article Title: mirRICH, a simple method to enrich the small RNA fraction from over-dried RNA pellets

    Journal: RNA Biology

    doi: 10.1080/15476286.2018.1451723

    ]. (D) The relative expression of miRNA-23a, miR-218 and miR-708 during breast cancer metastasis. Samples were prepared by either mirRICH or mirVana kit and the quantification of each miRNAs were measured by qPCR analysis.
    Figure Legend Snippet: ]. (D) The relative expression of miRNA-23a, miR-218 and miR-708 during breast cancer metastasis. Samples were prepared by either mirRICH or mirVana kit and the quantification of each miRNAs were measured by qPCR analysis.

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction

    6) Product Images from "A comparison of microRNA sequencing reproducibility and noise reduction using mirVana and TRIzol isolation methods"

    Article Title: A comparison of microRNA sequencing reproducibility and noise reduction using mirVana and TRIzol isolation methods

    Journal: International journal of computational biology and drug design

    doi: 10.1504/IJCBDD.2014.061642

    Reproducibility was evaluated using Spearman’s correlation between any two repeats for (a) mature miRNA and (b) precursor miRNA. The overall reproducibility is high for miRNAseq. The mirVana isolation kit showed slightly better reproducibility than TRIzol isolation method (see online version for colours)
    Figure Legend Snippet: Reproducibility was evaluated using Spearman’s correlation between any two repeats for (a) mature miRNA and (b) precursor miRNA. The overall reproducibility is high for miRNAseq. The mirVana isolation kit showed slightly better reproducibility than TRIzol isolation method (see online version for colours)

    Techniques Used: Isolation

    Median expression values of singleton, doubleton and tripleton (a) mature miRNA and (b) precursor miRNA for both mirVana and TRIzol isolation kits. The mirVana isolation kit had higher expression values than the TRIzol method for most freezing conditions. The doubleton and singleton miRNA have significantly lower expression compared to tripleton miRNA (see online version for colours)
    Figure Legend Snippet: Median expression values of singleton, doubleton and tripleton (a) mature miRNA and (b) precursor miRNA for both mirVana and TRIzol isolation kits. The mirVana isolation kit had higher expression values than the TRIzol method for most freezing conditions. The doubleton and singleton miRNA have significantly lower expression compared to tripleton miRNA (see online version for colours)

    Techniques Used: Expressing, Isolation

    The Venn diagram of overlapped, identified mature miRNA (a, b) and precursor miRNA (c, d) among the 3 repeats separate by miRNA isolation method. The mirVana isolation kit (a, c) identified more tripleton miRNA reads than the Trizol-based isolation method (b, d) (see online version for colours)
    Figure Legend Snippet: The Venn diagram of overlapped, identified mature miRNA (a, b) and precursor miRNA (c, d) among the 3 repeats separate by miRNA isolation method. The mirVana isolation kit (a, c) identified more tripleton miRNA reads than the Trizol-based isolation method (b, d) (see online version for colours)

    Techniques Used: Isolation

    7) Product Images from "Determination of abnormally expressed microRNAs in bone marrow smears from patients with follicular lymphomas"

    Article Title: Determination of abnormally expressed microRNAs in bone marrow smears from patients with follicular lymphomas

    Journal: SpringerPlus

    doi: 10.1186/2193-1801-3-288

    Successful isolation of small RNAs from BM smears and functional quantitative PCR analysis for the miRNAs. A , Ferrograms of the isolated RNA from BM smears. Left, mirVana miRNA Isolation Kit; and right, RNAqueous-Micro Kit. nt, nucleotide. B , Quality of the isolated small RNAs. RIN, RNA integrity number. C , Functional qRT-PCR for miRNAs (U6, let-7a, and miR-155).
    Figure Legend Snippet: Successful isolation of small RNAs from BM smears and functional quantitative PCR analysis for the miRNAs. A , Ferrograms of the isolated RNA from BM smears. Left, mirVana miRNA Isolation Kit; and right, RNAqueous-Micro Kit. nt, nucleotide. B , Quality of the isolated small RNAs. RIN, RNA integrity number. C , Functional qRT-PCR for miRNAs (U6, let-7a, and miR-155).

    Techniques Used: Isolation, Functional Assay, Real-time Polymerase Chain Reaction, Quantitative RT-PCR

    8) Product Images from "Transcriptome Profiling of microRNA by Next-Gen Deep Sequencing Reveals Known and Novel miRNA Species in the Lipid Fraction of Human Breast Milk"

    Article Title: Transcriptome Profiling of microRNA by Next-Gen Deep Sequencing Reveals Known and Novel miRNA Species in the Lipid Fraction of Human Breast Milk

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0050564

    Chromatograms of breast milk preparations. Shown above are chromatograms from RNA demonstrated in gel electrophoresis from Fig. 2. ( A ) ( B ): Whole breast milk (lanes 1 2), ( C ) ( D ): Lipid fraction (milk fat globules) of fresh breast milk (lanes 7 8), ( E ) ( F ): Lipid fraction frozen breast milk (lanes 9 10). These panels demonstrate enrichment for miRNA (blue boxes) in Trizol-treated, mirVANA isolated samples, which minimized the content of ribosomal RNA.
    Figure Legend Snippet: Chromatograms of breast milk preparations. Shown above are chromatograms from RNA demonstrated in gel electrophoresis from Fig. 2. ( A ) ( B ): Whole breast milk (lanes 1 2), ( C ) ( D ): Lipid fraction (milk fat globules) of fresh breast milk (lanes 7 8), ( E ) ( F ): Lipid fraction frozen breast milk (lanes 9 10). These panels demonstrate enrichment for miRNA (blue boxes) in Trizol-treated, mirVANA isolated samples, which minimized the content of ribosomal RNA.

    Techniques Used: Nucleic Acid Electrophoresis, Isolation

    9) Product Images from "Transcriptome Profiling of microRNA by Next-Gen Deep Sequencing Reveals Known and Novel miRNA Species in the Lipid Fraction of Human Breast Milk"

    Article Title: Transcriptome Profiling of microRNA by Next-Gen Deep Sequencing Reveals Known and Novel miRNA Species in the Lipid Fraction of Human Breast Milk

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0050564

    Chromatograms of breast milk preparations. Shown above are chromatograms from RNA demonstrated in gel electrophoresis from Fig. 2. ( A ) ( B ): Whole breast milk (lanes 1 2), ( C ) ( D ): Lipid fraction (milk fat globules) of fresh breast milk (lanes 7 8), ( E ) ( F ): Lipid fraction frozen breast milk (lanes 9 10). These panels demonstrate enrichment for miRNA (blue boxes) in Trizol-treated, mirVANA isolated samples, which minimized the content of ribosomal RNA.
    Figure Legend Snippet: Chromatograms of breast milk preparations. Shown above are chromatograms from RNA demonstrated in gel electrophoresis from Fig. 2. ( A ) ( B ): Whole breast milk (lanes 1 2), ( C ) ( D ): Lipid fraction (milk fat globules) of fresh breast milk (lanes 7 8), ( E ) ( F ): Lipid fraction frozen breast milk (lanes 9 10). These panels demonstrate enrichment for miRNA (blue boxes) in Trizol-treated, mirVANA isolated samples, which minimized the content of ribosomal RNA.

    Techniques Used: Nucleic Acid Electrophoresis, Isolation

    10) Product Images from "Reversible HuR‐micro RNA binding controls extracellular export of miR‐122 and augments stress response"

    Article Title: Reversible HuR‐micro RNA binding controls extracellular export of miR‐122 and augments stress response

    Journal: EMBO Reports

    doi: 10.15252/embr.201541930

    HuR binds and replaces mi RNA bound to Ago2 Time‐course experiment of HuR binding of miR‐122 replaced from Ago2 miRNPs. A schematic representation of in vitro miRNA‐binding assay of HuR (left panel). Equal amounts of recombinant HuR (rHuR), after the indicated time of the miRNP interaction on FLAG beads, were immunoprecipitated, and HuR‐associated miR‐122 levels were detected by qRT–PCR (right top panel). Ago2 Western blot detects its presence in the FLAG beads used in the assay and its absence in HuR‐immunoprecipitated materials. HuR Western blot was used to confirm its presence and quantification of its levels in the immunoprecipitated materials, at different time points (right bottom panel). A schematic diagram of in vitro miRNA‐binding assay of HuR, using wild‐type full‐length and delta RRMIII deletion mutant of HuR. Relative amount of miR‐122 bound to full‐length and delta RRMIII after 60 min of incubation with miR‐122 containing miRNPs. Coomassie‐stained gel picture denotes the purity of the recombinant HuR used in the assay. The same proteins were Western blotted for HuR to show the specificity of the antibody used for immunoprecipitation. The recombinant P and N proteins of Chandipura virus were used as negative control to confirm the specificity of 3A2 anti‐HuR antibody. HuR Western blot in middle right panel confirmed the presence of HuR and its truncated version in the immunoprecipitated materials obtained from assays described in panel (B). A representative domain picture of HuR and HuRΔIII is shown in the upper panel. Relative levels of HuR‐bound miR‐122 were determined by qRT–PCR (mean ± s.e.m., n = 3) (middle left panel). Amount of miR‐122 recovered from the immunoprecipitated materials was normalized against the amount of HuR or HuRΔIII present in the immunoprecipitated materials. Ago2 Western blot confirmed its presence in the FLAG beads used in the assay, while no Ago2 was detected in HuR‐immunoprecipitated materials (bottom panel). RNA electrophoretic mobility shift assay done with 32 P‐labeled synthetic miR‐122 and recombinant HuR proteins. Radiolabeled miR‐122 (100 fmol) was incubated with increasing concentration of FL‐HuR (5–100 nM) or HuRΔIII (100 nM), and gel shifting of miR‐122 was marked by arrowhead. Position of the free probes is marked by an arrow. In the right panel, 1 pmol of unlabeled TNF‐α AU‐rich element encoding synthetic RNA was used to compete with miR‐122 binding of full‐length HuR. Amount of HuR or HuRΔIII used for gel shift assay was premeasured by densitometric estimation of Coomassie‐stained gel bands from SDS–PAGE. Association of miRNAs with recombinant HuR in vitro . Small RNA pool of Huh7 cells isolated by mirVANA miRNA isolation kit was incubated with recombinant HuR in an in vitro binding reaction and HuR‐associated RNA, recovered from immunoprecipitated HuR after the binding reaction, were quantified along with the input RNA used for binding. The mean C t values of RNA from samples from three independent binding reactions along with input RNA were measured and plotted (mean ± s.e.m., n = 3). Recombinant HuR used in the binding assay and in the immunoprecipitated materials was detected by Western blot in the input. Data information: ** P
    Figure Legend Snippet: HuR binds and replaces mi RNA bound to Ago2 Time‐course experiment of HuR binding of miR‐122 replaced from Ago2 miRNPs. A schematic representation of in vitro miRNA‐binding assay of HuR (left panel). Equal amounts of recombinant HuR (rHuR), after the indicated time of the miRNP interaction on FLAG beads, were immunoprecipitated, and HuR‐associated miR‐122 levels were detected by qRT–PCR (right top panel). Ago2 Western blot detects its presence in the FLAG beads used in the assay and its absence in HuR‐immunoprecipitated materials. HuR Western blot was used to confirm its presence and quantification of its levels in the immunoprecipitated materials, at different time points (right bottom panel). A schematic diagram of in vitro miRNA‐binding assay of HuR, using wild‐type full‐length and delta RRMIII deletion mutant of HuR. Relative amount of miR‐122 bound to full‐length and delta RRMIII after 60 min of incubation with miR‐122 containing miRNPs. Coomassie‐stained gel picture denotes the purity of the recombinant HuR used in the assay. The same proteins were Western blotted for HuR to show the specificity of the antibody used for immunoprecipitation. The recombinant P and N proteins of Chandipura virus were used as negative control to confirm the specificity of 3A2 anti‐HuR antibody. HuR Western blot in middle right panel confirmed the presence of HuR and its truncated version in the immunoprecipitated materials obtained from assays described in panel (B). A representative domain picture of HuR and HuRΔIII is shown in the upper panel. Relative levels of HuR‐bound miR‐122 were determined by qRT–PCR (mean ± s.e.m., n = 3) (middle left panel). Amount of miR‐122 recovered from the immunoprecipitated materials was normalized against the amount of HuR or HuRΔIII present in the immunoprecipitated materials. Ago2 Western blot confirmed its presence in the FLAG beads used in the assay, while no Ago2 was detected in HuR‐immunoprecipitated materials (bottom panel). RNA electrophoretic mobility shift assay done with 32 P‐labeled synthetic miR‐122 and recombinant HuR proteins. Radiolabeled miR‐122 (100 fmol) was incubated with increasing concentration of FL‐HuR (5–100 nM) or HuRΔIII (100 nM), and gel shifting of miR‐122 was marked by arrowhead. Position of the free probes is marked by an arrow. In the right panel, 1 pmol of unlabeled TNF‐α AU‐rich element encoding synthetic RNA was used to compete with miR‐122 binding of full‐length HuR. Amount of HuR or HuRΔIII used for gel shift assay was premeasured by densitometric estimation of Coomassie‐stained gel bands from SDS–PAGE. Association of miRNAs with recombinant HuR in vitro . Small RNA pool of Huh7 cells isolated by mirVANA miRNA isolation kit was incubated with recombinant HuR in an in vitro binding reaction and HuR‐associated RNA, recovered from immunoprecipitated HuR after the binding reaction, were quantified along with the input RNA used for binding. The mean C t values of RNA from samples from three independent binding reactions along with input RNA were measured and plotted (mean ± s.e.m., n = 3). Recombinant HuR used in the binding assay and in the immunoprecipitated materials was detected by Western blot in the input. Data information: ** P

    Techniques Used: Binding Assay, In Vitro, Recombinant, Immunoprecipitation, Quantitative RT-PCR, Western Blot, Mutagenesis, Incubation, Staining, Negative Control, Electrophoretic Mobility Shift Assay, Labeling, Concentration Assay, SDS Page, Isolation

    11) Product Images from "The Bioactivity of D-/L-Isonucleoside- and 2′-Deoxyinosine-Incorporated Aptamer AS1411s Including DNA Replication/MicroRNA Expression"

    Article Title: The Bioactivity of D-/L-Isonucleoside- and 2′-Deoxyinosine-Incorporated Aptamer AS1411s Including DNA Replication/MicroRNA Expression

    Journal: Molecular Therapy. Nucleic Acids

    doi: 10.1016/j.omtn.2017.09.010

    Modulation of MicroRNA Expression by FCL-II and Suppression Effect of FCL-I/II on MCF-7 Xenografts (A) For TaqMan PCR, the total RNA was isolated using the mirVana miRNA Isolation Kit (Life Technologies Corporation, USA). RT-PCR was performed using the TaqMan MicroRNA Assay (Life Technologies Corporation, USA) and the Mx3005P QPCR System (Agilent Technologies, Inc., CA, USA). U6 gene quantification was used as the control. The results are shown as a mean of three separate experiments with SD. (B) Bilaterally ovariectomized female athymic nude mice (BALB/c/Nu/Nu) were subcutaneously inoculated with MCF-7 cells at the age of 4 weeks. Treatment of mice with established tumors by an intraperitoneal injection of aptamers at doses equivalent to approximately 3 OD/mice/day daily for the first 5 days and an additional treatment at day 7 for a total of 6 injections was performed. The tumor volume was calculated using the formula (1/2 × L × W 2 ). Above, the tumor measurement was made after the mice were sacrificed. The results are shown as a mean of six separate experiments with SD. (C) The body weights of the mice were measured daily, and the results are shown as a mean of six separate experiments with SD.
    Figure Legend Snippet: Modulation of MicroRNA Expression by FCL-II and Suppression Effect of FCL-I/II on MCF-7 Xenografts (A) For TaqMan PCR, the total RNA was isolated using the mirVana miRNA Isolation Kit (Life Technologies Corporation, USA). RT-PCR was performed using the TaqMan MicroRNA Assay (Life Technologies Corporation, USA) and the Mx3005P QPCR System (Agilent Technologies, Inc., CA, USA). U6 gene quantification was used as the control. The results are shown as a mean of three separate experiments with SD. (B) Bilaterally ovariectomized female athymic nude mice (BALB/c/Nu/Nu) were subcutaneously inoculated with MCF-7 cells at the age of 4 weeks. Treatment of mice with established tumors by an intraperitoneal injection of aptamers at doses equivalent to approximately 3 OD/mice/day daily for the first 5 days and an additional treatment at day 7 for a total of 6 injections was performed. The tumor volume was calculated using the formula (1/2 × L × W 2 ). Above, the tumor measurement was made after the mice were sacrificed. The results are shown as a mean of six separate experiments with SD. (C) The body weights of the mice were measured daily, and the results are shown as a mean of six separate experiments with SD.

    Techniques Used: Expressing, Polymerase Chain Reaction, Isolation, Reverse Transcription Polymerase Chain Reaction, TaqMan microRNA Assay, Real-time Polymerase Chain Reaction, Mouse Assay, Injection

    12) Product Images from "MicroRNAs Overexpressed in Growth-Restricted Rat Skeletal Muscles Regulate the Glucose Transport in Cell Culture Targeting Central TGF-? Factor SMAD4"

    Article Title: MicroRNAs Overexpressed in Growth-Restricted Rat Skeletal Muscles Regulate the Glucose Transport in Cell Culture Targeting Central TGF-? Factor SMAD4

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0034596

    Semi-quantitative RT-PCR analysis of microRNAs in male SKM samples. I. The total RNA (1 µg) has been used to make cDNA using Ambion mirVana isolation kit. Equal amount of cDNA has been used in separate microRNA-specific PCR reactions. CMCP (1-6) and SMSP (1-6) correspond to six samples of control and starved SKM. II. Image J analyses of the intensities of all bands were plotted as graphs for each microRNAs. T-test was done as a measure of statistical analysis. GAPDH was used as an internal control.
    Figure Legend Snippet: Semi-quantitative RT-PCR analysis of microRNAs in male SKM samples. I. The total RNA (1 µg) has been used to make cDNA using Ambion mirVana isolation kit. Equal amount of cDNA has been used in separate microRNA-specific PCR reactions. CMCP (1-6) and SMSP (1-6) correspond to six samples of control and starved SKM. II. Image J analyses of the intensities of all bands were plotted as graphs for each microRNAs. T-test was done as a measure of statistical analysis. GAPDH was used as an internal control.

    Techniques Used: Quantitative RT-PCR, Isolation, Polymerase Chain Reaction

    13) Product Images from "Transcriptome Profiling of microRNA by Next-Gen Deep Sequencing Reveals Known and Novel miRNA Species in the Lipid Fraction of Human Breast Milk"

    Article Title: Transcriptome Profiling of microRNA by Next-Gen Deep Sequencing Reveals Known and Novel miRNA Species in the Lipid Fraction of Human Breast Milk

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0050564

    Chromatograms of breast milk preparations. Shown above are chromatograms from RNA demonstrated in gel electrophoresis from Fig. 2. ( A ) ( B ): Whole breast milk (lanes 1 2), ( C ) ( D ): Lipid fraction (milk fat globules) of fresh breast milk (lanes 7 8), ( E ) ( F ): Lipid fraction frozen breast milk (lanes 9 10). These panels demonstrate enrichment for miRNA (blue boxes) in Trizol-treated, mirVANA isolated samples, which minimized the content of ribosomal RNA.
    Figure Legend Snippet: Chromatograms of breast milk preparations. Shown above are chromatograms from RNA demonstrated in gel electrophoresis from Fig. 2. ( A ) ( B ): Whole breast milk (lanes 1 2), ( C ) ( D ): Lipid fraction (milk fat globules) of fresh breast milk (lanes 7 8), ( E ) ( F ): Lipid fraction frozen breast milk (lanes 9 10). These panels demonstrate enrichment for miRNA (blue boxes) in Trizol-treated, mirVANA isolated samples, which minimized the content of ribosomal RNA.

    Techniques Used: Nucleic Acid Electrophoresis, Isolation

    14) Product Images from "Target-dependent biogenesis of cognate microRNAs in human cells"

    Article Title: Target-dependent biogenesis of cognate microRNAs in human cells

    Journal: Nature Communications

    doi: 10.1038/ncomms12200

    Reversal of amino acid-starvation-induced stress increases miR-122 biogenesis in Huh7 cells. ( a , b ) Outline of the experimental set-up used ( a ). Relative level of CAT-1 mRNA in Huh7 cells either fed or starved for 4 h and re-fed with media containing amino acids for another 2 h. CAT-1 mRNA levels were quantified by quantitative reverse transcriptase-PCR with levels in Fed cells taken as 1 ( b ). ( c ) Effect of starvation and re-feeding on mature miR-122 levels in Huh7 cells. Total RNA was extracted and 8 μg RNA was used for northern blotting of mature miR-122, let-7a and miR-16. U6 snRNA was used as loading control. ( d ) Copy number/number of molecules of mature miR-122 and CAT-1 mRNA per Huh7 cell calculated in fed, starved and re-fed Huh7 cells. Estimations were done by real-time-based methods. ( e ) Increase in mature miR-122 but not that of other non-relevant miRNAs, miR-16, miR-21, miR-24 and miR-125b on relief of starvation. Real-time PCR-based quantification of mature miRNA levels in Huh7 cells starved for amino acids (4 h) and subsequently re-fed (2 h). ( f ) Increase in mature miR-122 is accompanied by a concomitant decrease in pre-miR-122 on re-feeding the starved cells for 2 h. Cellular small RNA population was isolated by mirVANA kit to minimize possible contamination of pri-miR-122 and real-time-based assays were carried out to quantify pre-miR-122. Pre-miR-122 detected by northern blotting with 15 μg total RNA. Synthetic pre-miR-122 was used as a size marker to determine the position of the pre-miR-122 in the northern blotting. ( g ) Increase of mature miR-122 on re-feeding of starved cells is reduced in DICER1 knockdown Huh7 cells. miR-16 and miR-21 did not show any significant change. siDICER1-mediated knockdown of DICER1 is confirmed by western blotting. Paired two-tailed Student's t -tests were used for all comparisons. * P
    Figure Legend Snippet: Reversal of amino acid-starvation-induced stress increases miR-122 biogenesis in Huh7 cells. ( a , b ) Outline of the experimental set-up used ( a ). Relative level of CAT-1 mRNA in Huh7 cells either fed or starved for 4 h and re-fed with media containing amino acids for another 2 h. CAT-1 mRNA levels were quantified by quantitative reverse transcriptase-PCR with levels in Fed cells taken as 1 ( b ). ( c ) Effect of starvation and re-feeding on mature miR-122 levels in Huh7 cells. Total RNA was extracted and 8 μg RNA was used for northern blotting of mature miR-122, let-7a and miR-16. U6 snRNA was used as loading control. ( d ) Copy number/number of molecules of mature miR-122 and CAT-1 mRNA per Huh7 cell calculated in fed, starved and re-fed Huh7 cells. Estimations were done by real-time-based methods. ( e ) Increase in mature miR-122 but not that of other non-relevant miRNAs, miR-16, miR-21, miR-24 and miR-125b on relief of starvation. Real-time PCR-based quantification of mature miRNA levels in Huh7 cells starved for amino acids (4 h) and subsequently re-fed (2 h). ( f ) Increase in mature miR-122 is accompanied by a concomitant decrease in pre-miR-122 on re-feeding the starved cells for 2 h. Cellular small RNA population was isolated by mirVANA kit to minimize possible contamination of pri-miR-122 and real-time-based assays were carried out to quantify pre-miR-122. Pre-miR-122 detected by northern blotting with 15 μg total RNA. Synthetic pre-miR-122 was used as a size marker to determine the position of the pre-miR-122 in the northern blotting. ( g ) Increase of mature miR-122 on re-feeding of starved cells is reduced in DICER1 knockdown Huh7 cells. miR-16 and miR-21 did not show any significant change. siDICER1-mediated knockdown of DICER1 is confirmed by western blotting. Paired two-tailed Student's t -tests were used for all comparisons. * P

    Techniques Used: Polymerase Chain Reaction, Northern Blot, Real-time Polymerase Chain Reaction, Isolation, Marker, Western Blot, Two Tailed Test

    15) Product Images from "Developmental attenuation of N-methyl-D-aspartate receptor subunit expression by microRNAs"

    Article Title: Developmental attenuation of N-methyl-D-aspartate receptor subunit expression by microRNAs

    Journal: Neural Development

    doi: 10.1186/s13064-015-0047-5

    a . Validation of the Grin2a mRNA 3′UTR as a miR-19a target: relative Grin2a mRNA 3′UTR luciferase levels with 50 nM or 100 nM of miR-19a mimic measured 24 hrs after transfection (Mut., mutant UTR with a 3 bp mutation of the miR-19a target site; Ctrl, values obtained with the mirVana miRNA mimic Control) and relative Grin2a mRNA 3′UTR luciferase levels 24 h after transfection with an anti-miR-19a (concentrations of 50 nM and 100 nM) (Ctrl, transfection with a LNA Inhibitor Control). b . Validation of the Grin2b mRNA 3′UTR as a miR-539 target: relative Grin2b mRNA 3′UTR luciferase levels with 100 nM or 150 nM of miR-539 mimic 24 h after transfection (the concentrations used are higher than those for miR-19a because the Grin2b mRNA 3′UTR possesses two miR-539 target sites) (Mut., mutant UTR with a 3 bp mutation of the miR-539 target site; Ctrl, values obtained with the mirVana miRNA mimic Control) and relative Grin2b mRNA 3′UTR luciferase levels 24 h after transfection with an anti-miR-539 (concentrations of 100 nM and 150 nM) (Ctrl, transfection with a LNA Inhibitor Control). c . miR-19a and miR-539 binding sequences in the 3′UTR of Grin2a and Grin2b respectively, and the corresponding seed matches
    Figure Legend Snippet: a . Validation of the Grin2a mRNA 3′UTR as a miR-19a target: relative Grin2a mRNA 3′UTR luciferase levels with 50 nM or 100 nM of miR-19a mimic measured 24 hrs after transfection (Mut., mutant UTR with a 3 bp mutation of the miR-19a target site; Ctrl, values obtained with the mirVana miRNA mimic Control) and relative Grin2a mRNA 3′UTR luciferase levels 24 h after transfection with an anti-miR-19a (concentrations of 50 nM and 100 nM) (Ctrl, transfection with a LNA Inhibitor Control). b . Validation of the Grin2b mRNA 3′UTR as a miR-539 target: relative Grin2b mRNA 3′UTR luciferase levels with 100 nM or 150 nM of miR-539 mimic 24 h after transfection (the concentrations used are higher than those for miR-19a because the Grin2b mRNA 3′UTR possesses two miR-539 target sites) (Mut., mutant UTR with a 3 bp mutation of the miR-539 target site; Ctrl, values obtained with the mirVana miRNA mimic Control) and relative Grin2b mRNA 3′UTR luciferase levels 24 h after transfection with an anti-miR-539 (concentrations of 100 nM and 150 nM) (Ctrl, transfection with a LNA Inhibitor Control). c . miR-19a and miR-539 binding sequences in the 3′UTR of Grin2a and Grin2b respectively, and the corresponding seed matches

    Techniques Used: Luciferase, Transfection, Mutagenesis, Binding Assay

    16) Product Images from "mirRICH, a simple method to enrich the small RNA fraction from over-dried RNA pellets"

    Article Title: mirRICH, a simple method to enrich the small RNA fraction from over-dried RNA pellets

    Journal: RNA Biology

    doi: 10.1080/15476286.2018.1451723

    ]. (D) The relative expression of miRNA-23a, miR-218 and miR-708 during breast cancer metastasis. Samples were prepared by either mirRICH or mirVana kit and the quantification of each miRNAs were measured by qPCR analysis.
    Figure Legend Snippet: ]. (D) The relative expression of miRNA-23a, miR-218 and miR-708 during breast cancer metastasis. Samples were prepared by either mirRICH or mirVana kit and the quantification of each miRNAs were measured by qPCR analysis.

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction

    17) Product Images from "MicroRNA-186 targets Yes-associated protein 1 to inhibit Hippo signaling and tumorigenesis in hepatocellular carcinoma"

    Article Title: MicroRNA-186 targets Yes-associated protein 1 to inhibit Hippo signaling and tumorigenesis in hepatocellular carcinoma

    Journal: Oncology Letters

    doi: 10.3892/ol.2016.4312

    Transfection of miR-186 inhibits hepatocellular carcinoma (HCC) cell migration, invasion and proliferation. (A) Wound-healing assay for three human HCC cell lines (HepG2, Hep3B and SNU398) following transfection with either mirVana miRNA mimic negative
    Figure Legend Snippet: Transfection of miR-186 inhibits hepatocellular carcinoma (HCC) cell migration, invasion and proliferation. (A) Wound-healing assay for three human HCC cell lines (HepG2, Hep3B and SNU398) following transfection with either mirVana miRNA mimic negative

    Techniques Used: Transfection, Migration, Wound Healing Assay

    18) Product Images from "mirRICH, a simple method to enrich the small RNA fraction from over-dried RNA pellets"

    Article Title: mirRICH, a simple method to enrich the small RNA fraction from over-dried RNA pellets

    Journal: RNA Biology

    doi: 10.1080/15476286.2018.1451723

    Comparison of next generation sequencing (NGS) and qPCR quantification between mirRICH and mirVana. Redrawing diagram with Excel program shows the composition patterns and ratios of various types of RNAs after next generation sequencing either in mirRICH (A) and mirVana (B) drawn by Rfam v9.1 [ 38 ]. (C) The correlation of expression data of total 2588 known miRNAs obtained from two different small RNA preparation methods, mirRICH or mirVana were analyzed by using mirBase databases after NGS [ 39 ]. (D) The relative expression of miRNA-23a, miR-218 and miR-708 during breast cancer metastasis. Samples were prepared by either mirRICH or mirVana kit and the quantification of each miRNAs were measured by qPCR analysis.
    Figure Legend Snippet: Comparison of next generation sequencing (NGS) and qPCR quantification between mirRICH and mirVana. Redrawing diagram with Excel program shows the composition patterns and ratios of various types of RNAs after next generation sequencing either in mirRICH (A) and mirVana (B) drawn by Rfam v9.1 [ 38 ]. (C) The correlation of expression data of total 2588 known miRNAs obtained from two different small RNA preparation methods, mirRICH or mirVana were analyzed by using mirBase databases after NGS [ 39 ]. (D) The relative expression of miRNA-23a, miR-218 and miR-708 during breast cancer metastasis. Samples were prepared by either mirRICH or mirVana kit and the quantification of each miRNAs were measured by qPCR analysis.

    Techniques Used: Next-Generation Sequencing, Real-time Polymerase Chain Reaction, Expressing

    19) Product Images from "MicroRNAs Overexpressed in Growth-Restricted Rat Skeletal Muscles Regulate the Glucose Transport in Cell Culture Targeting Central TGF-? Factor SMAD4"

    Article Title: MicroRNAs Overexpressed in Growth-Restricted Rat Skeletal Muscles Regulate the Glucose Transport in Cell Culture Targeting Central TGF-? Factor SMAD4

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0034596

    Semi-quantitative RT-PCR analysis of microRNAs in male SKM samples. I. The total RNA (1 µg) has been used to make cDNA using Ambion mirVana isolation kit. Equal amount of cDNA has been used in separate microRNA-specific PCR reactions. CMCP (1-6) and SMSP (1-6) correspond to six samples of control and starved SKM. II. Image J analyses of the intensities of all bands were plotted as graphs for each microRNAs. T-test was done as a measure of statistical analysis. GAPDH was used as an internal control.
    Figure Legend Snippet: Semi-quantitative RT-PCR analysis of microRNAs in male SKM samples. I. The total RNA (1 µg) has been used to make cDNA using Ambion mirVana isolation kit. Equal amount of cDNA has been used in separate microRNA-specific PCR reactions. CMCP (1-6) and SMSP (1-6) correspond to six samples of control and starved SKM. II. Image J analyses of the intensities of all bands were plotted as graphs for each microRNAs. T-test was done as a measure of statistical analysis. GAPDH was used as an internal control.

    Techniques Used: Quantitative RT-PCR, Isolation, Polymerase Chain Reaction

    20) Product Images from "mirRICH, a simple method to enrich the small RNA fraction from over-dried RNA pellets"

    Article Title: mirRICH, a simple method to enrich the small RNA fraction from over-dried RNA pellets

    Journal: RNA Biology

    doi: 10.1080/15476286.2018.1451723

    Comparison of next generation sequencing (NGS) and qPCR quantification between mirRICH and mirVana. Redrawing diagram with Excel program shows the composition patterns and ratios of various types of RNAs after next generation sequencing either in mirRICH (A) and mirVana (B) drawn by Rfam v9.1 [ 38 ]. (C) The correlation of expression data of total 2588 known miRNAs obtained from two different small RNA preparation methods, mirRICH or mirVana were analyzed by using mirBase databases after NGS [ 39 ]. (D) The relative expression of miRNA-23a, miR-218 and miR-708 during breast cancer metastasis. Samples were prepared by either mirRICH or mirVana kit and the quantification of each miRNAs were measured by qPCR analysis.
    Figure Legend Snippet: Comparison of next generation sequencing (NGS) and qPCR quantification between mirRICH and mirVana. Redrawing diagram with Excel program shows the composition patterns and ratios of various types of RNAs after next generation sequencing either in mirRICH (A) and mirVana (B) drawn by Rfam v9.1 [ 38 ]. (C) The correlation of expression data of total 2588 known miRNAs obtained from two different small RNA preparation methods, mirRICH or mirVana were analyzed by using mirBase databases after NGS [ 39 ]. (D) The relative expression of miRNA-23a, miR-218 and miR-708 during breast cancer metastasis. Samples were prepared by either mirRICH or mirVana kit and the quantification of each miRNAs were measured by qPCR analysis.

    Techniques Used: Next-Generation Sequencing, Real-time Polymerase Chain Reaction, Expressing

    21) Product Images from "Short hairpin RNA-mediated knockdown of protein expression in Entamoeba histolytica"

    Article Title: Short hairpin RNA-mediated knockdown of protein expression in Entamoeba histolytica

    Journal: BMC Microbiology

    doi: 10.1186/1471-2180-9-38

    Northern blots of small RNAs extracted from Igl and PATMK transfectants . To test if the U6 promoter was driving hairpin expression, shRNA transfectants (PATMK (3552–3580), PATMK (2273–2301), PATMK (3552–3580 scrambled) [ 39 ], Igl (1198–1226), Igl (2412–2440), and Igl (2777–2805) were selected with 30 μg/ml hygromycin for 48 hours before harvesting. HM1:IMSS non-transfected amebae were included as negative controls. Small RNAs were extracted using the mirVana™ miRNA Isolation Kit (Ambion) (Applied Biosystems/Ambion, Austin, TX, USA). Fifty μg small RNA were loaded per lane on a 12% denaturing acrylamide gel and transferred to membrane. rRNA bands were analyzed to ensure equal RNA loading. Oligo probes matching to the sense and antisense strands of the hairpins were end-labeled with 32 P and were hybridized with each corresponding sample blot overnight at 37°C overnight, washed with low and medium stringency conditions, and exposed overnight to film. Note the two product sizes, which may correspond to the unprocessed hairpin (~60–70 nucleotides) (blue arrows) and the processed siRNA products (~30 nucleotides) (red arrows).
    Figure Legend Snippet: Northern blots of small RNAs extracted from Igl and PATMK transfectants . To test if the U6 promoter was driving hairpin expression, shRNA transfectants (PATMK (3552–3580), PATMK (2273–2301), PATMK (3552–3580 scrambled) [ 39 ], Igl (1198–1226), Igl (2412–2440), and Igl (2777–2805) were selected with 30 μg/ml hygromycin for 48 hours before harvesting. HM1:IMSS non-transfected amebae were included as negative controls. Small RNAs were extracted using the mirVana™ miRNA Isolation Kit (Ambion) (Applied Biosystems/Ambion, Austin, TX, USA). Fifty μg small RNA were loaded per lane on a 12% denaturing acrylamide gel and transferred to membrane. rRNA bands were analyzed to ensure equal RNA loading. Oligo probes matching to the sense and antisense strands of the hairpins were end-labeled with 32 P and were hybridized with each corresponding sample blot overnight at 37°C overnight, washed with low and medium stringency conditions, and exposed overnight to film. Note the two product sizes, which may correspond to the unprocessed hairpin (~60–70 nucleotides) (blue arrows) and the processed siRNA products (~30 nucleotides) (red arrows).

    Techniques Used: Northern Blot, Expressing, shRNA, Transfection, Isolation, Acrylamide Gel Assay, Labeling

    22) Product Images from "mirRICH, a simple method to enrich the small RNA fraction from over-dried RNA pellets"

    Article Title: mirRICH, a simple method to enrich the small RNA fraction from over-dried RNA pellets

    Journal: RNA Biology

    doi: 10.1080/15476286.2018.1451723

    ]. (D) The relative expression of miRNA-23a, miR-218 and miR-708 during breast cancer metastasis. Samples were prepared by either mirRICH or mirVana kit and the quantification of each miRNAs were measured by qPCR analysis.
    Figure Legend Snippet: ]. (D) The relative expression of miRNA-23a, miR-218 and miR-708 during breast cancer metastasis. Samples were prepared by either mirRICH or mirVana kit and the quantification of each miRNAs were measured by qPCR analysis.

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction

    23) Product Images from "The c-myb proto-oncogene and microRNA-15a comprise an active autoregulatory feedback loop in human hematopoietic cells"

    Article Title: The c-myb proto-oncogene and microRNA-15a comprise an active autoregulatory feedback loop in human hematopoietic cells

    Journal: Blood

    doi: 10.1182/blood-2008-01-136218

    Expression of miR-15a and c-Myb in human CD34 + cells cultured under conditions favoring erythroid differentiation . Human CD34 + cells were grown in medium supplemented with SCF and Epo. The expression of miR-15a (A) and c-myb (B) was examined on days 1, 2, 3, 4, 6, 8, and 10 using mirVana qRT-PCR miRNA detection method for miR-15a, or general real-time PCR for c-myb . c-Myb protein was measured by western-blotting (C) and quantitation of the c-Myb protein was done by density analysis (D). Representative data from 3 independent experiments are shown.
    Figure Legend Snippet: Expression of miR-15a and c-Myb in human CD34 + cells cultured under conditions favoring erythroid differentiation . Human CD34 + cells were grown in medium supplemented with SCF and Epo. The expression of miR-15a (A) and c-myb (B) was examined on days 1, 2, 3, 4, 6, 8, and 10 using mirVana qRT-PCR miRNA detection method for miR-15a, or general real-time PCR for c-myb . c-Myb protein was measured by western-blotting (C) and quantitation of the c-Myb protein was done by density analysis (D). Representative data from 3 independent experiments are shown.

    Techniques Used: Expressing, Cell Culture, Quantitative RT-PCR, Real-time Polymerase Chain Reaction, Western Blot, Quantitation Assay

    24) Product Images from "Profiling of 95 MicroRNAs in Pancreatic Cancer Cell Lines and Surgical Specimens by Real Time PCR Analysis"

    Article Title: Profiling of 95 MicroRNAs in Pancreatic Cancer Cell Lines and Surgical Specimens by Real Time PCR Analysis

    Journal: World journal of surgery

    doi: 10.1007/s00268-008-9833-0

    The expression pattern of 95 miRNAs in chronic pancreatitis, pancreatic cancer cell lines and surgical specimens. MiRNAs of tissues and cultured cells were extracted and purified using mirVana miRNA Isolation kit and converted to cDNAs with the QuantiMir™
    Figure Legend Snippet: The expression pattern of 95 miRNAs in chronic pancreatitis, pancreatic cancer cell lines and surgical specimens. MiRNAs of tissues and cultured cells were extracted and purified using mirVana miRNA Isolation kit and converted to cDNAs with the QuantiMir™

    Techniques Used: Expressing, Cell Culture, Purification, Isolation

    25) Product Images from "Target-dependent biogenesis of cognate microRNAs in human cells"

    Article Title: Target-dependent biogenesis of cognate microRNAs in human cells

    Journal: Nature Communications

    doi: 10.1038/ncomms12200

    Reversal of amino acid-starvation-induced stress increases miR-122 biogenesis in Huh7 cells. ( a , b ) Outline of the experimental set-up used ( a ). Relative level of CAT-1 mRNA in Huh7 cells either fed or starved for 4 h and re-fed with media containing amino acids for another 2 h. CAT-1 mRNA levels were quantified by quantitative reverse transcriptase-PCR with levels in Fed cells taken as 1 ( b ). ( c ) Effect of starvation and re-feeding on mature miR-122 levels in Huh7 cells. Total RNA was extracted and 8 μg RNA was used for northern blotting of mature miR-122, let-7a and miR-16. U6 snRNA was used as loading control. ( d ) Copy number/number of molecules of mature miR-122 and CAT-1 mRNA per Huh7 cell calculated in fed, starved and re-fed Huh7 cells. Estimations were done by real-time-based methods. ( e ) Increase in mature miR-122 but not that of other non-relevant miRNAs, miR-16, miR-21, miR-24 and miR-125b on relief of starvation. Real-time PCR-based quantification of mature miRNA levels in Huh7 cells starved for amino acids (4 h) and subsequently re-fed (2 h). ( f ) Increase in mature miR-122 is accompanied by a concomitant decrease in pre-miR-122 on re-feeding the starved cells for 2 h. Cellular small RNA population was isolated by mirVANA kit to minimize possible contamination of pri-miR-122 and real-time-based assays were carried out to quantify pre-miR-122. Pre-miR-122 detected by northern blotting with 15 μg total RNA. Synthetic pre-miR-122 was used as a size marker to determine the position of the pre-miR-122 in the northern blotting. ( g ) Increase of mature miR-122 on re-feeding of starved cells is reduced in DICER1 knockdown Huh7 cells. miR-16 and miR-21 did not show any significant change. siDICER1-mediated knockdown of DICER1 is confirmed by western blotting. Paired two-tailed Student's t -tests were used for all comparisons. * P
    Figure Legend Snippet: Reversal of amino acid-starvation-induced stress increases miR-122 biogenesis in Huh7 cells. ( a , b ) Outline of the experimental set-up used ( a ). Relative level of CAT-1 mRNA in Huh7 cells either fed or starved for 4 h and re-fed with media containing amino acids for another 2 h. CAT-1 mRNA levels were quantified by quantitative reverse transcriptase-PCR with levels in Fed cells taken as 1 ( b ). ( c ) Effect of starvation and re-feeding on mature miR-122 levels in Huh7 cells. Total RNA was extracted and 8 μg RNA was used for northern blotting of mature miR-122, let-7a and miR-16. U6 snRNA was used as loading control. ( d ) Copy number/number of molecules of mature miR-122 and CAT-1 mRNA per Huh7 cell calculated in fed, starved and re-fed Huh7 cells. Estimations were done by real-time-based methods. ( e ) Increase in mature miR-122 but not that of other non-relevant miRNAs, miR-16, miR-21, miR-24 and miR-125b on relief of starvation. Real-time PCR-based quantification of mature miRNA levels in Huh7 cells starved for amino acids (4 h) and subsequently re-fed (2 h). ( f ) Increase in mature miR-122 is accompanied by a concomitant decrease in pre-miR-122 on re-feeding the starved cells for 2 h. Cellular small RNA population was isolated by mirVANA kit to minimize possible contamination of pri-miR-122 and real-time-based assays were carried out to quantify pre-miR-122. Pre-miR-122 detected by northern blotting with 15 μg total RNA. Synthetic pre-miR-122 was used as a size marker to determine the position of the pre-miR-122 in the northern blotting. ( g ) Increase of mature miR-122 on re-feeding of starved cells is reduced in DICER1 knockdown Huh7 cells. miR-16 and miR-21 did not show any significant change. siDICER1-mediated knockdown of DICER1 is confirmed by western blotting. Paired two-tailed Student's t -tests were used for all comparisons. * P

    Techniques Used: Polymerase Chain Reaction, Northern Blot, Real-time Polymerase Chain Reaction, Isolation, Marker, Western Blot, Two Tailed Test

    26) Product Images from "The Tumor Suppressor, p53, Negatively Regulates Non-Canonical NF-κB Signaling through miRNA-Induced Silencing of NF-κB–Inducing Kinase"

    Article Title: The Tumor Suppressor, p53, Negatively Regulates Non-Canonical NF-κB Signaling through miRNA-Induced Silencing of NF-κB–Inducing Kinase

    Journal: Molecules and Cells

    doi: 10.14348/molcells.2019.0239

    p53-induced miR-34b negatively regulates the non-canonical NF-κB pathway by targeting the CDS of NIK (A) Heat map for upregulated miRNAs in Z138 treated with 10 μM nutlin-3a for 6 h identified via small RNA sequencing. Total RNA isolated from Z138 cells using the mirVana miRNA isolation kit was used for preparation of small RNA libraries, followed by small RNA sequencing. Genes showing fold change ≥ 1.5 and P
    Figure Legend Snippet: p53-induced miR-34b negatively regulates the non-canonical NF-κB pathway by targeting the CDS of NIK (A) Heat map for upregulated miRNAs in Z138 treated with 10 μM nutlin-3a for 6 h identified via small RNA sequencing. Total RNA isolated from Z138 cells using the mirVana miRNA isolation kit was used for preparation of small RNA libraries, followed by small RNA sequencing. Genes showing fold change ≥ 1.5 and P

    Techniques Used: RNA Sequencing Assay, Isolation

    27) Product Images from "Developmental attenuation of N-methyl-D-aspartate receptor subunit expression by microRNAs"

    Article Title: Developmental attenuation of N-methyl-D-aspartate receptor subunit expression by microRNAs

    Journal: Neural Development

    doi: 10.1186/s13064-015-0047-5

    a . Validation of the Grin2a mRNA 3′UTR as a miR-19a target: relative Grin2a mRNA 3′UTR luciferase levels with 50 nM or 100 nM of miR-19a mimic measured 24 hrs after transfection (Mut., mutant UTR with a 3 bp mutation of the miR-19a target site; Ctrl, values obtained with the mirVana miRNA mimic Control) and relative Grin2a mRNA 3′UTR luciferase levels 24 h after transfection with an anti-miR-19a (concentrations of 50 nM and 100 nM) (Ctrl, transfection with a LNA Inhibitor Control). b . Validation of the Grin2b mRNA 3′UTR as a miR-539 target: relative Grin2b mRNA 3′UTR luciferase levels with 100 nM or 150 nM of miR-539 mimic 24 h after transfection (the concentrations used are higher than those for miR-19a because the Grin2b mRNA 3′UTR possesses two miR-539 target sites) (Mut., mutant UTR with a 3 bp mutation of the miR-539 target site; Ctrl, values obtained with the mirVana miRNA mimic Control) and relative Grin2b mRNA 3′UTR luciferase levels 24 h after transfection with an anti-miR-539 (concentrations of 100 nM and 150 nM) (Ctrl, transfection with a LNA Inhibitor Control). c . miR-19a and miR-539 binding sequences in the 3′UTR of Grin2a and Grin2b respectively, and the corresponding seed matches
    Figure Legend Snippet: a . Validation of the Grin2a mRNA 3′UTR as a miR-19a target: relative Grin2a mRNA 3′UTR luciferase levels with 50 nM or 100 nM of miR-19a mimic measured 24 hrs after transfection (Mut., mutant UTR with a 3 bp mutation of the miR-19a target site; Ctrl, values obtained with the mirVana miRNA mimic Control) and relative Grin2a mRNA 3′UTR luciferase levels 24 h after transfection with an anti-miR-19a (concentrations of 50 nM and 100 nM) (Ctrl, transfection with a LNA Inhibitor Control). b . Validation of the Grin2b mRNA 3′UTR as a miR-539 target: relative Grin2b mRNA 3′UTR luciferase levels with 100 nM or 150 nM of miR-539 mimic 24 h after transfection (the concentrations used are higher than those for miR-19a because the Grin2b mRNA 3′UTR possesses two miR-539 target sites) (Mut., mutant UTR with a 3 bp mutation of the miR-539 target site; Ctrl, values obtained with the mirVana miRNA mimic Control) and relative Grin2b mRNA 3′UTR luciferase levels 24 h after transfection with an anti-miR-539 (concentrations of 100 nM and 150 nM) (Ctrl, transfection with a LNA Inhibitor Control). c . miR-19a and miR-539 binding sequences in the 3′UTR of Grin2a and Grin2b respectively, and the corresponding seed matches

    Techniques Used: Luciferase, Transfection, Mutagenesis, Binding Assay

    28) Product Images from "mirRICH, a simple method to enrich the small RNA fraction from over-dried RNA pellets"

    Article Title: mirRICH, a simple method to enrich the small RNA fraction from over-dried RNA pellets

    Journal: RNA Biology

    doi: 10.1080/15476286.2018.1451723

    ]. (D) The relative expression of miRNA-23a, miR-218 and miR-708 during breast cancer metastasis. Samples were prepared by either mirRICH or mirVana kit and the quantification of each miRNAs were measured by qPCR analysis.
    Figure Legend Snippet: ]. (D) The relative expression of miRNA-23a, miR-218 and miR-708 during breast cancer metastasis. Samples were prepared by either mirRICH or mirVana kit and the quantification of each miRNAs were measured by qPCR analysis.

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction

    29) Product Images from "mirRICH, a simple method to enrich the small RNA fraction from over-dried RNA pellets"

    Article Title: mirRICH, a simple method to enrich the small RNA fraction from over-dried RNA pellets

    Journal: RNA Biology

    doi: 10.1080/15476286.2018.1451723

    ]. (D) The relative expression of miRNA-23a, miR-218 and miR-708 during breast cancer metastasis. Samples were prepared by either mirRICH or mirVana kit and the quantification of each miRNAs were measured by qPCR analysis.
    Figure Legend Snippet: ]. (D) The relative expression of miRNA-23a, miR-218 and miR-708 during breast cancer metastasis. Samples were prepared by either mirRICH or mirVana kit and the quantification of each miRNAs were measured by qPCR analysis.

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction

    Related Articles

    Immunomagnetic Separation:

    Article Title: Role of TGF‐β1/miR‐382‐5p/ SOD2 axis in the induction of oxidative stress in CD34+ cells from primary myelofibrosis
    Article Snippet: .. Briefly, 24 h after immunomagnetic separation, CD34+ cells were electroporated twice, once every 24 h, with 3 μg (0.214 nm ) of mirVana miR‐382‐5p mimic or mirVana miRNA mimic Negative Control (mimic‐Neg; Life Technologies, Carlsbad, CA, USA). .. For each electroporation, 4 × 105 CD34+ cells were resuspended in 100 μL of P3 Primary Cell Solution (Lonza) containing mimic miRNA, and pulsed with the program DS112.

    Nucleic Acid Electrophoresis:

    Article Title: mirRICH, a simple method to enrich the small RNA fraction from over-dried RNA pellets
    Article Snippet: .. Thus, after the isolation of total RNAs, the following approaches can be used: (1) separation of total RNAs by gel electrophoresis and elution of the miRNA fraction from the gel, (2) removal of large RNA molecules by polyethylene glycol to leave behind miRNA, (3) filtration of RNA molecules based on molecular weight, or (4) the use of a commercial kit (e.g., the mirVana miRNA isolation kit, Invitrogen, MA, USA). ..

    Negative Control:

    Article Title: Role of TGF‐β1/miR‐382‐5p/ SOD2 axis in the induction of oxidative stress in CD34+ cells from primary myelofibrosis
    Article Snippet: .. Briefly, 24 h after immunomagnetic separation, CD34+ cells were electroporated twice, once every 24 h, with 3 μg (0.214 nm ) of mirVana miR‐382‐5p mimic or mirVana miRNA mimic Negative Control (mimic‐Neg; Life Technologies, Carlsbad, CA, USA). .. For each electroporation, 4 × 105 CD34+ cells were resuspended in 100 μL of P3 Primary Cell Solution (Lonza) containing mimic miRNA, and pulsed with the program DS112.

    Filtration:

    Article Title: mirRICH, a simple method to enrich the small RNA fraction from over-dried RNA pellets
    Article Snippet: .. Thus, after the isolation of total RNAs, the following approaches can be used: (1) separation of total RNAs by gel electrophoresis and elution of the miRNA fraction from the gel, (2) removal of large RNA molecules by polyethylene glycol to leave behind miRNA, (3) filtration of RNA molecules based on molecular weight, or (4) the use of a commercial kit (e.g., the mirVana miRNA isolation kit, Invitrogen, MA, USA). ..

    Isolation:

    Article Title: mirRICH, a simple method to enrich the small RNA fraction from over-dried RNA pellets
    Article Snippet: .. Thus, after the isolation of total RNAs, the following approaches can be used: (1) separation of total RNAs by gel electrophoresis and elution of the miRNA fraction from the gel, (2) removal of large RNA molecules by polyethylene glycol to leave behind miRNA, (3) filtration of RNA molecules based on molecular weight, or (4) the use of a commercial kit (e.g., the mirVana miRNA isolation kit, Invitrogen, MA, USA). ..

    Article Title: Dietary Immunostimulant CpG Modulates MicroRNA Biomarkers Associated with Immune Responses in Atlantic Salmon (Salmo salar)
    Article Snippet: .. RNA Isolation Total RNAs of all collected head kidney samples were extracted using the mirVana miRNA isolation kit (Ambion/Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s instructions. .. The RNA integrity was verified by 1% agarose gel electrophoresis, and RNA purity was assessed by A260/280 and A260/230 using NanoDrop spectrophotometry (Thermo Fisher, Mississauga, ON, Canada).

    Article Title: MicroRNA-186 targets Yes-associated protein 1 to inhibit Hippo signaling and tumorigenesis in hepatocellular carcinoma
    Article Snippet: .. Total mRNA was extracted with the mirVANA miRNA isolation kit (Ambion Life Technologies, Carlsbad, CA, USA) according to the manufacturer's instructions. .. The expression level of miR-186 was quantified using miRNA-specific TaqMan Pri-miRNA assays (assay ID Hs03303293_pri; Applied Biosystems) and normalized by RNU48 control miRNA assay (P/N 001006; Applied Biosystems).

    Transfection:

    Article Title: Microparticles Mediate the Intercellular Regulation of microRNA-503 and Proline-Rich Tyrosine Kinase 2 to Alter the Migration and Invasion Capacity of Breast Cancer Cells
    Article Snippet: .. Transfection of miR-503 antagomiR and pre-miR We sought to determine the functional consequences of MP-transferred miR-503 on recipient cells. mirVana® miR-503 antagomiR, mirVana® miR-503 pre-miR, and its scrambled control (Life Technologies) were used to study the effect of miR-503 on the migration and invasion capacity of cells. .. MCF-7 and MCF-7/Dx cells were transfected for 24 h with 40 nM miR-503 antagomiR, pre-miR or the scrambled control using Lipofectamine 2000 (Life Technologies) according to the manufacturer’s instructions.

    Quantitative RT-PCR:

    Article Title: MicroRNA-451a overexpression induces accelerated neuronal differentiation of Ntera2/D1 cells and ablation affects neurogenesis in microRNA-451a-/- mice
    Article Snippet: .. Standard curves for absolute quantification of miRNA A standard curve using defined copy numbers of mimics of miR-451a (Ambion mirVana miR-451a mimic, AAACCGUUACCAUUACUGAUU ) was created using qRT-PCR. ..

    Article Title: miR-125b regulates differentiation and metabolic reprogramming of T cell acute lymphoblastic leukemia by directly targeting A20
    Article Snippet: .. For miRNA expression analysis, qRT-PCR was performed using qRT-PCR miRNA Detection Kit and mirVana qRT-PCR Primer Sets (Applied Biosystems) according to the manufacturer's protocols. ..

    Article Title: microRNA-21 Governs TORC1 Activation in Renal Cancer Cell Proliferation and Invasion
    Article Snippet: .. The PCR conditions for amplifying pri-miR-21 were identical to those for pre-miR-21 except annealing was performed at 54°C. mirVana qRT-PCR primer sets for U6 (Ambion) were used for normalization. ..

    Functional Assay:

    Article Title: Microparticles Mediate the Intercellular Regulation of microRNA-503 and Proline-Rich Tyrosine Kinase 2 to Alter the Migration and Invasion Capacity of Breast Cancer Cells
    Article Snippet: .. Transfection of miR-503 antagomiR and pre-miR We sought to determine the functional consequences of MP-transferred miR-503 on recipient cells. mirVana® miR-503 antagomiR, mirVana® miR-503 pre-miR, and its scrambled control (Life Technologies) were used to study the effect of miR-503 on the migration and invasion capacity of cells. .. MCF-7 and MCF-7/Dx cells were transfected for 24 h with 40 nM miR-503 antagomiR, pre-miR or the scrambled control using Lipofectamine 2000 (Life Technologies) according to the manufacturer’s instructions.

    Migration:

    Article Title: Microparticles Mediate the Intercellular Regulation of microRNA-503 and Proline-Rich Tyrosine Kinase 2 to Alter the Migration and Invasion Capacity of Breast Cancer Cells
    Article Snippet: .. Transfection of miR-503 antagomiR and pre-miR We sought to determine the functional consequences of MP-transferred miR-503 on recipient cells. mirVana® miR-503 antagomiR, mirVana® miR-503 pre-miR, and its scrambled control (Life Technologies) were used to study the effect of miR-503 on the migration and invasion capacity of cells. .. MCF-7 and MCF-7/Dx cells were transfected for 24 h with 40 nM miR-503 antagomiR, pre-miR or the scrambled control using Lipofectamine 2000 (Life Technologies) according to the manufacturer’s instructions.

    Expressing:

    Article Title: miR-125b regulates differentiation and metabolic reprogramming of T cell acute lymphoblastic leukemia by directly targeting A20
    Article Snippet: .. For miRNA expression analysis, qRT-PCR was performed using qRT-PCR miRNA Detection Kit and mirVana qRT-PCR Primer Sets (Applied Biosystems) according to the manufacturer's protocols. ..

    Polymerase Chain Reaction:

    Article Title: microRNA-21 Governs TORC1 Activation in Renal Cancer Cell Proliferation and Invasion
    Article Snippet: .. The PCR conditions for amplifying pri-miR-21 were identical to those for pre-miR-21 except annealing was performed at 54°C. mirVana qRT-PCR primer sets for U6 (Ambion) were used for normalization. ..

    Molecular Weight:

    Article Title: mirRICH, a simple method to enrich the small RNA fraction from over-dried RNA pellets
    Article Snippet: .. Thus, after the isolation of total RNAs, the following approaches can be used: (1) separation of total RNAs by gel electrophoresis and elution of the miRNA fraction from the gel, (2) removal of large RNA molecules by polyethylene glycol to leave behind miRNA, (3) filtration of RNA molecules based on molecular weight, or (4) the use of a commercial kit (e.g., the mirVana miRNA isolation kit, Invitrogen, MA, USA). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher mirvana mirna isolation kit
    Mirvana Mirna Isolation Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 588 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mirvana mirna isolation kit/product/Thermo Fisher
    Average 99 stars, based on 588 article reviews
    Price from $9.99 to $1999.99
    mirvana mirna isolation kit - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    Image Search Results