minelute pcr purification kit  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Qiagen minelute pcr purification kit
    Minelute Pcr Purification Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 2289 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/minelute pcr purification kit/product/Qiagen
    Average 99 stars, based on 2289 article reviews
    Price from $9.99 to $1999.99
    minelute pcr purification kit - by Bioz Stars, 2020-04
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Direct Cloning Method for Expression of Recombinant Proteins with an Inositol Hexakisphosphate Inducible Self-Cleaving Tag.
    Article Snippet: Protein purification is the most basic and critical step for protein biophysical and biochemical studies to understand its function and structure. .. Protein purification is the most basic and critical step for protein biophysical and biochemical studies to understand its function and structure.

    Article Title: Comparisons of dual isogenic human iPSC pairs identify functional alterations directly caused by an epilepsy associated SCN1A mutation.
    Article Snippet: To increase viability of cells during defrosting, clones from 48-well plates were frozen with 50-250 µl of freezing medium depending on the size of Jo ur na l P re -p ro f pellets after centrifugation and were stored in 1.2 ml cryo-vials at -80°C. .. PCR products were confirmed by gel electrophoresis and purified with MinElute PCR Purification Kit (Qiagen) prior to sequencing (Retrogen).

    Centrifugation:

    Article Title: Comparisons of dual isogenic human iPSC pairs identify functional alterations directly caused by an epilepsy associated SCN1A mutation.
    Article Snippet: To increase viability of cells during defrosting, clones from 48-well plates were frozen with 50-250 µl of freezing medium depending on the size of Jo ur na l P re -p ro f pellets after centrifugation and were stored in 1.2 ml cryo-vials at -80°C. .. PCR products were confirmed by gel electrophoresis and purified with MinElute PCR Purification Kit (Qiagen) prior to sequencing (Retrogen).

    Amplification:

    Article Title: Virus characterization and discovery in formalin-fixed paraffin-embedded tissues.
    Article Snippet: Paragraph title: Sequence-independent amplification and next-generation sequencing of tissue samples ... Random PCR products from the RNA and DNA fractions were pooled, purified using the MinElute PCR purification kit (Qiagen) and subsequently prepared for next-generation sequencing on a 454 GS Junior instrument according to the instructions of the manufacturer (454 Life Science, Roche).

    Article Title: Direct Cloning Method for Expression of Recombinant Proteins with an Inositol Hexakisphosphate Inducible Self-Cleaving Tag.
    Article Snippet: Protein purification is the most basic and critical step for protein biophysical and biochemical studies to understand its function and structure. .. Protein purification is the most basic and critical step for protein biophysical and biochemical studies to understand its function and structure.

    Article Title: Detection of CSF1 rearrangements deleting the 3' UTR in tenosynovial giant cell tumors.
    Article Snippet: .. Tenosynovial giant cell tumors (TGCTs) are characterized by rearrangements of CSF1, thought to drive overexpression of macrophage colony-stimulating factor (CSF1), thereby promoting tumor growth and recruitment of non-neoplastic mononuclear and multinucleated inflammatory cells. ..

    Article Title: Molecular epidemiology and evolution of avian infectious bronchitis virus in Spain over a fourteen-year period.
    Article Snippet: The complete S1 gene was amplified with oligonucleotides S1Uni2+ and IBP1-as previously described (Adzhar et al., 1996) . .. The 1800-bp RT-PCR products were purified by QIAquick gel extraction Kit and Minelute PCR purification Kit (Qiagen Inc.) following manufacturer's instructions.

    Article Title: Metagenomic analysis of viromes of dromedary camel fecal samples reveals large number and high diversity of circoviruses and picobirnaviruses.
    Article Snippet: Standard precautions were taken to avoid PCR contamination and no amplified PCR product was observed in negative control. .. The PCR product was purified using the MinElute PCR Purification Kit (Qiagen, Hilden, Germany) following the manufacturer's protocol with slight modification.

    Article Title: Ribosomal RNA depletion or exclusion has negligible effect on the detection of viruses in a pan viral microarray.
    Article Snippet: Labelling DNA with fluorescent dye Indirect labelling of the amplified DNA templates (5 l) was performed using 15-20 cycles of PCR which incorporates amino allyl dUTP (Life Technologies, Paisley, UK) into the reaction (Gurrala et al., 2009) . .. The labelled products were purified using the MinElute PCR purification Kit (Qiagen, Manchester, UK) following the manufacturer's protocol, substituting the wash buffer with 75% ethanol and eluting the sample in 13 l of water.

    Article Title: Comparisons of dual isogenic human iPSC pairs identify functional alterations directly caused by an epilepsy associated SCN1A mutation.
    Article Snippet: Fragments around the intended mutation sites were amplified by PCR in 50 µl reactions with Taq DNA polymerase (Invitrogen), forward primer 5'- CTACCATAGATTCCATCCCCCAA -3' and reverse primer 5'- TTCCACCAATAGTCTTTCCCCTG -3'. .. PCR products were confirmed by gel electrophoresis and purified with MinElute PCR Purification Kit (Qiagen) prior to sequencing (Retrogen).

    Polymerase Chain Reaction:

    Article Title: Virus characterization and discovery in formalin-fixed paraffin-embedded tissues.
    Article Snippet: .. Random PCR products from the RNA and DNA fractions were pooled, purified using the MinElute PCR purification kit (Qiagen) and subsequently prepared for next-generation sequencing on a 454 GS Junior instrument according to the instructions of the manufacturer (454 Life Science, Roche). .. Sequence-independent amplification and next-generation sequencing of tissue samples Obtained reads were analyzed by a bioinformatics virus discovery pipeline as described previously using standard parameters .

    Article Title: Direct Cloning Method for Expression of Recombinant Proteins with an Inositol Hexakisphosphate Inducible Self-Cleaving Tag.
    Article Snippet: .. Protein purification is the most basic and critical step for protein biophysical and biochemical studies to understand its function and structure. ..

    Article Title: Detection of CSF1 rearrangements deleting the 3' UTR in tenosynovial giant cell tumors.
    Article Snippet: .. Tenosynovial giant cell tumors (TGCTs) are characterized by rearrangements of CSF1, thought to drive overexpression of macrophage colony-stimulating factor (CSF1), thereby promoting tumor growth and recruitment of non-neoplastic mononuclear and multinucleated inflammatory cells. ..

    Article Title: Molecular epidemiology and evolution of avian infectious bronchitis virus in Spain over a fourteen-year period.
    Article Snippet: .. The 1800-bp RT-PCR products were purified by QIAquick gel extraction Kit and Minelute PCR purification Kit (Qiagen Inc.) following manufacturer's instructions. .. Sequencing of the whole S1 gene was carried out using a combination of eight internal primers previously published (Dolz et al., 2006) .

    Article Title: Metagenomic analysis of viromes of dromedary camel fecal samples reveals large number and high diversity of circoviruses and picobirnaviruses.
    Article Snippet: .. The PCR product was purified using the MinElute PCR Purification Kit (Qiagen, Hilden, Germany) following the manufacturer's protocol with slight modification. .. The purified DNA was eluted in 15 μl of EB buffer and used as the template for library construction.

    Article Title: Ribosomal RNA depletion or exclusion has negligible effect on the detection of viruses in a pan viral microarray.
    Article Snippet: .. The labelled products were purified using the MinElute PCR purification Kit (Qiagen, Manchester, UK) following the manufacturer's protocol, substituting the wash buffer with 75% ethanol and eluting the sample in 13 l of water. .. The fluorescent dye was coupled to the amino allyl labelled PCR product by adding 6 l of Sodium Bicarbonate (25 mg in 1 ml of water) and 4 l of Alexa Fluor ® 647 Reactive Dye (Life Technologies, Paisley, UK), reconstituted in 18 l of DMSO, to the eluted DNA, vortexing and incubating at room temperature in the dark for up to two hours.

    Article Title: Detection of HHV-6B in post-mortem central nervous system tissue of a post-bone marrow transplant recipient: a multi-virus array analysis.
    Article Snippet: .. For sequencing analysis, PCR products were purified using MinElute PCR Purification Kit (Qiagen, CA). .. Sequencing was performed with Genetic Analyzer 3100 (Applied Biosystems).

    Formalin-fixed Paraffin-Embedded:

    Article Title: Virus characterization and discovery in formalin-fixed paraffin-embedded tissues.
    Article Snippet: Immediately after collection, tissue sections were deparaffinized in xylene, and both RNA and DNA were extracted from each sample using the RNEasy FFPE kit and QIAamp DNA FFPE Tissue Kit (both Qiagen) respectively, according to the instructions of the manufacturer. .. Random PCR products from the RNA and DNA fractions were pooled, purified using the MinElute PCR purification kit (Qiagen) and subsequently prepared for next-generation sequencing on a 454 GS Junior instrument according to the instructions of the manufacturer (454 Life Science, Roche).

    Modification:

    Article Title: Molecular epidemiology and evolution of avian infectious bronchitis virus in Spain over a fourteen-year period.
    Article Snippet: The 1800-bp RT-PCR products were purified by QIAquick gel extraction Kit and Minelute PCR purification Kit (Qiagen Inc.) following manufacturer's instructions. .. Sequences of modified primers were S1PR2+ nou (5′ TAGCCTACTTTGTTAATGGTA 3′), S1PR2-nou (5′ GTACCATTAACAAAGTAGGCTA 3′), S1PR5+nou (5′ TAGATACTTCAGGAGCCATAGACA 3′) and S1PR6+nou (5′ CCATAGACATATTTGTTGTTC 3′).

    Article Title: Metagenomic analysis of viromes of dromedary camel fecal samples reveals large number and high diversity of circoviruses and picobirnaviruses.
    Article Snippet: .. The PCR product was purified using the MinElute PCR Purification Kit (Qiagen, Hilden, Germany) following the manufacturer's protocol with slight modification. .. The purified DNA was eluted in 15 μl of EB buffer and used as the template for library construction.

    Article Title: Comparisons of dual isogenic human iPSC pairs identify functional alterations directly caused by an epilepsy associated SCN1A mutation.
    Article Snippet: A protocol for freezing iPSCs in low density was modified from Stover et al (Stover and Schwartz, 2011). .. PCR products were confirmed by gel electrophoresis and purified with MinElute PCR Purification Kit (Qiagen) prior to sequencing (Retrogen).

    Derivative Assay:

    Article Title: Comparisons of dual isogenic human iPSC pairs identify functional alterations directly caused by an epilepsy associated SCN1A mutation.
    Article Snippet: Paragraph title: 2.2 CRISPR/Cas9 editing on iPSCs derived from two siblings ... PCR products were confirmed by gel electrophoresis and purified with MinElute PCR Purification Kit (Qiagen) prior to sequencing (Retrogen).

    Generated:

    Article Title: Detection of CSF1 rearrangements deleting the 3' UTR in tenosynovial giant cell tumors.
    Article Snippet: Tenosynovial giant cell tumors (TGCTs) are characterized by rearrangements of CSF1, thought to drive overexpression of macrophage colony-stimulating factor (CSF1), thereby promoting tumor growth and recruitment of non-neoplastic mononuclear and multinucleated inflammatory cells. .. Tenosynovial giant cell tumors (TGCTs) are characterized by rearrangements of CSF1, thought to drive overexpression of macrophage colony-stimulating factor (CSF1), thereby promoting tumor growth and recruitment of non-neoplastic mononuclear and multinucleated inflammatory cells.

    Article Title: Detection of HHV-6B in post-mortem central nervous system tissue of a post-bone marrow transplant recipient: a multi-virus array analysis.
    Article Snippet: A standard curve was generated using a known concentration of variant-specific HHV-6 plasmids. .. For sequencing analysis, PCR products were purified using MinElute PCR Purification Kit (Qiagen, CA).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Molecular epidemiology and evolution of avian infectious bronchitis virus in Spain over a fourteen-year period.
    Article Snippet: .. The 1800-bp RT-PCR products were purified by QIAquick gel extraction Kit and Minelute PCR purification Kit (Qiagen Inc.) following manufacturer's instructions. .. Sequencing of the whole S1 gene was carried out using a combination of eight internal primers previously published (Dolz et al., 2006) .

    Dye Terminator Removal:

    Article Title: Ribosomal RNA depletion or exclusion has negligible effect on the detection of viruses in a pan viral microarray.
    Article Snippet: The labelled products were purified using the MinElute PCR purification Kit (Qiagen, Manchester, UK) following the manufacturer's protocol, substituting the wash buffer with 75% ethanol and eluting the sample in 13 l of water. .. The coupling reaction was made to a volume of 50 l with water before unincorporated dye was removed using the illustra TM AutoSeq TM G-50 Dye terminator removal Kit (GE Healthcare, Buckinghamshire, UK), according to the manufacturer's protocol.

    DNA Extraction:

    Article Title: Comparisons of dual isogenic human iPSC pairs identify functional alterations directly caused by an epilepsy associated SCN1A mutation.
    Article Snippet: Genomic DNA was extracted with 10-13 µl of QuickExtract DNA Extraction Solution (Epicentre). .. PCR products were confirmed by gel electrophoresis and purified with MinElute PCR Purification Kit (Qiagen) prior to sequencing (Retrogen).

    Article Title: Detection of HHV-6B in post-mortem central nervous system tissue of a post-bone marrow transplant recipient: a multi-virus array analysis.
    Article Snippet: Paragraph title: DNA isolation and PCR analysis ... For sequencing analysis, PCR products were purified using MinElute PCR Purification Kit (Qiagen, CA).

    Nucleic Acid Electrophoresis:

    Article Title: Comparisons of dual isogenic human iPSC pairs identify functional alterations directly caused by an epilepsy associated SCN1A mutation.
    Article Snippet: .. PCR products were confirmed by gel electrophoresis and purified with MinElute PCR Purification Kit (Qiagen) prior to sequencing (Retrogen). .. MacVector software was used to analyze sequencing data.

    Mutagenesis:

    Article Title: Comparisons of dual isogenic human iPSC pairs identify functional alterations directly caused by an epilepsy associated SCN1A mutation.
    Article Snippet: Fragments around the intended mutation sites were amplified by PCR in 50 µl reactions with Taq DNA polymerase (Invitrogen), forward primer 5'- CTACCATAGATTCCATCCCCCAA -3' and reverse primer 5'- TTCCACCAATAGTCTTTCCCCTG -3'. .. PCR products were confirmed by gel electrophoresis and purified with MinElute PCR Purification Kit (Qiagen) prior to sequencing (Retrogen).

    Negative Control:

    Article Title: Metagenomic analysis of viromes of dromedary camel fecal samples reveals large number and high diversity of circoviruses and picobirnaviruses.
    Article Snippet: Standard precautions were taken to avoid PCR contamination and no amplified PCR product was observed in negative control. .. The PCR product was purified using the MinElute PCR Purification Kit (Qiagen, Hilden, Germany) following the manufacturer's protocol with slight modification.

    Purification:

    Article Title: Virus characterization and discovery in formalin-fixed paraffin-embedded tissues.
    Article Snippet: .. Random PCR products from the RNA and DNA fractions were pooled, purified using the MinElute PCR purification kit (Qiagen) and subsequently prepared for next-generation sequencing on a 454 GS Junior instrument according to the instructions of the manufacturer (454 Life Science, Roche). .. Sequence-independent amplification and next-generation sequencing of tissue samples Obtained reads were analyzed by a bioinformatics virus discovery pipeline as described previously using standard parameters .

    Article Title: Direct Cloning Method for Expression of Recombinant Proteins with an Inositol Hexakisphosphate Inducible Self-Cleaving Tag.
    Article Snippet: .. Protein purification is the most basic and critical step for protein biophysical and biochemical studies to understand its function and structure. ..

    Article Title: Detection of CSF1 rearrangements deleting the 3' UTR in tenosynovial giant cell tumors.
    Article Snippet: .. Tenosynovial giant cell tumors (TGCTs) are characterized by rearrangements of CSF1, thought to drive overexpression of macrophage colony-stimulating factor (CSF1), thereby promoting tumor growth and recruitment of non-neoplastic mononuclear and multinucleated inflammatory cells. ..

    Article Title: Molecular epidemiology and evolution of avian infectious bronchitis virus in Spain over a fourteen-year period.
    Article Snippet: .. The 1800-bp RT-PCR products were purified by QIAquick gel extraction Kit and Minelute PCR purification Kit (Qiagen Inc.) following manufacturer's instructions. .. Sequencing of the whole S1 gene was carried out using a combination of eight internal primers previously published (Dolz et al., 2006) .

    Article Title: Metagenomic analysis of viromes of dromedary camel fecal samples reveals large number and high diversity of circoviruses and picobirnaviruses.
    Article Snippet: .. The PCR product was purified using the MinElute PCR Purification Kit (Qiagen, Hilden, Germany) following the manufacturer's protocol with slight modification. .. The purified DNA was eluted in 15 μl of EB buffer and used as the template for library construction.

    Article Title: Ribosomal RNA depletion or exclusion has negligible effect on the detection of viruses in a pan viral microarray.
    Article Snippet: .. The labelled products were purified using the MinElute PCR purification Kit (Qiagen, Manchester, UK) following the manufacturer's protocol, substituting the wash buffer with 75% ethanol and eluting the sample in 13 l of water. .. The fluorescent dye was coupled to the amino allyl labelled PCR product by adding 6 l of Sodium Bicarbonate (25 mg in 1 ml of water) and 4 l of Alexa Fluor ® 647 Reactive Dye (Life Technologies, Paisley, UK), reconstituted in 18 l of DMSO, to the eluted DNA, vortexing and incubating at room temperature in the dark for up to two hours.

    Article Title: Detection of HHV-6B in post-mortem central nervous system tissue of a post-bone marrow transplant recipient: a multi-virus array analysis.
    Article Snippet: .. For sequencing analysis, PCR products were purified using MinElute PCR Purification Kit (Qiagen, CA). .. Sequencing was performed with Genetic Analyzer 3100 (Applied Biosystems).

    Sequencing:

    Article Title: Virus characterization and discovery in formalin-fixed paraffin-embedded tissues.
    Article Snippet: Paragraph title: Sequence-independent amplification and next-generation sequencing of tissue samples ... Random PCR products from the RNA and DNA fractions were pooled, purified using the MinElute PCR purification kit (Qiagen) and subsequently prepared for next-generation sequencing on a 454 GS Junior instrument according to the instructions of the manufacturer (454 Life Science, Roche).

    Article Title: Detection of CSF1 rearrangements deleting the 3' UTR in tenosynovial giant cell tumors.
    Article Snippet: .. Tenosynovial giant cell tumors (TGCTs) are characterized by rearrangements of CSF1, thought to drive overexpression of macrophage colony-stimulating factor (CSF1), thereby promoting tumor growth and recruitment of non-neoplastic mononuclear and multinucleated inflammatory cells. ..

    Article Title: Molecular epidemiology and evolution of avian infectious bronchitis virus in Spain over a fourteen-year period.
    Article Snippet: Paragraph title: RT-PCR and nucleotide sequencing ... The 1800-bp RT-PCR products were purified by QIAquick gel extraction Kit and Minelute PCR purification Kit (Qiagen Inc.) following manufacturer's instructions.

    Article Title: Metagenomic analysis of viromes of dromedary camel fecal samples reveals large number and high diversity of circoviruses and picobirnaviruses.
    Article Snippet: Paragraph title: Sample preparation for Illumina sequencing ... The PCR product was purified using the MinElute PCR Purification Kit (Qiagen, Hilden, Germany) following the manufacturer's protocol with slight modification.

    Article Title: Detection of HHV-6B in post-mortem central nervous system tissue of a post-bone marrow transplant recipient: a multi-virus array analysis.
    Article Snippet: .. For sequencing analysis, PCR products were purified using MinElute PCR Purification Kit (Qiagen, CA). .. Sequencing was performed with Genetic Analyzer 3100 (Applied Biosystems).

    CRISPR:

    Article Title: Comparisons of dual isogenic human iPSC pairs identify functional alterations directly caused by an epilepsy associated SCN1A mutation.
    Article Snippet: Paragraph title: 2.2 CRISPR/Cas9 editing on iPSCs derived from two siblings ... PCR products were confirmed by gel electrophoresis and purified with MinElute PCR Purification Kit (Qiagen) prior to sequencing (Retrogen).

    Agarose Gel Electrophoresis:

    Article Title: Direct Cloning Method for Expression of Recombinant Proteins with an Inositol Hexakisphosphate Inducible Self-Cleaving Tag.
    Article Snippet: Protein purification is the most basic and critical step for protein biophysical and biochemical studies to understand its function and structure. .. Protein purification is the most basic and critical step for protein biophysical and biochemical studies to understand its function and structure.

    Article Title: Detection of CSF1 rearrangements deleting the 3' UTR in tenosynovial giant cell tumors.
    Article Snippet: Tenosynovial giant cell tumors (TGCTs) are characterized by rearrangements of CSF1, thought to drive overexpression of macrophage colony-stimulating factor (CSF1), thereby promoting tumor growth and recruitment of non-neoplastic mononuclear and multinucleated inflammatory cells. .. Tenosynovial giant cell tumors (TGCTs) are characterized by rearrangements of CSF1, thought to drive overexpression of macrophage colony-stimulating factor (CSF1), thereby promoting tumor growth and recruitment of non-neoplastic mononuclear and multinucleated inflammatory cells.

    Plasmid Preparation:

    Article Title: Direct Cloning Method for Expression of Recombinant Proteins with an Inositol Hexakisphosphate Inducible Self-Cleaving Tag.
    Article Snippet: Protein purification is the most basic and critical step for protein biophysical and biochemical studies to understand its function and structure. .. Protein purification is the most basic and critical step for protein biophysical and biochemical studies to understand its function and structure.

    Software:

    Article Title: Comparisons of dual isogenic human iPSC pairs identify functional alterations directly caused by an epilepsy associated SCN1A mutation.
    Article Snippet: PCR products were confirmed by gel electrophoresis and purified with MinElute PCR Purification Kit (Qiagen) prior to sequencing (Retrogen). .. MacVector software was used to analyze sequencing data.

    Multiplex Assay:

    Article Title: Virus characterization and discovery in formalin-fixed paraffin-embedded tissues.
    Article Snippet: Random PCR products from the RNA and DNA fractions were pooled, purified using the MinElute PCR purification kit (Qiagen) and subsequently prepared for next-generation sequencing on a 454 GS Junior instrument according to the instructions of the manufacturer (454 Life Science, Roche). .. In brief, this virus discovery pipeline consists of a combination of removal of multiplex identifier adaptors and primer sequences, quality trimming, iterative exhaustive assembly, filtering of low complexity sequences, and a BLASTN and BLASTX search of the remaining singletons and contigs.

    Sample Prep:

    Article Title: Metagenomic analysis of viromes of dromedary camel fecal samples reveals large number and high diversity of circoviruses and picobirnaviruses.
    Article Snippet: Paragraph title: Sample preparation for Illumina sequencing ... The PCR product was purified using the MinElute PCR Purification Kit (Qiagen, Hilden, Germany) following the manufacturer's protocol with slight modification.

    Next-Generation Sequencing:

    Article Title: Virus characterization and discovery in formalin-fixed paraffin-embedded tissues.
    Article Snippet: .. Random PCR products from the RNA and DNA fractions were pooled, purified using the MinElute PCR purification kit (Qiagen) and subsequently prepared for next-generation sequencing on a 454 GS Junior instrument according to the instructions of the manufacturer (454 Life Science, Roche). .. Sequence-independent amplification and next-generation sequencing of tissue samples Obtained reads were analyzed by a bioinformatics virus discovery pipeline as described previously using standard parameters .

    Spectrophotometry:

    Article Title: Direct Cloning Method for Expression of Recombinant Proteins with an Inositol Hexakisphosphate Inducible Self-Cleaving Tag.
    Article Snippet: Protein purification is the most basic and critical step for protein biophysical and biochemical studies to understand its function and structure. .. Protein purification is the most basic and critical step for protein biophysical and biochemical studies to understand its function and structure.

    Concentration Assay:

    Article Title: Direct Cloning Method for Expression of Recombinant Proteins with an Inositol Hexakisphosphate Inducible Self-Cleaving Tag.
    Article Snippet: Protein purification is the most basic and critical step for protein biophysical and biochemical studies to understand its function and structure. .. Protein purification is the most basic and critical step for protein biophysical and biochemical studies to understand its function and structure.

    Article Title: Detection of HHV-6B in post-mortem central nervous system tissue of a post-bone marrow transplant recipient: a multi-virus array analysis.
    Article Snippet: A standard curve was generated using a known concentration of variant-specific HHV-6 plasmids. .. For sequencing analysis, PCR products were purified using MinElute PCR Purification Kit (Qiagen, CA).

    Gel Extraction:

    Article Title: Molecular epidemiology and evolution of avian infectious bronchitis virus in Spain over a fourteen-year period.
    Article Snippet: .. The 1800-bp RT-PCR products were purified by QIAquick gel extraction Kit and Minelute PCR purification Kit (Qiagen Inc.) following manufacturer's instructions. .. Sequencing of the whole S1 gene was carried out using a combination of eight internal primers previously published (Dolz et al., 2006) .

    Variant Assay:

    Article Title: Detection of HHV-6B in post-mortem central nervous system tissue of a post-bone marrow transplant recipient: a multi-virus array analysis.
    Article Snippet: A standard curve was generated using a known concentration of variant-specific HHV-6 plasmids. .. For sequencing analysis, PCR products were purified using MinElute PCR Purification Kit (Qiagen, CA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen minelute pcr purification kit
    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and <t>PCR</t> Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, <t>MinElute</t> PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown
    Minelute Pcr Purification Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 2289 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/minelute pcr purification kit/product/Qiagen
    Average 99 stars, based on 2289 article reviews
    Price from $9.99 to $1999.99
    minelute pcr purification kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Journal: BMC Genomics

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application

    doi: 10.1186/s12864-017-4371-5

    Figure Lengend Snippet: DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Article Snippet: The ChIP DNA Clean & Concentrator™ (Zymo Research; Zy), the Monarch® PCR & DNA Cleanup Kit (New England Biolabs; Ne), the MinElute PCR Purification Kit (Qiagen, Qm), the QIAquick PCR Purification Kit (Qiagen; Qp), the Agencourt AMPure XP kit (Beckman; Ba) and the RNAClean™ XP kit (Beckman; Br), and phenol/chloroform extraction (Invitrogen; PC) performed well with de-crosslinked chromatin.

    Techniques: DNA Purification, Chromatin Immunoprecipitation, Purification, Generated, Derivative Assay, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction