minelute columns  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    MinElute Gel Extraction Kit
    Description:

    Catalog Number:
    28604
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    Qiagen minelute columns

    https://www.bioz.com/result/minelute columns/product/Qiagen
    Average 99 stars, based on 110 article reviews
    Price from $9.99 to $1999.99
    minelute columns - by Bioz Stars, 2019-12
    99/100 stars

    Images

    Related Articles

    Diagnostic Assay:

    Article Title: Origin and Evolution of Japanese Encephalitis Virus in Southeast Asia
    Article Snippet: RT-PCR products were purified by using the QIAGEN gel extraction kit. .. Purified cDNA was directly sequenced in both directions by using the appropriate sense and antisense primers and were ligated into pGEM-T Easy vector according to the manufacturer's protocol (Promega Corp., Madison, Wis.).

    Clone Assay:

    Article Title: Cell surface display of chimeric glycoproteins via the S-layer of Paenibacillus alvei
    Article Snippet: The MinElute gel extraction kit (Qiagen, Vienna, Austria) was used to purify DNA fragments from agarose gels, and the MinElute reaction cleanup kit (Qiagen) was used to purify digested oligonucleotides and plasmids. .. The MinElute gel extraction kit (Qiagen, Vienna, Austria) was used to purify DNA fragments from agarose gels, and the MinElute reaction cleanup kit (Qiagen) was used to purify digested oligonucleotides and plasmids.

    Article Title: Autographa californica Multiple Nucleopolyhedrovirus Ac92 (ORF92, P33) Is Required for Budded Virus Production and Multiply Enveloped Occlusion-Derived Virus Formation
    Article Snippet: 5′ rapid amplification of cDNA 5′ ends (RACE) was performed using a 5′ RACE system kit, version 2.0, according to the handbook provided (Invitrogen). ac92 -specific reverse primer Ac92SP1 (5′-CCATATCGTCGATGATGAG-3′) and Ac92SP2 (5′-CCCATATGGTAGTAAACG-3′) were used for PCR amplification. .. PCR products were gel purified with a gel extraction kit (Qiagen) and cloned into pCRII (Invitrogen) prior to derivation of the nucleotide sequence. .. A monolayer of Sf9 cells (1.0 × 106 ) was infected at an MOI of 5 with Ac92HARep-PG, an ac92 -knockout bacmid expressing ac92 at a different locus (see below).

    Article Title: A Single-Electron Reducing Quinone Oxidoreductase Is Necessary to Induce Haustorium Development in the Root Parasitic Plant Triphysaria
    Article Snippet: The mas-YFP fusion was then cloned into the Sac I site of pHellsgate8 to allow visual screening of transgenic roots ( ). .. The PCR products were gel purified using a Qiagen gel extraction kit and recombined into the Gateway donor vector pDONR211 following the manufacturer's protocols (Invitrogen).

    Article Title: Origin and Evolution of Japanese Encephalitis Virus in Southeast Asia
    Article Snippet: RT-PCR products were purified by using the QIAGEN gel extraction kit. .. Plasmids were screened for possession of the insert by diagnostic restriction digests with Eco RI.

    Amplification:

    Article Title: Comparison of Real-Time Multiplex Human Papillomavirus (HPV) PCR Assays with the Linear Array HPV Genotyping PCR Assay and Influence of DNA Extraction Method on HPV Detection
    Article Snippet: With this specimen set, multiplex HPV PCR was performed as per its standard real-time amplification/detection protocol, Linear Array was performed as per its standard amplification and detection protocols, and Linear Array was performed per a modified amplification and detection protocol, such that DNA input would be equal to that of multiplex HPV PCR. .. Subsequently, an additional DNA extraction technique was used with specimens extracted by the Qiagen MinElute kit, the preferred process cited in the manufacturer's protocol for the Linear Array.

    Article Title: Autographa californica Multiple Nucleopolyhedrovirus Ac92 (ORF92, P33) Is Required for Budded Virus Production and Multiply Enveloped Occlusion-Derived Virus Formation
    Article Snippet: 5′ rapid amplification of cDNA 5′ ends (RACE) was performed using a 5′ RACE system kit, version 2.0, according to the handbook provided (Invitrogen). ac92 -specific reverse primer Ac92SP1 (5′-CCATATCGTCGATGATGAG-3′) and Ac92SP2 (5′-CCCATATGGTAGTAAACG-3′) were used for PCR amplification. .. PCR products were gel purified with a gel extraction kit (Qiagen) and cloned into pCRII (Invitrogen) prior to derivation of the nucleotide sequence.

    Article Title: A Single-Electron Reducing Quinone Oxidoreductase Is Necessary to Induce Haustorium Development in the Root Parasitic Plant Triphysaria
    Article Snippet: A 300-nucleotide region toward the 3′ end of the QR1 open reading frame and a 436-nucleotide region toward the 5′ end of QR2 open reading frame were amplified by PCR using primers modified with attB recombinase sites. .. The PCR products were gel purified using a Qiagen gel extraction kit and recombined into the Gateway donor vector pDONR211 following the manufacturer's protocols (Invitrogen).

    Article Title: A Functional Single-Nucleotide Polymorphism in the TRPC6 Gene Promoter Associated With Idiopathic Pulmonary Arterial Hypertension
    Article Snippet: PCR amplification of genomic DNA encoding the putative TRPC6 promoter region was performed by a GeneAmp PCR System (Perkin Elmer) using a Platinum PCR Supermix Kit (Invitrogen). .. The PCR products were detected by agarose gel electrophoresis, purified with a Gel extraction kit (Qiagen), and sequenced.

    Article Title: Origin and Evolution of Japanese Encephalitis Virus in Southeast Asia
    Article Snippet: RNA was reverse transcribed by using RAV2 reverse transcriptase (RT; Amersham Pharmacia Biotech Inc., Piscataway, N.J.) and was PCR amplified by using Taq DNA polymerase (Roche Diagnostics Corp.). .. RT-PCR products were purified by using the QIAGEN gel extraction kit.

    Article Title: Genetic divergence and geographic variation in the deep-water Conus orbignyi complex (Mollusca: Conoidea)
    Article Snippet: Amplification consisted of an initial denaturation step at 95°C for 5 min, followed by 35 cycles of denaturation at 95°C for 1min, annealing at 50°C for the COI gene, 61°C for the ITS2 gene, 54°C for 12S gene and 52°C for 16S for 30s, followed by extension at 68°C for 30sec. .. PCR products were purified using the Qiagen gel extraction kit (Qiagen, CA, USA) or the High Pure PCR Product Purification Kit and sequenced by the Health Sciences Center Core Sequencing Facility, University of Utah.

    Article Title: Rapid Mapping and Identification of Mutations in Caenorhabditis elegans by Restriction Site-Associated DNA Mapping and Genomic Interval Pull-Down Sequencing
    Article Snippet: The following cycling conditions were used for PCR: 98° for 2 min, 15 cycles of 98° for 10 sec, 65° for 30 sec, and 72° for 15 sec. .. Following amplification, samples were size separated by agarose gel electrophoresis, and fragments between 150 and 500 bp were purified with a Gel Extraction kit (Qiagen). .. DNA preps homologous to the targeted genomic interval were prepared from genomic fosmids, using a nearly genome-wide fosmid library for C. elegans that was developed by the Genome Sciences Centre in Vancouver, BC, Canada.

    Article Title: Characterization of β-catenin expression in canine osteosarcoma
    Article Snippet: Cycling conditions were 95 °C for 15 min, 90 cycles of 95 °C for 1 min, 58 °C for 1 min and 72 °C for 1 min, followed by 72 °C for 10 min. Polymerase chain reaction products were visualized on a 1% agarose gel containing 0.1% ethidium bromide. .. The Qiagen Gel Extraction Kit (#28404) was used to extract the amplified β -catenin exon 3 from the gel. .. The extracted product was concentrated by ethanol precipitation and resuspended in tris-ethylenediaminetetraacetic acid buffer.

    Article Title: Inflammation-associated DNA methylation patterns in epithelium of ulcerative colitis
    Article Snippet: All subsequent protocol steps up to polymerase chain reaction (PCR) amplification were performed using the HELP-tagging library preparation protocol developed by Suzuki et al. .. The PCR product was extracted from a 3.5% low molecular weight agarose gel electrophoresis and purified by Mini-Elute gel Extraction Kit (Qiagen).

    Article Title: Modulation of the Tumor Suppressor Protein ?-Catenin by Ischemic Microenvironment
    Article Snippet: Paragraph title: PCR Amplification and Sequences Analysis ... Genomic DNA was isolated from cultured cells using an extraction kit (Qiagen, Hilden, Germany).

    Article Title: Simian T-Cell Leukemia Virus (STLV) Infection in Wild Primate Populations in Cameroon: Evidence for Dual STLV Type 1 and Type 3 Infection in Agile Mangabeys (Cercocebus agilis)
    Article Snippet: DNA was isolated from whole blood or peripheral blood mononuclear cells using Qiagen DNA extraction kits (Qiagen, Courtaboeuf, France). .. DNA was isolated from whole blood or peripheral blood mononuclear cells using Qiagen DNA extraction kits (Qiagen, Courtaboeuf, France).

    Synthesized:

    Article Title: A Single-Electron Reducing Quinone Oxidoreductase Is Necessary to Induce Haustorium Development in the Root Parasitic Plant Triphysaria
    Article Snippet: The PCR products were gel purified using a Qiagen gel extraction kit and recombined into the Gateway donor vector pDONR211 following the manufacturer's protocols (Invitrogen). .. The PCR products were gel purified using a Qiagen gel extraction kit and recombined into the Gateway donor vector pDONR211 following the manufacturer's protocols (Invitrogen).

    Blocking Assay:

    Article Title: Mechanism of the ATP-dependent DNA End Resection Machinery from S. cerevisiae
    Article Snippet: The substrates were purified from 1% agarose gels with the Gel Extraction kit (Qiagen). .. The substrate in was generated using the same template and primers, except with the first primer being biotinylated at the 5′ end.

    SYBR Green Assay:

    Article Title: Mesodermal iPSC–derived progenitor cells functionally regenerate cardiac and skeletal muscle
    Article Snippet: The initial sonicated gDNA fragment suspension (5 μl of 100 μl) was used as a reference input. .. Purification of ChIP and input DNA was performed using a MinElute kit (QIAGEN), and quantification as a percentage of input was performed by SYBR Green qPCR under the conditions described above. .. Statistical analysis was performed using three qPCR replicates per cell clone (3 clones per cell type obtained from independent donors).

    Microarray:

    Article Title: Response of Staphylococcus aureus to Subinhibitory Concentrations of a Sequence-Selective, DNA Minor Groove Cross-Linking Pyrrolobenzodiazepine Dimer
    Article Snippet: Mixtures were incubated for 5 min at RT, centrifuged, RNA isolated from pellets with FastRNA® Pro Blue kit (Qbiogen) and treated with DNase I. RNA aliquots (5 μg) were labeled with Cy5 dye (GE Healthcare) concomitant with reverse transcription into cDNA. .. EMRSA-16 genomic DNA was used as reference; DNA concentration was measured (OD260 ) and 1 μg fluorescently labeled with Cy3 dye (GE Healthcare). cDNA was purified using a MinElute kit (Qiagen), probes pooled, hybridised overnight to the S. aureus microarray at 65 °C and subjected to stringent washing. .. Hybridization data was analyzed using an Affymetrix 428 scanner then quantified using Bluefuse for Microarrays 3.5 software (BlueGnome).

    Incubation:

    Article Title: Response of Staphylococcus aureus to Subinhibitory Concentrations of a Sequence-Selective, DNA Minor Groove Cross-Linking Pyrrolobenzodiazepine Dimer
    Article Snippet: Mixtures were incubated for 5 min at RT, centrifuged, RNA isolated from pellets with FastRNA® Pro Blue kit (Qbiogen) and treated with DNase I. RNA aliquots (5 μg) were labeled with Cy5 dye (GE Healthcare) concomitant with reverse transcription into cDNA. .. EMRSA-16 genomic DNA was used as reference; DNA concentration was measured (OD260 ) and 1 μg fluorescently labeled with Cy3 dye (GE Healthcare). cDNA was purified using a MinElute kit (Qiagen), probes pooled, hybridised overnight to the S. aureus microarray at 65 °C and subjected to stringent washing.

    Article Title: Mechanism of the ATP-dependent DNA End Resection Machinery from S. cerevisiae
    Article Snippet: The substrates were purified from 1% agarose gels with the Gel Extraction kit (Qiagen). .. The substrate in was generated using the same template and primers, except with the first primer being biotinylated at the 5′ end.

    Article Title: Regulation of heterochromatic DNA replication by histone H3 lysine 27 methyltransferases
    Article Snippet: For the recovery of the BIG fraction of DNA from the gel we diluted it 5 times with TE and incubated at 65°C until the agarose melted. .. For the recovery of the SMALL fraction of DNA from the gel we used Qiagen gel extraction kit and followed the manufacturer's instructions.

    Expressing:

    Article Title: Response of Staphylococcus aureus to Subinhibitory Concentrations of a Sequence-Selective, DNA Minor Groove Cross-Linking Pyrrolobenzodiazepine Dimer
    Article Snippet: EMRSA-16 genomic DNA was used as reference; DNA concentration was measured (OD260 ) and 1 μg fluorescently labeled with Cy3 dye (GE Healthcare). cDNA was purified using a MinElute kit (Qiagen), probes pooled, hybridised overnight to the S. aureus microarray at 65 °C and subjected to stringent washing. .. EMRSA-16 genomic DNA was used as reference; DNA concentration was measured (OD260 ) and 1 μg fluorescently labeled with Cy3 dye (GE Healthcare). cDNA was purified using a MinElute kit (Qiagen), probes pooled, hybridised overnight to the S. aureus microarray at 65 °C and subjected to stringent washing.

    Modification:

    Article Title: Comparison of Real-Time Multiplex Human Papillomavirus (HPV) PCR Assays with the Linear Array HPV Genotyping PCR Assay and Influence of DNA Extraction Method on HPV Detection
    Article Snippet: With this specimen set, multiplex HPV PCR was performed as per its standard real-time amplification/detection protocol, Linear Array was performed as per its standard amplification and detection protocols, and Linear Array was performed per a modified amplification and detection protocol, such that DNA input would be equal to that of multiplex HPV PCR. .. Subsequently, an additional DNA extraction technique was used with specimens extracted by the Qiagen MinElute kit, the preferred process cited in the manufacturer's protocol for the Linear Array.

    Article Title: A Single-Electron Reducing Quinone Oxidoreductase Is Necessary to Induce Haustorium Development in the Root Parasitic Plant Triphysaria
    Article Snippet: A 300-nucleotide region toward the 3′ end of the QR1 open reading frame and a 436-nucleotide region toward the 5′ end of QR2 open reading frame were amplified by PCR using primers modified with attB recombinase sites. .. The PCR products were gel purified using a Qiagen gel extraction kit and recombined into the Gateway donor vector pDONR211 following the manufacturer's protocols (Invitrogen).

    Article Title: Rapid Mapping and Identification of Mutations in Caenorhabditis elegans by Restriction Site-Associated DNA Mapping and Genomic Interval Pull-Down Sequencing
    Article Snippet: A total of 7 μl of 1-μM modified Illumina sequencing adapters were ligated to the sheared genomic fragments at 16° for 2 hr using 2000 units of T4 DNA ligase (New England Biolabs). .. Following amplification, samples were size separated by agarose gel electrophoresis, and fragments between 150 and 500 bp were purified with a Gel Extraction kit (Qiagen).

    Western Blot:

    Article Title: Mesodermal iPSC–derived progenitor cells functionally regenerate cardiac and skeletal muscle
    Article Snippet: Purification of ChIP and input DNA was performed using a MinElute kit (QIAGEN), and quantification as a percentage of input was performed by SYBR Green qPCR under the conditions described above. .. Statistical analysis was performed using three qPCR replicates per cell clone (3 clones per cell type obtained from independent donors).

    Article Title: Comparison of Various Sample Preparation Methods for PCR Diagnosis of Visceral Leishmaniasis Using Peripheral Blood
    Article Snippet: Finally, these methods were also compared to a commercial lysis and extraction kit (Qiagen), since the latter has the advantages of technical simplicity, speed, and greater safety. .. Thus, using PK-based methods with BC samples, the sensitivity of our PCR assay reached 10 parasites/ml of blood (and inconsistently 1 parasite/ml).

    Transformation Assay:

    Article Title: Cell surface display of chimeric glycoproteins via the S-layer of Paenibacillus alvei
    Article Snippet: The MinElute gel extraction kit (Qiagen, Vienna, Austria) was used to purify DNA fragments from agarose gels, and the MinElute reaction cleanup kit (Qiagen) was used to purify digested oligonucleotides and plasmids. .. The MinElute gel extraction kit (Qiagen, Vienna, Austria) was used to purify DNA fragments from agarose gels, and the MinElute reaction cleanup kit (Qiagen) was used to purify digested oligonucleotides and plasmids.

    Derivative Assay:

    Article Title: Origin and Evolution of Japanese Encephalitis Virus in Southeast Asia
    Article Snippet: Primers were designed to amplify overlapping fragments of the genome on the basis of a consensus alignment of complete JEV nucleotides available or on sequence of JKT6468 already derived. .. RT-PCR products were purified by using the QIAGEN gel extraction kit.

    Bisulfite Sequencing:

    Article Title: Mesodermal iPSC–derived progenitor cells functionally regenerate cardiac and skeletal muscle
    Article Snippet: Histone mark levels were assayed by ChIP on the same CpG islands assayed by bisulphite sequencing, adapting previously described conditions ( ) to 5 × 106 cell pellets. .. Purification of ChIP and input DNA was performed using a MinElute kit (QIAGEN), and quantification as a percentage of input was performed by SYBR Green qPCR under the conditions described above.

    Ligation:

    Article Title: Rapid Mapping and Identification of Mutations in Caenorhabditis elegans by Restriction Site-Associated DNA Mapping and Genomic Interval Pull-Down Sequencing
    Article Snippet: The purified ligation products were PCR amplified using Phusion high fidelity DNA polymerase (New England Biolabs) and the Illumina amplification primers 5′ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT 3′ and 5′ CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT 3′. .. Following amplification, samples were size separated by agarose gel electrophoresis, and fragments between 150 and 500 bp were purified with a Gel Extraction kit (Qiagen).

    Article Title: Inflammation-associated DNA methylation patterns in epithelium of ulcerative colitis
    Article Snippet: Adapter EcoP15I side (TS_AE adaptor) ligation was performed in a 13 μl reaction containing 2x Quick ligase buffer, 0.5 μl of TS_AE adaptor (0.1 μM), digested DNA and 1 μl of Quick Ligase for 15 min at room temperature. .. The PCR product was extracted from a 3.5% low molecular weight agarose gel electrophoresis and purified by Mini-Elute gel Extraction Kit (Qiagen).

    Cell Culture:

    Article Title: Modulation of the Tumor Suppressor Protein ?-Catenin by Ischemic Microenvironment
    Article Snippet: Slides were randomized, and the numbers of isolectin-positive blood vessel structures were counted in three separate areas of each section at ×10 magnification. .. Genomic DNA was isolated from cultured cells using an extraction kit (Qiagen, Hilden, Germany). .. Mutation analysis of codon Cyc767 of CTNA1 (accession number NC_00005.8) was performed by amplification of the 480-bp fragment using the following primers: Cta forward 5′-GCCACACTGAACCTTTCAGAAA-3′ and Cta reverse 5′-GCCTTTCAGCCCTTGCAGT-3′.

    Generated:

    Article Title: Mechanism of the ATP-dependent DNA End Resection Machinery from S. cerevisiae
    Article Snippet: The 1.9-kb internally labeled substrate was generated by PCR in the presence of [α-32 P]-dCTP (PerkinElmer) and 5′-GCCGAGCCATATGTCAAGTGAGTCAACAACT TTCATCGTGG-3′ and 5′-GCACGACTCGAGTTAATTATTGCTATTGTTTGGACTT CCCC-3′ as primers and the S. cerevisiae HDF2 gene as template. .. The substrates were purified from 1% agarose gels with the Gel Extraction kit (Qiagen).

    Article Title: Characterization of β-catenin expression in canine osteosarcoma
    Article Snippet: Forward and reverse primers were generated with the following sequences:(F) 5′-GGGTAGCACAAATTCAGGTGAATGC-3′ and (R) 5′-CATTCTGAGGCTCCTTGAGAGTT-3′ (Eurofms MWG Operon, Huntsville, AZ, USA). .. The Qiagen Gel Extraction Kit (#28404) was used to extract the amplified β -catenin exon 3 from the gel.

    Polymerase Chain Reaction:

    Article Title: Cell surface display of chimeric glycoproteins via the S-layer of Paenibacillus alvei
    Article Snippet: The MinElute gel extraction kit (Qiagen, Vienna, Austria) was used to purify DNA fragments from agarose gels, and the MinElute reaction cleanup kit (Qiagen) was used to purify digested oligonucleotides and plasmids. .. Transformation of E. coli DH5α was done according to the manufacturer’s protocol (Invitrogen).

    Article Title: Comparison of Real-Time Multiplex Human Papillomavirus (HPV) PCR Assays with the Linear Array HPV Genotyping PCR Assay and Influence of DNA Extraction Method on HPV Detection
    Article Snippet: With this specimen set, multiplex HPV PCR was performed as per its standard real-time amplification/detection protocol, Linear Array was performed as per its standard amplification and detection protocols, and Linear Array was performed per a modified amplification and detection protocol, such that DNA input would be equal to that of multiplex HPV PCR. .. Subsequently, an additional DNA extraction technique was used with specimens extracted by the Qiagen MinElute kit, the preferred process cited in the manufacturer's protocol for the Linear Array.

    Article Title: Response of Staphylococcus aureus to Subinhibitory Concentrations of a Sequence-Selective, DNA Minor Groove Cross-Linking Pyrrolobenzodiazepine Dimer
    Article Snippet: The BμG@S SAv1.1.0 microarray used in this study has been described elsewhere and contains PCR products representing all predicted open reading frames from the initial seven S. aureus genome sequencing projects. .. EMRSA-16 genomic DNA was used as reference; DNA concentration was measured (OD260 ) and 1 μg fluorescently labeled with Cy3 dye (GE Healthcare). cDNA was purified using a MinElute kit (Qiagen), probes pooled, hybridised overnight to the S. aureus microarray at 65 °C and subjected to stringent washing.

    Article Title: Mechanism of the ATP-dependent DNA End Resection Machinery from S. cerevisiae
    Article Snippet: The 1.9-kb internally labeled substrate was generated by PCR in the presence of [α-32 P]-dCTP (PerkinElmer) and 5′-GCCGAGCCATATGTCAAGTGAGTCAACAACT TTCATCGTGG-3′ and 5′-GCACGACTCGAGTTAATTATTGCTATTGTTTGGACTT CCCC-3′ as primers and the S. cerevisiae HDF2 gene as template. .. The substrates were purified from 1% agarose gels with the Gel Extraction kit (Qiagen).

    Article Title: Autographa californica Multiple Nucleopolyhedrovirus Ac92 (ORF92, P33) Is Required for Budded Virus Production and Multiply Enveloped Occlusion-Derived Virus Formation
    Article Snippet: 5′ rapid amplification of cDNA 5′ ends (RACE) was performed using a 5′ RACE system kit, version 2.0, according to the handbook provided (Invitrogen). ac92 -specific reverse primer Ac92SP1 (5′-CCATATCGTCGATGATGAG-3′) and Ac92SP2 (5′-CCCATATGGTAGTAAACG-3′) were used for PCR amplification. .. PCR products were gel purified with a gel extraction kit (Qiagen) and cloned into pCRII (Invitrogen) prior to derivation of the nucleotide sequence. .. A monolayer of Sf9 cells (1.0 × 106 ) was infected at an MOI of 5 with Ac92HARep-PG, an ac92 -knockout bacmid expressing ac92 at a different locus (see below).

    Article Title: A Single-Electron Reducing Quinone Oxidoreductase Is Necessary to Induce Haustorium Development in the Root Parasitic Plant Triphysaria
    Article Snippet: A 300-nucleotide region toward the 3′ end of the QR1 open reading frame and a 436-nucleotide region toward the 5′ end of QR2 open reading frame were amplified by PCR using primers modified with attB recombinase sites. .. The PCR products were gel purified using a Qiagen gel extraction kit and recombined into the Gateway donor vector pDONR211 following the manufacturer's protocols (Invitrogen). .. To make a hairpin targeted to both genes simultaneously, the 300-nucleotide QR1 and 436-nucleotide QR2 fragments were denatured and annealed with a single primer containing a 20-mer sequence homologous to the QR1 fragment and a 20-mer sequence homologous to the QR2 sequence.

    Article Title: A Functional Single-Nucleotide Polymorphism in the TRPC6 Gene Promoter Associated With Idiopathic Pulmonary Arterial Hypertension
    Article Snippet: PCR amplification of genomic DNA encoding the putative TRPC6 promoter region was performed by a GeneAmp PCR System (Perkin Elmer) using a Platinum PCR Supermix Kit (Invitrogen). .. The PCR products were detected by agarose gel electrophoresis, purified with a Gel extraction kit (Qiagen), and sequenced. .. The sequencing data were analyzed by Chromas software and compared with known SNPs deposited in the NCBI SNP databank.

    Article Title: Genetic divergence and geographic variation in the deep-water Conus orbignyi complex (Mollusca: Conoidea)
    Article Snippet: Amplification consisted of an initial denaturation step at 95°C for 5 min, followed by 35 cycles of denaturation at 95°C for 1min, annealing at 50°C for the COI gene, 61°C for the ITS2 gene, 54°C for 12S gene and 52°C for 16S for 30s, followed by extension at 68°C for 30sec. .. PCR products were purified using the Qiagen gel extraction kit (Qiagen, CA, USA) or the High Pure PCR Product Purification Kit and sequenced by the Health Sciences Center Core Sequencing Facility, University of Utah. .. In most cases, both directions were sequenced to confirm accuracy of each haplotype sequence.

    Article Title: NPAS3 Demonstrates Features of a Tumor Suppressive Role in Driving the Progression of Astrocytomas
    Article Snippet: A final extension of 5 minutes at 68°C was performed for each PCR reaction. .. PCR products were electrophoresed on 1% agarose gels, gel purified (Gel Extraction Kit; Qiagen GmbH), and sequenced using the forward and reverse primers that were used to produce each PCR product ( ). .. Chromatograms were analyzed using commercially available software (FinchTV, version1.4; Geospiza, Inc., Seattle, WA), and the sequences were subjected to alignment with wild-type sequence using FASTA ( ) to identify mutations.

    Article Title: Rapid Mapping and Identification of Mutations in Caenorhabditis elegans by Restriction Site-Associated DNA Mapping and Genomic Interval Pull-Down Sequencing
    Article Snippet: Following amplification, samples were size separated by agarose gel electrophoresis, and fragments between 150 and 500 bp were purified with a Gel Extraction kit (Qiagen). .. Following amplification, samples were size separated by agarose gel electrophoresis, and fragments between 150 and 500 bp were purified with a Gel Extraction kit (Qiagen).

    Article Title: Characterization of β-catenin expression in canine osteosarcoma
    Article Snippet: Cycling conditions were 95 °C for 15 min, 90 cycles of 95 °C for 1 min, 58 °C for 1 min and 72 °C for 1 min, followed by 72 °C for 10 min. Polymerase chain reaction products were visualized on a 1% agarose gel containing 0.1% ethidium bromide. .. The Qiagen Gel Extraction Kit (#28404) was used to extract the amplified β -catenin exon 3 from the gel.

    Article Title: Inflammation-associated DNA methylation patterns in epithelium of ulcerative colitis
    Article Snippet: Please refer to Supplementary Materials and Methods for the exact protocol description. .. The PCR product was extracted from a 3.5% low molecular weight agarose gel electrophoresis and purified by Mini-Elute gel Extraction Kit (Qiagen). .. Purified products were analyzed by Bioanalyzer to ensure integrity and purity followed by Illumina sequencing (end library size ∼160 bp).

    Article Title: A Sensitive Peptide Nucleic Acid Probe Assay for Detection of BRAF V600 Mutations in Melanoma
    Article Snippet: Genomic DNA from the tissues was extracted by Blood and Tissue Extraction kit (Qiagen, Valencia, CA, USA) following the manufacturer's instructions. .. Genomic DNA from the tissues was extracted by Blood and Tissue Extraction kit (Qiagen, Valencia, CA, USA) following the manufacturer's instructions.

    Article Title: Modulation of the Tumor Suppressor Protein ?-Catenin by Ischemic Microenvironment
    Article Snippet: Paragraph title: PCR Amplification and Sequences Analysis ... Genomic DNA was isolated from cultured cells using an extraction kit (Qiagen, Hilden, Germany).

    Article Title: Comparison of Various Sample Preparation Methods for PCR Diagnosis of Visceral Leishmaniasis Using Peripheral Blood
    Article Snippet: Finally, these methods were also compared to a commercial lysis and extraction kit (Qiagen), since the latter has the advantages of technical simplicity, speed, and greater safety. .. Overall, using the optimized PCR conditions developed in our laboratory, (i) the BC gave a 10-fold increase in sensitivity over that of WB, and (ii) PK-based methods proved clearly superior to GE-based methods.

    Article Title: Simian T-Cell Leukemia Virus (STLV) Infection in Wild Primate Populations in Cameroon: Evidence for Dual STLV Type 1 and Type 3 Infection in Agile Mangabeys (Cercocebus agilis)
    Article Snippet: Paragraph title: PCR. ... DNA was isolated from whole blood or peripheral blood mononuclear cells using Qiagen DNA extraction kits (Qiagen, Courtaboeuf, France).

    DNA Sequencing:

    Article Title: Characterization of β-catenin expression in canine osteosarcoma
    Article Snippet: The Qiagen Gel Extraction Kit (#28404) was used to extract the amplified β -catenin exon 3 from the gel. .. The extracted product was concentrated by ethanol precipitation and resuspended in tris-ethylenediaminetetraacetic acid buffer.

    Sequencing:

    Article Title: Cell surface display of chimeric glycoproteins via the S-layer of Paenibacillus alvei
    Article Snippet: The MinElute gel extraction kit (Qiagen, Vienna, Austria) was used to purify DNA fragments from agarose gels, and the MinElute reaction cleanup kit (Qiagen) was used to purify digested oligonucleotides and plasmids. .. Transformation of E. coli DH5α was done according to the manufacturer’s protocol (Invitrogen).

    Article Title: Response of Staphylococcus aureus to Subinhibitory Concentrations of a Sequence-Selective, DNA Minor Groove Cross-Linking Pyrrolobenzodiazepine Dimer
    Article Snippet: The BμG@S SAv1.1.0 microarray used in this study has been described elsewhere and contains PCR products representing all predicted open reading frames from the initial seven S. aureus genome sequencing projects. .. EMRSA-16 genomic DNA was used as reference; DNA concentration was measured (OD260 ) and 1 μg fluorescently labeled with Cy3 dye (GE Healthcare). cDNA was purified using a MinElute kit (Qiagen), probes pooled, hybridised overnight to the S. aureus microarray at 65 °C and subjected to stringent washing.

    Article Title: Autographa californica Multiple Nucleopolyhedrovirus Ac92 (ORF92, P33) Is Required for Budded Virus Production and Multiply Enveloped Occlusion-Derived Virus Formation
    Article Snippet: 5′ rapid amplification of cDNA 5′ ends (RACE) was performed using a 5′ RACE system kit, version 2.0, according to the handbook provided (Invitrogen). ac92 -specific reverse primer Ac92SP1 (5′-CCATATCGTCGATGATGAG-3′) and Ac92SP2 (5′-CCCATATGGTAGTAAACG-3′) were used for PCR amplification. .. PCR products were gel purified with a gel extraction kit (Qiagen) and cloned into pCRII (Invitrogen) prior to derivation of the nucleotide sequence. .. A monolayer of Sf9 cells (1.0 × 106 ) was infected at an MOI of 5 with Ac92HARep-PG, an ac92 -knockout bacmid expressing ac92 at a different locus (see below).

    Article Title: A Functional Single-Nucleotide Polymorphism in the TRPC6 Gene Promoter Associated With Idiopathic Pulmonary Arterial Hypertension
    Article Snippet: To identify SNPs in the 5′- promoter region of TRPC6 , approximately a 2000-bp size of TRPC6 5'-regulatory region sequence and total TRPC6 gene sequence were obtained from the human chromosome 11 clone: RP11−223E3 ( ) in human genomic database. .. The PCR products were detected by agarose gel electrophoresis, purified with a Gel extraction kit (Qiagen), and sequenced.

    Article Title: Origin and Evolution of Japanese Encephalitis Virus in Southeast Asia
    Article Snippet: Paragraph title: Virus culture, sequencing, and phylogenetic analysis. ... RT-PCR products were purified by using the QIAGEN gel extraction kit.

    Article Title: Genetic divergence and geographic variation in the deep-water Conus orbignyi complex (Mollusca: Conoidea)
    Article Snippet: Amplification consisted of an initial denaturation step at 95°C for 5 min, followed by 35 cycles of denaturation at 95°C for 1min, annealing at 50°C for the COI gene, 61°C for the ITS2 gene, 54°C for 12S gene and 52°C for 16S for 30s, followed by extension at 68°C for 30sec. .. PCR products were purified using the Qiagen gel extraction kit (Qiagen, CA, USA) or the High Pure PCR Product Purification Kit and sequenced by the Health Sciences Center Core Sequencing Facility, University of Utah. .. In most cases, both directions were sequenced to confirm accuracy of each haplotype sequence.

    Article Title: NPAS3 Demonstrates Features of a Tumor Suppressive Role in Driving the Progression of Astrocytomas
    Article Snippet: Paragraph title: DNA Sequence Mutation and Polymorphism Analysis ... PCR products were electrophoresed on 1% agarose gels, gel purified (Gel Extraction Kit; Qiagen GmbH), and sequenced using the forward and reverse primers that were used to produce each PCR product ( ).

    Article Title: Rapid Mapping and Identification of Mutations in Caenorhabditis elegans by Restriction Site-Associated DNA Mapping and Genomic Interval Pull-Down Sequencing
    Article Snippet: Paragraph title: Illumina sequencing of genomic intervals ... Following amplification, samples were size separated by agarose gel electrophoresis, and fragments between 150 and 500 bp were purified with a Gel Extraction kit (Qiagen).

    Article Title: Characterization of β-catenin expression in canine osteosarcoma
    Article Snippet: Primers to canine β -catenin exon 3 were designed to cover the intron/exon junction of exon 3 using the sequence information for canine β -catenin available from NCBI accession number (Fig. SI, Supporting Information). .. The Qiagen Gel Extraction Kit (#28404) was used to extract the amplified β -catenin exon 3 from the gel.

    Article Title: A Sensitive Peptide Nucleic Acid Probe Assay for Detection of BRAF V600 Mutations in Melanoma
    Article Snippet: Genomic DNA from the tissues was extracted by Blood and Tissue Extraction kit (Qiagen, Valencia, CA, USA) following the manufacturer's instructions. .. After PCR and melting analysis, mutation was identified by the appearance of a mutant melting peak.

    Article Title: Modulation of the Tumor Suppressor Protein ?-Catenin by Ischemic Microenvironment
    Article Snippet: Genomic DNA was isolated from cultured cells using an extraction kit (Qiagen, Hilden, Germany). .. PCR amplification was performed using Phusion high-fidelity DNA polymerase enzyme (New England Biolabs, Ipswich, MA) under the following conditions: one cycle at 98°C for 30 seconds, 35 cycles of 10 seconds at 98°C, 20 seconds at 64°C for CTNA1 , 52°C for KRAS , and 20 seconds at 72°C, followed by a final cycle of 5 minutes at 72°C.

    Sonication:

    Article Title: Mesodermal iPSC–derived progenitor cells functionally regenerate cardiac and skeletal muscle
    Article Snippet: The initial sonicated gDNA fragment suspension (5 μl of 100 μl) was used as a reference input. .. Purification of ChIP and input DNA was performed using a MinElute kit (QIAGEN), and quantification as a percentage of input was performed by SYBR Green qPCR under the conditions described above.

    Recombinant:

    Article Title: Cell surface display of chimeric glycoproteins via the S-layer of Paenibacillus alvei
    Article Snippet: The MinElute gel extraction kit (Qiagen, Vienna, Austria) was used to purify DNA fragments from agarose gels, and the MinElute reaction cleanup kit (Qiagen) was used to purify digested oligonucleotides and plasmids. .. Transformation of E. coli DH5α was done according to the manufacturer’s protocol (Invitrogen).

    Molecular Weight:

    Article Title: Inflammation-associated DNA methylation patterns in epithelium of ulcerative colitis
    Article Snippet: Please refer to Supplementary Materials and Methods for the exact protocol description. .. The PCR product was extracted from a 3.5% low molecular weight agarose gel electrophoresis and purified by Mini-Elute gel Extraction Kit (Qiagen). .. Purified products were analyzed by Bioanalyzer to ensure integrity and purity followed by Illumina sequencing (end library size ∼160 bp).

    DNA Extraction:

    Article Title: Comparison of Real-Time Multiplex Human Papillomavirus (HPV) PCR Assays with the Linear Array HPV Genotyping PCR Assay and Influence of DNA Extraction Method on HPV Detection
    Article Snippet: With this specimen set, multiplex HPV PCR was performed as per its standard real-time amplification/detection protocol, Linear Array was performed as per its standard amplification and detection protocols, and Linear Array was performed per a modified amplification and detection protocol, such that DNA input would be equal to that of multiplex HPV PCR. .. Subsequently, an additional DNA extraction technique was used with specimens extracted by the Qiagen MinElute kit, the preferred process cited in the manufacturer's protocol for the Linear Array. .. With this specimen set, both the multiplex HPV PCR and Linear Array assays were run as per their standard amplification and detection protocols.

    Article Title: Genetic divergence and geographic variation in the deep-water Conus orbignyi complex (Mollusca: Conoidea)
    Article Snippet: Paragraph title: DNA extraction and sequencing ... PCR products were purified using the Qiagen gel extraction kit (Qiagen, CA, USA) or the High Pure PCR Product Purification Kit and sequenced by the Health Sciences Center Core Sequencing Facility, University of Utah.

    Article Title: Comparison of Various Sample Preparation Methods for PCR Diagnosis of Visceral Leishmaniasis Using Peripheral Blood
    Article Snippet: For DNA extraction, the most widely used method is the classical ΦC, which, even if simplified for routine hospital diagnosis, remains among the most efficient methods ( , , ) and is cheap compared with commercial kits. .. Finally, these methods were also compared to a commercial lysis and extraction kit (Qiagen), since the latter has the advantages of technical simplicity, speed, and greater safety.

    Article Title: Simian T-Cell Leukemia Virus (STLV) Infection in Wild Primate Populations in Cameroon: Evidence for Dual STLV Type 1 and Type 3 Infection in Agile Mangabeys (Cercocebus agilis)
    Article Snippet: In addition to these HTLV antigens, control lines are present on each strip: one sample addition line (3+) containing anti-human immunoglobulin (Ig) and two test performance lines (1+ and +/−) containing human IgG. .. DNA was isolated from whole blood or peripheral blood mononuclear cells using Qiagen DNA extraction kits (Qiagen, Courtaboeuf, France). .. To confirm the presence of PTLVs in samples with HTLV-cross-reactive antibodies, a previously described diagnostic tax-rex PCR allowing generic as well as type-specific detection of PTLVs was done ( ).

    Methylation:

    Article Title: Mesodermal iPSC–derived progenitor cells functionally regenerate cardiac and skeletal muscle
    Article Snippet: Statistical analysis was performed on average methylation values of 5 sequences per cell clone (3 clones per cell type obtained from independent donors). .. Purification of ChIP and input DNA was performed using a MinElute kit (QIAGEN), and quantification as a percentage of input was performed by SYBR Green qPCR under the conditions described above.

    Mutagenesis:

    Article Title: Effect of Reaction Conditions and 3AB on the Mutation Rate of Poliovirus RNA-Dependent RNA Polymerase in a ?-Complementation Assay
    Article Snippet: DNA was recovered using a Qiagen gel extraction kit and treated with 5 U of CIP for 2 hours at 37°C. .. The quality of the vectors for the fidelity assay was assessed by re-ligating the cleaved vector and PvuII-EcoRI vector fragment (recovered from agarose gels after cleavage of pBSΔPvuII1146 ) as described below.

    Article Title: NPAS3 Demonstrates Features of a Tumor Suppressive Role in Driving the Progression of Astrocytomas
    Article Snippet: Paragraph title: DNA Sequence Mutation and Polymorphism Analysis ... PCR products were electrophoresed on 1% agarose gels, gel purified (Gel Extraction Kit; Qiagen GmbH), and sequenced using the forward and reverse primers that were used to produce each PCR product ( ).

    Article Title: A Sensitive Peptide Nucleic Acid Probe Assay for Detection of BRAF V600 Mutations in Melanoma
    Article Snippet: Different amounts of mutant genomic DNA from the HT-29 cell line (with a heterozygous BRAF c.1799T > A mutation, correlated to p.V600E) were added to 100 ng genomic DNA from the TSGH cell line (with wild-type BRAF ), generating mutant percentages ranging from 0.05% to 50%. .. Genomic DNA from the tissues was extracted by Blood and Tissue Extraction kit (Qiagen, Valencia, CA, USA) following the manufacturer's instructions.

    Isolation:

    Article Title: Cell surface display of chimeric glycoproteins via the S-layer of Paenibacillus alvei
    Article Snippet: Genomic DNA of P. alvei CCM 2051T was isolated as described recently. .. The MinElute gel extraction kit (Qiagen, Vienna, Austria) was used to purify DNA fragments from agarose gels, and the MinElute reaction cleanup kit (Qiagen) was used to purify digested oligonucleotides and plasmids.

    Article Title: Comparison of Real-Time Multiplex Human Papillomavirus (HPV) PCR Assays with the Linear Array HPV Genotyping PCR Assay and Influence of DNA Extraction Method on HPV Detection
    Article Snippet: Initially, the DNA extraction technique was held as a constant, with DNA isolated from swab specimens using the Qiagen Spin blood kit, the preferred process for use with multiplex HPV PCR. .. Subsequently, an additional DNA extraction technique was used with specimens extracted by the Qiagen MinElute kit, the preferred process cited in the manufacturer's protocol for the Linear Array.

    Article Title: Response of Staphylococcus aureus to Subinhibitory Concentrations of a Sequence-Selective, DNA Minor Groove Cross-Linking Pyrrolobenzodiazepine Dimer
    Article Snippet: Mixtures were incubated for 5 min at RT, centrifuged, RNA isolated from pellets with FastRNA® Pro Blue kit (Qbiogen) and treated with DNase I. RNA aliquots (5 μg) were labeled with Cy5 dye (GE Healthcare) concomitant with reverse transcription into cDNA. .. EMRSA-16 genomic DNA was used as reference; DNA concentration was measured (OD260 ) and 1 μg fluorescently labeled with Cy3 dye (GE Healthcare). cDNA was purified using a MinElute kit (Qiagen), probes pooled, hybridised overnight to the S. aureus microarray at 65 °C and subjected to stringent washing.

    Article Title: Origin and Evolution of Japanese Encephalitis Virus in Southeast Asia
    Article Snippet: JEV strain JKT6468, isolated in 1981 from C. tritaeniorhynchus mosquitoes in Flores, Indonesia, was inoculated onto confluent monolayers of C6/36 cells in 2% fetal calf serum. .. RT-PCR products were purified by using the QIAGEN gel extraction kit.

    Article Title: Modulation of the Tumor Suppressor Protein ?-Catenin by Ischemic Microenvironment
    Article Snippet: Slides were randomized, and the numbers of isolectin-positive blood vessel structures were counted in three separate areas of each section at ×10 magnification. .. Genomic DNA was isolated from cultured cells using an extraction kit (Qiagen, Hilden, Germany). .. Mutation analysis of codon Cyc767 of CTNA1 (accession number NC_00005.8) was performed by amplification of the 480-bp fragment using the following primers: Cta forward 5′-GCCACACTGAACCTTTCAGAAA-3′ and Cta reverse 5′-GCCTTTCAGCCCTTGCAGT-3′.

    Article Title: Simian T-Cell Leukemia Virus (STLV) Infection in Wild Primate Populations in Cameroon: Evidence for Dual STLV Type 1 and Type 3 Infection in Agile Mangabeys (Cercocebus agilis)
    Article Snippet: In addition to these HTLV antigens, control lines are present on each strip: one sample addition line (3+) containing anti-human immunoglobulin (Ig) and two test performance lines (1+ and +/−) containing human IgG. .. DNA was isolated from whole blood or peripheral blood mononuclear cells using Qiagen DNA extraction kits (Qiagen, Courtaboeuf, France). .. To confirm the presence of PTLVs in samples with HTLV-cross-reactive antibodies, a previously described diagnostic tax-rex PCR allowing generic as well as type-specific detection of PTLVs was done ( ).

    Detection Assay:

    Article Title: Comparison of Real-Time Multiplex Human Papillomavirus (HPV) PCR Assays with the Linear Array HPV Genotyping PCR Assay and Influence of DNA Extraction Method on HPV Detection
    Article Snippet: Subsequently, an additional DNA extraction technique was used with specimens extracted by the Qiagen MinElute kit, the preferred process cited in the manufacturer's protocol for the Linear Array. .. With this specimen set, both the multiplex HPV PCR and Linear Array assays were run as per their standard amplification and detection protocols.

    Size-exclusion Chromatography:

    Article Title: Rapid Mapping and Identification of Mutations in Caenorhabditis elegans by Restriction Site-Associated DNA Mapping and Genomic Interval Pull-Down Sequencing
    Article Snippet: Following amplification, samples were size separated by agarose gel electrophoresis, and fragments between 150 and 500 bp were purified with a Gel Extraction kit (Qiagen). .. Following amplification, samples were size separated by agarose gel electrophoresis, and fragments between 150 and 500 bp were purified with a Gel Extraction kit (Qiagen).

    Labeling:

    Article Title: Response of Staphylococcus aureus to Subinhibitory Concentrations of a Sequence-Selective, DNA Minor Groove Cross-Linking Pyrrolobenzodiazepine Dimer
    Article Snippet: Mixtures were incubated for 5 min at RT, centrifuged, RNA isolated from pellets with FastRNA® Pro Blue kit (Qbiogen) and treated with DNase I. RNA aliquots (5 μg) were labeled with Cy5 dye (GE Healthcare) concomitant with reverse transcription into cDNA. .. EMRSA-16 genomic DNA was used as reference; DNA concentration was measured (OD260 ) and 1 μg fluorescently labeled with Cy3 dye (GE Healthcare). cDNA was purified using a MinElute kit (Qiagen), probes pooled, hybridised overnight to the S. aureus microarray at 65 °C and subjected to stringent washing. .. Hybridization data was analyzed using an Affymetrix 428 scanner then quantified using Bluefuse for Microarrays 3.5 software (BlueGnome).

    Article Title: Mechanism of the ATP-dependent DNA End Resection Machinery from S. cerevisiae
    Article Snippet: The 1.9-kb internally labeled substrate was generated by PCR in the presence of [α-32 P]-dCTP (PerkinElmer) and 5′-GCCGAGCCATATGTCAAGTGAGTCAACAACT TTCATCGTGG-3′ and 5′-GCACGACTCGAGTTAATTATTGCTATTGTTTGGACTT CCCC-3′ as primers and the S. cerevisiae HDF2 gene as template. .. The substrates were purified from 1% agarose gels with the Gel Extraction kit (Qiagen).

    Purification:

    Article Title: Response of Staphylococcus aureus to Subinhibitory Concentrations of a Sequence-Selective, DNA Minor Groove Cross-Linking Pyrrolobenzodiazepine Dimer
    Article Snippet: Mixtures were incubated for 5 min at RT, centrifuged, RNA isolated from pellets with FastRNA® Pro Blue kit (Qbiogen) and treated with DNase I. RNA aliquots (5 μg) were labeled with Cy5 dye (GE Healthcare) concomitant with reverse transcription into cDNA. .. EMRSA-16 genomic DNA was used as reference; DNA concentration was measured (OD260 ) and 1 μg fluorescently labeled with Cy3 dye (GE Healthcare). cDNA was purified using a MinElute kit (Qiagen), probes pooled, hybridised overnight to the S. aureus microarray at 65 °C and subjected to stringent washing. .. Hybridization data was analyzed using an Affymetrix 428 scanner then quantified using Bluefuse for Microarrays 3.5 software (BlueGnome).

    Article Title: Mesodermal iPSC–derived progenitor cells functionally regenerate cardiac and skeletal muscle
    Article Snippet: The initial sonicated gDNA fragment suspension (5 μl of 100 μl) was used as a reference input. .. Purification of ChIP and input DNA was performed using a MinElute kit (QIAGEN), and quantification as a percentage of input was performed by SYBR Green qPCR under the conditions described above. .. Statistical analysis was performed using three qPCR replicates per cell clone (3 clones per cell type obtained from independent donors).

    Article Title: Mechanism of the ATP-dependent DNA End Resection Machinery from S. cerevisiae
    Article Snippet: The 1.9-kb internally labeled substrate was generated by PCR in the presence of [α-32 P]-dCTP (PerkinElmer) and 5′-GCCGAGCCATATGTCAAGTGAGTCAACAACT TTCATCGTGG-3′ and 5′-GCACGACTCGAGTTAATTATTGCTATTGTTTGGACTT CCCC-3′ as primers and the S. cerevisiae HDF2 gene as template. .. The substrates were purified from 1% agarose gels with the Gel Extraction kit (Qiagen). .. The substrate in was generated using the same template and primers, except with the first primer being biotinylated at the 5′ end.

    Article Title: Autographa californica Multiple Nucleopolyhedrovirus Ac92 (ORF92, P33) Is Required for Budded Virus Production and Multiply Enveloped Occlusion-Derived Virus Formation
    Article Snippet: 5′ rapid amplification of cDNA 5′ ends (RACE) was performed using a 5′ RACE system kit, version 2.0, according to the handbook provided (Invitrogen). ac92 -specific reverse primer Ac92SP1 (5′-CCATATCGTCGATGATGAG-3′) and Ac92SP2 (5′-CCCATATGGTAGTAAACG-3′) were used for PCR amplification. .. PCR products were gel purified with a gel extraction kit (Qiagen) and cloned into pCRII (Invitrogen) prior to derivation of the nucleotide sequence. .. A monolayer of Sf9 cells (1.0 × 106 ) was infected at an MOI of 5 with Ac92HARep-PG, an ac92 -knockout bacmid expressing ac92 at a different locus (see below).

    Article Title: A Single-Electron Reducing Quinone Oxidoreductase Is Necessary to Induce Haustorium Development in the Root Parasitic Plant Triphysaria
    Article Snippet: A 300-nucleotide region toward the 3′ end of the QR1 open reading frame and a 436-nucleotide region toward the 5′ end of QR2 open reading frame were amplified by PCR using primers modified with attB recombinase sites. .. The PCR products were gel purified using a Qiagen gel extraction kit and recombined into the Gateway donor vector pDONR211 following the manufacturer's protocols (Invitrogen). .. To make a hairpin targeted to both genes simultaneously, the 300-nucleotide QR1 and 436-nucleotide QR2 fragments were denatured and annealed with a single primer containing a 20-mer sequence homologous to the QR1 fragment and a 20-mer sequence homologous to the QR2 sequence.

    Article Title: A Functional Single-Nucleotide Polymorphism in the TRPC6 Gene Promoter Associated With Idiopathic Pulmonary Arterial Hypertension
    Article Snippet: PCR amplification of genomic DNA encoding the putative TRPC6 promoter region was performed by a GeneAmp PCR System (Perkin Elmer) using a Platinum PCR Supermix Kit (Invitrogen). .. The PCR products were detected by agarose gel electrophoresis, purified with a Gel extraction kit (Qiagen), and sequenced. .. The sequencing data were analyzed by Chromas software and compared with known SNPs deposited in the NCBI SNP databank.

    Article Title: Origin and Evolution of Japanese Encephalitis Virus in Southeast Asia
    Article Snippet: Primers were designed to amplify overlapping fragments of the genome on the basis of a consensus alignment of complete JEV nucleotides available or on sequence of JKT6468 already derived. .. RT-PCR products were purified by using the QIAGEN gel extraction kit. .. Purified cDNA was directly sequenced in both directions by using the appropriate sense and antisense primers and were ligated into pGEM-T Easy vector according to the manufacturer's protocol (Promega Corp., Madison, Wis.).

    Article Title: Genetic divergence and geographic variation in the deep-water Conus orbignyi complex (Mollusca: Conoidea)
    Article Snippet: Amplification consisted of an initial denaturation step at 95°C for 5 min, followed by 35 cycles of denaturation at 95°C for 1min, annealing at 50°C for the COI gene, 61°C for the ITS2 gene, 54°C for 12S gene and 52°C for 16S for 30s, followed by extension at 68°C for 30sec. .. PCR products were purified using the Qiagen gel extraction kit (Qiagen, CA, USA) or the High Pure PCR Product Purification Kit and sequenced by the Health Sciences Center Core Sequencing Facility, University of Utah. .. In most cases, both directions were sequenced to confirm accuracy of each haplotype sequence.

    Article Title: NPAS3 Demonstrates Features of a Tumor Suppressive Role in Driving the Progression of Astrocytomas
    Article Snippet: A final extension of 5 minutes at 68°C was performed for each PCR reaction. .. PCR products were electrophoresed on 1% agarose gels, gel purified (Gel Extraction Kit; Qiagen GmbH), and sequenced using the forward and reverse primers that were used to produce each PCR product ( ). .. Chromatograms were analyzed using commercially available software (FinchTV, version1.4; Geospiza, Inc., Seattle, WA), and the sequences were subjected to alignment with wild-type sequence using FASTA ( ) to identify mutations.

    Article Title: Rapid Mapping and Identification of Mutations in Caenorhabditis elegans by Restriction Site-Associated DNA Mapping and Genomic Interval Pull-Down Sequencing
    Article Snippet: The following cycling conditions were used for PCR: 98° for 2 min, 15 cycles of 98° for 10 sec, 65° for 30 sec, and 72° for 15 sec. .. Following amplification, samples were size separated by agarose gel electrophoresis, and fragments between 150 and 500 bp were purified with a Gel Extraction kit (Qiagen). .. DNA preps homologous to the targeted genomic interval were prepared from genomic fosmids, using a nearly genome-wide fosmid library for C. elegans that was developed by the Genome Sciences Centre in Vancouver, BC, Canada.

    Article Title: Inflammation-associated DNA methylation patterns in epithelium of ulcerative colitis
    Article Snippet: Please refer to Supplementary Materials and Methods for the exact protocol description. .. The PCR product was extracted from a 3.5% low molecular weight agarose gel electrophoresis and purified by Mini-Elute gel Extraction Kit (Qiagen). .. Purified products were analyzed by Bioanalyzer to ensure integrity and purity followed by Illumina sequencing (end library size ∼160 bp).

    Article Title: Modulation of the Tumor Suppressor Protein ?-Catenin by Ischemic Microenvironment
    Article Snippet: Genomic DNA was isolated from cultured cells using an extraction kit (Qiagen, Hilden, Germany). .. PCR amplification was performed using Phusion high-fidelity DNA polymerase enzyme (New England Biolabs, Ipswich, MA) under the following conditions: one cycle at 98°C for 30 seconds, 35 cycles of 10 seconds at 98°C, 20 seconds at 64°C for CTNA1 , 52°C for KRAS , and 20 seconds at 72°C, followed by a final cycle of 5 minutes at 72°C.

    Article Title: Comparison of Various Sample Preparation Methods for PCR Diagnosis of Visceral Leishmaniasis Using Peripheral Blood
    Article Snippet: For extraction from GE lysates, because ΦC gave a poor sensitivity in our hands and because in the initial protocol ( ) it was followed by a purification step (Centricon), we tested a simple extraction method based on silica beads. .. Finally, these methods were also compared to a commercial lysis and extraction kit (Qiagen), since the latter has the advantages of technical simplicity, speed, and greater safety.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Origin and Evolution of Japanese Encephalitis Virus in Southeast Asia
    Article Snippet: Primers were designed to amplify overlapping fragments of the genome on the basis of a consensus alignment of complete JEV nucleotides available or on sequence of JKT6468 already derived. .. RT-PCR products were purified by using the QIAGEN gel extraction kit. .. Purified cDNA was directly sequenced in both directions by using the appropriate sense and antisense primers and were ligated into pGEM-T Easy vector according to the manufacturer's protocol (Promega Corp., Madison, Wis.).

    Construct:

    Article Title: A Single-Electron Reducing Quinone Oxidoreductase Is Necessary to Induce Haustorium Development in the Root Parasitic Plant Triphysaria
    Article Snippet: The hairpin RNAi vectors used to silence QR1 and QR2 gene transcripts were constructed as follows. .. The PCR products were gel purified using a Qiagen gel extraction kit and recombined into the Gateway donor vector pDONR211 following the manufacturer's protocols (Invitrogen).

    Gel Extraction:

    Article Title: Cell surface display of chimeric glycoproteins via the S-layer of Paenibacillus alvei
    Article Snippet: Restriction and cloning enzymes were purchased from Invitrogen. .. The MinElute gel extraction kit (Qiagen, Vienna, Austria) was used to purify DNA fragments from agarose gels, and the MinElute reaction cleanup kit (Qiagen) was used to purify digested oligonucleotides and plasmids. .. Plasmid DNA from transformed cells was isolated with the Plasmid Miniprep kit (Qiagen).

    Article Title: Effect of Reaction Conditions and 3AB on the Mutation Rate of Poliovirus RNA-Dependent RNA Polymerase in a ?-Complementation Assay
    Article Snippet: The DNA was located by minimal exposure to long wave UV and excised. .. DNA was recovered using a Qiagen gel extraction kit and treated with 5 U of CIP for 2 hours at 37°C. .. Dephosphorylated vector was recovered by phenol-chloroform extraction and ethanol precipitation and quantified with a spectrophotometer.

    Article Title: Mechanism of the ATP-dependent DNA End Resection Machinery from S. cerevisiae
    Article Snippet: The 1.9-kb internally labeled substrate was generated by PCR in the presence of [α-32 P]-dCTP (PerkinElmer) and 5′-GCCGAGCCATATGTCAAGTGAGTCAACAACT TTCATCGTGG-3′ and 5′-GCACGACTCGAGTTAATTATTGCTATTGTTTGGACTT CCCC-3′ as primers and the S. cerevisiae HDF2 gene as template. .. The substrates were purified from 1% agarose gels with the Gel Extraction kit (Qiagen). .. The substrate in was generated using the same template and primers, except with the first primer being biotinylated at the 5′ end.

    Article Title: Autographa californica Multiple Nucleopolyhedrovirus Ac92 (ORF92, P33) Is Required for Budded Virus Production and Multiply Enveloped Occlusion-Derived Virus Formation
    Article Snippet: 5′ rapid amplification of cDNA 5′ ends (RACE) was performed using a 5′ RACE system kit, version 2.0, according to the handbook provided (Invitrogen). ac92 -specific reverse primer Ac92SP1 (5′-CCATATCGTCGATGATGAG-3′) and Ac92SP2 (5′-CCCATATGGTAGTAAACG-3′) were used for PCR amplification. .. PCR products were gel purified with a gel extraction kit (Qiagen) and cloned into pCRII (Invitrogen) prior to derivation of the nucleotide sequence. .. A monolayer of Sf9 cells (1.0 × 106 ) was infected at an MOI of 5 with Ac92HARep-PG, an ac92 -knockout bacmid expressing ac92 at a different locus (see below).

    Article Title: A Single-Electron Reducing Quinone Oxidoreductase Is Necessary to Induce Haustorium Development in the Root Parasitic Plant Triphysaria
    Article Snippet: A 300-nucleotide region toward the 3′ end of the QR1 open reading frame and a 436-nucleotide region toward the 5′ end of QR2 open reading frame were amplified by PCR using primers modified with attB recombinase sites. .. The PCR products were gel purified using a Qiagen gel extraction kit and recombined into the Gateway donor vector pDONR211 following the manufacturer's protocols (Invitrogen). .. To make a hairpin targeted to both genes simultaneously, the 300-nucleotide QR1 and 436-nucleotide QR2 fragments were denatured and annealed with a single primer containing a 20-mer sequence homologous to the QR1 fragment and a 20-mer sequence homologous to the QR2 sequence.

    Article Title: A Functional Single-Nucleotide Polymorphism in the TRPC6 Gene Promoter Associated With Idiopathic Pulmonary Arterial Hypertension
    Article Snippet: PCR amplification of genomic DNA encoding the putative TRPC6 promoter region was performed by a GeneAmp PCR System (Perkin Elmer) using a Platinum PCR Supermix Kit (Invitrogen). .. The PCR products were detected by agarose gel electrophoresis, purified with a Gel extraction kit (Qiagen), and sequenced. .. The sequencing data were analyzed by Chromas software and compared with known SNPs deposited in the NCBI SNP databank.

    Article Title: Origin and Evolution of Japanese Encephalitis Virus in Southeast Asia
    Article Snippet: Primers were designed to amplify overlapping fragments of the genome on the basis of a consensus alignment of complete JEV nucleotides available or on sequence of JKT6468 already derived. .. RT-PCR products were purified by using the QIAGEN gel extraction kit. .. Purified cDNA was directly sequenced in both directions by using the appropriate sense and antisense primers and were ligated into pGEM-T Easy vector according to the manufacturer's protocol (Promega Corp., Madison, Wis.).

    Article Title: Genetic divergence and geographic variation in the deep-water Conus orbignyi complex (Mollusca: Conoidea)
    Article Snippet: Amplification consisted of an initial denaturation step at 95°C for 5 min, followed by 35 cycles of denaturation at 95°C for 1min, annealing at 50°C for the COI gene, 61°C for the ITS2 gene, 54°C for 12S gene and 52°C for 16S for 30s, followed by extension at 68°C for 30sec. .. PCR products were purified using the Qiagen gel extraction kit (Qiagen, CA, USA) or the High Pure PCR Product Purification Kit and sequenced by the Health Sciences Center Core Sequencing Facility, University of Utah. .. In most cases, both directions were sequenced to confirm accuracy of each haplotype sequence.

    Article Title: NPAS3 Demonstrates Features of a Tumor Suppressive Role in Driving the Progression of Astrocytomas
    Article Snippet: A final extension of 5 minutes at 68°C was performed for each PCR reaction. .. PCR products were electrophoresed on 1% agarose gels, gel purified (Gel Extraction Kit; Qiagen GmbH), and sequenced using the forward and reverse primers that were used to produce each PCR product ( ). .. Chromatograms were analyzed using commercially available software (FinchTV, version1.4; Geospiza, Inc., Seattle, WA), and the sequences were subjected to alignment with wild-type sequence using FASTA ( ) to identify mutations.

    Article Title: Rapid Mapping and Identification of Mutations in Caenorhabditis elegans by Restriction Site-Associated DNA Mapping and Genomic Interval Pull-Down Sequencing
    Article Snippet: The following cycling conditions were used for PCR: 98° for 2 min, 15 cycles of 98° for 10 sec, 65° for 30 sec, and 72° for 15 sec. .. Following amplification, samples were size separated by agarose gel electrophoresis, and fragments between 150 and 500 bp were purified with a Gel Extraction kit (Qiagen). .. DNA preps homologous to the targeted genomic interval were prepared from genomic fosmids, using a nearly genome-wide fosmid library for C. elegans that was developed by the Genome Sciences Centre in Vancouver, BC, Canada.

    Article Title: Characterization of β-catenin expression in canine osteosarcoma
    Article Snippet: Cycling conditions were 95 °C for 15 min, 90 cycles of 95 °C for 1 min, 58 °C for 1 min and 72 °C for 1 min, followed by 72 °C for 10 min. Polymerase chain reaction products were visualized on a 1% agarose gel containing 0.1% ethidium bromide. .. The Qiagen Gel Extraction Kit (#28404) was used to extract the amplified β -catenin exon 3 from the gel. .. The extracted product was concentrated by ethanol precipitation and resuspended in tris-ethylenediaminetetraacetic acid buffer.

    Article Title: Regulation of heterochromatic DNA replication by histone H3 lysine 27 methyltransferases
    Article Snippet: We then performed serial extractions with phenol, phenol/chloroform and chloroform followed by isopropanol precipitation and resuspension in 50 μL of TE. .. For the recovery of the SMALL fraction of DNA from the gel we used Qiagen gel extraction kit and followed the manufacturer's instructions. .. DNA was eluted in 50 μL of TE. qPCR was performed using the IQ -SYBR Green Supermix from Bio-Rad, a Stratagene MX3005P qPCR system.

    Article Title: Inflammation-associated DNA methylation patterns in epithelium of ulcerative colitis
    Article Snippet: Please refer to Supplementary Materials and Methods for the exact protocol description. .. The PCR product was extracted from a 3.5% low molecular weight agarose gel electrophoresis and purified by Mini-Elute gel Extraction Kit (Qiagen). .. Purified products were analyzed by Bioanalyzer to ensure integrity and purity followed by Illumina sequencing (end library size ∼160 bp).

    Chromatin Immunoprecipitation:

    Article Title: Mesodermal iPSC–derived progenitor cells functionally regenerate cardiac and skeletal muscle
    Article Snippet: The initial sonicated gDNA fragment suspension (5 μl of 100 μl) was used as a reference input. .. Purification of ChIP and input DNA was performed using a MinElute kit (QIAGEN), and quantification as a percentage of input was performed by SYBR Green qPCR under the conditions described above. .. Statistical analysis was performed using three qPCR replicates per cell clone (3 clones per cell type obtained from independent donors).

    Plasmid Preparation:

    Article Title: Effect of Reaction Conditions and 3AB on the Mutation Rate of Poliovirus RNA-Dependent RNA Polymerase in a ?-Complementation Assay
    Article Snippet: Paragraph title: 2.10. Preparation of vector for fidelity assay ... DNA was recovered using a Qiagen gel extraction kit and treated with 5 U of CIP for 2 hours at 37°C.

    Article Title: A Single-Electron Reducing Quinone Oxidoreductase Is Necessary to Induce Haustorium Development in the Root Parasitic Plant Triphysaria
    Article Snippet: A 300-nucleotide region toward the 3′ end of the QR1 open reading frame and a 436-nucleotide region toward the 5′ end of QR2 open reading frame were amplified by PCR using primers modified with attB recombinase sites. .. The PCR products were gel purified using a Qiagen gel extraction kit and recombined into the Gateway donor vector pDONR211 following the manufacturer's protocols (Invitrogen). .. To make a hairpin targeted to both genes simultaneously, the 300-nucleotide QR1 and 436-nucleotide QR2 fragments were denatured and annealed with a single primer containing a 20-mer sequence homologous to the QR1 fragment and a 20-mer sequence homologous to the QR2 sequence.

    Article Title: Origin and Evolution of Japanese Encephalitis Virus in Southeast Asia
    Article Snippet: RT-PCR products were purified by using the QIAGEN gel extraction kit. .. At least three clones of plasmids containing inserts were sequenced in both directions by using universal M13 forward and reverse primers.

    Software:

    Article Title: A Single-Electron Reducing Quinone Oxidoreductase Is Necessary to Induce Haustorium Development in the Root Parasitic Plant Triphysaria
    Article Snippet: The PCR products were gel purified using a Qiagen gel extraction kit and recombined into the Gateway donor vector pDONR211 following the manufacturer's protocols (Invitrogen). .. The PCR products were gel purified using a Qiagen gel extraction kit and recombined into the Gateway donor vector pDONR211 following the manufacturer's protocols (Invitrogen).

    Article Title: Origin and Evolution of Japanese Encephalitis Virus in Southeast Asia
    Article Snippet: RT-PCR products were purified by using the QIAGEN gel extraction kit. .. At least three clones of plasmids containing inserts were sequenced in both directions by using universal M13 forward and reverse primers.

    Real-time Polymerase Chain Reaction:

    Article Title: Mesodermal iPSC–derived progenitor cells functionally regenerate cardiac and skeletal muscle
    Article Snippet: The initial sonicated gDNA fragment suspension (5 μl of 100 μl) was used as a reference input. .. Purification of ChIP and input DNA was performed using a MinElute kit (QIAGEN), and quantification as a percentage of input was performed by SYBR Green qPCR under the conditions described above. .. Statistical analysis was performed using three qPCR replicates per cell clone (3 clones per cell type obtained from independent donors).

    Article Title: Regulation of heterochromatic DNA replication by histone H3 lysine 27 methyltransferases
    Article Snippet: Paragraph title: Quantitative PCR assays on gel separated genomic DNA ... For the recovery of the SMALL fraction of DNA from the gel we used Qiagen gel extraction kit and followed the manufacturer's instructions.

    Multiplex Assay:

    Article Title: Comparison of Real-Time Multiplex Human Papillomavirus (HPV) PCR Assays with the Linear Array HPV Genotyping PCR Assay and Influence of DNA Extraction Method on HPV Detection
    Article Snippet: With this specimen set, multiplex HPV PCR was performed as per its standard real-time amplification/detection protocol, Linear Array was performed as per its standard amplification and detection protocols, and Linear Array was performed per a modified amplification and detection protocol, such that DNA input would be equal to that of multiplex HPV PCR. .. Subsequently, an additional DNA extraction technique was used with specimens extracted by the Qiagen MinElute kit, the preferred process cited in the manufacturer's protocol for the Linear Array.

    Binding Assay:

    Article Title: A Functional Single-Nucleotide Polymorphism in the TRPC6 Gene Promoter Associated With Idiopathic Pulmonary Arterial Hypertension
    Article Snippet: The PCR products were detected by agarose gel electrophoresis, purified with a Gel extraction kit (Qiagen), and sequenced. .. The sequencing data were analyzed by Chromas software and compared with known SNPs deposited in the NCBI SNP databank.

    Agarose Gel Electrophoresis:

    Article Title: Cell surface display of chimeric glycoproteins via the S-layer of Paenibacillus alvei
    Article Snippet: The MinElute gel extraction kit (Qiagen, Vienna, Austria) was used to purify DNA fragments from agarose gels, and the MinElute reaction cleanup kit (Qiagen) was used to purify digested oligonucleotides and plasmids. .. Plasmid DNA from transformed cells was isolated with the Plasmid Miniprep kit (Qiagen).

    Article Title: Effect of Reaction Conditions and 3AB on the Mutation Rate of Poliovirus RNA-Dependent RNA Polymerase in a ?-Complementation Assay
    Article Snippet: After 2 hours, 6X loading buffer was added and the DNA was electrophoresed on a 1% agarose gel as described above. .. DNA was recovered using a Qiagen gel extraction kit and treated with 5 U of CIP for 2 hours at 37°C.

    Article Title: A Functional Single-Nucleotide Polymorphism in the TRPC6 Gene Promoter Associated With Idiopathic Pulmonary Arterial Hypertension
    Article Snippet: PCR amplification of genomic DNA encoding the putative TRPC6 promoter region was performed by a GeneAmp PCR System (Perkin Elmer) using a Platinum PCR Supermix Kit (Invitrogen). .. The PCR products were detected by agarose gel electrophoresis, purified with a Gel extraction kit (Qiagen), and sequenced. .. The sequencing data were analyzed by Chromas software and compared with known SNPs deposited in the NCBI SNP databank.

    Article Title: Rapid Mapping and Identification of Mutations in Caenorhabditis elegans by Restriction Site-Associated DNA Mapping and Genomic Interval Pull-Down Sequencing
    Article Snippet: The following cycling conditions were used for PCR: 98° for 2 min, 15 cycles of 98° for 10 sec, 65° for 30 sec, and 72° for 15 sec. .. Following amplification, samples were size separated by agarose gel electrophoresis, and fragments between 150 and 500 bp were purified with a Gel Extraction kit (Qiagen). .. DNA preps homologous to the targeted genomic interval were prepared from genomic fosmids, using a nearly genome-wide fosmid library for C. elegans that was developed by the Genome Sciences Centre in Vancouver, BC, Canada.

    Article Title: Characterization of β-catenin expression in canine osteosarcoma
    Article Snippet: Cycling conditions were 95 °C for 15 min, 90 cycles of 95 °C for 1 min, 58 °C for 1 min and 72 °C for 1 min, followed by 72 °C for 10 min. Polymerase chain reaction products were visualized on a 1% agarose gel containing 0.1% ethidium bromide. .. The Qiagen Gel Extraction Kit (#28404) was used to extract the amplified β -catenin exon 3 from the gel.

    Article Title: Regulation of heterochromatic DNA replication by histone H3 lysine 27 methyltransferases
    Article Snippet: Around 10 μg of this DNA was run in a 1% low melting point agarose gel (Lonza) for both Col0 and atxr5 atxr6 and the band for the genomic DNA was cut out of the gel (BIG) along with the rest of the lane below that band (SMALL, DNA < 12 Kb). .. For the recovery of the SMALL fraction of DNA from the gel we used Qiagen gel extraction kit and followed the manufacturer's instructions.

    Article Title: Inflammation-associated DNA methylation patterns in epithelium of ulcerative colitis
    Article Snippet: Please refer to Supplementary Materials and Methods for the exact protocol description. .. The PCR product was extracted from a 3.5% low molecular weight agarose gel electrophoresis and purified by Mini-Elute gel Extraction Kit (Qiagen). .. Purified products were analyzed by Bioanalyzer to ensure integrity and purity followed by Illumina sequencing (end library size ∼160 bp).

    In Situ:

    Article Title: Cell surface display of chimeric glycoproteins via the S-layer of Paenibacillus alvei
    Article Snippet: The MinElute gel extraction kit (Qiagen, Vienna, Austria) was used to purify DNA fragments from agarose gels, and the MinElute reaction cleanup kit (Qiagen) was used to purify digested oligonucleotides and plasmids. .. Transformation of E. coli DH5α was done according to the manufacturer’s protocol (Invitrogen).

    Transgenic Assay:

    Article Title: A Single-Electron Reducing Quinone Oxidoreductase Is Necessary to Induce Haustorium Development in the Root Parasitic Plant Triphysaria
    Article Snippet: The mas-YFP fusion was then cloned into the Sac I site of pHellsgate8 to allow visual screening of transgenic roots ( ). .. The PCR products were gel purified using a Qiagen gel extraction kit and recombined into the Gateway donor vector pDONR211 following the manufacturer's protocols (Invitrogen).

    Concentration Assay:

    Article Title: Response of Staphylococcus aureus to Subinhibitory Concentrations of a Sequence-Selective, DNA Minor Groove Cross-Linking Pyrrolobenzodiazepine Dimer
    Article Snippet: Mixtures were incubated for 5 min at RT, centrifuged, RNA isolated from pellets with FastRNA® Pro Blue kit (Qbiogen) and treated with DNase I. RNA aliquots (5 μg) were labeled with Cy5 dye (GE Healthcare) concomitant with reverse transcription into cDNA. .. EMRSA-16 genomic DNA was used as reference; DNA concentration was measured (OD260 ) and 1 μg fluorescently labeled with Cy3 dye (GE Healthcare). cDNA was purified using a MinElute kit (Qiagen), probes pooled, hybridised overnight to the S. aureus microarray at 65 °C and subjected to stringent washing. .. Hybridization data was analyzed using an Affymetrix 428 scanner then quantified using Bluefuse for Microarrays 3.5 software (BlueGnome).

    Lysis:

    Article Title: Regulation of heterochromatic DNA replication by histone H3 lysine 27 methyltransferases
    Article Snippet: Four 3-week-old leaves were ground and extracted in 400 μL extraction buffer (sorbitol 350 mM, Tris-HCl pH7.5 100mM, EDTA 5 mM) followed by lysis in 400 μL of lysis buffer (Tris-HCl pH7.5 200mM, EDTA 50mM, NaCl 2M, CTAB 2%) plus 27 μL of 10% sarkosyl. .. For the recovery of the SMALL fraction of DNA from the gel we used Qiagen gel extraction kit and followed the manufacturer's instructions.

    Article Title: Comparison of Various Sample Preparation Methods for PCR Diagnosis of Visceral Leishmaniasis Using Peripheral Blood
    Article Snippet: For extraction from GE lysates, because ΦC gave a poor sensitivity in our hands and because in the initial protocol ( ) it was followed by a purification step (Centricon), we tested a simple extraction method based on silica beads. .. Finally, these methods were also compared to a commercial lysis and extraction kit (Qiagen), since the latter has the advantages of technical simplicity, speed, and greater safety. .. Overall, using the optimized PCR conditions developed in our laboratory, (i) the BC gave a 10-fold increase in sensitivity over that of WB, and (ii) PK-based methods proved clearly superior to GE-based methods.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen rna affinity columns
    Functional and structural validation of newly discovered HIV-1 <t>RNA</t> motifs ( a ) Scheme for simultaneous deconvolution and structural analysis of a mixture of native sequence and U3 PK mutant genomes. (b) SHAPE profiles for the U3 PK pseudoknot bridging U3 and R. The experiment simultaneously probed a mixture of viruses with native sequence and mutant U3 PK <t>RNAs.</t> Secondary structure for the native sequence is shown as arcs below the y-axis intercept. Significant SHAPE reactivity differences are emphasized with yellow vertical lines (see Online Methods). (c) Direct growth competition and viral spread for U3 PK mutant and native sequence NL4-3 HIV-1 virions in Jurkat cells. Percentage of mutant in the initial inoculum is presented as a grey square at day 0. p24 levels correspond to the amount of HIV-1 capsid protein. ( d ) SHAPE profiles for the RT PK pseudoknot within the reverse transcriptase coding region. In this case, SHAPE data were obtained in separate experiments for each virus. ( e ) Viral spread and direct growth competition for RT PK mutant and native sequence NL4-3 HIV-1 virions in Jurkat cells. For the competition data, y-axes are shown on an expanded scale for clarity.
    Rna Affinity Columns, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 110 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna affinity columns/product/Qiagen
    Average 99 stars, based on 110 article reviews
    Price from $9.99 to $1999.99
    rna affinity columns - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    99
    Qiagen pcr purification kit
    3′ RACE Analysis and Identification of feCath. (A) Schematic of 3′ RACE strategy targeting the signal sequence region and the propeptide (cathelin) domain with sense primers and using antisense adaptor primer, AP1. Feline bone marrow RNA was reverse transcribed with oligo-dT conjugated to adaptor primer 1/2 (AP1/2). Sense primers (sequences found in Table 1 ) were used to amplify cathelicidin related sequences in the pool of bone marrow <t>cDNA.</t> (B) Agarose gel electrophoresis analysis of 3′ RACE <t>PCR</t> products from (A). HaeIII digested Phi-X174 phage DNA used as the marker.
    Pcr Purification Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1758 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr purification kit/product/Qiagen
    Average 99 stars, based on 1758 article reviews
    Price from $9.99 to $1999.99
    pcr purification kit - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    Image Search Results


    Functional and structural validation of newly discovered HIV-1 RNA motifs ( a ) Scheme for simultaneous deconvolution and structural analysis of a mixture of native sequence and U3 PK mutant genomes. (b) SHAPE profiles for the U3 PK pseudoknot bridging U3 and R. The experiment simultaneously probed a mixture of viruses with native sequence and mutant U3 PK RNAs. Secondary structure for the native sequence is shown as arcs below the y-axis intercept. Significant SHAPE reactivity differences are emphasized with yellow vertical lines (see Online Methods). (c) Direct growth competition and viral spread for U3 PK mutant and native sequence NL4-3 HIV-1 virions in Jurkat cells. Percentage of mutant in the initial inoculum is presented as a grey square at day 0. p24 levels correspond to the amount of HIV-1 capsid protein. ( d ) SHAPE profiles for the RT PK pseudoknot within the reverse transcriptase coding region. In this case, SHAPE data were obtained in separate experiments for each virus. ( e ) Viral spread and direct growth competition for RT PK mutant and native sequence NL4-3 HIV-1 virions in Jurkat cells. For the competition data, y-axes are shown on an expanded scale for clarity.

    Journal: Nature methods

    Article Title: RNA motif discovery by SHAPE and mutational profiling (SHAPE-MaP)

    doi: 10.1038/nmeth.3029

    Figure Lengend Snippet: Functional and structural validation of newly discovered HIV-1 RNA motifs ( a ) Scheme for simultaneous deconvolution and structural analysis of a mixture of native sequence and U3 PK mutant genomes. (b) SHAPE profiles for the U3 PK pseudoknot bridging U3 and R. The experiment simultaneously probed a mixture of viruses with native sequence and mutant U3 PK RNAs. Secondary structure for the native sequence is shown as arcs below the y-axis intercept. Significant SHAPE reactivity differences are emphasized with yellow vertical lines (see Online Methods). (c) Direct growth competition and viral spread for U3 PK mutant and native sequence NL4-3 HIV-1 virions in Jurkat cells. Percentage of mutant in the initial inoculum is presented as a grey square at day 0. p24 levels correspond to the amount of HIV-1 capsid protein. ( d ) SHAPE profiles for the RT PK pseudoknot within the reverse transcriptase coding region. In this case, SHAPE data were obtained in separate experiments for each virus. ( e ) Viral spread and direct growth competition for RT PK mutant and native sequence NL4-3 HIV-1 virions in Jurkat cells. For the competition data, y-axes are shown on an expanded scale for clarity.

    Article Snippet: Following modification, RNAs were isolated using either RNA affinity columns (RNeasy MinElute; Qiagen) or G-50 spin columns (GE Healthcare).

    Techniques: Functional Assay, Sequencing, Mutagenesis

    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Journal: BMC Genomics

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application

    doi: 10.1186/s12864-017-4371-5

    Figure Lengend Snippet: DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Article Snippet: We prepared chromatin fragments from HeLa cells using the combination of MNase and sonication, and DNA was purified using a Qiagen MinElute column following our standard ChIP protocol as previously described [ ].

    Techniques: DNA Purification, Chromatin Immunoprecipitation, Purification, Generated, Derivative Assay, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction

    3′ RACE Analysis and Identification of feCath. (A) Schematic of 3′ RACE strategy targeting the signal sequence region and the propeptide (cathelin) domain with sense primers and using antisense adaptor primer, AP1. Feline bone marrow RNA was reverse transcribed with oligo-dT conjugated to adaptor primer 1/2 (AP1/2). Sense primers (sequences found in Table 1 ) were used to amplify cathelicidin related sequences in the pool of bone marrow cDNA. (B) Agarose gel electrophoresis analysis of 3′ RACE PCR products from (A). HaeIII digested Phi-X174 phage DNA used as the marker.

    Journal: PLoS ONE

    Article Title: Expression and Activity of a Novel Cathelicidin from Domestic Cats

    doi: 10.1371/journal.pone.0018756

    Figure Lengend Snippet: 3′ RACE Analysis and Identification of feCath. (A) Schematic of 3′ RACE strategy targeting the signal sequence region and the propeptide (cathelin) domain with sense primers and using antisense adaptor primer, AP1. Feline bone marrow RNA was reverse transcribed with oligo-dT conjugated to adaptor primer 1/2 (AP1/2). Sense primers (sequences found in Table 1 ) were used to amplify cathelicidin related sequences in the pool of bone marrow cDNA. (B) Agarose gel electrophoresis analysis of 3′ RACE PCR products from (A). HaeIII digested Phi-X174 phage DNA used as the marker.

    Article Snippet: Subsequent to RNase-H treatment, cDNA was purified using column adsorption chromatography (PCR Purification Kit, Qiagen, Valencia, CA).

    Techniques: Sequencing, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Marker

    qChIP analysis of Cib1 binding to the pit1/2 - and tin1-1 -promoter. (A) Schematic overview of promoter organization and probe regions used for qChIP experiments. Sequence of the predicted Cib1 binding sites (UPRE) in the pit1/2 and tin1-1 promoter region is given in bold in case of identical nucleotides in pit1/2 and tin1-1 UPREs. (B) qChIP analysis of Cib1 binding to the pit1/2 and tin1-1 promoter in strain SG200 cib1-3xHA 3 h after DTT (3 mM) treatment. The HA-tagged Cib1 protein was immunoprecipitated with anti HA-antibody coupled agarose beads (Sigma). Enrichment of immunoprecipitated DNA is shown relative to the input control. PCR-amplicons corresponding to the pit1/2 and tin1-1 promoter are significantly enriched compared to ORF controls. No significant enrichment was observed for PCR-amplicons corresponding to pit1 , pit2 and tin1-1 ORFs in comparison to the eIF2b control. Given are the mean values of four independent experiments. Error bars represent the standard error (SE). Statistical significance was tested using Student's t -test. *indicates p-value

    Journal: PLoS ONE

    Article Title: Unfolded Protein Response (UPR) Regulator Cib1 Controls Expression of Genes Encoding Secreted Virulence Factors in Ustilago maydis

    doi: 10.1371/journal.pone.0153861

    Figure Lengend Snippet: qChIP analysis of Cib1 binding to the pit1/2 - and tin1-1 -promoter. (A) Schematic overview of promoter organization and probe regions used for qChIP experiments. Sequence of the predicted Cib1 binding sites (UPRE) in the pit1/2 and tin1-1 promoter region is given in bold in case of identical nucleotides in pit1/2 and tin1-1 UPREs. (B) qChIP analysis of Cib1 binding to the pit1/2 and tin1-1 promoter in strain SG200 cib1-3xHA 3 h after DTT (3 mM) treatment. The HA-tagged Cib1 protein was immunoprecipitated with anti HA-antibody coupled agarose beads (Sigma). Enrichment of immunoprecipitated DNA is shown relative to the input control. PCR-amplicons corresponding to the pit1/2 and tin1-1 promoter are significantly enriched compared to ORF controls. No significant enrichment was observed for PCR-amplicons corresponding to pit1 , pit2 and tin1-1 ORFs in comparison to the eIF2b control. Given are the mean values of four independent experiments. Error bars represent the standard error (SE). Statistical significance was tested using Student's t -test. *indicates p-value

    Article Snippet: After RNase A (0.8 mg/ml) incubation for 30 min at 37°C and Proteinase K (0.6 mg/ml) treatment for 2 h at 37°C DNA was recovered by column purification (PCR Purification Kit, Qiagen) and subjected to qPCR.

    Techniques: Binding Assay, Sequencing, Hemagglutination Assay, Immunoprecipitation, Polymerase Chain Reaction