minelute pcr purification kit  (Qiagen)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
    Name:
    MinElute PCR Purification Kit
    Description:
    For purification of up to 5 μg PCR products 70 bp to 4 kb in low elution volumes Kit contents Qiagen MinElute PCR Purification Kit 50 MinElute Spin Columns 5g Binding Capacity 10L Elution Volume Tube Format Silica Technology 70 bp to 4 kb Fragment Size Manual Processing DNA Sample Fast Procedure and Easy Handling High Reproducible Recoveries For Purification of up to 5μg PCR Products in Low Elution Volumes Includes 50 MinElute Spin Columns Buffers 2mL Collection Tubes Benefits Very small elution volumes Fast procedure and easy handling High reproducible recoveries Gel loading dye for convenient sample analysis
    Catalog Number:
    28004
    Price:
    134
    Category:
    MinElute PCR Purification Kit
    		Buy from Supplier

    Structured Review

    Qiagen minelute pcr purification kit
    MinElute PCR Purification Kit
    For purification of up to 5 μg PCR products 70 bp to 4 kb in low elution volumes Kit contents Qiagen MinElute PCR Purification Kit 50 MinElute Spin Columns 5g Binding Capacity 10L Elution Volume Tube Format Silica Technology 70 bp to 4 kb Fragment Size Manual Processing DNA Sample Fast Procedure and Easy Handling High Reproducible Recoveries For Purification of up to 5μg PCR Products in Low Elution Volumes Includes 50 MinElute Spin Columns Buffers 2mL Collection Tubes Benefits Very small elution volumes Fast procedure and easy handling High reproducible recoveries Gel loading dye for convenient sample analysis
    https://www.bioz.com/result/minelute pcr purification kit/product/Qiagen
    Average 99 stars, based on 3006 article reviews
    Price from $9.99 to $1999.99
    minelute pcr purification kit - by Bioz Stars, 2021-01
    99/100 stars

    Related Products / Commonly Used Together

    pcr
    cdna
    amplicons
    dna fragments
    rna
    proteinase k
    qiaquick pcr purification kit
    qiaquick gel extraction kit
    agarose gel electrophoresis
    pcr amplicons
    pcr amplification
    cdna library
    3730xl dna analyzer
    triplicate pcr reactions
    t4 dna ligase

    Images

    1) Product Images from "Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application"

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application

    Journal: BMC Genomics

    doi: 10.1186/s12864-017-4371-5

    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown
    Figure Legend Snippet: DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Techniques Used: DNA Purification, Chromatin Immunoprecipitation, Purification, Generated, Derivative Assay, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction

    2) Product Images from "Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application"

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application

    Journal: BMC Genomics

    doi: 10.1186/s12864-017-4371-5

    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown
    Figure Legend Snippet: DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Techniques Used: DNA Purification, Chromatin Immunoprecipitation, Purification, Generated, Derivative Assay, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction

    3) Product Images from "Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application"

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application

    Journal: BMC Genomics

    doi: 10.1186/s12864-017-4371-5

    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown
    Figure Legend Snippet: DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Techniques Used: DNA Purification, Chromatin Immunoprecipitation, Purification, Generated, Derivative Assay, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction

    4) Product Images from "Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application"

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application

    Journal: BMC Genomics

    doi: 10.1186/s12864-017-4371-5

    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown
    Figure Legend Snippet: DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Techniques Used: DNA Purification, Chromatin Immunoprecipitation, Purification, Generated, Derivative Assay, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction

    5) Product Images from "Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application"

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application

    Journal: BMC Genomics

    doi: 10.1186/s12864-017-4371-5

    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown
    Figure Legend Snippet: DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Techniques Used: DNA Purification, Chromatin Immunoprecipitation, Purification, Generated, Derivative Assay, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction

    6) Product Images from "Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application"

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application

    Journal: BMC Genomics

    doi: 10.1186/s12864-017-4371-5

    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown
    Figure Legend Snippet: DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Techniques Used: DNA Purification, Chromatin Immunoprecipitation, Purification, Generated, Derivative Assay, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction

    7) Product Images from "Components of the interleukin-33/ST2 system are differentially expressed and regulated in human cardiac cells and in cells of the cardiac vasculature"

    Article Title: Components of the interleukin-33/ST2 system are differentially expressed and regulated in human cardiac cells and in cells of the cardiac vasculature

    Journal: Journal of Molecular and Cellular Cardiology

    doi: 10.1016/j.yjmcc.2013.03.020

    Expression of ST2 receptor isoforms in human cardiac cells and in vascular cells. Human adult cardiac fibroblasts (HACF), human adult cardiac myocytes (HACM), human aortic smooth muscle cells (HASMC), human coronary artery smooth muscle cells (HCASMC), human umbilical vein endothelial cells (HUVEC), human coronary artery endothelial cells (HCAEC), human aortic endothelial cells (HAEC), and human heart microvascular endothelial cells (HHMEC) were left untreated. mRNA was prepared, cDNA was additionally eluted with MinElute PCR Purification Kit and equal amount of cDNA was used for RealTime-PCR with primers specific for totalST2 (A), ST2L (B), or sST2 (C) as described in “ Materials and methods ”. Values are given as x-fold of HAEC, which was set as 1 and represent mean ± SD. Experiments were performed with cells obtained from at least 3 different donors for each type of cells.
    Figure Legend Snippet: Expression of ST2 receptor isoforms in human cardiac cells and in vascular cells. Human adult cardiac fibroblasts (HACF), human adult cardiac myocytes (HACM), human aortic smooth muscle cells (HASMC), human coronary artery smooth muscle cells (HCASMC), human umbilical vein endothelial cells (HUVEC), human coronary artery endothelial cells (HCAEC), human aortic endothelial cells (HAEC), and human heart microvascular endothelial cells (HHMEC) were left untreated. mRNA was prepared, cDNA was additionally eluted with MinElute PCR Purification Kit and equal amount of cDNA was used for RealTime-PCR with primers specific for totalST2 (A), ST2L (B), or sST2 (C) as described in “ Materials and methods ”. Values are given as x-fold of HAEC, which was set as 1 and represent mean ± SD. Experiments were performed with cells obtained from at least 3 different donors for each type of cells.

    Techniques Used: Expressing, Polymerase Chain Reaction, Purification

    8) Product Images from "Protocol for Metagenomic Virus Detection in Clinical Specimens 1"

    Article Title: Protocol for Metagenomic Virus Detection in Clinical Specimens 1

    Journal: Emerging Infectious Diseases

    doi: 10.3201/eid2101.140766

    Comparison of extraction methods used for development of tissue-based universal virus detection for viral metagenomics protocol. Copy numbers were measured by quantitative PCR in duplicate. RQ, relative quantification: RQ (2 – ΔΔCt); (ΔΔCt = Δ purified – Δ unprocessed). Lower panel left y-axis indicates signal-to-noise ratio (RQ) for all viruses tested. The method with the highest score was used to establish the protocol and is shaded in yellow. Red stars indicate highest scores. Diagonally striped area indicates not significant. Ct, cycle threshold. Numbers along baseline indicate method used. 1, Nucleospin RNA II (Macherey Nagel, Dueren, Germany); 2, Nucleospin DNA (Macherey Nagel); 3, RTP DNA/RNA Virus Ultra Sense (Invitek, Berlin Germany); 4, RTP DNA/RNA Virus Mini Kit (Invitek); 5, QIAmp UltraSens Virus Kit (QIAGEN, Hilden, Germany); 6, Viral Mini Kit (QIAGEN); 7, QIAmp MinElute Virus Spin Kit (QIAGEN); 8, PureLink Viral RNA/DNA (Invitrogen Life Technologies, Grand Island, NY, USA); 9, TRIzol LS; 10, phenol chloroform.
    Figure Legend Snippet: Comparison of extraction methods used for development of tissue-based universal virus detection for viral metagenomics protocol. Copy numbers were measured by quantitative PCR in duplicate. RQ, relative quantification: RQ (2 – ΔΔCt); (ΔΔCt = Δ purified – Δ unprocessed). Lower panel left y-axis indicates signal-to-noise ratio (RQ) for all viruses tested. The method with the highest score was used to establish the protocol and is shaded in yellow. Red stars indicate highest scores. Diagonally striped area indicates not significant. Ct, cycle threshold. Numbers along baseline indicate method used. 1, Nucleospin RNA II (Macherey Nagel, Dueren, Germany); 2, Nucleospin DNA (Macherey Nagel); 3, RTP DNA/RNA Virus Ultra Sense (Invitek, Berlin Germany); 4, RTP DNA/RNA Virus Mini Kit (Invitek); 5, QIAmp UltraSens Virus Kit (QIAGEN, Hilden, Germany); 6, Viral Mini Kit (QIAGEN); 7, QIAmp MinElute Virus Spin Kit (QIAGEN); 8, PureLink Viral RNA/DNA (Invitrogen Life Technologies, Grand Island, NY, USA); 9, TRIzol LS; 10, phenol chloroform.

    Techniques Used: Real-time Polymerase Chain Reaction, Purification

    9) Product Images from "Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application"

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application

    Journal: BMC Genomics

    doi: 10.1186/s12864-017-4371-5

    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown
    Figure Legend Snippet: DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Techniques Used: DNA Purification, Chromatin Immunoprecipitation, Purification, Generated, Derivative Assay, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction

    10) Product Images from "Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application"

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application

    Journal: BMC Genomics

    doi: 10.1186/s12864-017-4371-5

    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown
    Figure Legend Snippet: DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Techniques Used: DNA Purification, Chromatin Immunoprecipitation, Purification, Generated, Derivative Assay, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction

    Related Articles

    Amplification:

    Article Title: Homozygous mdm2 SNP309 cancer cells with compromised transcriptional elongation at p53 target genes are sensitive to induction of p53-independent cell death
    Article Snippet: .. The DNA fragments were purified using the PCR Purification kit (Qiagen) according to manufacturer's protocol and amplified by quantitative PCR. .. Primer probe mixes used with Taqman Universal Master Mix as described in [ , ]: p21 p53RE (5′): Forward- GTGGCTCTGATTGGCTTTCTG Reverse- CTGAAAACAGGCAGCCCAAG Probe- TGGCATAGAAGAGGCTGGTGGC TATTTTG p21 TATA box: Forward- CGCGAGGATGCGTGTTC Reverse CATTCACCTGCCGCAGAAA Probe - CGGGTGTGTGC puma p53RE: Forward-GCGAGACTGTGGCCTTGTGT Reverse- CGTTCCAGGGTCCACAAAGT Probe- TGTGAGTACATCCTCTGGGCTC TGCCTG Primers used with SYBR Green PCR Master Mix (Applied Biosystems) as described in [ , ]: p21 +7011 F- CCTGGCTGACTTCTGCTGTCT p21 +7011 R- CGGCGTTTGGAGTGGTAGA puma +6014 F-AGGTGCTGCTCCGCCA puma +6014 R- CCCTCTGCCTCTCCAAGGTC

    In Vitro:

    Article Title: Selecting rRNA binding sites for the ribosomal proteins L4 and L6 from randomly fragmented rRNA: Application of a method called SERF
    Article Snippet: .. A 100-μl T7 in vitro transcription ( ) using the purified PCR product (Qiagen PCR purification kit; Chatsworth, CA) as template yielded 2.5 A260 units of rRNA fragments after gel purification. .. The ribosomal proteins were purified from total proteins of the 50S ribosomal subunit as described ( ) and were essentially pure as judged from Coomassie-stained two-dimensional gels.

    Isolation:

    Article Title: Generation and Characterization of an scFv Directed against Site II of Rabies Glycoprotein
    Article Snippet: .. The plasmid mini-prep kit for isolation of plasmid, gel extraction kit for extraction of DNA, PCR purification kit, HiFi Taq DNA polymerase, PCR reagents, and Ni-NTA agarose used for the purification of His- tagged proteins were purchased from Qiagen (Hilden, Germany). .. The bacterial strain (E. coli TG1) used for the propagation of phagemid vector pCANTAB 5E was purchased from Stratagene, USA.

    Purification:

    Article Title: SNIP1 Recruits TET2 to Regulate c-MYC Target Genes and Cellular DNA Damage Response
    Article Snippet: .. After cross-link reversal and proteinase K (TaKaRa) treatment, immunoprecipitated DNA was extracted with PCR Purification Kit (QIAGEN). .. After library construction, samples were sequenced in BasePair Biotechnology (Su Zhou, China) by Hiseq × 10 (illumina).

    Article Title: Generation and Characterization of an scFv Directed against Site II of Rabies Glycoprotein
    Article Snippet: .. The plasmid mini-prep kit for isolation of plasmid, gel extraction kit for extraction of DNA, PCR purification kit, HiFi Taq DNA polymerase, PCR reagents, and Ni-NTA agarose used for the purification of His- tagged proteins were purchased from Qiagen (Hilden, Germany). .. The bacterial strain (E. coli TG1) used for the propagation of phagemid vector pCANTAB 5E was purchased from Stratagene, USA.

    Article Title: Epigenetic regulatory elements associate with specific histone modifications to prevent silencing of telomeric genes
    Article Snippet: .. Precipitated DNA was recovered using the Qiagen PCR purification kit. .. Quantitative PCR where PPEff corresponds to the primer pair efficiency calculated using LinRegPCR software ( ).

    Article Title: Role of intragenic binding of cAMP responsive protein (CRP) in regulation of the succinate dehydrogenase genes Rv0249c-Rv0247c in TB complex mycobacteria
    Article Snippet: .. DNA was purified using PCR purification kit (QIAGEN). .. Briefly, sequencing was performed on the Illumina platform, using a GAIIx (Boston University, sequencing core).

    Article Title: Outer Membrane c-Type Cytochromes Required for Fe(III) and Mn(IV) Oxide Reduction in Geobacter sulfurreducens
    Article Snippet: .. Plasmid DNA purification was carried out using Mini plasmid purification kits and PCR purification kits (QIAGEN, Inc., Valencia, Calif.). .. The deletion mutants Δ omcT :: spec , ΔomcS :: spec , and Δ omcE :: kan were transformed with pMJG- omcS , pMJG- omcT , and pMJG- omcE , respectively, as previously described ( ).

    Article Title: Selecting rRNA binding sites for the ribosomal proteins L4 and L6 from randomly fragmented rRNA: Application of a method called SERF
    Article Snippet: .. A 100-μl T7 in vitro transcription ( ) using the purified PCR product (Qiagen PCR purification kit; Chatsworth, CA) as template yielded 2.5 A260 units of rRNA fragments after gel purification. .. The ribosomal proteins were purified from total proteins of the 50S ribosomal subunit as described ( ) and were essentially pure as judged from Coomassie-stained two-dimensional gels.

    Article Title: Homozygous mdm2 SNP309 cancer cells with compromised transcriptional elongation at p53 target genes are sensitive to induction of p53-independent cell death
    Article Snippet: .. The DNA fragments were purified using the PCR Purification kit (Qiagen) according to manufacturer's protocol and amplified by quantitative PCR. .. Primer probe mixes used with Taqman Universal Master Mix as described in [ , ]: p21 p53RE (5′): Forward- GTGGCTCTGATTGGCTTTCTG Reverse- CTGAAAACAGGCAGCCCAAG Probe- TGGCATAGAAGAGGCTGGTGGC TATTTTG p21 TATA box: Forward- CGCGAGGATGCGTGTTC Reverse CATTCACCTGCCGCAGAAA Probe - CGGGTGTGTGC puma p53RE: Forward-GCGAGACTGTGGCCTTGTGT Reverse- CGTTCCAGGGTCCACAAAGT Probe- TGTGAGTACATCCTCTGGGCTC TGCCTG Primers used with SYBR Green PCR Master Mix (Applied Biosystems) as described in [ , ]: p21 +7011 F- CCTGGCTGACTTCTGCTGTCT p21 +7011 R- CGGCGTTTGGAGTGGTAGA puma +6014 F-AGGTGCTGCTCCGCCA puma +6014 R- CCCTCTGCCTCTCCAAGGTC

    Real-time Polymerase Chain Reaction:

    Article Title: Homozygous mdm2 SNP309 cancer cells with compromised transcriptional elongation at p53 target genes are sensitive to induction of p53-independent cell death
    Article Snippet: .. The DNA fragments were purified using the PCR Purification kit (Qiagen) according to manufacturer's protocol and amplified by quantitative PCR. .. Primer probe mixes used with Taqman Universal Master Mix as described in [ , ]: p21 p53RE (5′): Forward- GTGGCTCTGATTGGCTTTCTG Reverse- CTGAAAACAGGCAGCCCAAG Probe- TGGCATAGAAGAGGCTGGTGGC TATTTTG p21 TATA box: Forward- CGCGAGGATGCGTGTTC Reverse CATTCACCTGCCGCAGAAA Probe - CGGGTGTGTGC puma p53RE: Forward-GCGAGACTGTGGCCTTGTGT Reverse- CGTTCCAGGGTCCACAAAGT Probe- TGTGAGTACATCCTCTGGGCTC TGCCTG Primers used with SYBR Green PCR Master Mix (Applied Biosystems) as described in [ , ]: p21 +7011 F- CCTGGCTGACTTCTGCTGTCT p21 +7011 R- CGGCGTTTGGAGTGGTAGA puma +6014 F-AGGTGCTGCTCCGCCA puma +6014 R- CCCTCTGCCTCTCCAAGGTC

    Immunoprecipitation:

    Article Title: SNIP1 Recruits TET2 to Regulate c-MYC Target Genes and Cellular DNA Damage Response
    Article Snippet: .. After cross-link reversal and proteinase K (TaKaRa) treatment, immunoprecipitated DNA was extracted with PCR Purification Kit (QIAGEN). .. After library construction, samples were sequenced in BasePair Biotechnology (Su Zhou, China) by Hiseq × 10 (illumina).

    DNA Purification:

    Article Title: Outer Membrane c-Type Cytochromes Required for Fe(III) and Mn(IV) Oxide Reduction in Geobacter sulfurreducens
    Article Snippet: .. Plasmid DNA purification was carried out using Mini plasmid purification kits and PCR purification kits (QIAGEN, Inc., Valencia, Calif.). .. The deletion mutants Δ omcT :: spec , ΔomcS :: spec , and Δ omcE :: kan were transformed with pMJG- omcS , pMJG- omcT , and pMJG- omcE , respectively, as previously described ( ).

    Polymerase Chain Reaction:

    Article Title: SNIP1 Recruits TET2 to Regulate c-MYC Target Genes and Cellular DNA Damage Response
    Article Snippet: .. After cross-link reversal and proteinase K (TaKaRa) treatment, immunoprecipitated DNA was extracted with PCR Purification Kit (QIAGEN). .. After library construction, samples were sequenced in BasePair Biotechnology (Su Zhou, China) by Hiseq × 10 (illumina).

    Article Title: Generation and Characterization of an scFv Directed against Site II of Rabies Glycoprotein
    Article Snippet: .. The plasmid mini-prep kit for isolation of plasmid, gel extraction kit for extraction of DNA, PCR purification kit, HiFi Taq DNA polymerase, PCR reagents, and Ni-NTA agarose used for the purification of His- tagged proteins were purchased from Qiagen (Hilden, Germany). .. The bacterial strain (E. coli TG1) used for the propagation of phagemid vector pCANTAB 5E was purchased from Stratagene, USA.

    Article Title: Epigenetic regulatory elements associate with specific histone modifications to prevent silencing of telomeric genes
    Article Snippet: .. Precipitated DNA was recovered using the Qiagen PCR purification kit. .. Quantitative PCR where PPEff corresponds to the primer pair efficiency calculated using LinRegPCR software ( ).

    Article Title: Role of intragenic binding of cAMP responsive protein (CRP) in regulation of the succinate dehydrogenase genes Rv0249c-Rv0247c in TB complex mycobacteria
    Article Snippet: .. DNA was purified using PCR purification kit (QIAGEN). .. Briefly, sequencing was performed on the Illumina platform, using a GAIIx (Boston University, sequencing core).

    Article Title: Outer Membrane c-Type Cytochromes Required for Fe(III) and Mn(IV) Oxide Reduction in Geobacter sulfurreducens
    Article Snippet: .. Plasmid DNA purification was carried out using Mini plasmid purification kits and PCR purification kits (QIAGEN, Inc., Valencia, Calif.). .. The deletion mutants Δ omcT :: spec , ΔomcS :: spec , and Δ omcE :: kan were transformed with pMJG- omcS , pMJG- omcT , and pMJG- omcE , respectively, as previously described ( ).

    Article Title: Selecting rRNA binding sites for the ribosomal proteins L4 and L6 from randomly fragmented rRNA: Application of a method called SERF
    Article Snippet: .. A 100-μl T7 in vitro transcription ( ) using the purified PCR product (Qiagen PCR purification kit; Chatsworth, CA) as template yielded 2.5 A260 units of rRNA fragments after gel purification. .. The ribosomal proteins were purified from total proteins of the 50S ribosomal subunit as described ( ) and were essentially pure as judged from Coomassie-stained two-dimensional gels.

    Article Title: Homozygous mdm2 SNP309 cancer cells with compromised transcriptional elongation at p53 target genes are sensitive to induction of p53-independent cell death
    Article Snippet: .. The DNA fragments were purified using the PCR Purification kit (Qiagen) according to manufacturer's protocol and amplified by quantitative PCR. .. Primer probe mixes used with Taqman Universal Master Mix as described in [ , ]: p21 p53RE (5′): Forward- GTGGCTCTGATTGGCTTTCTG Reverse- CTGAAAACAGGCAGCCCAAG Probe- TGGCATAGAAGAGGCTGGTGGC TATTTTG p21 TATA box: Forward- CGCGAGGATGCGTGTTC Reverse CATTCACCTGCCGCAGAAA Probe - CGGGTGTGTGC puma p53RE: Forward-GCGAGACTGTGGCCTTGTGT Reverse- CGTTCCAGGGTCCACAAAGT Probe- TGTGAGTACATCCTCTGGGCTC TGCCTG Primers used with SYBR Green PCR Master Mix (Applied Biosystems) as described in [ , ]: p21 +7011 F- CCTGGCTGACTTCTGCTGTCT p21 +7011 R- CGGCGTTTGGAGTGGTAGA puma +6014 F-AGGTGCTGCTCCGCCA puma +6014 R- CCCTCTGCCTCTCCAAGGTC

    Gel Extraction:

    Article Title: Generation and Characterization of an scFv Directed against Site II of Rabies Glycoprotein
    Article Snippet: .. The plasmid mini-prep kit for isolation of plasmid, gel extraction kit for extraction of DNA, PCR purification kit, HiFi Taq DNA polymerase, PCR reagents, and Ni-NTA agarose used for the purification of His- tagged proteins were purchased from Qiagen (Hilden, Germany). .. The bacterial strain (E. coli TG1) used for the propagation of phagemid vector pCANTAB 5E was purchased from Stratagene, USA.

    Plasmid Preparation:

    Article Title: Generation and Characterization of an scFv Directed against Site II of Rabies Glycoprotein
    Article Snippet: .. The plasmid mini-prep kit for isolation of plasmid, gel extraction kit for extraction of DNA, PCR purification kit, HiFi Taq DNA polymerase, PCR reagents, and Ni-NTA agarose used for the purification of His- tagged proteins were purchased from Qiagen (Hilden, Germany). .. The bacterial strain (E. coli TG1) used for the propagation of phagemid vector pCANTAB 5E was purchased from Stratagene, USA.

    Article Title: Outer Membrane c-Type Cytochromes Required for Fe(III) and Mn(IV) Oxide Reduction in Geobacter sulfurreducens
    Article Snippet: .. Plasmid DNA purification was carried out using Mini plasmid purification kits and PCR purification kits (QIAGEN, Inc., Valencia, Calif.). .. The deletion mutants Δ omcT :: spec , ΔomcS :: spec , and Δ omcE :: kan were transformed with pMJG- omcS , pMJG- omcT , and pMJG- omcE , respectively, as previously described ( ).

    Gel Purification:

    Article Title: Selecting rRNA binding sites for the ribosomal proteins L4 and L6 from randomly fragmented rRNA: Application of a method called SERF
    Article Snippet: .. A 100-μl T7 in vitro transcription ( ) using the purified PCR product (Qiagen PCR purification kit; Chatsworth, CA) as template yielded 2.5 A260 units of rRNA fragments after gel purification. .. The ribosomal proteins were purified from total proteins of the 50S ribosomal subunit as described ( ) and were essentially pure as judged from Coomassie-stained two-dimensional gels.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • minelute pcr purification kit  (Qiagen)
    99
    Qiagen minelute pcr purification kit
    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and <t>PCR</t> Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, <t>MinElute</t> PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown
    Minelute Pcr Purification Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 3006 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/minelute pcr purification kit/product/Qiagen
    Average 99 stars, based on 3006 article reviews
    Price from $9.99 to $1999.99
    minelute pcr purification kit - by Bioz Stars, 2021-01
    99/100 stars
    		  Buy from Supplier

    Image Search Results


    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Journal: BMC Genomics

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application

    doi: 10.1186/s12864-017-4371-5

    Figure Lengend Snippet: DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Article Snippet: The ChIP DNA Clean & Concentrator™ (Zymo Research; Zy), the Monarch® PCR & DNA Cleanup Kit (New England Biolabs; Ne), the MinElute PCR Purification Kit (Qiagen, Qm), the QIAquick PCR Purification Kit (Qiagen; Qp), the Agencourt AMPure XP kit (Beckman; Ba) and the RNAClean™ XP kit (Beckman; Br), and phenol/chloroform extraction (Invitrogen; PC) performed well with de-crosslinked chromatin.

    Techniques: DNA Purification, Chromatin Immunoprecipitation, Purification, Generated, Derivative Assay, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction