mini plasmid kit  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    QIAGEN Plasmid Mini Kit
    Description:
    For purification of up to 10 mg transfection grade plasmid or cosmid DNA Kit contents Qiagen Plasmid Mini Kit 25 preps 3 to 10mL Culture Volume Transfection grade Plasmid or Cosmid DNA Purification Anion exchange Technology Manual Processing 80 min Time Run 20g Yield 1 Sample Run For Purification of up to 20g Transfection grade Plasmid or Cosmid DNA Ideal for Transfection Cloning Sequencing Capillary Sequencing PCR In vitro Transcription Includes 25 Qiagen to tip 20 Reagents Buffers Benefits Purity equivalent to 2 x CsCl gradient centrifugation High yields of plasmid DNA Cost effective preparations LyseBlue for optimum lysis and maximum DNA yie
    Catalog Number:
    12123
    Price:
    214
    Category:
    QIAGEN Plasmid Kits
    Buy from Supplier


    Structured Review

    Qiagen mini plasmid kit
    QIAGEN Plasmid Mini Kit
    For purification of up to 10 mg transfection grade plasmid or cosmid DNA Kit contents Qiagen Plasmid Mini Kit 25 preps 3 to 10mL Culture Volume Transfection grade Plasmid or Cosmid DNA Purification Anion exchange Technology Manual Processing 80 min Time Run 20g Yield 1 Sample Run For Purification of up to 20g Transfection grade Plasmid or Cosmid DNA Ideal for Transfection Cloning Sequencing Capillary Sequencing PCR In vitro Transcription Includes 25 Qiagen to tip 20 Reagents Buffers Benefits Purity equivalent to 2 x CsCl gradient centrifugation High yields of plasmid DNA Cost effective preparations LyseBlue for optimum lysis and maximum DNA yie
    https://www.bioz.com/result/mini plasmid kit/product/Qiagen
    Average 99 stars, based on 23 article reviews
    Price from $9.99 to $1999.99
    mini plasmid kit - by Bioz Stars, 2020-03
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Probing the human natural autoantibody repertoire using an immunoscreening approach
    Article Snippet: Paragraph title: Characterization of positive clones ... The isolated phagemids were propagated in E. coli XLOLR cells, and phagemid DNA was isolated using the Qiagen mini-plasmid isolation kit following the manufacturer's instructions (Qiagen, Hilden, Germany).

    Article Title: In Vivo CD8+ T-Cell Suppression of SIV Viremia Is Not Mediated by CTL Clearance of Productively Infected CellsCD8+ Lymphocytes Control Viral Replication in SIVmac239-Infected Rhesus Macaques without Decreasing the Lifespan of Productively Infected CellsCD8+ T Cell Control of HIV–A Known Unknown
    Article Snippet: .. Clones were picked and plasmids prepared using the Qiagen Plasmid Mini Kit (Qiagen, Chatsworth CA) according to the manufacturer's protocol. .. Plasmids were sequenced using SIVgag1151F and SIVGag1826R ( CCTGGCACTACTTCTGCTCC ) as sequencing primers for gag and SIV nef5′in and SIV nef3′in for nef .

    Article Title: Targeting the INCENP IN-box–Aurora B interaction to inhibit CPC activity in vivo
    Article Snippet: Library inserts were cloned into pIRES puro2 SICLOPPSWT using BamHI and AflII . .. For transfection, library constructs were prepared using the transfection-grade Plasmid Mini Kit (QIAGEN) following the manufacturer's instructions.

    Article Title: Function of Native OmtA In Vivo and Expression and Distribution of This Protein in Colonies of Aspergillus parasiticus
    Article Snippet: .. The proper construction of pLW12 in clones expressing MBP-OmtA was confirmed by restriction enzyme analysis of purified plasmid DNA isolated by the Qiagen (Valencia, Calif.) miniprep plasmid kit. .. The size of the fusion protein was determined by small-scale expression studies.

    Article Title: BacCapSeq: a Platform for Diagnosis and Characterization of Bacterial Infections
    Article Snippet: Standards for quantitation were generated by cloning a fragment of the targeted gene spanning the primers into pGEM-T Easy vector (Promega, Madison, WI). .. Recombinant plasmid DNA was purified using a Mini Plasmid Prep kit (Qiagen).

    Amplification:

    Article Title: Decreased Amounts of Cell Wall-Associated Protein A and Fibronectin-Binding Proteins in Staphylococcus aureus sarA Mutants due to Up-Regulation of Extracellular Proteases
    Article Snippet: Plasmid DNA was extracted using the Qiagen plasmid mini-kit. .. For construction of strain AK1 ( aur allelic replacement mutant) two PCR fragments, of 1,064 and 953 bp, encompassing the first 197 and the last 61 codons of the 508-codon aureolysin gene were amplified using forward primers with added Pst I and Eco RI restriction sites and a reverse primer with added Spe I and Nco I restriction sites.

    Article Title: The ROP2 GTPase Controls the Formation of Cortical Fine F-Actin and the Early Phase of Directional Cell Expansion during Arabidopsis Organogenesis
    Article Snippet: .. For particle bombardment, all plasmids were amplified in Escherichia coli strain Top 10 and purified using plasmid midi or mini kits according to the manufacturer's instructions (Qiagen, Valencia, CA). .. Expanding rosette leaves of 0.8 to 1.2 cm in length were collected from 3- to 6-week-old plants and were bombarded with gold particles coated with plasmids using a Bio-Rad PDS-1000/He particle delivery system.

    Article Title: Targeting the INCENP IN-box–Aurora B interaction to inhibit CPC activity in vivo
    Article Snippet: Inserts were amplified using the Expand High Fidelity PCR System (Roche) from a NcoI -digested pIRES puro2 SICLOPPSWT template using a universal forward primer (5′-CCGAATTCGGATCCATGGTTAAAGTAATCGGC-3′) annealing to the MCS and a reverse primer (5′-GCCCGTATTCAACTGTAAGTATTTCAGTGCCAAAACTTAAGCA[variable]GCAATTATGGGCAATAGCC-3′) encoding the library insert, which spans the junction between the two intein halves and a AflII site present within the distal intein half. .. For transfection, library constructs were prepared using the transfection-grade Plasmid Mini Kit (QIAGEN) following the manufacturer's instructions.

    Article Title: Function of Native OmtA In Vivo and Expression and Distribution of This Protein in Colonies of Aspergillus parasiticus
    Article Snippet: One primer for omtA amplification contained a Hin dIII (AAGCTT) restriction site (underlined), and the other primer contained an Xba I (TCTAGA) restriction site (underlined) to facilitate cloning (5′-CCC TCTAGA ATGGCACTACCGAGCAAAG-3′ and 5′-TGC AAGCTT CTACTTGCGCAAACGCAGT-3′). .. The proper construction of pLW12 in clones expressing MBP-OmtA was confirmed by restriction enzyme analysis of purified plasmid DNA isolated by the Qiagen (Valencia, Calif.) miniprep plasmid kit.

    Article Title: Hepatitis B virus core protein dimer-dimer interface is critical for viral replication
    Article Snippet: The amplification program consisted of an initial denaturing step at 94°C for 10 min, followed by 45 cycles of 95°C for 10 sec, 55°C for 20 sec and 72°C for 20 sec. .. The pHBV1.2 plasmid, which contained 1.2 copies of the HBV genome, was extracted using the QIAGEN Plasmid Mini kit (Qiagen GmbH), according to the manufacturer's instructions.

    Article Title: Formin-like 3 regulates RhoC/FAK pathway and actin assembly to promote cell invasion in colorectal carcinoma
    Article Snippet: To obtain an active mutant construct of RhoC-V14, the wild-type coding region of RhoC was amplified by polymerase chain reaction (PCR) and inserted into the expression plasmid pGEX-4T-1. .. DNA was purified with a Mini plasmid Purification Kit (Qiagen, Japan) and digested with suitable restriction enzymes.

    Article Title: Severe Sepsis Facilitates Intestinal Colonization by Extended-Spectrum-β-Lactamase-Producing Klebsiella pneumoniae and Transfer of the SHV-18 Resistance Gene to Escherichia coli during Antimicrobial Treatment
    Article Snippet: .. Plasmids were extracted from purified and amplified colonies of E. coli and K. pneumoniae with the Qiagen Plasmid Mini Kit (Qiagen, Germany) following the instructions of the manufacturer. .. PCR was used to determine if bla SHV-18 was present.

    Synthesized:

    Article Title: Inhibition and conformational change of SERCA3b induced by Bcl-2
    Article Snippet: Mutant DNA strands were synthesized using the QuickChange multi site-directed mutagenesis kit according to the protocol provided with the kit. .. Mutant plasmid DNA was isolated from a few colonies using the QIAGEN Plasmid mini kit according to the manufacturer’s protocol and the isolated DNA samples were submitted for sequencing (Northwoods DNA, Inc., Solway, MN).

    Article Title: Tol2-mediated transgenesis in tilapia (Oreochromis niloticus)
    Article Snippet: The plasmid was electroporated into E. coli strain DH10B (Invitrogen, Carlsbad CA, USA), cultured, and prepared using the Qiagen Plasmid mini kit (Qiagen, Duesseldorf, Germany). .. The transposase mRNA was synthesized using pCS-TP and mMessage mMachine Sp6 Kit (Ambion, Austin TX, USA) following .

    TA Cloning:

    Article Title: In Vivo CD8+ T-Cell Suppression of SIV Viremia Is Not Mediated by CTL Clearance of Productively Infected CellsCD8+ Lymphocytes Control Viral Replication in SIVmac239-Infected Rhesus Macaques without Decreasing the Lifespan of Productively Infected CellsCD8+ T Cell Control of HIV–A Known Unknown
    Article Snippet: Products were proportionately pooled then cloned using the TOPO TA cloning kit. .. Clones were picked and plasmids prepared using the Qiagen Plasmid Mini Kit (Qiagen, Chatsworth CA) according to the manufacturer's protocol.

    Construct:

    Article Title: Decreased Amounts of Cell Wall-Associated Protein A and Fibronectin-Binding Proteins in Staphylococcus aureus sarA Mutants due to Up-Regulation of Extracellular Proteases
    Article Snippet: The plasmids were constructed in Escherichia coli DH5α, and molecular biology techniques and recombinant DNA manipulations were done as previously described ( ). .. Plasmid DNA was extracted using the Qiagen plasmid mini-kit.

    Article Title: The ROP2 GTPase Controls the Formation of Cortical Fine F-Actin and the Early Phase of Directional Cell Expansion during Arabidopsis Organogenesis
    Article Snippet: For particle bombardment, all plasmids were amplified in Escherichia coli strain Top 10 and purified using plasmid midi or mini kits according to the manufacturer's instructions (Qiagen, Valencia, CA). .. In all experiments, 0.8 μg of pBI221:GFP-mTalin, 0.5 μg of pBI221:CA-rop2 or pBI221:DN-rop2, and 1.0 μg of pBI221:PFN1 constructs were used.

    Article Title: Targeting the INCENP IN-box–Aurora B interaction to inhibit CPC activity in vivo
    Article Snippet: .. For transfection, library constructs were prepared using the transfection-grade Plasmid Mini Kit (QIAGEN) following the manufacturer's instructions. .. Protein-splicing deficient SICLOPPSAA mutants of selected library constructs were generated by digestion with BamHI and AflII and insertion of the resulting fragment into pIRES puro2 SICLOPPSAA , which also lacks the MCS AflII site.

    Article Title: Function of Native OmtA In Vivo and Expression and Distribution of This Protein in Colonies of Aspergillus parasiticus
    Article Snippet: The resulting plasmid construct, pLW12, was transformed into E. coli DH5α. .. The proper construction of pLW12 in clones expressing MBP-OmtA was confirmed by restriction enzyme analysis of purified plasmid DNA isolated by the Qiagen (Valencia, Calif.) miniprep plasmid kit.

    Article Title: Formin-like 3 regulates RhoC/FAK pathway and actin assembly to promote cell invasion in colorectal carcinoma
    Article Snippet: The mutant construct was then generated with the KOD-Plus-Mutagenesis Kit (TOYOBO, Japan). .. DNA was purified with a Mini plasmid Purification Kit (Qiagen, Japan) and digested with suitable restriction enzymes.

    Real-time Polymerase Chain Reaction:

    Article Title: Hepatitis B virus core protein dimer-dimer interface is critical for viral replication
    Article Snippet: The pHBV1.2 plasmid, which contained 1.2 copies of the HBV genome, was extracted using the QIAGEN Plasmid Mini kit (Qiagen GmbH), according to the manufacturer's instructions. .. Ten-fold serial dilutions of pHBV1.2 plasmid stock (109 −102 copies/ml) were used to establish qPCR standard curves for detecting HBV cccDNA and HBV total DNA.

    Article Title: BacCapSeq: a Platform for Diagnosis and Characterization of Bacterial Infections
    Article Snippet: Paragraph title: Agent-specific quantitative TaqMan real-time PCR and standards. ... Recombinant plasmid DNA was purified using a Mini Plasmid Prep kit (Qiagen).

    Incubation:

    Article Title: Large-scale identification of serotype 4 Streptococcus pneumoniae virulence factors
    Article Snippet: Plasmid DNA was purified from E. coli strains harbouring each of the 93 uniquely tagged magellan2 elements using Qiagen mini plasmid preparation kit according to the manufacturer's instructions (Qiagen). .. Cells were washed in sterile dH2 0, resuspended in 200 µl of lysis buffer (0.1% deoxycholate, 0.01% SDS, 0.15 M NaCl) and incubated at 37°C for 10 min. Next, 0.9 ml of SSC was added and samples were incubated an additional 10 min at 65°C.

    Article Title: Inhibition and conformational change of SERCA3b induced by Bcl-2
    Article Snippet: The polymerase chain reaction (PCR) was carried out using a thermal cycler (MJ Mini personal thermal cycler, Bio-Rad Laboratories, Hercules, CA) according to the following program: one cycle of incubation at 95°C for 1 min followed by 30 cycles of incubation at 95°C for 1 min, 55°C for 1 min and 65°C for 10 min. .. Mutant plasmid DNA was isolated from a few colonies using the QIAGEN Plasmid mini kit according to the manufacturer’s protocol and the isolated DNA samples were submitted for sequencing (Northwoods DNA, Inc., Solway, MN).

    Article Title: Function of Native OmtA In Vivo and Expression and Distribution of This Protein in Colonies of Aspergillus parasiticus
    Article Snippet: The proper construction of pLW12 in clones expressing MBP-OmtA was confirmed by restriction enzyme analysis of purified plasmid DNA isolated by the Qiagen (Valencia, Calif.) miniprep plasmid kit. .. E coli DH5α carrying pLW12 was incubated in 5 ml of Luria-Bertani broth containing ampicillin (100 μg per ml) for 16 h. One milliliter of bacterial culture was saved as noninduced control.

    Cell Culture:

    Article Title: Tol2-mediated transgenesis in tilapia (Oreochromis niloticus)
    Article Snippet: .. The plasmid was electroporated into E. coli strain DH10B (Invitrogen, Carlsbad CA, USA), cultured, and prepared using the Qiagen Plasmid mini kit (Qiagen, Duesseldorf, Germany). .. The plasmid solution was further purified using the QIAquick PCR purification kit (Qiagen), and diluted to a stock concentration of 125 ng/μl.

    Expressing:

    Article Title: The ROP2 GTPase Controls the Formation of Cortical Fine F-Actin and the Early Phase of Directional Cell Expansion during Arabidopsis Organogenesis
    Article Snippet: Paragraph title: Particle Bombardment–Mediated Transient Expression in Arabidopsis Leaves ... For particle bombardment, all plasmids were amplified in Escherichia coli strain Top 10 and purified using plasmid midi or mini kits according to the manufacturer's instructions (Qiagen, Valencia, CA).

    Article Title: Function of Native OmtA In Vivo and Expression and Distribution of This Protein in Colonies of Aspergillus parasiticus
    Article Snippet: .. The proper construction of pLW12 in clones expressing MBP-OmtA was confirmed by restriction enzyme analysis of purified plasmid DNA isolated by the Qiagen (Valencia, Calif.) miniprep plasmid kit. .. The size of the fusion protein was determined by small-scale expression studies.

    Article Title: Tol2-mediated transgenesis in tilapia (Oreochromis niloticus)
    Article Snippet: The plasmid contains minimal elements for Tol2 transposition as well as the green fluorescent protein (GFP) expression cassette, namely the Xenopus elongation factor 1α (EF1α) enhancer-promoter, the rabbit β-globin intron, the enhanced GFP gene, and the SV40 poly(A) signal. .. The plasmid was electroporated into E. coli strain DH10B (Invitrogen, Carlsbad CA, USA), cultured, and prepared using the Qiagen Plasmid mini kit (Qiagen, Duesseldorf, Germany).

    Article Title: Formin-like 3 regulates RhoC/FAK pathway and actin assembly to promote cell invasion in colorectal carcinoma
    Article Snippet: To obtain an active mutant construct of RhoC-V14, the wild-type coding region of RhoC was amplified by polymerase chain reaction (PCR) and inserted into the expression plasmid pGEX-4T-1. .. DNA was purified with a Mini plasmid Purification Kit (Qiagen, Japan) and digested with suitable restriction enzymes.

    Modification:

    Article Title: Targeting the INCENP IN-box–Aurora B interaction to inhibit CPC activity in vivo
    Article Snippet: SICLOPPS IN-box library The INCENP IN-box library was created in a modified version of pIRES puro2 vector from which the multiple cloning site (MCS) AflII site was removed by site-directed mutagenesis (oligos: 5′-CCGGTTAACAGGCCTATAGCGCTAGCTAGGCCGC-3′ and 5′-GCGGCCTAGCTAGCGCTATAGGCCTGTTAACCGG-3′). .. For transfection, library constructs were prepared using the transfection-grade Plasmid Mini Kit (QIAGEN) following the manufacturer's instructions.

    Transformation Assay:

    Article Title: Large-scale identification of serotype 4 Streptococcus pneumoniae virulence factors
    Article Snippet: Paragraph title: In vitro transposon mutagenesis, DNA transformation, and pool construction ... Plasmid DNA was purified from E. coli strains harbouring each of the 93 uniquely tagged magellan2 elements using Qiagen mini plasmid preparation kit according to the manufacturer's instructions (Qiagen).

    Article Title: Inhibition and conformational change of SERCA3b induced by Bcl-2
    Article Snippet: Paragraph title: 2.2. G145E-Bcl-2 mutant construction, transformation, DNA isolation, and sequencing ... Mutant plasmid DNA was isolated from a few colonies using the QIAGEN Plasmid mini kit according to the manufacturer’s protocol and the isolated DNA samples were submitted for sequencing (Northwoods DNA, Inc., Solway, MN).

    Article Title: Function of Native OmtA In Vivo and Expression and Distribution of This Protein in Colonies of Aspergillus parasiticus
    Article Snippet: The resulting plasmid construct, pLW12, was transformed into E. coli DH5α. .. The proper construction of pLW12 in clones expressing MBP-OmtA was confirmed by restriction enzyme analysis of purified plasmid DNA isolated by the Qiagen (Valencia, Calif.) miniprep plasmid kit.

    High Performance Liquid Chromatography:

    Article Title: Targeting the INCENP IN-box–Aurora B interaction to inhibit CPC activity in vivo
    Article Snippet: HPLC-purified oligos encoding each of the library members were purchased from Sigma-Aldrich (St Louis, MO, USA) and used to generate individual library inserts using the polymerase chain reaction (PCR) protocol described previously, but with the omission of the zipper step [ ]. .. For transfection, library constructs were prepared using the transfection-grade Plasmid Mini Kit (QIAGEN) following the manufacturer's instructions.

    Transfection:

    Article Title: Targeting the INCENP IN-box–Aurora B interaction to inhibit CPC activity in vivo
    Article Snippet: .. For transfection, library constructs were prepared using the transfection-grade Plasmid Mini Kit (QIAGEN) following the manufacturer's instructions. .. Protein-splicing deficient SICLOPPSAA mutants of selected library constructs were generated by digestion with BamHI and AflII and insertion of the resulting fragment into pIRES puro2 SICLOPPSAA , which also lacks the MCS AflII site.

    Article Title: Formin-like 3 regulates RhoC/FAK pathway and actin assembly to promote cell invasion in colorectal carcinoma
    Article Snippet: Paragraph title: Construction of plasmids and transfection ... DNA was purified with a Mini plasmid Purification Kit (Qiagen, Japan) and digested with suitable restriction enzymes.

    Introduce:

    Article Title: Trp-107 and Trp-253 Account for the Increased Steady State Fluorescence That Accompanies the Conformational Change in Human Pancreatic Triglyceride Lipase Induced by Tetrahydrolipstatin and Bile Salt *
    Article Snippet: Oligonucleotide primers were designed to introduce the desired mutations and were generally 27 bp long. .. Minipreps were performed using either the Qiagen plasmid mini kit or the Qiagen QIAprep miniprep kit.

    Generated:

    Article Title: Targeting the INCENP IN-box–Aurora B interaction to inhibit CPC activity in vivo
    Article Snippet: For transfection, library constructs were prepared using the transfection-grade Plasmid Mini Kit (QIAGEN) following the manufacturer's instructions. .. Protein-splicing deficient SICLOPPSAA mutants of selected library constructs were generated by digestion with BamHI and AflII and insertion of the resulting fragment into pIRES puro2 SICLOPPSAA , which also lacks the MCS AflII site.

    Article Title: Formin-like 3 regulates RhoC/FAK pathway and actin assembly to promote cell invasion in colorectal carcinoma
    Article Snippet: The mutant construct was then generated with the KOD-Plus-Mutagenesis Kit (TOYOBO, Japan). .. DNA was purified with a Mini plasmid Purification Kit (Qiagen, Japan) and digested with suitable restriction enzymes.

    Article Title: BacCapSeq: a Platform for Diagnosis and Characterization of Bacterial Infections
    Article Snippet: Standards for quantitation were generated by cloning a fragment of the targeted gene spanning the primers into pGEM-T Easy vector (Promega, Madison, WI). .. Recombinant plasmid DNA was purified using a Mini Plasmid Prep kit (Qiagen).

    Sequencing:

    Article Title: In Vivo CD8+ T-Cell Suppression of SIV Viremia Is Not Mediated by CTL Clearance of Productively Infected CellsCD8+ Lymphocytes Control Viral Replication in SIVmac239-Infected Rhesus Macaques without Decreasing the Lifespan of Productively Infected CellsCD8+ T Cell Control of HIV–A Known Unknown
    Article Snippet: Paragraph title: Sequencing and sequence analysis of partial gag and nef ... Clones were picked and plasmids prepared using the Qiagen Plasmid Mini Kit (Qiagen, Chatsworth CA) according to the manufacturer's protocol.

    Article Title: Trp-107 and Trp-253 Account for the Increased Steady State Fluorescence That Accompanies the Conformational Change in Human Pancreatic Triglyceride Lipase Induced by Tetrahydrolipstatin and Bile Salt *
    Article Snippet: Minipreps were performed using either the Qiagen plasmid mini kit or the Qiagen QIAprep miniprep kit. .. The presence of the desired mutation was confirmed by dideoxynucleotide sequence analysis of the complete cDNA using the ABI PRISM Big Dye terminator cycle sequencing ready reaction kit.

    Article Title: Inhibition and conformational change of SERCA3b induced by Bcl-2
    Article Snippet: .. Mutant plasmid DNA was isolated from a few colonies using the QIAGEN Plasmid mini kit according to the manufacturer’s protocol and the isolated DNA samples were submitted for sequencing (Northwoods DNA, Inc., Solway, MN). .. HEK-293 cells, which were stably transfected with a human SERCA3b-encoding vector were a kind gift of Dr. Jocelyne Enouf (INSERM, Villejuif, France).

    Recombinant:

    Article Title: Decreased Amounts of Cell Wall-Associated Protein A and Fibronectin-Binding Proteins in Staphylococcus aureus sarA Mutants due to Up-Regulation of Extracellular Proteases
    Article Snippet: The plasmids were constructed in Escherichia coli DH5α, and molecular biology techniques and recombinant DNA manipulations were done as previously described ( ). .. Plasmid DNA was extracted using the Qiagen plasmid mini-kit.

    Article Title: BacCapSeq: a Platform for Diagnosis and Characterization of Bacterial Infections
    Article Snippet: .. Recombinant plasmid DNA was purified using a Mini Plasmid Prep kit (Qiagen). .. The linearized plasmid DNA concentration was determined using NanoDrop One, and copy numbers were adjusted by dilution in Tris-HCl (pH 8) with 1 ng/ml salmon sperm DNA.

    Molecular Weight:

    Article Title: Probing the human natural autoantibody repertoire using an immunoscreening approach
    Article Snippet: The isolated phagemids were propagated in E. coli XLOLR cells, and phagemid DNA was isolated using the Qiagen mini-plasmid isolation kit following the manufacturer's instructions (Qiagen, Hilden, Germany). .. Standard TAE agarose gel electrophoresis was used to size fractionate the DNA restriction fragments and appropriate standard DNA molecular weight markers (Roche Diagnostics).

    Article Title: Hepatitis B virus core protein dimer-dimer interface is critical for viral replication
    Article Snippet: The pHBV1.2 plasmid, which contained 1.2 copies of the HBV genome, was extracted using the QIAGEN Plasmid Mini kit (Qiagen GmbH), according to the manufacturer's instructions. .. The copy number of the plasmid was calculated using the following formula: Copies/ml = C/M xA (where C is the plasmid concentration, M is the molecular weight and A is the Avogadro constant).

    DNA Extraction:

    Article Title: Inhibition and conformational change of SERCA3b induced by Bcl-2
    Article Snippet: Paragraph title: 2.2. G145E-Bcl-2 mutant construction, transformation, DNA isolation, and sequencing ... Mutant plasmid DNA was isolated from a few colonies using the QIAGEN Plasmid mini kit according to the manufacturer’s protocol and the isolated DNA samples were submitted for sequencing (Northwoods DNA, Inc., Solway, MN).

    In Vivo:

    Article Title: Probing the human natural autoantibody repertoire using an immunoscreening approach
    Article Snippet: Serum-positive phage clones were isolated, and the pBK-CMV phagemids were excised in vivo using the ExAssist Interference-Resistant Helper Phage following the manufacturer's instructions (Stratagene). .. The isolated phagemids were propagated in E. coli XLOLR cells, and phagemid DNA was isolated using the Qiagen mini-plasmid isolation kit following the manufacturer's instructions (Qiagen, Hilden, Germany).

    Mutagenesis:

    Article Title: Decreased Amounts of Cell Wall-Associated Protein A and Fibronectin-Binding Proteins in Staphylococcus aureus sarA Mutants due to Up-Regulation of Extracellular Proteases
    Article Snippet: Plasmid DNA was extracted using the Qiagen plasmid mini-kit. .. For construction of strain AK1 ( aur allelic replacement mutant) two PCR fragments, of 1,064 and 953 bp, encompassing the first 197 and the last 61 codons of the 508-codon aureolysin gene were amplified using forward primers with added Pst I and Eco RI restriction sites and a reverse primer with added Spe I and Nco I restriction sites.

    Article Title: Large-scale identification of serotype 4 Streptococcus pneumoniae virulence factors
    Article Snippet: Paragraph title: In vitro transposon mutagenesis, DNA transformation, and pool construction ... Plasmid DNA was purified from E. coli strains harbouring each of the 93 uniquely tagged magellan2 elements using Qiagen mini plasmid preparation kit according to the manufacturer's instructions (Qiagen).

    Article Title: Trp-107 and Trp-253 Account for the Increased Steady State Fluorescence That Accompanies the Conformational Change in Human Pancreatic Triglyceride Lipase Induced by Tetrahydrolipstatin and Bile Salt *
    Article Snippet: Mutations were introduced into the wild type PTL cDNA in the pHILS1 vector by polymerase chain reaction using the Stratagene QuikChange site-directed mutagenesis kit as per the manufacturer's protocol ( ). .. Minipreps were performed using either the Qiagen plasmid mini kit or the Qiagen QIAprep miniprep kit.

    Article Title: Inhibition and conformational change of SERCA3b induced by Bcl-2
    Article Snippet: .. Mutant plasmid DNA was isolated from a few colonies using the QIAGEN Plasmid mini kit according to the manufacturer’s protocol and the isolated DNA samples were submitted for sequencing (Northwoods DNA, Inc., Solway, MN). .. HEK-293 cells, which were stably transfected with a human SERCA3b-encoding vector were a kind gift of Dr. Jocelyne Enouf (INSERM, Villejuif, France).

    Article Title: Targeting the INCENP IN-box–Aurora B interaction to inhibit CPC activity in vivo
    Article Snippet: SICLOPPS IN-box library The INCENP IN-box library was created in a modified version of pIRES puro2 vector from which the multiple cloning site (MCS) AflII site was removed by site-directed mutagenesis (oligos: 5′-CCGGTTAACAGGCCTATAGCGCTAGCTAGGCCGC-3′ and 5′-GCGGCCTAGCTAGCGCTATAGGCCTGTTAACCGG-3′). .. For transfection, library constructs were prepared using the transfection-grade Plasmid Mini Kit (QIAGEN) following the manufacturer's instructions.

    Article Title: Formin-like 3 regulates RhoC/FAK pathway and actin assembly to promote cell invasion in colorectal carcinoma
    Article Snippet: The mutant construct was then generated with the KOD-Plus-Mutagenesis Kit (TOYOBO, Japan). .. DNA was purified with a Mini plasmid Purification Kit (Qiagen, Japan) and digested with suitable restriction enzymes.

    Isolation:

    Article Title: Large-scale identification of serotype 4 Streptococcus pneumoniae virulence factors
    Article Snippet: Plasmid DNA was purified from E. coli strains harbouring each of the 93 uniquely tagged magellan2 elements using Qiagen mini plasmid preparation kit according to the manufacturer's instructions (Qiagen). .. Streptococcus pneumoniae genomic DNA was isolated from AC353 as follows: AC353 was grown in 40 ml of THY (Todd Hewitt broth, 0.5% yeast extract) supplemented with Sm and 5 µl ml−1 Oxyrase (Oxyrase) statically in a candle extinction jar.

    Article Title: Probing the human natural autoantibody repertoire using an immunoscreening approach
    Article Snippet: .. The isolated phagemids were propagated in E. coli XLOLR cells, and phagemid DNA was isolated using the Qiagen mini-plasmid isolation kit following the manufacturer's instructions (Qiagen, Hilden, Germany). .. The length of the DNA insert cloned into the pBK-CMV phagemids was determined by performing a double Eco RI and Xho I restriction endonuclease digestion following the manufacturer's instructions (Roche Diagnostics, Mannheim, Germany).

    Article Title: Inhibition and conformational change of SERCA3b induced by Bcl-2
    Article Snippet: .. Mutant plasmid DNA was isolated from a few colonies using the QIAGEN Plasmid mini kit according to the manufacturer’s protocol and the isolated DNA samples were submitted for sequencing (Northwoods DNA, Inc., Solway, MN). .. HEK-293 cells, which were stably transfected with a human SERCA3b-encoding vector were a kind gift of Dr. Jocelyne Enouf (INSERM, Villejuif, France).

    Article Title: Function of Native OmtA In Vivo and Expression and Distribution of This Protein in Colonies of Aspergillus parasiticus
    Article Snippet: .. The proper construction of pLW12 in clones expressing MBP-OmtA was confirmed by restriction enzyme analysis of purified plasmid DNA isolated by the Qiagen (Valencia, Calif.) miniprep plasmid kit. .. The size of the fusion protein was determined by small-scale expression studies.

    Size-exclusion Chromatography:

    Article Title: Hepatitis B virus core protein dimer-dimer interface is critical for viral replication
    Article Snippet: The amplification program consisted of an initial denaturing step at 94°C for 10 min, followed by 45 cycles of 95°C for 10 sec, 55°C for 20 sec and 72°C for 20 sec. .. The pHBV1.2 plasmid, which contained 1.2 copies of the HBV genome, was extracted using the QIAGEN Plasmid Mini kit (Qiagen GmbH), according to the manufacturer's instructions.

    Purification:

    Article Title: Large-scale identification of serotype 4 Streptococcus pneumoniae virulence factors
    Article Snippet: .. Plasmid DNA was purified from E. coli strains harbouring each of the 93 uniquely tagged magellan2 elements using Qiagen mini plasmid preparation kit according to the manufacturer's instructions (Qiagen). .. Streptococcus pneumoniae genomic DNA was isolated from AC353 as follows: AC353 was grown in 40 ml of THY (Todd Hewitt broth, 0.5% yeast extract) supplemented with Sm and 5 µl ml−1 Oxyrase (Oxyrase) statically in a candle extinction jar.

    Article Title: The ROP2 GTPase Controls the Formation of Cortical Fine F-Actin and the Early Phase of Directional Cell Expansion during Arabidopsis Organogenesis
    Article Snippet: .. For particle bombardment, all plasmids were amplified in Escherichia coli strain Top 10 and purified using plasmid midi or mini kits according to the manufacturer's instructions (Qiagen, Valencia, CA). .. Expanding rosette leaves of 0.8 to 1.2 cm in length were collected from 3- to 6-week-old plants and were bombarded with gold particles coated with plasmids using a Bio-Rad PDS-1000/He particle delivery system.

    Article Title: In Vivo CD8+ T-Cell Suppression of SIV Viremia Is Not Mediated by CTL Clearance of Productively Infected CellsCD8+ Lymphocytes Control Viral Replication in SIVmac239-Infected Rhesus Macaques without Decreasing the Lifespan of Productively Infected CellsCD8+ T Cell Control of HIV–A Known Unknown
    Article Snippet: The gag PCR product was gel purified using Qiagen QIAex Gel Extraction Kit prior to being used for cloning. .. Clones were picked and plasmids prepared using the Qiagen Plasmid Mini Kit (Qiagen, Chatsworth CA) according to the manufacturer's protocol.

    Article Title: Function of Native OmtA In Vivo and Expression and Distribution of This Protein in Colonies of Aspergillus parasiticus
    Article Snippet: .. The proper construction of pLW12 in clones expressing MBP-OmtA was confirmed by restriction enzyme analysis of purified plasmid DNA isolated by the Qiagen (Valencia, Calif.) miniprep plasmid kit. .. The size of the fusion protein was determined by small-scale expression studies.

    Article Title: Tol2-mediated transgenesis in tilapia (Oreochromis niloticus)
    Article Snippet: The plasmid was electroporated into E. coli strain DH10B (Invitrogen, Carlsbad CA, USA), cultured, and prepared using the Qiagen Plasmid mini kit (Qiagen, Duesseldorf, Germany). .. The plasmid solution was further purified using the QIAquick PCR purification kit (Qiagen), and diluted to a stock concentration of 125 ng/μl.

    Article Title: Formin-like 3 regulates RhoC/FAK pathway and actin assembly to promote cell invasion in colorectal carcinoma
    Article Snippet: .. DNA was purified with a Mini plasmid Purification Kit (Qiagen, Japan) and digested with suitable restriction enzymes. ..

    Article Title: Severe Sepsis Facilitates Intestinal Colonization by Extended-Spectrum-β-Lactamase-Producing Klebsiella pneumoniae and Transfer of the SHV-18 Resistance Gene to Escherichia coli during Antimicrobial Treatment
    Article Snippet: .. Plasmids were extracted from purified and amplified colonies of E. coli and K. pneumoniae with the Qiagen Plasmid Mini Kit (Qiagen, Germany) following the instructions of the manufacturer. .. PCR was used to determine if bla SHV-18 was present.

    Article Title: BacCapSeq: a Platform for Diagnosis and Characterization of Bacterial Infections
    Article Snippet: .. Recombinant plasmid DNA was purified using a Mini Plasmid Prep kit (Qiagen). .. The linearized plasmid DNA concentration was determined using NanoDrop One, and copy numbers were adjusted by dilution in Tris-HCl (pH 8) with 1 ng/ml salmon sperm DNA.

    Polymerase Chain Reaction:

    Article Title: Decreased Amounts of Cell Wall-Associated Protein A and Fibronectin-Binding Proteins in Staphylococcus aureus sarA Mutants due to Up-Regulation of Extracellular Proteases
    Article Snippet: Plasmid DNA was extracted using the Qiagen plasmid mini-kit. .. For construction of strain AK1 ( aur allelic replacement mutant) two PCR fragments, of 1,064 and 953 bp, encompassing the first 197 and the last 61 codons of the 508-codon aureolysin gene were amplified using forward primers with added Pst I and Eco RI restriction sites and a reverse primer with added Spe I and Nco I restriction sites.

    Article Title: In Vivo CD8+ T-Cell Suppression of SIV Viremia Is Not Mediated by CTL Clearance of Productively Infected CellsCD8+ Lymphocytes Control Viral Replication in SIVmac239-Infected Rhesus Macaques without Decreasing the Lifespan of Productively Infected CellsCD8+ T Cell Control of HIV–A Known Unknown
    Article Snippet: The gag PCR product was gel purified using Qiagen QIAex Gel Extraction Kit prior to being used for cloning. .. Clones were picked and plasmids prepared using the Qiagen Plasmid Mini Kit (Qiagen, Chatsworth CA) according to the manufacturer's protocol.

    Article Title: Trp-107 and Trp-253 Account for the Increased Steady State Fluorescence That Accompanies the Conformational Change in Human Pancreatic Triglyceride Lipase Induced by Tetrahydrolipstatin and Bile Salt *
    Article Snippet: Mutations were introduced into the wild type PTL cDNA in the pHILS1 vector by polymerase chain reaction using the Stratagene QuikChange site-directed mutagenesis kit as per the manufacturer's protocol ( ). .. Minipreps were performed using either the Qiagen plasmid mini kit or the Qiagen QIAprep miniprep kit.

    Article Title: Inhibition and conformational change of SERCA3b induced by Bcl-2
    Article Snippet: The transformations of PCR products were done using XL10-Gold ultracompetent cells according to the manufacturer’s protocol. .. Mutant plasmid DNA was isolated from a few colonies using the QIAGEN Plasmid mini kit according to the manufacturer’s protocol and the isolated DNA samples were submitted for sequencing (Northwoods DNA, Inc., Solway, MN).

    Article Title: Targeting the INCENP IN-box–Aurora B interaction to inhibit CPC activity in vivo
    Article Snippet: Inserts were amplified using the Expand High Fidelity PCR System (Roche) from a NcoI -digested pIRES puro2 SICLOPPSWT template using a universal forward primer (5′-CCGAATTCGGATCCATGGTTAAAGTAATCGGC-3′) annealing to the MCS and a reverse primer (5′-GCCCGTATTCAACTGTAAGTATTTCAGTGCCAAAACTTAAGCA[variable]GCAATTATGGGCAATAGCC-3′) encoding the library insert, which spans the junction between the two intein halves and a AflII site present within the distal intein half. .. For transfection, library constructs were prepared using the transfection-grade Plasmid Mini Kit (QIAGEN) following the manufacturer's instructions.

    Article Title: Function of Native OmtA In Vivo and Expression and Distribution of This Protein in Colonies of Aspergillus parasiticus
    Article Snippet: The omtA PCR fragment (1,260 bp) was digested with restriction enzymes Xba I and Hin dIII and cloned into plasmid pMAL-c2 (New England Biolabs, Beverly, Mass.) digested with the same enzymes. .. The proper construction of pLW12 in clones expressing MBP-OmtA was confirmed by restriction enzyme analysis of purified plasmid DNA isolated by the Qiagen (Valencia, Calif.) miniprep plasmid kit.

    Article Title: Tol2-mediated transgenesis in tilapia (Oreochromis niloticus)
    Article Snippet: The plasmid was electroporated into E. coli strain DH10B (Invitrogen, Carlsbad CA, USA), cultured, and prepared using the Qiagen Plasmid mini kit (Qiagen, Duesseldorf, Germany). .. The plasmid solution was further purified using the QIAquick PCR purification kit (Qiagen), and diluted to a stock concentration of 125 ng/μl.

    Article Title: Hepatitis B virus core protein dimer-dimer interface is critical for viral replication
    Article Snippet: The PCR primers for the amplification of total DNA were: For, 5′-GCCAAAATTCGCAGTCC-3′ and Rev, 5′-AAACTGAGCCAGGAGAAA-3′. .. The pHBV1.2 plasmid, which contained 1.2 copies of the HBV genome, was extracted using the QIAGEN Plasmid Mini kit (Qiagen GmbH), according to the manufacturer's instructions.

    Article Title: Formin-like 3 regulates RhoC/FAK pathway and actin assembly to promote cell invasion in colorectal carcinoma
    Article Snippet: To obtain an active mutant construct of RhoC-V14, the wild-type coding region of RhoC was amplified by polymerase chain reaction (PCR) and inserted into the expression plasmid pGEX-4T-1. .. DNA was purified with a Mini plasmid Purification Kit (Qiagen, Japan) and digested with suitable restriction enzymes.

    Article Title: Severe Sepsis Facilitates Intestinal Colonization by Extended-Spectrum-β-Lactamase-Producing Klebsiella pneumoniae and Transfer of the SHV-18 Resistance Gene to Escherichia coli during Antimicrobial Treatment
    Article Snippet: Plasmids were extracted from purified and amplified colonies of E. coli and K. pneumoniae with the Qiagen Plasmid Mini Kit (Qiagen, Germany) following the instructions of the manufacturer. .. PCR was used to determine if bla SHV-18 was present.

    Gel Extraction:

    Article Title: In Vivo CD8+ T-Cell Suppression of SIV Viremia Is Not Mediated by CTL Clearance of Productively Infected CellsCD8+ Lymphocytes Control Viral Replication in SIVmac239-Infected Rhesus Macaques without Decreasing the Lifespan of Productively Infected CellsCD8+ T Cell Control of HIV–A Known Unknown
    Article Snippet: The gag PCR product was gel purified using Qiagen QIAex Gel Extraction Kit prior to being used for cloning. .. Clones were picked and plasmids prepared using the Qiagen Plasmid Mini Kit (Qiagen, Chatsworth CA) according to the manufacturer's protocol.

    IA:

    Article Title: Inhibition and conformational change of SERCA3b induced by Bcl-2
    Article Snippet: The oligonucleotide primer of 5’-AGG GAC GGG GTG AAC TGG GAG AGG ATT GTG GCC TTC TTT GAG-3’ for the G145E mutant of Bcl-2 was designed and purchased from DNA technologies, Inc. (Coralville, IA). .. Mutant plasmid DNA was isolated from a few colonies using the QIAGEN Plasmid mini kit according to the manufacturer’s protocol and the isolated DNA samples were submitted for sequencing (Northwoods DNA, Inc., Solway, MN).

    Plasmid Preparation:

    Article Title: Decreased Amounts of Cell Wall-Associated Protein A and Fibronectin-Binding Proteins in Staphylococcus aureus sarA Mutants due to Up-Regulation of Extracellular Proteases
    Article Snippet: .. Plasmid DNA was extracted using the Qiagen plasmid mini-kit. .. E. coli transformants were selected on Luria-Bertani (Difco) plates containing 100 μg of ampicillin ml−1 .

    Article Title: Large-scale identification of serotype 4 Streptococcus pneumoniae virulence factors
    Article Snippet: .. Plasmid DNA was purified from E. coli strains harbouring each of the 93 uniquely tagged magellan2 elements using Qiagen mini plasmid preparation kit according to the manufacturer's instructions (Qiagen). .. Streptococcus pneumoniae genomic DNA was isolated from AC353 as follows: AC353 was grown in 40 ml of THY (Todd Hewitt broth, 0.5% yeast extract) supplemented with Sm and 5 µl ml−1 Oxyrase (Oxyrase) statically in a candle extinction jar.

    Article Title: The ROP2 GTPase Controls the Formation of Cortical Fine F-Actin and the Early Phase of Directional Cell Expansion during Arabidopsis Organogenesis
    Article Snippet: .. For particle bombardment, all plasmids were amplified in Escherichia coli strain Top 10 and purified using plasmid midi or mini kits according to the manufacturer's instructions (Qiagen, Valencia, CA). .. Expanding rosette leaves of 0.8 to 1.2 cm in length were collected from 3- to 6-week-old plants and were bombarded with gold particles coated with plasmids using a Bio-Rad PDS-1000/He particle delivery system.

    Article Title: In Vivo CD8+ T-Cell Suppression of SIV Viremia Is Not Mediated by CTL Clearance of Productively Infected CellsCD8+ Lymphocytes Control Viral Replication in SIVmac239-Infected Rhesus Macaques without Decreasing the Lifespan of Productively Infected CellsCD8+ T Cell Control of HIV–A Known Unknown
    Article Snippet: .. Clones were picked and plasmids prepared using the Qiagen Plasmid Mini Kit (Qiagen, Chatsworth CA) according to the manufacturer's protocol. .. Plasmids were sequenced using SIVgag1151F and SIVGag1826R ( CCTGGCACTACTTCTGCTCC ) as sequencing primers for gag and SIV nef5′in and SIV nef3′in for nef .

    Article Title: Trp-107 and Trp-253 Account for the Increased Steady State Fluorescence That Accompanies the Conformational Change in Human Pancreatic Triglyceride Lipase Induced by Tetrahydrolipstatin and Bile Salt *
    Article Snippet: .. Minipreps were performed using either the Qiagen plasmid mini kit or the Qiagen QIAprep miniprep kit. .. The presence of the desired mutation was confirmed by dideoxynucleotide sequence analysis of the complete cDNA using the ABI PRISM Big Dye terminator cycle sequencing ready reaction kit.

    Article Title: Inhibition and conformational change of SERCA3b induced by Bcl-2
    Article Snippet: .. Mutant plasmid DNA was isolated from a few colonies using the QIAGEN Plasmid mini kit according to the manufacturer’s protocol and the isolated DNA samples were submitted for sequencing (Northwoods DNA, Inc., Solway, MN). .. HEK-293 cells, which were stably transfected with a human SERCA3b-encoding vector were a kind gift of Dr. Jocelyne Enouf (INSERM, Villejuif, France).

    Article Title: Targeting the INCENP IN-box–Aurora B interaction to inhibit CPC activity in vivo
    Article Snippet: .. For transfection, library constructs were prepared using the transfection-grade Plasmid Mini Kit (QIAGEN) following the manufacturer's instructions. .. Protein-splicing deficient SICLOPPSAA mutants of selected library constructs were generated by digestion with BamHI and AflII and insertion of the resulting fragment into pIRES puro2 SICLOPPSAA , which also lacks the MCS AflII site.

    Article Title: Effects of a specific nutrient combination on ESBL resistance
    Article Snippet: .. 2.4 Plasmid extraction Plasmid DNA was extracted using QIAGEN Plasmid Mini Kit (QIAGEN GmbH, D-40724 Hilden) and the procedure was carried out according to the manufacturers’ protocol. ..

    Article Title: Function of Native OmtA In Vivo and Expression and Distribution of This Protein in Colonies of Aspergillus parasiticus
    Article Snippet: .. The proper construction of pLW12 in clones expressing MBP-OmtA was confirmed by restriction enzyme analysis of purified plasmid DNA isolated by the Qiagen (Valencia, Calif.) miniprep plasmid kit. .. The size of the fusion protein was determined by small-scale expression studies.

    Article Title: Tol2-mediated transgenesis in tilapia (Oreochromis niloticus)
    Article Snippet: .. The plasmid was electroporated into E. coli strain DH10B (Invitrogen, Carlsbad CA, USA), cultured, and prepared using the Qiagen Plasmid mini kit (Qiagen, Duesseldorf, Germany). .. The plasmid solution was further purified using the QIAquick PCR purification kit (Qiagen), and diluted to a stock concentration of 125 ng/μl.

    Article Title: Hepatitis B virus core protein dimer-dimer interface is critical for viral replication
    Article Snippet: .. The pHBV1.2 plasmid, which contained 1.2 copies of the HBV genome, was extracted using the QIAGEN Plasmid Mini kit (Qiagen GmbH), according to the manufacturer's instructions. ..

    Article Title: Formin-like 3 regulates RhoC/FAK pathway and actin assembly to promote cell invasion in colorectal carcinoma
    Article Snippet: .. DNA was purified with a Mini plasmid Purification Kit (Qiagen, Japan) and digested with suitable restriction enzymes. ..

    Article Title: Severe Sepsis Facilitates Intestinal Colonization by Extended-Spectrum-β-Lactamase-Producing Klebsiella pneumoniae and Transfer of the SHV-18 Resistance Gene to Escherichia coli during Antimicrobial Treatment
    Article Snippet: .. Plasmids were extracted from purified and amplified colonies of E. coli and K. pneumoniae with the Qiagen Plasmid Mini Kit (Qiagen, Germany) following the instructions of the manufacturer. .. PCR was used to determine if bla SHV-18 was present.

    Article Title: BacCapSeq: a Platform for Diagnosis and Characterization of Bacterial Infections
    Article Snippet: .. Recombinant plasmid DNA was purified using a Mini Plasmid Prep kit (Qiagen). .. The linearized plasmid DNA concentration was determined using NanoDrop One, and copy numbers were adjusted by dilution in Tris-HCl (pH 8) with 1 ng/ml salmon sperm DNA.

    shRNA:

    Article Title: Formin-like 3 regulates RhoC/FAK pathway and actin assembly to promote cell invasion in colorectal carcinoma
    Article Snippet: A scrambled shRNA, which has no homology with the mammalian mRNA sequences, was inserted into the GV102 vector and served as the control. .. DNA was purified with a Mini plasmid Purification Kit (Qiagen, Japan) and digested with suitable restriction enzymes.

    Agarose Gel Electrophoresis:

    Article Title: Probing the human natural autoantibody repertoire using an immunoscreening approach
    Article Snippet: The isolated phagemids were propagated in E. coli XLOLR cells, and phagemid DNA was isolated using the Qiagen mini-plasmid isolation kit following the manufacturer's instructions (Qiagen, Hilden, Germany). .. Standard TAE agarose gel electrophoresis was used to size fractionate the DNA restriction fragments and appropriate standard DNA molecular weight markers (Roche Diagnostics).

    In Vitro:

    Article Title: Large-scale identification of serotype 4 Streptococcus pneumoniae virulence factors
    Article Snippet: Paragraph title: In vitro transposon mutagenesis, DNA transformation, and pool construction ... Plasmid DNA was purified from E. coli strains harbouring each of the 93 uniquely tagged magellan2 elements using Qiagen mini plasmid preparation kit according to the manufacturer's instructions (Qiagen).

    Quantitation Assay:

    Article Title: BacCapSeq: a Platform for Diagnosis and Characterization of Bacterial Infections
    Article Snippet: Standards for quantitation were generated by cloning a fragment of the targeted gene spanning the primers into pGEM-T Easy vector (Promega, Madison, WI). .. Recombinant plasmid DNA was purified using a Mini Plasmid Prep kit (Qiagen).

    Spectrophotometry:

    Article Title: Trp-107 and Trp-253 Account for the Increased Steady State Fluorescence That Accompanies the Conformational Change in Human Pancreatic Triglyceride Lipase Induced by Tetrahydrolipstatin and Bile Salt *
    Article Snippet: Minipreps were performed using either the Qiagen plasmid mini kit or the Qiagen QIAprep miniprep kit. .. Protein concentrations were determined by amino acid analysis and by spectrophotometry at 280 nm using an extinction coefficient of E 1% = 1.2.

    Concentration Assay:

    Article Title: Tol2-mediated transgenesis in tilapia (Oreochromis niloticus)
    Article Snippet: The plasmid was electroporated into E. coli strain DH10B (Invitrogen, Carlsbad CA, USA), cultured, and prepared using the Qiagen Plasmid mini kit (Qiagen, Duesseldorf, Germany). .. The plasmid solution was further purified using the QIAquick PCR purification kit (Qiagen), and diluted to a stock concentration of 125 ng/μl.

    Article Title: BacCapSeq: a Platform for Diagnosis and Characterization of Bacterial Infections
    Article Snippet: Recombinant plasmid DNA was purified using a Mini Plasmid Prep kit (Qiagen). .. The linearized plasmid DNA concentration was determined using NanoDrop One, and copy numbers were adjusted by dilution in Tris-HCl (pH 8) with 1 ng/ml salmon sperm DNA.

    Lysis:

    Article Title: Large-scale identification of serotype 4 Streptococcus pneumoniae virulence factors
    Article Snippet: Plasmid DNA was purified from E. coli strains harbouring each of the 93 uniquely tagged magellan2 elements using Qiagen mini plasmid preparation kit according to the manufacturer's instructions (Qiagen). .. Cells were washed in sterile dH2 0, resuspended in 200 µl of lysis buffer (0.1% deoxycholate, 0.01% SDS, 0.15 M NaCl) and incubated at 37°C for 10 min. Next, 0.9 ml of SSC was added and samples were incubated an additional 10 min at 65°C.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen qiaamp viral rna mini kit
    Amplification of a serial dilution of the EUROHEP standard with HBV-specific primers in a nested PCR following extraction with the Chemagic <t>DNA/RNA</t> kit and the <t>QIAamp</t> DNA Blood Mini kit. (A) Chemagen extracts. (B) QIAGEN extracts. Lane M shows a 100-bp ladder, and lane C shows results for the negative control. Lanes 1 through 10 show results for different viral loads expressed in numbers of copies per ml: 1, 4 × 10 5 ; 2, 4 × 10 4 ; 3, 4 × 10 3 ; 4, 4 × 10 2 ; 5, 2 × 10 2 ; 6, 1 × 10 2 ; 7, 8 × 10 1 ; 8, 4 × 10 1 ; 9, 2 × 10 1 ; 10, 1 × 10 1 .
    Qiaamp Viral Rna Mini Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1541 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qiaamp viral rna mini kit/product/Qiagen
    Average 99 stars, based on 1541 article reviews
    Price from $9.99 to $1999.99
    qiaamp viral rna mini kit - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    99
    Qiagen rneasy plant mini kit
    The efficiency of filter paper for purification of nucleic acids from various sources using respective <t>Qiagen</t> kits. (A) Tomato genomic DNAs purified using Qiagen DNeasy plant mini kit. (B) Tomato total RNAs purified using Qiagen <t>RNeasy</t> plant mini kit. (C) PCR products of a GUS fragment purified using Qiagen QIAquick PCR purification kit. (D) PCR products of GUS fragment recovered from an agarose gel using a Qiagen QIAquick gel extraction kit. (E) pUC -19 plasmid DNAs purified using a Qiagen QIAprep spin miniprep kit. For each panel, from left to right are (Q) nucleic acid purified in experiments using original Qiagen spin column, (G) reassembled spin column using two layers of Whatman glass microfiber filters (Grade GF/F), and (P) reassembled spin column using two layers of Whatman qualitative filter paper, (Grade 3) respectively. Upper panel is quantification data based on three experimental replicates normalized according to performance of the Qiagen kit; lower panel is an image of agarose gel electrophoresis for the same volume of purified nucleic acids.
    Rneasy Plant Mini Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1756 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rneasy plant mini kit/product/Qiagen
    Average 99 stars, based on 1756 article reviews
    Price from $9.99 to $1999.99
    rneasy plant mini kit - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    99
    Qiagen qiaamp dna mini kit
    Efficiency of genomic and plasmid <t>DNA</t> recovery with the <t>QIAamp</t> DNA mini kit columns. Genomic and plasmid DNA were isolated from E . coli DH5α and E . coli DH5α [pBR322] with the use of Genomic and Plasmid DNA mini kits, respectively (A A Biotechnology). DNA concentrations were measured by NanoDrop 1000 UV-VIS spectrophotometer (Thermo Scientific). Genomic DNA in the following amounts: 2110 ng, 1855 ng and 3922 ng, was coupled with 524 ng, 1100 ng and 1684 ng of plasmid DNA, respectively. Then, 100 μl of the lysis buffer (Qiagen) was added separately to genomic and plasmid DNA and the nucleic acids isolation was performed according to the QIAamp DNA mini kit manufacturer’s manual. The level of isolated DNA is indicated as a percentage relative to the unprocessed sample. The diagram represents three independent experiments. Error bars represent standard deviation (n = 3); (* P
    Qiaamp Dna Mini Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 2498 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qiaamp dna mini kit/product/Qiagen
    Average 99 stars, based on 2498 article reviews
    Price from $9.99 to $1999.99
    qiaamp dna mini kit - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    Image Search Results


    Amplification of a serial dilution of the EUROHEP standard with HBV-specific primers in a nested PCR following extraction with the Chemagic DNA/RNA kit and the QIAamp DNA Blood Mini kit. (A) Chemagen extracts. (B) QIAGEN extracts. Lane M shows a 100-bp ladder, and lane C shows results for the negative control. Lanes 1 through 10 show results for different viral loads expressed in numbers of copies per ml: 1, 4 × 10 5 ; 2, 4 × 10 4 ; 3, 4 × 10 3 ; 4, 4 × 10 2 ; 5, 2 × 10 2 ; 6, 1 × 10 2 ; 7, 8 × 10 1 ; 8, 4 × 10 1 ; 9, 2 × 10 1 ; 10, 1 × 10 1 .

    Journal: Journal of Clinical Microbiology

    Article Title: Efficient Extraction of Viral DNA and Viral RNA by the Chemagic Viral DNA/RNA Kit Allows Sensitive Detection of Cytomegalovirus, Hepatitis B Virus, and Hepatitis G Virus by PCR

    doi: 10.1128/JCM.41.11.5273-5276.2003

    Figure Lengend Snippet: Amplification of a serial dilution of the EUROHEP standard with HBV-specific primers in a nested PCR following extraction with the Chemagic DNA/RNA kit and the QIAamp DNA Blood Mini kit. (A) Chemagen extracts. (B) QIAGEN extracts. Lane M shows a 100-bp ladder, and lane C shows results for the negative control. Lanes 1 through 10 show results for different viral loads expressed in numbers of copies per ml: 1, 4 × 10 5 ; 2, 4 × 10 4 ; 3, 4 × 10 3 ; 4, 4 × 10 2 ; 5, 2 × 10 2 ; 6, 1 × 10 2 ; 7, 8 × 10 1 ; 8, 4 × 10 1 ; 9, 2 × 10 1 ; 10, 1 × 10 1 .

    Article Snippet: Identical results were obtained after extraction of the identical specimens with the QIAamp Viral RNA Mini kit.

    Techniques: Amplification, Serial Dilution, Nested PCR, Negative Control

    Amplification of a serial dilution of the standard plasmid pCR-gpB by real-time PCR with CMV-specific primers (amplicon, 254 bp) on the LightCycler instrument (software, version 3.5; analysis method, fit points with manual noise band adjustment, hybridization probe format) following extraction with the Chemagic DNA/RNA kit and the QIAamp DNA Blood Mini kit. pCR-gpB concentrations (from left to right) were 2 × 10 5 , 2 × 10 4 , 2 × 10 3 , and 2 × 10 2 copies per ml of serum. Continuous line, Chemagen extracts; broken line, QIAGEN extracts. Cycle number, cycle number of the amplification reaction; F2/F1, quotient of fluorescence channel F2 (hybridization probe) and fluorescence channel F1 (fluorescein).

    Journal: Journal of Clinical Microbiology

    Article Title: Efficient Extraction of Viral DNA and Viral RNA by the Chemagic Viral DNA/RNA Kit Allows Sensitive Detection of Cytomegalovirus, Hepatitis B Virus, and Hepatitis G Virus by PCR

    doi: 10.1128/JCM.41.11.5273-5276.2003

    Figure Lengend Snippet: Amplification of a serial dilution of the standard plasmid pCR-gpB by real-time PCR with CMV-specific primers (amplicon, 254 bp) on the LightCycler instrument (software, version 3.5; analysis method, fit points with manual noise band adjustment, hybridization probe format) following extraction with the Chemagic DNA/RNA kit and the QIAamp DNA Blood Mini kit. pCR-gpB concentrations (from left to right) were 2 × 10 5 , 2 × 10 4 , 2 × 10 3 , and 2 × 10 2 copies per ml of serum. Continuous line, Chemagen extracts; broken line, QIAGEN extracts. Cycle number, cycle number of the amplification reaction; F2/F1, quotient of fluorescence channel F2 (hybridization probe) and fluorescence channel F1 (fluorescein).

    Article Snippet: Identical results were obtained after extraction of the identical specimens with the QIAamp Viral RNA Mini kit.

    Techniques: Amplification, Serial Dilution, Plasmid Preparation, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Software, Hybridization, Fluorescence

    NS1 unique regions are important for modulating host responses Human monocyte-derived dendritic cells (MDDCs) were transduced with either only empty lentiviral vectors (empty) or lentivirus vectors that express either EBOV-VP35, hRSV-NS1, hRSV-NS1-(1-118), hRSV-NS1-L132A/L133A. RNA was isolated from transduced MDDCs that were either mock-infected or infected with SeV. RNA was extracted at the indicated hours post-infection; and a, IFN-β, b, TNF-α, c, ISG54, and d, ISG56 mRNA levels were quantified RT-qPCR, normalizing their levels to that of β-actin mRNA. The graph indicates the fold-change relative to the mock-infected samples. For a–d, symbols are: ○, empty vector; ▲, hRSV NS1 1-118; ▼, hRSV NS1 L132A/L133A; ■, hRSV NS1 WT; and ●, EBOV VP35. hRSV NS1 inhibits upregulation of DC maturation markers. Transduced MDDCs were infected with SeV for 20h, harvested and stained for expression of CD40, CD80, CD83 and CD86. Fold change in mean fluorescence intensity (MFI) for the indicated proteins in transduced MDDCs where fold increase indicates comparisons of SeV-infected to uninfected MDDCs. Error bars indicate standard deviations from three independent experiments (*p

    Journal: Nature microbiology

    Article Title: Structural basis for human respiratory syncytial virus NS1-mediated modulation of host responses

    doi: 10.1038/nmicrobiol.2017.101

    Figure Lengend Snippet: NS1 unique regions are important for modulating host responses Human monocyte-derived dendritic cells (MDDCs) were transduced with either only empty lentiviral vectors (empty) or lentivirus vectors that express either EBOV-VP35, hRSV-NS1, hRSV-NS1-(1-118), hRSV-NS1-L132A/L133A. RNA was isolated from transduced MDDCs that were either mock-infected or infected with SeV. RNA was extracted at the indicated hours post-infection; and a, IFN-β, b, TNF-α, c, ISG54, and d, ISG56 mRNA levels were quantified RT-qPCR, normalizing their levels to that of β-actin mRNA. The graph indicates the fold-change relative to the mock-infected samples. For a–d, symbols are: ○, empty vector; ▲, hRSV NS1 1-118; ▼, hRSV NS1 L132A/L133A; ■, hRSV NS1 WT; and ●, EBOV VP35. hRSV NS1 inhibits upregulation of DC maturation markers. Transduced MDDCs were infected with SeV for 20h, harvested and stained for expression of CD40, CD80, CD83 and CD86. Fold change in mean fluorescence intensity (MFI) for the indicated proteins in transduced MDDCs where fold increase indicates comparisons of SeV-infected to uninfected MDDCs. Error bars indicate standard deviations from three independent experiments (*p

    Article Snippet: RNA was isolated from medium using Qiagen Viral RNA Mini Kit and hRSV titer was determined by qPCR and expressed as fold change compared to 2 hour time point.

    Techniques: Derivative Assay, Transduction, Isolation, Infection, Quantitative RT-PCR, Plasmid Preparation, Staining, Expressing, Fluorescence

    The efficiency of filter paper for purification of nucleic acids from various sources using respective Qiagen kits. (A) Tomato genomic DNAs purified using Qiagen DNeasy plant mini kit. (B) Tomato total RNAs purified using Qiagen RNeasy plant mini kit. (C) PCR products of a GUS fragment purified using Qiagen QIAquick PCR purification kit. (D) PCR products of GUS fragment recovered from an agarose gel using a Qiagen QIAquick gel extraction kit. (E) pUC -19 plasmid DNAs purified using a Qiagen QIAprep spin miniprep kit. For each panel, from left to right are (Q) nucleic acid purified in experiments using original Qiagen spin column, (G) reassembled spin column using two layers of Whatman glass microfiber filters (Grade GF/F), and (P) reassembled spin column using two layers of Whatman qualitative filter paper, (Grade 3) respectively. Upper panel is quantification data based on three experimental replicates normalized according to performance of the Qiagen kit; lower panel is an image of agarose gel electrophoresis for the same volume of purified nucleic acids.

    Journal: PLoS ONE

    Article Title: Filter paper-based spin column method for cost-efficient DNA or RNA purification

    doi: 10.1371/journal.pone.0203011

    Figure Lengend Snippet: The efficiency of filter paper for purification of nucleic acids from various sources using respective Qiagen kits. (A) Tomato genomic DNAs purified using Qiagen DNeasy plant mini kit. (B) Tomato total RNAs purified using Qiagen RNeasy plant mini kit. (C) PCR products of a GUS fragment purified using Qiagen QIAquick PCR purification kit. (D) PCR products of GUS fragment recovered from an agarose gel using a Qiagen QIAquick gel extraction kit. (E) pUC -19 plasmid DNAs purified using a Qiagen QIAprep spin miniprep kit. For each panel, from left to right are (Q) nucleic acid purified in experiments using original Qiagen spin column, (G) reassembled spin column using two layers of Whatman glass microfiber filters (Grade GF/F), and (P) reassembled spin column using two layers of Whatman qualitative filter paper, (Grade 3) respectively. Upper panel is quantification data based on three experimental replicates normalized according to performance of the Qiagen kit; lower panel is an image of agarose gel electrophoresis for the same volume of purified nucleic acids.

    Article Snippet: Purification of plant RNA Plant total RNAs were purified using filter paper-based spin columns following the protocol of the Qiagen RNeasy Plant mini kit (RNeasy Mini Handbook.

    Techniques: Purification, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Gel Extraction, Plasmid Preparation

    Evaluation of purification of tobacco genomic DNA and total RNA using filter paper-based spin columns with respective Qiagen kit buffers and homemade buffers. (A) Agarose gel electrophoresis for 2.5 μl tobacco genomic DNAs elution from purification experiments using Qiagen DNeasy plant mini kit buffers with Qiagen original spin column (Lane Q/Q), filter paper recharged used spin column (Lane Q/R) and filter paper-based homemade spin column (Lane Q/H*), followed by tobacco genomic DNAs purified using homemade buffer with Qiagen original spin column (Lane H/Q), filter paper recharged used spin column (Lane H/R) and filter paper-based homemade spin column (Lane H/H*). (B) UV spectrum curve of tobacco DNAs purified using Qiagen kit (Q/Q, black curve), filter paper recharged spin columns with Qiagen kit buffers (Q/R, blue curve) or homemade buffers (H/R, red curve) from the same amount leaf tissue. Y-axis is UV absorbance, and X-axis is wavelength (nM). (C) Amplification plots for three duplicated qPCR reactions contain 20 ng DNA purified using Qiagen kit (Q/Q, Blue curves) or DNA purified from filter paper recharged spin column with homemade buffer (H/R, Red curves) respectively. The x-axis is PCR cycle numbers, Y-axis is the level of SYBR fluorescence, and the green line is an arbitrary threshold to determine the Cq value (the fractional cycle number at which amplification curve meet threshold level). (D) MOPS-formaldehyde denaturing agarose gel electrophoresis separated 5 μl RNA purified using Qiagen RNeasy plant mini kit buffers with a Qiagen original spin column (Lane Q/Q), filter paper recharged used spin column (Lane Q/R) and homemade filter paper-based spin column (Lane Q/H*), followed total tobacco RNAs purified by using homemade buffer with Qiagen original spin column (Lane H/Q), filter paper recharged used spin column (Lane H/R) and filter paper-based homemade spin column (Lane H/H*). (E) UV spectrum of tobacco total RNA purified using Qiagen kit (Q/Q, black curve), filter paper recharged spin column with Qiagen RNeasy plant mini kit buffers (Q/R, blue curve) or homemade buffers (H/R, red curve). Y-axis is UV absorbance, and the X-axis is wavelength. (F) Amplification plots of three duplicated qRT-PCR reactions for 2.5 ng RNA purified using Qiagen kit (Q/Q, Blue curves) or RNA purified using filter paper recharged spin column with homemade buffer (H/R, Red curves) respectively. Note: * The starting material amount is 100 mg tobacco leaf tissue for experiments using a Qiagen spin column or filter paper recharged spin column, and half amount of plant sample (50 mg) used for homemade spin column purification. All DNAs or RNAs were eluted using 100 ul elution solution.

    Journal: PLoS ONE

    Article Title: Filter paper-based spin column method for cost-efficient DNA or RNA purification

    doi: 10.1371/journal.pone.0203011

    Figure Lengend Snippet: Evaluation of purification of tobacco genomic DNA and total RNA using filter paper-based spin columns with respective Qiagen kit buffers and homemade buffers. (A) Agarose gel electrophoresis for 2.5 μl tobacco genomic DNAs elution from purification experiments using Qiagen DNeasy plant mini kit buffers with Qiagen original spin column (Lane Q/Q), filter paper recharged used spin column (Lane Q/R) and filter paper-based homemade spin column (Lane Q/H*), followed by tobacco genomic DNAs purified using homemade buffer with Qiagen original spin column (Lane H/Q), filter paper recharged used spin column (Lane H/R) and filter paper-based homemade spin column (Lane H/H*). (B) UV spectrum curve of tobacco DNAs purified using Qiagen kit (Q/Q, black curve), filter paper recharged spin columns with Qiagen kit buffers (Q/R, blue curve) or homemade buffers (H/R, red curve) from the same amount leaf tissue. Y-axis is UV absorbance, and X-axis is wavelength (nM). (C) Amplification plots for three duplicated qPCR reactions contain 20 ng DNA purified using Qiagen kit (Q/Q, Blue curves) or DNA purified from filter paper recharged spin column with homemade buffer (H/R, Red curves) respectively. The x-axis is PCR cycle numbers, Y-axis is the level of SYBR fluorescence, and the green line is an arbitrary threshold to determine the Cq value (the fractional cycle number at which amplification curve meet threshold level). (D) MOPS-formaldehyde denaturing agarose gel electrophoresis separated 5 μl RNA purified using Qiagen RNeasy plant mini kit buffers with a Qiagen original spin column (Lane Q/Q), filter paper recharged used spin column (Lane Q/R) and homemade filter paper-based spin column (Lane Q/H*), followed total tobacco RNAs purified by using homemade buffer with Qiagen original spin column (Lane H/Q), filter paper recharged used spin column (Lane H/R) and filter paper-based homemade spin column (Lane H/H*). (E) UV spectrum of tobacco total RNA purified using Qiagen kit (Q/Q, black curve), filter paper recharged spin column with Qiagen RNeasy plant mini kit buffers (Q/R, blue curve) or homemade buffers (H/R, red curve). Y-axis is UV absorbance, and the X-axis is wavelength. (F) Amplification plots of three duplicated qRT-PCR reactions for 2.5 ng RNA purified using Qiagen kit (Q/Q, Blue curves) or RNA purified using filter paper recharged spin column with homemade buffer (H/R, Red curves) respectively. Note: * The starting material amount is 100 mg tobacco leaf tissue for experiments using a Qiagen spin column or filter paper recharged spin column, and half amount of plant sample (50 mg) used for homemade spin column purification. All DNAs or RNAs were eluted using 100 ul elution solution.

    Article Snippet: Purification of plant RNA Plant total RNAs were purified using filter paper-based spin columns following the protocol of the Qiagen RNeasy Plant mini kit (RNeasy Mini Handbook.

    Techniques: Purification, Agarose Gel Electrophoresis, Amplification, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, Fluorescence, Quantitative RT-PCR

    Efficiency of genomic and plasmid DNA recovery with the QIAamp DNA mini kit columns. Genomic and plasmid DNA were isolated from E . coli DH5α and E . coli DH5α [pBR322] with the use of Genomic and Plasmid DNA mini kits, respectively (A A Biotechnology). DNA concentrations were measured by NanoDrop 1000 UV-VIS spectrophotometer (Thermo Scientific). Genomic DNA in the following amounts: 2110 ng, 1855 ng and 3922 ng, was coupled with 524 ng, 1100 ng and 1684 ng of plasmid DNA, respectively. Then, 100 μl of the lysis buffer (Qiagen) was added separately to genomic and plasmid DNA and the nucleic acids isolation was performed according to the QIAamp DNA mini kit manufacturer’s manual. The level of isolated DNA is indicated as a percentage relative to the unprocessed sample. The diagram represents three independent experiments. Error bars represent standard deviation (n = 3); (* P

    Journal: PLoS ONE

    Article Title: Quantification of Plasmid Copy Number with Single Colour Droplet Digital PCR

    doi: 10.1371/journal.pone.0169846

    Figure Lengend Snippet: Efficiency of genomic and plasmid DNA recovery with the QIAamp DNA mini kit columns. Genomic and plasmid DNA were isolated from E . coli DH5α and E . coli DH5α [pBR322] with the use of Genomic and Plasmid DNA mini kits, respectively (A A Biotechnology). DNA concentrations were measured by NanoDrop 1000 UV-VIS spectrophotometer (Thermo Scientific). Genomic DNA in the following amounts: 2110 ng, 1855 ng and 3922 ng, was coupled with 524 ng, 1100 ng and 1684 ng of plasmid DNA, respectively. Then, 100 μl of the lysis buffer (Qiagen) was added separately to genomic and plasmid DNA and the nucleic acids isolation was performed according to the QIAamp DNA mini kit manufacturer’s manual. The level of isolated DNA is indicated as a percentage relative to the unprocessed sample. The diagram represents three independent experiments. Error bars represent standard deviation (n = 3); (* P

    Article Snippet: However, these numbers were significantly lower than those calculated for DNA templates isolated by the QIAamp DNA mini kit.

    Techniques: Plasmid Preparation, Isolation, Spectrophotometry, Lysis, Standard Deviation

    Quantification of pBR322 plasmid copy number by digital droplet PCR. E . coli DH5α total DNA isolated by the bead beating method (A) and the QIAamp DNA mini kit (B), from two independent bacterial cultures in a logarithmic growth phase (Experiment 1 and 2), served as a template for the bla and dxs ddPCR amplification with the use of primer set A ( Table 1A ). Each experiment was run in two replicates (bla1, bla2 and dxs1, dxs2). Error bars indicate the 95% confidence limits as determined from the Poisson distribution. (C) Columns A01 and E01 represents single wells of ~ 20,000 droplets after ddPCR amplification of bla and dxs , respectively. (D) Estimated pBR322 copy number by digital droplet PCR. The plasmid copy number of pBR322 was calculated by dividing the copy number of bla by the copy number of dxs . Average PCN from four measurements was determined to be 20.5 for QIA and 7.3 for the bead-beating method.

    Journal: PLoS ONE

    Article Title: Quantification of Plasmid Copy Number with Single Colour Droplet Digital PCR

    doi: 10.1371/journal.pone.0169846

    Figure Lengend Snippet: Quantification of pBR322 plasmid copy number by digital droplet PCR. E . coli DH5α total DNA isolated by the bead beating method (A) and the QIAamp DNA mini kit (B), from two independent bacterial cultures in a logarithmic growth phase (Experiment 1 and 2), served as a template for the bla and dxs ddPCR amplification with the use of primer set A ( Table 1A ). Each experiment was run in two replicates (bla1, bla2 and dxs1, dxs2). Error bars indicate the 95% confidence limits as determined from the Poisson distribution. (C) Columns A01 and E01 represents single wells of ~ 20,000 droplets after ddPCR amplification of bla and dxs , respectively. (D) Estimated pBR322 copy number by digital droplet PCR. The plasmid copy number of pBR322 was calculated by dividing the copy number of bla by the copy number of dxs . Average PCN from four measurements was determined to be 20.5 for QIA and 7.3 for the bead-beating method.

    Article Snippet: However, these numbers were significantly lower than those calculated for DNA templates isolated by the QIAamp DNA mini kit.

    Techniques: Plasmid Preparation, Polymerase Chain Reaction, Isolation, Amplification