mgcl2  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 75
    Name:
    MgCl2
    Description:
    Molecular biology grade, Ambion 1 M MgCl2 solution is supplied in one bottle containing 100 mL. The solution is certified RNase-free, economical, and ready-to-use. Due to the ubiquitous presence of RNases, manufacturing products for use with RNA is especially challenging. Ambion's nuclease-free reagents and buffers are manufactured in facilities specifically designed to prevent the introduction of nucleases. Highly sensitive RNase assays are performed at several different stages of the manufacturing process to ensure the highest quality. These reagents are rigorously tested for contaminating nonspecific endonuclease, exonuclease, and RNase activity.
    Catalog Number:
    AM9530G
    Price:
    None
    Purity:
    Molecular Biology Grade
    Size:
    100 mL
    Category:
    Lab Reagents and Chemicals, General Chemicals for Life Science, Other General Chemicals
    Score:
    85
    Buy from Supplier


    Structured Review

    Thermo Fisher mgcl2
    Analysis of the complex formed between HTNV N protein and deletion RNAs by UV cross-linking analysis. The concentration of N protein used in each binding reaction was 3.5 × 10−6 M. Reaction mixtures were assembled in 100 mM NaCl with 5 mM <t>MgCl2</t> in addition to standard reaction components as described in Material and Methods. Binding reactions were separated by sodium dodecyl sulfate–12% polyacrylamide gel electrophoresis, and unbound RNA was digested by adding 1 U of RNase V1. Signals were imaged with the Molecular Dynamics Storm PhosphorImager and quantified using ImageQuaNT version 4.2 software (Molecular Dynamics). The RNAs used to form the complexes are HTNV S-segment vRNA (lane 1), ORF RNA (lane 2), minipan RNA (lane 3), and Δ12 RNA (lane 4).
    Molecular biology grade, Ambion 1 M MgCl2 solution is supplied in one bottle containing 100 mL. The solution is certified RNase-free, economical, and ready-to-use. Due to the ubiquitous presence of RNases, manufacturing products for use with RNA is especially challenging. Ambion's nuclease-free reagents and buffers are manufactured in facilities specifically designed to prevent the introduction of nucleases. Highly sensitive RNase assays are performed at several different stages of the manufacturing process to ensure the highest quality. These reagents are rigorously tested for contaminating nonspecific endonuclease, exonuclease, and RNase activity.
    https://www.bioz.com/result/mgcl2/product/Thermo Fisher
    Average 75 stars, based on 0 article reviews
    Price from $9.99 to $1999.99
    mgcl2 - by Bioz Stars, 2019-10
    75/100 stars

    Related Products / Commonly Used Together

    atpase
    nadh-coupled
    kapa taq polymerase
    dntp
    kapa taq buffer

    Images

    1) Product Images from "cis-Acting Signals in Encapsidation of Hantaan Virus S-Segment Viral Genomic RNA by Its N Protein"

    Article Title: cis-Acting Signals in Encapsidation of Hantaan Virus S-Segment Viral Genomic RNA by Its N Protein

    Journal:

    doi: 10.1128/JVI.75.6.2646-2652.2001

    Analysis of the complex formed between HTNV N protein and deletion RNAs by UV cross-linking analysis. The concentration of N protein used in each binding reaction was 3.5 × 10−6 M. Reaction mixtures were assembled in 100 mM NaCl with 5 mM MgCl2 in addition to standard reaction components as described in Material and Methods. Binding reactions were separated by sodium dodecyl sulfate–12% polyacrylamide gel electrophoresis, and unbound RNA was digested by adding 1 U of RNase V1. Signals were imaged with the Molecular Dynamics Storm PhosphorImager and quantified using ImageQuaNT version 4.2 software (Molecular Dynamics). The RNAs used to form the complexes are HTNV S-segment vRNA (lane 1), ORF RNA (lane 2), minipan RNA (lane 3), and Δ12 RNA (lane 4).
    Figure Legend Snippet: Analysis of the complex formed between HTNV N protein and deletion RNAs by UV cross-linking analysis. The concentration of N protein used in each binding reaction was 3.5 × 10−6 M. Reaction mixtures were assembled in 100 mM NaCl with 5 mM MgCl2 in addition to standard reaction components as described in Material and Methods. Binding reactions were separated by sodium dodecyl sulfate–12% polyacrylamide gel electrophoresis, and unbound RNA was digested by adding 1 U of RNase V1. Signals were imaged with the Molecular Dynamics Storm PhosphorImager and quantified using ImageQuaNT version 4.2 software (Molecular Dynamics). The RNAs used to form the complexes are HTNV S-segment vRNA (lane 1), ORF RNA (lane 2), minipan RNA (lane 3), and Δ12 RNA (lane 4).

    Techniques Used: Concentration Assay, Binding Assay, Polyacrylamide Gel Electrophoresis, Software

    Saturation binding curves of various RNA substrates and the HTNV N protein. Binding isotherms were constructed following measurement of the binding of HTNV N protein with full-length S-segment vRNA (A), ORF vRNA (B), minipan RNA (C), Δ12 vRNA (D), and control RNA (E); panel F shows a compilation of data for all RNAs. Binding reaction mixtures were assembled in 100 mM NaCl and 1 mM MgCl2 in addition to standard reaction components as described in Materials and Methods. 32 P-labeled RNA was incubated with the indicated molar concentrations of N protein. The amount of radioactively labeled N protein retained on the filter was calculated relative to maximum radioactivity retained in each experiment. Apparent dissociation constants were calculated by nonlinear curve fitting and correspond to the amount of protein necessary to obtain 50% saturation, assuming that the concentration of free protein is equivalent to the concentration of total protein.
    Figure Legend Snippet: Saturation binding curves of various RNA substrates and the HTNV N protein. Binding isotherms were constructed following measurement of the binding of HTNV N protein with full-length S-segment vRNA (A), ORF vRNA (B), minipan RNA (C), Δ12 vRNA (D), and control RNA (E); panel F shows a compilation of data for all RNAs. Binding reaction mixtures were assembled in 100 mM NaCl and 1 mM MgCl2 in addition to standard reaction components as described in Materials and Methods. 32 P-labeled RNA was incubated with the indicated molar concentrations of N protein. The amount of radioactively labeled N protein retained on the filter was calculated relative to maximum radioactivity retained in each experiment. Apparent dissociation constants were calculated by nonlinear curve fitting and correspond to the amount of protein necessary to obtain 50% saturation, assuming that the concentration of free protein is equivalent to the concentration of total protein.

    Techniques Used: Binding Assay, Protein Binding, Construct, Labeling, Incubation, Radioactivity, Concentration Assay

    2) Product Images from "Further characterisation of rotavirus cores: Ss(+)RNAs can be packaged in vitro but packaging lacks sequence specificity"

    Article Title: Further characterisation of rotavirus cores: Ss(+)RNAs can be packaged in vitro but packaging lacks sequence specificity

    Journal: Virus Research

    doi: 10.1016/j.virusres.2013.09.034

    Formation of rotavirus DLPs and intermediates by addition of recombinant VP6 to cores opened by EGTA and restabilised by Mg 2+, spermidine 3+ , and cobalthexamine 3+ . Agarose gel 0.8%, electrophoresis with 10 mM MOPS/Tris buffer, pH 7.7, followed by staining with ethidium bromide. Lane 1: Purified DLPs; lane 2: purified cores: lane 3: cores + 400 μM EGTA; lane 4: cores + 400 μM EGTA + 1.6 mM MgCl 2 after 1 min; lane 5: cores + 400 μM EGTA + VP6; lane 6: cores + 400 μM EGTA + 1.6 mM MgCl 2 after 1 min + VP6; lane 7: cores + 400 μM EGTA + 300 μM spermidine 3+ after 1 min; lane 8: cores + 400 μM EGTA + 300 μM spermidine 3+ after 1 min; lane 9: cores + 400 μM EGTA + 350 μM cobalthexamine 3+ after 1 min; lane 10: cores + 400 μM EGTA + 350 μM cobalthexamine 3+ after 1 min + VP6; lane 11: 400 μM EGTA + 1.6 mM MgCl2 + VP6.
    Figure Legend Snippet: Formation of rotavirus DLPs and intermediates by addition of recombinant VP6 to cores opened by EGTA and restabilised by Mg 2+, spermidine 3+ , and cobalthexamine 3+ . Agarose gel 0.8%, electrophoresis with 10 mM MOPS/Tris buffer, pH 7.7, followed by staining with ethidium bromide. Lane 1: Purified DLPs; lane 2: purified cores: lane 3: cores + 400 μM EGTA; lane 4: cores + 400 μM EGTA + 1.6 mM MgCl 2 after 1 min; lane 5: cores + 400 μM EGTA + VP6; lane 6: cores + 400 μM EGTA + 1.6 mM MgCl 2 after 1 min + VP6; lane 7: cores + 400 μM EGTA + 300 μM spermidine 3+ after 1 min; lane 8: cores + 400 μM EGTA + 300 μM spermidine 3+ after 1 min; lane 9: cores + 400 μM EGTA + 350 μM cobalthexamine 3+ after 1 min; lane 10: cores + 400 μM EGTA + 350 μM cobalthexamine 3+ after 1 min + VP6; lane 11: 400 μM EGTA + 1.6 mM MgCl2 + VP6.

    Techniques Used: Recombinant, Agarose Gel Electrophoresis, Electrophoresis, Staining, Purification

    3) Product Images from "Intrinsic regulation of FIC-domain AMP-transferases by oligomerization and automodification"

    Article Title: Intrinsic regulation of FIC-domain AMP-transferases by oligomerization and automodification

    Journal:

    doi: 10.1073/pnas.1516930113

    NmFicE186G adenylylates GyrB. Autoradiographs obtained after incubation of NmFicwt ( Left ) and inhibition-relieved variant NmFicE186G ( Right ) with 40 nM α-[32 P]ATP, 15 mM MgCl2 , and E. coli cell lysates overexpressing potential targets as indicated. Incubation was for 1 h at 30 °C.
    Figure Legend Snippet: NmFicE186G adenylylates GyrB. Autoradiographs obtained after incubation of NmFicwt ( Left ) and inhibition-relieved variant NmFicE186G ( Right ) with 40 nM α-[32 P]ATP, 15 mM MgCl2 , and E. coli cell lysates overexpressing potential targets as indicated. Incubation was for 1 h at 30 °C.

    Techniques Used: Incubation, Inhibition, Variant Assay

    4) Product Images from "A Quantitative Raman Spectroscopic Signal for Metal-Phosphodiester Interactions in Solution"

    Article Title: A Quantitative Raman Spectroscopic Signal for Metal-Phosphodiester Interactions in Solution

    Journal:

    doi: 10.1021/bi901866u

    Influence of electrostatics, H-bonding, and inner-sphere coordination interactions on νs PO2 − . Raman difference spectra (1200–1000 cm−1 ) of νs PO2 − from DMP (A), HATP3− (B), and yeast tRNAPHE (C), in the presence of MgCl2 (black line), NaCl (gray line), NH4 Cl (black dashed line), Co(NH3 )6 Cl3 (gray dashed line), or N(CH3 )4 Cl (black dotted line) at an equal ionic strength of 0.45 M. The ability of individual metal ions to interact with nonbridging phosphate oxygens by electrostatic interactions (E), hydrogen bonding (H), or direct coordination (C) is noted by the aforementioned letters adjacent to the ions shown in the legend of panel A. The right inset in panel B shows an enlargement of all metal-induced difference spectra with the exception of that from MgCl2 to facilitate comparison of weaker ion-induced changes to the Raman signal of HATP3− . The left inset in panel B shows all metal-induced difference spectra, including that from MgCl2 . The shaded area in the positive node (PN) of metal ion difference spectra (Mg2+ , left inset; Na+ , right inset) reflects the shift of the νs PO2 − signal to higher wavenumbers due to inner-sphere coordination defined by νs PO2 − MPN . With the exception of metal ion concentration, experimental conditions are identical to those described in the legend of .
    Figure Legend Snippet: Influence of electrostatics, H-bonding, and inner-sphere coordination interactions on νs PO2 − . Raman difference spectra (1200–1000 cm−1 ) of νs PO2 − from DMP (A), HATP3− (B), and yeast tRNAPHE (C), in the presence of MgCl2 (black line), NaCl (gray line), NH4 Cl (black dashed line), Co(NH3 )6 Cl3 (gray dashed line), or N(CH3 )4 Cl (black dotted line) at an equal ionic strength of 0.45 M. The ability of individual metal ions to interact with nonbridging phosphate oxygens by electrostatic interactions (E), hydrogen bonding (H), or direct coordination (C) is noted by the aforementioned letters adjacent to the ions shown in the legend of panel A. The right inset in panel B shows an enlargement of all metal-induced difference spectra with the exception of that from MgCl2 to facilitate comparison of weaker ion-induced changes to the Raman signal of HATP3− . The left inset in panel B shows all metal-induced difference spectra, including that from MgCl2 . The shaded area in the positive node (PN) of metal ion difference spectra (Mg2+ , left inset; Na+ , right inset) reflects the shift of the νs PO2 − signal to higher wavenumbers due to inner-sphere coordination defined by νs PO2 − MPN . With the exception of metal ion concentration, experimental conditions are identical to those described in the legend of .

    Techniques Used: Concentration Assay

    Effect of Mg2+ on the Raman spectra of structurally distinct phosphodiesters. Raman spectral data (black) and Raman difference spectra (subtracting spectra at 0 M from 0.3 M MgCl2 , dark gray) for 200 mM DMP (A), 100 mM HATP3− (B), and 0.81 mM (20 mg/mL) yeast tRNAPHE (C). (D) Overlay of Mg2+ difference spectra (1200–1000 cm−1 ) of the symmetric stretch for nonbridging phosphate oxygens (νs PO2 − ) for DMP (gray dots), HATP3− (gray line), and yeast tRNAPHE (black). The arrow indicates the spectral distance between inflection points of the positive and negative nodes (marked by vertical black lines) of the Mg2+ -induced inflection of νs PO2 − , which defines ΔνM. The inset shows a superposition of the metal-induced inflections shown in panel D to illustrate the relative similarity in the apparent shift of νs PO2 − to higher wavenumbers. (E) Overlay of Mg2+ difference spectra (1200–1000 cm−1 ) of νs PO2 − for an 11-nucleotide single-stranded RNA (black dots), 12-nucleotide GAAA tetraloop (gray dots), 27-nucleotide bulged stem–loop sequence (black dashes), 76-nucleotide yeast tRNAPHE (dark gray line), and 400-nucleotide E. coli RNase P RNA (black line). Dotted gray boxes indicate the metal-induced inflection of νs PO2 − observed in difference spectra. DMP and RNAs were measured at pH 6 (200 mM cacodylate), while HATP3 − was measured at pH 3.8 (200 mM formate) to generate a single negative charge on the terminal phosphate.
    Figure Legend Snippet: Effect of Mg2+ on the Raman spectra of structurally distinct phosphodiesters. Raman spectral data (black) and Raman difference spectra (subtracting spectra at 0 M from 0.3 M MgCl2 , dark gray) for 200 mM DMP (A), 100 mM HATP3− (B), and 0.81 mM (20 mg/mL) yeast tRNAPHE (C). (D) Overlay of Mg2+ difference spectra (1200–1000 cm−1 ) of the symmetric stretch for nonbridging phosphate oxygens (νs PO2 − ) for DMP (gray dots), HATP3− (gray line), and yeast tRNAPHE (black). The arrow indicates the spectral distance between inflection points of the positive and negative nodes (marked by vertical black lines) of the Mg2+ -induced inflection of νs PO2 − , which defines ΔνM. The inset shows a superposition of the metal-induced inflections shown in panel D to illustrate the relative similarity in the apparent shift of νs PO2 − to higher wavenumbers. (E) Overlay of Mg2+ difference spectra (1200–1000 cm−1 ) of νs PO2 − for an 11-nucleotide single-stranded RNA (black dots), 12-nucleotide GAAA tetraloop (gray dots), 27-nucleotide bulged stem–loop sequence (black dashes), 76-nucleotide yeast tRNAPHE (dark gray line), and 400-nucleotide E. coli RNase P RNA (black line). Dotted gray boxes indicate the metal-induced inflection of νs PO2 − observed in difference spectra. DMP and RNAs were measured at pH 6 (200 mM cacodylate), while HATP3 − was measured at pH 3.8 (200 mM formate) to generate a single negative charge on the terminal phosphate.

    Techniques Used: Sequencing

    5) Product Images from "Cellular Mobile Genetic Elements in the Regulatory Region of the Pneumotropic Mouse Polyomavirus Genome: Structure and Function in Viral Gene Expression and DNA Replication"

    Article Title: Cellular Mobile Genetic Elements in the Regulatory Region of the Pneumotropic Mouse Polyomavirus Genome: Structure and Function in Viral Gene Expression and DNA Replication

    Journal:

    doi: 10.1128/JVI.77.6.3477-3486.2003

    Agarose gel electrophoresis of PCR products from amplification of MPtV-related sequences in mouse DNA. DNA was extracted from the spleen of a C3H mouse and then purified. PCR amplification was done for 35 cycles in the presence or absence (−) of template DNA by using a primer pair that would generate a 179-bp product with the in A or in B insert of MPtV DNA as a template. After amplification, DNA was resolved by electrophoresis in a 1.5% agarose gel in the presence of 0.5 μg of ethidium bromide per ml. DNA was visualized in UV light. The final concentration of MgCl2 in the PCR is indicated. The electrophoretic mobility of size markers is displayed to the left.
    Figure Legend Snippet: Agarose gel electrophoresis of PCR products from amplification of MPtV-related sequences in mouse DNA. DNA was extracted from the spleen of a C3H mouse and then purified. PCR amplification was done for 35 cycles in the presence or absence (−) of template DNA by using a primer pair that would generate a 179-bp product with the in A or in B insert of MPtV DNA as a template. After amplification, DNA was resolved by electrophoresis in a 1.5% agarose gel in the presence of 0.5 μg of ethidium bromide per ml. DNA was visualized in UV light. The final concentration of MgCl2 in the PCR is indicated. The electrophoretic mobility of size markers is displayed to the left.

    Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Amplification, Purification, Electrophoresis, Concentration Assay

    Related Articles

    DNA Extraction:

    Article Title: Identification of 14-α-Lanosterol Demethylase (CYP51) in Scedosporium Species
    Article Snippet: The genomic DNA extraction of yeast was performed with MasterPure yeast DNA purification kit (Biozym Scientific GmbH, Hessisch Oldendorf, Germany) ( ). .. The qPCR assay (25 μl) included 1 μl of yeast cDNA, 0.6 μM each gene-specific primer (endogenous ScereERG11 , codon-optimized ERG11/CYP51 , and S. cerevisiae actin gene; TIB Molbiol) (Table S4), 1 mM GeneAMP dNTP blend with dUTP (Thermo Fisher Scientific), 0.65 × EvaGreen dye (Biotium, Fremont, CA, USA), 1× ROX reference dye (Invitrogen), 3 mM MgCl2 (Invitrogen), 1× Platinum Taq buffer without MgCl2 , and 2 U Platinum Taq DNA polymerase (Invitrogen).

    Amplification:

    Article Title: Single molecule real time sequencing in ADTKD-MUC1 allows complete assembly of the VNTR and exact positioning of causative mutations
    Article Snippet: Briefly, 25 µl reactions contained 30 ng of genomic DNA, 0.25 µM of PS2 (5′-XXXXXXXXXXXXXXXGGAGAAAAGGAGACTTCGGCTAC CCAG-3′; X stands for each nucleotide) and PS3 (5′-XXXXXXXXXXXX XXXXGCCGTTGTGCACCAGAGTAGAAGCTGA-3′) primers, 5% DMSO, 0.4 µM dNTP´s, 1 × reaction buffer with 1.5 mM MgCl2 , 250 µM MgCl2 , and 0.9 U DyNAzyme EXT DNA polymerase (Finnzymes, GRI Research, Braintree, UK). .. Briefly, 25 µl reactions contained 30 ng of genomic DNA, 0.25 µM of PS2 (5′-XXXXXXXXXXXXXXXGGAGAAAAGGAGACTTCGGCTAC CCAG-3′; X stands for each nucleotide) and PS3 (5′-XXXXXXXXXXXX XXXXGCCGTTGTGCACCAGAGTAGAAGCTGA-3′) primers, 5% DMSO, 0.4 µM dNTP´s, 1 × reaction buffer with 1.5 mM MgCl2 , 250 µM MgCl2 , and 0.9 U DyNAzyme EXT DNA polymerase (Finnzymes, GRI Research, Braintree, UK).

    Article Title: Molecular identification of Lodoicea maldivica (coco de mer) seeds
    Article Snippet: The amplification products were electrophoresed on a 1% agarose gel, stained with ethidium bromide and observed under UV illumination. .. The PRK gene was amplified with 50 ng DNA template, 1.25 μL of 5 mM dNTPs, 2.0 μL of 25 mM MgCl2 , 2.5 μL of 10× PCR buffer without MgCl2 (Applied Biosystems, USA), 1.5 μL of 10 μM specific primers (Table ), 1.25 μL of 40 ng/μL bovine serum albumin (BSA), 0.5 μL of dimethyl sulfoxide (DMSO) and 1 U of AmpliTaq Gold polymerase (Applied Biosystems, USA). .. The DNA template was denatured at 95°C for four minutes, and then 35 cycles of one minute at 94°C, 30 seconds at 54°C, one minute at 72°C and final extension at 72°C for seven minutes.

    Article Title: Genetic and Functional Role of TNF-alpha in the Development Trypanosoma cruzi Infection
    Article Snippet: Polymorphisms in the promoter region of the TNF-alpha gene were determined by PCR amplification, followed by digestion with appropriate restriction enzymes. .. For TNF-238G/A , PCR was carried out in a volume of 30 µL containing 11.70 µL sterile and filtered Milli-Q water, 3.0 µL 10× buffer without MgCl2 (Gibco), 1.0 µL 50 mM MgCl2 (Gibco), 3.0 µL 2 mM dNTPs (Invitrogen), 3.0 µL of each primer (40 nmol 238F: 5′ GGT CCT ACA CAC AAA TCA GT 3′, and 43.2 nmol 238R: 5′ CAC TCC CCA TCC TCC TCC CTG GTC 3′) (Gibco), 0.30 µL (500 units, 5 U/µL) Taq DNA polymerase (Gibco), and 5.0 µL genomic DNA at a concentration of 20 µg/mL.

    Synthesized:

    Article Title: A Quantitative Raman Spectroscopic Signal for Metal-Phosphodiester Interactions in Solution
    Article Snippet: CdCl2 was obtained from Acros Organics. .. MgCl2 was purchased from Ambion Inc. DMP and DMTP were synthesized by hydrolysis of dimethyl chlorophosphate and dimethyl chlorothiophosphate (Aldrich). .. Specifically, individual chlorophosphates were incubated overnight in a 40-fold molar excess of water and dehydrated to near dryness under vacuum.

    Autoradiography:

    Article Title: cis-Acting Signals in Encapsidation of Hantaan Virus S-Segment Viral Genomic RNA by Its N Protein
    Article Snippet: Analyses of competition assays were performed by a nonlinear fit of the data using the Origin program (MicroCal). .. One nanogram of 32 P-radiolabeled vRNA S segment, prepared as described above, was incubated with a 22.7 μM concentration of purified protein in binding buffer (20 mM HEPES [pH 7.4], 100 mM NaCl, 1 mM MgCl2 , 0.2 mM dithiothreitol, 5% glycerol, and 20 U of RNase inhibitor [Ambion]) in a final reaction volume of 20 μl and incubated at 37°C for 20 min. Two microliters of sample buffer (80% glycerol and 0.2% bromophenol blue) was added to each reaction mixture, and the reaction products were loaded onto a 1% agarose gel, separated by electrophoresis in 0.5× Tris-borate-EDTA at 120 V (constant voltage) for 1.5 h, and visualized by autoradiography. .. The optimal and suboptimal secondary structures of the HTNV S-segment RNAs were predicted with the RNA secondary structure prediction program mfold , version 3.0 ( ).

    Construct:

    Article Title: Identification of 14-α-Lanosterol Demethylase (CYP51) in Scedosporium Species
    Article Snippet: Insertion of the constructs was confirmed by PCR (primers in Table S4) and the replacement of the endogenous ScereERG11 by the codon-optimized ERG11/CYP51 by quantitative PCR (qPCR). .. The qPCR assay (25 μl) included 1 μl of yeast cDNA, 0.6 μM each gene-specific primer (endogenous ScereERG11 , codon-optimized ERG11/CYP51 , and S. cerevisiae actin gene; TIB Molbiol) (Table S4), 1 mM GeneAMP dNTP blend with dUTP (Thermo Fisher Scientific), 0.65 × EvaGreen dye (Biotium, Fremont, CA, USA), 1× ROX reference dye (Invitrogen), 3 mM MgCl2 (Invitrogen), 1× Platinum Taq buffer without MgCl2 , and 2 U Platinum Taq DNA polymerase (Invitrogen).

    Electrophoresis:

    Article Title: cis-Acting Signals in Encapsidation of Hantaan Virus S-Segment Viral Genomic RNA by Its N Protein
    Article Snippet: Analyses of competition assays were performed by a nonlinear fit of the data using the Origin program (MicroCal). .. One nanogram of 32 P-radiolabeled vRNA S segment, prepared as described above, was incubated with a 22.7 μM concentration of purified protein in binding buffer (20 mM HEPES [pH 7.4], 100 mM NaCl, 1 mM MgCl2 , 0.2 mM dithiothreitol, 5% glycerol, and 20 U of RNase inhibitor [Ambion]) in a final reaction volume of 20 μl and incubated at 37°C for 20 min. Two microliters of sample buffer (80% glycerol and 0.2% bromophenol blue) was added to each reaction mixture, and the reaction products were loaded onto a 1% agarose gel, separated by electrophoresis in 0.5× Tris-borate-EDTA at 120 V (constant voltage) for 1.5 h, and visualized by autoradiography. .. The optimal and suboptimal secondary structures of the HTNV S-segment RNAs were predicted with the RNA secondary structure prediction program mfold , version 3.0 ( ).

    Article Title: Melt Analysis of Mismatch Amplification Mutation Assays (Melt-MAMA): A Functional Study of a Cost-Effective SNP Genotyping Assay in Bacterial Models
    Article Snippet: We converted a subset of our Melt-MAMAs to a lower technology platform using conventional PCR coupled with agarose gel electrophoresis (Agarose-MAMAs) ( ). .. The conventional PCR master mix comprised two forward AS primers and a common reverse primer starting at 0.2 µM (IDT, San Diego, CA), 1x PCR buffer without MgCl2 (Invitrogen, Carlsbad, CA), 2 mM MgCl2 (Invitrogen, Carlsbad, CA), 200 µM of each dNTPs (Invitrogen, Carlsbad, CA), 0.8 units of Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA), 1 µl of template at ∼1ng/µl, and molecular grade water to a final volume of 10 µl.

    Incubation:

    Article Title: cis-Acting Signals in Encapsidation of Hantaan Virus S-Segment Viral Genomic RNA by Its N Protein
    Article Snippet: Analyses of competition assays were performed by a nonlinear fit of the data using the Origin program (MicroCal). .. One nanogram of 32 P-radiolabeled vRNA S segment, prepared as described above, was incubated with a 22.7 μM concentration of purified protein in binding buffer (20 mM HEPES [pH 7.4], 100 mM NaCl, 1 mM MgCl2 , 0.2 mM dithiothreitol, 5% glycerol, and 20 U of RNase inhibitor [Ambion]) in a final reaction volume of 20 μl and incubated at 37°C for 20 min. Two microliters of sample buffer (80% glycerol and 0.2% bromophenol blue) was added to each reaction mixture, and the reaction products were loaded onto a 1% agarose gel, separated by electrophoresis in 0.5× Tris-borate-EDTA at 120 V (constant voltage) for 1.5 h, and visualized by autoradiography. .. The optimal and suboptimal secondary structures of the HTNV S-segment RNAs were predicted with the RNA secondary structure prediction program mfold , version 3.0 ( ).

    Expressing:

    Article Title: Selecting Optimal Peptides for Targeted Proteomic Experiments in Human Plasma Using in vitro Synthesized Proteins as Analytical Standards
    Article Snippet: Paragraph title: 1.1 Preparation of c-terminal GST fusion proteins to use as analytical standards via in vitro protein expression ... Dulbecco’s phosphate-buffered saline without MgCl2 and CaCl2 (Gibco, Grand Island, NY) Sepharose Bead Wash Solution #1 Dulbecco’s phosphate-buffered saline without MgCl2 and CaCl2 (Gibco, Grand Island, NY) supplemented with 863 mM sodium chloride (Fisher Scientific).

    Modification:

    Article Title: Single molecule real time sequencing in ADTKD-MUC1 allows complete assembly of the VNTR and exact positioning of causative mutations
    Article Snippet: The PCR protocol was adapted from a previous study with slightly modified cycling conditions and PCR composition . .. Briefly, 25 µl reactions contained 30 ng of genomic DNA, 0.25 µM of PS2 (5′-XXXXXXXXXXXXXXXGGAGAAAAGGAGACTTCGGCTAC CCAG-3′; X stands for each nucleotide) and PS3 (5′-XXXXXXXXXXXX XXXXGCCGTTGTGCACCAGAGTAGAAGCTGA-3′) primers, 5% DMSO, 0.4 µM dNTP´s, 1 × reaction buffer with 1.5 mM MgCl2 , 250 µM MgCl2 , and 0.9 U DyNAzyme EXT DNA polymerase (Finnzymes, GRI Research, Braintree, UK).

    Derivative Assay:

    Article Title: A Quantitative Raman Spectroscopic Signal for Metal-Phosphodiester Interactions in Solution
    Article Snippet: MgCl2 was purchased from Ambion Inc. DMP and DMTP were synthesized by hydrolysis of dimethyl chlorophosphate and dimethyl chlorothiophosphate (Aldrich). .. The resulting phophodiesters were then brought to a stock concentration of 0.4 M with water, and the solution was adjusted to pH 5.0 with formate.

    Gas Chromatography:

    Article Title: Melt Analysis of Mismatch Amplification Mutation Assays (Melt-MAMA): A Functional Study of a Cost-Effective SNP Genotyping Assay in Bacterial Models
    Article Snippet: Selected assays possessed a 19 bp GC-clamp to provide sufficient size difference among AS-PCR products visible on 3% and 2% agarose gels. .. The conventional PCR master mix comprised two forward AS primers and a common reverse primer starting at 0.2 µM (IDT, San Diego, CA), 1x PCR buffer without MgCl2 (Invitrogen, Carlsbad, CA), 2 mM MgCl2 (Invitrogen, Carlsbad, CA), 200 µM of each dNTPs (Invitrogen, Carlsbad, CA), 0.8 units of Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA), 1 µl of template at ∼1ng/µl, and molecular grade water to a final volume of 10 µl.

    Mobility Shift:

    Article Title: cis-Acting Signals in Encapsidation of Hantaan Virus S-Segment Viral Genomic RNA by Its N Protein
    Article Snippet: Paragraph title: Gel electrophoresis mobility shift assay (GEMSA). ... One nanogram of 32 P-radiolabeled vRNA S segment, prepared as described above, was incubated with a 22.7 μM concentration of purified protein in binding buffer (20 mM HEPES [pH 7.4], 100 mM NaCl, 1 mM MgCl2 , 0.2 mM dithiothreitol, 5% glycerol, and 20 U of RNase inhibitor [Ambion]) in a final reaction volume of 20 μl and incubated at 37°C for 20 min. Two microliters of sample buffer (80% glycerol and 0.2% bromophenol blue) was added to each reaction mixture, and the reaction products were loaded onto a 1% agarose gel, separated by electrophoresis in 0.5× Tris-borate-EDTA at 120 V (constant voltage) for 1.5 h, and visualized by autoradiography.

    Cell Culture:

    Article Title: Identification of 14-α-Lanosterol Demethylase (CYP51) in Scedosporium Species
    Article Snippet: For the qPCR, the yeast RNA was extracted from 1.5 ml of a 2-day-old cell culture using the NucleoSpin RNA plant kit (Macherey-Nagel), following the manufacturer's protocol. .. The qPCR assay (25 μl) included 1 μl of yeast cDNA, 0.6 μM each gene-specific primer (endogenous ScereERG11 , codon-optimized ERG11/CYP51 , and S. cerevisiae actin gene; TIB Molbiol) (Table S4), 1 mM GeneAMP dNTP blend with dUTP (Thermo Fisher Scientific), 0.65 × EvaGreen dye (Biotium, Fremont, CA, USA), 1× ROX reference dye (Invitrogen), 3 mM MgCl2 (Invitrogen), 1× Platinum Taq buffer without MgCl2 , and 2 U Platinum Taq DNA polymerase (Invitrogen).

    Generated:

    Article Title: Genetic and Functional Role of TNF-alpha in the Development Trypanosoma cruzi Infection
    Article Snippet: For TNF-238G/A , PCR was carried out in a volume of 30 µL containing 11.70 µL sterile and filtered Milli-Q water, 3.0 µL 10× buffer without MgCl2 (Gibco), 1.0 µL 50 mM MgCl2 (Gibco), 3.0 µL 2 mM dNTPs (Invitrogen), 3.0 µL of each primer (40 nmol 238F: 5′ GGT CCT ACA CAC AAA TCA GT 3′, and 43.2 nmol 238R: 5′ CAC TCC CCA TCC TCC TCC CTG GTC 3′) (Gibco), 0.30 µL (500 units, 5 U/µL) Taq DNA polymerase (Gibco), and 5.0 µL genomic DNA at a concentration of 20 µg/mL. .. For TNF-238G/A , PCR was carried out in a volume of 30 µL containing 11.70 µL sterile and filtered Milli-Q water, 3.0 µL 10× buffer without MgCl2 (Gibco), 1.0 µL 50 mM MgCl2 (Gibco), 3.0 µL 2 mM dNTPs (Invitrogen), 3.0 µL of each primer (40 nmol 238F: 5′ GGT CCT ACA CAC AAA TCA GT 3′, and 43.2 nmol 238R: 5′ CAC TCC CCA TCC TCC TCC CTG GTC 3′) (Gibco), 0.30 µL (500 units, 5 U/µL) Taq DNA polymerase (Gibco), and 5.0 µL genomic DNA at a concentration of 20 µg/mL.

    Article Title: Genetic and Functional Role of TNF-alpha in the Development Trypanosoma cruzi Infection
    Article Snippet: Digestion of the PCR products from patients homozygous for the TNF-238A allele (-238A/A) generated only one 71-base pairs (bp) fragment, whereas those from patients homozygous for the TNF-238G allele (-238G/G) were completely digested (51 and 20 bp). .. For TNF-308G/A , the PCR mixture contained 11.70 µL sterile and filtered Milli-Q water, 3.0 µL 10× buffer without MgCl2 (Gibco), 1.0 µL 50 mM MgCl2 (Gibco), 3.0 µL 2 mM dNTPs (Invitrogen), and 3.0 µL of each primer (38 nmol -308F: 5′ AGG CAA TAG GTT TTG AGG GCC AT 3′, and 45 nmol -308R: TCC TCC CTG CTC CGA TTC CG 3′) (Gibco), 0.30 µL (500 units, 5 U/µL) Taq DNA polymerase (Gibco), and 5.0 µL genomic DNA at a concentration of 20 µg/mL in a final volume of 30 µL.

    Polymerase Chain Reaction:

    Article Title: Understand the Potential Role of Aureobasidium pullulans, a Resident Microorganism From Grapevine, to Prevent the Infection Caused by Diplodia seriata
    Article Snippet: Herein, a nested-PCR reaction was performed for the GST gene, while the ITS region was analyzed as previously described in the plant colonization analysis section. .. The master mix for the first PCR consisted in a 25 μL reaction mix containing 1x Dream Taq buffer with MgCl2 (Thermo Scientific), 0.5 mM MgCl2 (Thermo Scientific), 0.2 mM dNTPs (Thermo Scientific), 0.2 μM of each primer (GST_F and GST_EF1R), 1.25 U of Dream Taq DNA polymerase (Thermo Scientific) and 0.5 μL of genomic DNA. .. The mixture was incubated at 94 °C for 4 min; 20 cycles of 94°C for 30 s, 58°C for 30 s, and 72°C for 45 s; and a final extension at 72°C for 5 min. For the second (nested) PCR, the mix was similar to the first, except that 0.5 μL of the first PCR product was used as template DNA, the primers used were GST_F2 (5′-CTGTCGGTGCCCTTGAGGA-3′) and GST_EF1R1 (5′-CGTCGTTGTACTTGTAGTCC-3′), and the reaction mixture was incubated at 94°C for 4 min; 30 cycles of 94°C for 30 s, 57°C for 30 s, and 72°C for 45 s; and a final extension at 72°C for 5 min.

    Article Title: Identification of 14-α-Lanosterol Demethylase (CYP51) in Scedosporium Species
    Article Snippet: Insertion of the constructs was confirmed by PCR (primers in Table S4) and the replacement of the endogenous ScereERG11 by the codon-optimized ERG11/CYP51 by quantitative PCR (qPCR). .. The qPCR assay (25 μl) included 1 μl of yeast cDNA, 0.6 μM each gene-specific primer (endogenous ScereERG11 , codon-optimized ERG11/CYP51 , and S. cerevisiae actin gene; TIB Molbiol) (Table S4), 1 mM GeneAMP dNTP blend with dUTP (Thermo Fisher Scientific), 0.65 × EvaGreen dye (Biotium, Fremont, CA, USA), 1× ROX reference dye (Invitrogen), 3 mM MgCl2 (Invitrogen), 1× Platinum Taq buffer without MgCl2 , and 2 U Platinum Taq DNA polymerase (Invitrogen).

    Article Title: Single molecule real time sequencing in ADTKD-MUC1 allows complete assembly of the VNTR and exact positioning of causative mutations
    Article Snippet: Paragraph title: MUC1 VNTR PCR ... Briefly, 25 µl reactions contained 30 ng of genomic DNA, 0.25 µM of PS2 (5′-XXXXXXXXXXXXXXXGGAGAAAAGGAGACTTCGGCTAC CCAG-3′; X stands for each nucleotide) and PS3 (5′-XXXXXXXXXXXX XXXXGCCGTTGTGCACCAGAGTAGAAGCTGA-3′) primers, 5% DMSO, 0.4 µM dNTP´s, 1 × reaction buffer with 1.5 mM MgCl2 , 250 µM MgCl2 , and 0.9 U DyNAzyme EXT DNA polymerase (Finnzymes, GRI Research, Braintree, UK).

    Article Title: Molecular identification of Lodoicea maldivica (coco de mer) seeds
    Article Snippet: The amplification products were electrophoresed on a 1% agarose gel, stained with ethidium bromide and observed under UV illumination. .. The PRK gene was amplified with 50 ng DNA template, 1.25 μL of 5 mM dNTPs, 2.0 μL of 25 mM MgCl2 , 2.5 μL of 10× PCR buffer without MgCl2 (Applied Biosystems, USA), 1.5 μL of 10 μM specific primers (Table ), 1.25 μL of 40 ng/μL bovine serum albumin (BSA), 0.5 μL of dimethyl sulfoxide (DMSO) and 1 U of AmpliTaq Gold polymerase (Applied Biosystems, USA). .. The DNA template was denatured at 95°C for four minutes, and then 35 cycles of one minute at 94°C, 30 seconds at 54°C, one minute at 72°C and final extension at 72°C for seven minutes.

    Article Title: Distribution pattern following systemic mesenchymal stem cell injection depends on the age of the recipient and neuronal health
    Article Snippet: Up to four copies of Y-chromosomes can be detected in the background of up to 50 ng gDNA. .. The PCR mix contained 0.2 μM primers, 0.2 mM dNTPs (Thermo Scientific), 2.8 mM MgCl2 (Life Technologies), 1× buffer without MgCl2 (Life Technologies), and 1 U platinum taq polymerase (Life Technologies). gDNA (5 μl) was added to the mix as a template. .. As a positive control, 5 μl gDNA isolated from male mouse brain tissue was used (concentration: 0.55 ng/ml in TE buffer, pH 8.0) instead of the sample gDNA.

    Article Title: Population Structure of East African Relapsing Fever Borrelia spp.
    Article Snippet: A real-time TaqMan flagellin assay was used to screen samples for the presence of borrelial DNA before investigation. .. A mastermix composed of PCR working concentration buffer without MgCl2 (Invitrogen, Carlsbad, CA, USA), 0.2 mmol/L of each dNTP, 5 mmol/L MgCl2 , 0.075 nmol/L Rox, and 0.06 U Taq polymerase (Invitrogen). .. Mastermix was divided into aliquots of 23 μL to which 2 μL of extracted DNA was added.

    Article Title: Melt Analysis of Mismatch Amplification Mutation Assays (Melt-MAMA): A Functional Study of a Cost-Effective SNP Genotyping Assay in Bacterial Models
    Article Snippet: Selected assays possessed a 19 bp GC-clamp to provide sufficient size difference among AS-PCR products visible on 3% and 2% agarose gels. .. The conventional PCR master mix comprised two forward AS primers and a common reverse primer starting at 0.2 µM (IDT, San Diego, CA), 1x PCR buffer without MgCl2 (Invitrogen, Carlsbad, CA), 2 mM MgCl2 (Invitrogen, Carlsbad, CA), 200 µM of each dNTPs (Invitrogen, Carlsbad, CA), 0.8 units of Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA), 1 µl of template at ∼1ng/µl, and molecular grade water to a final volume of 10 µl. .. Agarose-MAMAs were performed under the following conditions: PCR amplifications were conducted on a MJ Research 96 well block thermal cycler DNA engines equipped with hot bonnets.

    Article Title: Genetic and Functional Role of TNF-alpha in the Development Trypanosoma cruzi Infection
    Article Snippet: All three fragments (71, 51 and 20 bp) were present in heterozygous patients. .. For TNF-308G/A , the PCR mixture contained 11.70 µL sterile and filtered Milli-Q water, 3.0 µL 10× buffer without MgCl2 (Gibco), 1.0 µL 50 mM MgCl2 (Gibco), 3.0 µL 2 mM dNTPs (Invitrogen), and 3.0 µL of each primer (38 nmol -308F: 5′ AGG CAA TAG GTT TTG AGG GCC AT 3′, and 45 nmol -308R: TCC TCC CTG CTC CGA TTC CG 3′) (Gibco), 0.30 µL (500 units, 5 U/µL) Taq DNA polymerase (Gibco), and 5.0 µL genomic DNA at a concentration of 20 µg/mL in a final volume of 30 µL. .. The following PCR conditions were used: 5 min at 95°C for initial denaturation, followed by 35 cycles at 95°C for 1 min (denaturation), 52°C for 45 s (primer annealing), and 72°C for 45 s (extension), followed by a final extension step at 72°C for 3 min. For RFLP, the mixture contained 0.1 µL Nco I (10 U/µL) (Gibco), 1.5 µL REACT 3 buffer provided with the restriction enzyme, 10.5 µL sterile and filtered Milli-Q water, and 3.0 µL of the PCR product in a final volume of 12.1 µL.

    Antiviral Assay:

    Article Title: Genetic and Functional Role of TNF-alpha in the Development Trypanosoma cruzi Infection
    Article Snippet: The following PCR conditions were used: 5 min at 95°C for initial denaturation and 35 cycles at 95°C for 1 min (denaturation), 55°C for 45 s (primer annealing), and 72°C for 45 s (extension), followed by a final extension step at 72°C for 3 min. Next, RFLP was performed using 0.1 µL Ava II (10,000 U/mL) (New England Biolabs), 1.0 µL NE 4 buffer provided with the restriction enzyme, 0.4 µL sterile and filtered Milli-Q water, and 8.5 µL of the PCR product in a final volume of 10 µL. .. For TNF-308G/A , the PCR mixture contained 11.70 µL sterile and filtered Milli-Q water, 3.0 µL 10× buffer without MgCl2 (Gibco), 1.0 µL 50 mM MgCl2 (Gibco), 3.0 µL 2 mM dNTPs (Invitrogen), and 3.0 µL of each primer (38 nmol -308F: 5′ AGG CAA TAG GTT TTG AGG GCC AT 3′, and 45 nmol -308R: TCC TCC CTG CTC CGA TTC CG 3′) (Gibco), 0.30 µL (500 units, 5 U/µL) Taq DNA polymerase (Gibco), and 5.0 µL genomic DNA at a concentration of 20 µg/mL in a final volume of 30 µL.

    Binding Assay:

    Article Title: cis-Acting Signals in Encapsidation of Hantaan Virus S-Segment Viral Genomic RNA by Its N Protein
    Article Snippet: Analyses of competition assays were performed by a nonlinear fit of the data using the Origin program (MicroCal). .. One nanogram of 32 P-radiolabeled vRNA S segment, prepared as described above, was incubated with a 22.7 μM concentration of purified protein in binding buffer (20 mM HEPES [pH 7.4], 100 mM NaCl, 1 mM MgCl2 , 0.2 mM dithiothreitol, 5% glycerol, and 20 U of RNase inhibitor [Ambion]) in a final reaction volume of 20 μl and incubated at 37°C for 20 min. Two microliters of sample buffer (80% glycerol and 0.2% bromophenol blue) was added to each reaction mixture, and the reaction products were loaded onto a 1% agarose gel, separated by electrophoresis in 0.5× Tris-borate-EDTA at 120 V (constant voltage) for 1.5 h, and visualized by autoradiography. .. The optimal and suboptimal secondary structures of the HTNV S-segment RNAs were predicted with the RNA secondary structure prediction program mfold , version 3.0 ( ).

    Cellular Antioxidant Activity Assay:

    Article Title: Genetic and Functional Role of TNF-alpha in the Development Trypanosoma cruzi Infection
    Article Snippet: All three fragments (71, 51 and 20 bp) were present in heterozygous patients. .. For TNF-308G/A , the PCR mixture contained 11.70 µL sterile and filtered Milli-Q water, 3.0 µL 10× buffer without MgCl2 (Gibco), 1.0 µL 50 mM MgCl2 (Gibco), 3.0 µL 2 mM dNTPs (Invitrogen), and 3.0 µL of each primer (38 nmol -308F: 5′ AGG CAA TAG GTT TTG AGG GCC AT 3′, and 45 nmol -308R: TCC TCC CTG CTC CGA TTC CG 3′) (Gibco), 0.30 µL (500 units, 5 U/µL) Taq DNA polymerase (Gibco), and 5.0 µL genomic DNA at a concentration of 20 µg/mL in a final volume of 30 µL. .. The following PCR conditions were used: 5 min at 95°C for initial denaturation, followed by 35 cycles at 95°C for 1 min (denaturation), 52°C for 45 s (primer annealing), and 72°C for 45 s (extension), followed by a final extension step at 72°C for 3 min. For RFLP, the mixture contained 0.1 µL Nco I (10 U/µL) (Gibco), 1.5 µL REACT 3 buffer provided with the restriction enzyme, 10.5 µL sterile and filtered Milli-Q water, and 3.0 µL of the PCR product in a final volume of 12.1 µL.

    Multiplexing:

    Article Title: Single molecule real time sequencing in ADTKD-MUC1 allows complete assembly of the VNTR and exact positioning of causative mutations
    Article Snippet: Custom-designed 16 bp barcodes were added to the PCR primers for multiplexing different individuals following the guidelines for using PacBio Barcodes for SMRT Sequencing (Pacific Biosciences). .. Briefly, 25 µl reactions contained 30 ng of genomic DNA, 0.25 µM of PS2 (5′-XXXXXXXXXXXXXXXGGAGAAAAGGAGACTTCGGCTAC CCAG-3′; X stands for each nucleotide) and PS3 (5′-XXXXXXXXXXXX XXXXGCCGTTGTGCACCAGAGTAGAAGCTGA-3′) primers, 5% DMSO, 0.4 µM dNTP´s, 1 × reaction buffer with 1.5 mM MgCl2 , 250 µM MgCl2 , and 0.9 U DyNAzyme EXT DNA polymerase (Finnzymes, GRI Research, Braintree, UK).

    Nucleic Acid Electrophoresis:

    Article Title: cis-Acting Signals in Encapsidation of Hantaan Virus S-Segment Viral Genomic RNA by Its N Protein
    Article Snippet: Paragraph title: Gel electrophoresis mobility shift assay (GEMSA). ... One nanogram of 32 P-radiolabeled vRNA S segment, prepared as described above, was incubated with a 22.7 μM concentration of purified protein in binding buffer (20 mM HEPES [pH 7.4], 100 mM NaCl, 1 mM MgCl2 , 0.2 mM dithiothreitol, 5% glycerol, and 20 U of RNase inhibitor [Ambion]) in a final reaction volume of 20 μl and incubated at 37°C for 20 min. Two microliters of sample buffer (80% glycerol and 0.2% bromophenol blue) was added to each reaction mixture, and the reaction products were loaded onto a 1% agarose gel, separated by electrophoresis in 0.5× Tris-borate-EDTA at 120 V (constant voltage) for 1.5 h, and visualized by autoradiography.

    Article Title: Identification of 14-α-Lanosterol Demethylase (CYP51) in Scedosporium Species
    Article Snippet: The qPCR assay (25 μl) included 1 μl of yeast cDNA, 0.6 μM each gene-specific primer (endogenous ScereERG11 , codon-optimized ERG11/CYP51 , and S. cerevisiae actin gene; TIB Molbiol) (Table S4), 1 mM GeneAMP dNTP blend with dUTP (Thermo Fisher Scientific), 0.65 × EvaGreen dye (Biotium, Fremont, CA, USA), 1× ROX reference dye (Invitrogen), 3 mM MgCl2 (Invitrogen), 1× Platinum Taq buffer without MgCl2 , and 2 U Platinum Taq DNA polymerase (Invitrogen). .. Amplification was performed in an ABI 7500 cycler (Applied Biosystems), as follows: 2 min at 50°C and 10 min at 95°C, followed by 45 cycles at 95°C for 15 s, 55°C for 30 s, and 72°C for 40 s. The data collection was done during the extension step.

    Cell Tracking Assay:

    Article Title: Distribution pattern following systemic mesenchymal stem cell injection depends on the age of the recipient and neuronal health
    Article Snippet: Paragraph title: Cell-tracking PCR ... The PCR mix contained 0.2 μM primers, 0.2 mM dNTPs (Thermo Scientific), 2.8 mM MgCl2 (Life Technologies), 1× buffer without MgCl2 (Life Technologies), and 1 U platinum taq polymerase (Life Technologies). gDNA (5 μl) was added to the mix as a template.

    Marker:

    Article Title: Single molecule real time sequencing in ADTKD-MUC1 allows complete assembly of the VNTR and exact positioning of causative mutations
    Article Snippet: Briefly, 25 µl reactions contained 30 ng of genomic DNA, 0.25 µM of PS2 (5′-XXXXXXXXXXXXXXXGGAGAAAAGGAGACTTCGGCTAC CCAG-3′; X stands for each nucleotide) and PS3 (5′-XXXXXXXXXXXX XXXXGCCGTTGTGCACCAGAGTAGAAGCTGA-3′) primers, 5% DMSO, 0.4 µM dNTP´s, 1 × reaction buffer with 1.5 mM MgCl2 , 250 µM MgCl2 , and 0.9 U DyNAzyme EXT DNA polymerase (Finnzymes, GRI Research, Braintree, UK). .. Amplification of VNTR (25 µl of each pooled sample) was verified by agarose gel electrophoresis (0.7%).

    Size-exclusion Chromatography:

    Article Title: Melt Analysis of Mismatch Amplification Mutation Assays (Melt-MAMA): A Functional Study of a Cost-Effective SNP Genotyping Assay in Bacterial Models
    Article Snippet: The conventional PCR master mix comprised two forward AS primers and a common reverse primer starting at 0.2 µM (IDT, San Diego, CA), 1x PCR buffer without MgCl2 (Invitrogen, Carlsbad, CA), 2 mM MgCl2 (Invitrogen, Carlsbad, CA), 200 µM of each dNTPs (Invitrogen, Carlsbad, CA), 0.8 units of Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA), 1 µl of template at ∼1ng/µl, and molecular grade water to a final volume of 10 µl. .. Agarose-MAMAs were performed under the following conditions: PCR amplifications were conducted on a MJ Research 96 well block thermal cycler DNA engines equipped with hot bonnets.

    Purification:

    Article Title: cis-Acting Signals in Encapsidation of Hantaan Virus S-Segment Viral Genomic RNA by Its N Protein
    Article Snippet: Analyses of competition assays were performed by a nonlinear fit of the data using the Origin program (MicroCal). .. One nanogram of 32 P-radiolabeled vRNA S segment, prepared as described above, was incubated with a 22.7 μM concentration of purified protein in binding buffer (20 mM HEPES [pH 7.4], 100 mM NaCl, 1 mM MgCl2 , 0.2 mM dithiothreitol, 5% glycerol, and 20 U of RNase inhibitor [Ambion]) in a final reaction volume of 20 μl and incubated at 37°C for 20 min. Two microliters of sample buffer (80% glycerol and 0.2% bromophenol blue) was added to each reaction mixture, and the reaction products were loaded onto a 1% agarose gel, separated by electrophoresis in 0.5× Tris-borate-EDTA at 120 V (constant voltage) for 1.5 h, and visualized by autoradiography. .. The optimal and suboptimal secondary structures of the HTNV S-segment RNAs were predicted with the RNA secondary structure prediction program mfold , version 3.0 ( ).

    Article Title: Single molecule real time sequencing in ADTKD-MUC1 allows complete assembly of the VNTR and exact positioning of causative mutations
    Article Snippet: Briefly, 25 µl reactions contained 30 ng of genomic DNA, 0.25 µM of PS2 (5′-XXXXXXXXXXXXXXXGGAGAAAAGGAGACTTCGGCTAC CCAG-3′; X stands for each nucleotide) and PS3 (5′-XXXXXXXXXXXX XXXXGCCGTTGTGCACCAGAGTAGAAGCTGA-3′) primers, 5% DMSO, 0.4 µM dNTP´s, 1 × reaction buffer with 1.5 mM MgCl2 , 250 µM MgCl2 , and 0.9 U DyNAzyme EXT DNA polymerase (Finnzymes, GRI Research, Braintree, UK). .. The GeneRuler DNA Ladder (1 kb, 0.5 µg/µl, Fermentas) was used as a size marker.

    Sequencing:

    Article Title: A Quantitative Raman Spectroscopic Signal for Metal-Phosphodiester Interactions in Solution
    Article Snippet: MgCl2 was purchased from Ambion Inc. DMP and DMTP were synthesized by hydrolysis of dimethyl chlorophosphate and dimethyl chlorothiophosphate (Aldrich). .. The resulting phophodiesters were then brought to a stock concentration of 0.4 M with water, and the solution was adjusted to pH 5.0 with formate.

    Article Title: Understand the Potential Role of Aureobasidium pullulans, a Resident Microorganism From Grapevine, to Prevent the Infection Caused by Diplodia seriata
    Article Snippet: The presence of strain Fito_F278 was confirmed by using strain-specific primers targeting the GST and by sequencing the ITS region. .. The master mix for the first PCR consisted in a 25 μL reaction mix containing 1x Dream Taq buffer with MgCl2 (Thermo Scientific), 0.5 mM MgCl2 (Thermo Scientific), 0.2 mM dNTPs (Thermo Scientific), 0.2 μM of each primer (GST_F and GST_EF1R), 1.25 U of Dream Taq DNA polymerase (Thermo Scientific) and 0.5 μL of genomic DNA.

    Article Title: Single molecule real time sequencing in ADTKD-MUC1 allows complete assembly of the VNTR and exact positioning of causative mutations
    Article Snippet: Custom-designed 16 bp barcodes were added to the PCR primers for multiplexing different individuals following the guidelines for using PacBio Barcodes for SMRT Sequencing (Pacific Biosciences). .. Briefly, 25 µl reactions contained 30 ng of genomic DNA, 0.25 µM of PS2 (5′-XXXXXXXXXXXXXXXGGAGAAAAGGAGACTTCGGCTAC CCAG-3′; X stands for each nucleotide) and PS3 (5′-XXXXXXXXXXXX XXXXGCCGTTGTGCACCAGAGTAGAAGCTGA-3′) primers, 5% DMSO, 0.4 µM dNTP´s, 1 × reaction buffer with 1.5 mM MgCl2 , 250 µM MgCl2 , and 0.9 U DyNAzyme EXT DNA polymerase (Finnzymes, GRI Research, Braintree, UK).

    Nested PCR:

    Article Title: Understand the Potential Role of Aureobasidium pullulans, a Resident Microorganism From Grapevine, to Prevent the Infection Caused by Diplodia seriata
    Article Snippet: Herein, a nested-PCR reaction was performed for the GST gene, while the ITS region was analyzed as previously described in the plant colonization analysis section. .. The master mix for the first PCR consisted in a 25 μL reaction mix containing 1x Dream Taq buffer with MgCl2 (Thermo Scientific), 0.5 mM MgCl2 (Thermo Scientific), 0.2 mM dNTPs (Thermo Scientific), 0.2 μM of each primer (GST_F and GST_EF1R), 1.25 U of Dream Taq DNA polymerase (Thermo Scientific) and 0.5 μL of genomic DNA.

    Real-time Polymerase Chain Reaction:

    Article Title: Identification of 14-α-Lanosterol Demethylase (CYP51) in Scedosporium Species
    Article Snippet: The first-strand cDNA synthesis was performed on 350 ng of RNA by SuperScript II reverse transcriptase (Invitrogen) with an oligo(dT)12–18 primer (Invitrogen), following the manufacturer's protocol. .. The qPCR assay (25 μl) included 1 μl of yeast cDNA, 0.6 μM each gene-specific primer (endogenous ScereERG11 , codon-optimized ERG11/CYP51 , and S. cerevisiae actin gene; TIB Molbiol) (Table S4), 1 mM GeneAMP dNTP blend with dUTP (Thermo Fisher Scientific), 0.65 × EvaGreen dye (Biotium, Fremont, CA, USA), 1× ROX reference dye (Invitrogen), 3 mM MgCl2 (Invitrogen), 1× Platinum Taq buffer without MgCl2 , and 2 U Platinum Taq DNA polymerase (Invitrogen). .. Amplification was performed in an ABI 7500 cycler (Applied Biosystems), as follows: 2 min at 50°C and 10 min at 95°C, followed by 45 cycles at 95°C for 15 s, 55°C for 30 s, and 72°C for 40 s. The data collection was done during the extension step.

    Functional Assay:

    Article Title: Identification of 14-α-Lanosterol Demethylase (CYP51) in Scedosporium Species
    Article Snippet: Paragraph title: Functional complementation study. ... The qPCR assay (25 μl) included 1 μl of yeast cDNA, 0.6 μM each gene-specific primer (endogenous ScereERG11 , codon-optimized ERG11/CYP51 , and S. cerevisiae actin gene; TIB Molbiol) (Table S4), 1 mM GeneAMP dNTP blend with dUTP (Thermo Fisher Scientific), 0.65 × EvaGreen dye (Biotium, Fremont, CA, USA), 1× ROX reference dye (Invitrogen), 3 mM MgCl2 (Invitrogen), 1× Platinum Taq buffer without MgCl2 , and 2 U Platinum Taq DNA polymerase (Invitrogen).

    Agarose Gel Electrophoresis:

    Article Title: cis-Acting Signals in Encapsidation of Hantaan Virus S-Segment Viral Genomic RNA by Its N Protein
    Article Snippet: Analyses of competition assays were performed by a nonlinear fit of the data using the Origin program (MicroCal). .. One nanogram of 32 P-radiolabeled vRNA S segment, prepared as described above, was incubated with a 22.7 μM concentration of purified protein in binding buffer (20 mM HEPES [pH 7.4], 100 mM NaCl, 1 mM MgCl2 , 0.2 mM dithiothreitol, 5% glycerol, and 20 U of RNase inhibitor [Ambion]) in a final reaction volume of 20 μl and incubated at 37°C for 20 min. Two microliters of sample buffer (80% glycerol and 0.2% bromophenol blue) was added to each reaction mixture, and the reaction products were loaded onto a 1% agarose gel, separated by electrophoresis in 0.5× Tris-borate-EDTA at 120 V (constant voltage) for 1.5 h, and visualized by autoradiography. .. The optimal and suboptimal secondary structures of the HTNV S-segment RNAs were predicted with the RNA secondary structure prediction program mfold , version 3.0 ( ).

    Article Title: Single molecule real time sequencing in ADTKD-MUC1 allows complete assembly of the VNTR and exact positioning of causative mutations
    Article Snippet: Briefly, 25 µl reactions contained 30 ng of genomic DNA, 0.25 µM of PS2 (5′-XXXXXXXXXXXXXXXGGAGAAAAGGAGACTTCGGCTAC CCAG-3′; X stands for each nucleotide) and PS3 (5′-XXXXXXXXXXXX XXXXGCCGTTGTGCACCAGAGTAGAAGCTGA-3′) primers, 5% DMSO, 0.4 µM dNTP´s, 1 × reaction buffer with 1.5 mM MgCl2 , 250 µM MgCl2 , and 0.9 U DyNAzyme EXT DNA polymerase (Finnzymes, GRI Research, Braintree, UK). .. Briefly, 25 µl reactions contained 30 ng of genomic DNA, 0.25 µM of PS2 (5′-XXXXXXXXXXXXXXXGGAGAAAAGGAGACTTCGGCTAC CCAG-3′; X stands for each nucleotide) and PS3 (5′-XXXXXXXXXXXX XXXXGCCGTTGTGCACCAGAGTAGAAGCTGA-3′) primers, 5% DMSO, 0.4 µM dNTP´s, 1 × reaction buffer with 1.5 mM MgCl2 , 250 µM MgCl2 , and 0.9 U DyNAzyme EXT DNA polymerase (Finnzymes, GRI Research, Braintree, UK).

    Article Title: Molecular identification of Lodoicea maldivica (coco de mer) seeds
    Article Snippet: The PRK gene was amplified with 50 ng DNA template, 1.25 μL of 5 mM dNTPs, 2.0 μL of 25 mM MgCl2 , 2.5 μL of 10× PCR buffer without MgCl2 (Applied Biosystems, USA), 1.5 μL of 10 μM specific primers (Table ), 1.25 μL of 40 ng/μL bovine serum albumin (BSA), 0.5 μL of dimethyl sulfoxide (DMSO) and 1 U of AmpliTaq Gold polymerase (Applied Biosystems, USA). .. The PRK gene was amplified with 50 ng DNA template, 1.25 μL of 5 mM dNTPs, 2.0 μL of 25 mM MgCl2 , 2.5 μL of 10× PCR buffer without MgCl2 (Applied Biosystems, USA), 1.5 μL of 10 μM specific primers (Table ), 1.25 μL of 40 ng/μL bovine serum albumin (BSA), 0.5 μL of dimethyl sulfoxide (DMSO) and 1 U of AmpliTaq Gold polymerase (Applied Biosystems, USA).

    Article Title: Distribution pattern following systemic mesenchymal stem cell injection depends on the age of the recipient and neuronal health
    Article Snippet: The PCR mix contained 0.2 μM primers, 0.2 mM dNTPs (Thermo Scientific), 2.8 mM MgCl2 (Life Technologies), 1× buffer without MgCl2 (Life Technologies), and 1 U platinum taq polymerase (Life Technologies). gDNA (5 μl) was added to the mix as a template. .. PCR was performed in a thermocycler T professional (Biometra) with a primary 3-min denaturation step at 95 °C followed by 35 cycles: 30 s at 95 °C, 30 s at 60 °C, and 30 s at 72 °C, with a final 3-min elongation step at 72 °C.

    Article Title: Melt Analysis of Mismatch Amplification Mutation Assays (Melt-MAMA): A Functional Study of a Cost-Effective SNP Genotyping Assay in Bacterial Models
    Article Snippet: We converted a subset of our Melt-MAMAs to a lower technology platform using conventional PCR coupled with agarose gel electrophoresis (Agarose-MAMAs) ( ). .. The conventional PCR master mix comprised two forward AS primers and a common reverse primer starting at 0.2 µM (IDT, San Diego, CA), 1x PCR buffer without MgCl2 (Invitrogen, Carlsbad, CA), 2 mM MgCl2 (Invitrogen, Carlsbad, CA), 200 µM of each dNTPs (Invitrogen, Carlsbad, CA), 0.8 units of Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA), 1 µl of template at ∼1ng/µl, and molecular grade water to a final volume of 10 µl.

    In Vitro:

    Article Title: A Quantitative Raman Spectroscopic Signal for Metal-Phosphodiester Interactions in Solution
    Article Snippet: MgCl2 was purchased from Ambion Inc. DMP and DMTP were synthesized by hydrolysis of dimethyl chlorophosphate and dimethyl chlorothiophosphate (Aldrich). .. Eleven-nucleotide single-stranded RNA 5′-UCAAGUACCGA-3′, the 12-nucleotide GAAA tetraloop (5′-GGGCGAAAGUCC-3′), and the 27-nucleotide bulged stem–loop sequence derived from the P4 helix/stem-loop portion of RNase P RNA ( ) (5′-GGAAGUCCGGUCUUCGGACCGGCUUCC-3′) were made by solid phase synthesis (Dharmacon Inc.).

    Article Title: Selecting Optimal Peptides for Targeted Proteomic Experiments in Human Plasma Using in vitro Synthesized Proteins as Analytical Standards
    Article Snippet: Paragraph title: 1.1 Preparation of c-terminal GST fusion proteins to use as analytical standards via in vitro protein expression ... Dulbecco’s phosphate-buffered saline without MgCl2 and CaCl2 (Gibco, Grand Island, NY) Sepharose Bead Wash Solution #1 Dulbecco’s phosphate-buffered saline without MgCl2 and CaCl2 (Gibco, Grand Island, NY) supplemented with 863 mM sodium chloride (Fisher Scientific).

    Spectrophotometry:

    Article Title: Selecting Optimal Peptides for Targeted Proteomic Experiments in Human Plasma Using in vitro Synthesized Proteins as Analytical Standards
    Article Snippet: ND-1000 Spectrophotometer (Nanodrop, Wilmington, DE) 1-step Human Coupled in vitro protein synthesis kit (Pierce Biotechnology, Rockford, IL). .. Dulbecco’s phosphate-buffered saline without MgCl2 and CaCl2 (Gibco, Grand Island, NY) Sepharose Bead Wash Solution #1 Dulbecco’s phosphate-buffered saline without MgCl2 and CaCl2 (Gibco, Grand Island, NY) supplemented with 863 mM sodium chloride (Fisher Scientific).

    Concentration Assay:

    Article Title: A Quantitative Raman Spectroscopic Signal for Metal-Phosphodiester Interactions in Solution
    Article Snippet: MgCl2 was purchased from Ambion Inc. DMP and DMTP were synthesized by hydrolysis of dimethyl chlorophosphate and dimethyl chlorothiophosphate (Aldrich). .. Specifically, individual chlorophosphates were incubated overnight in a 40-fold molar excess of water and dehydrated to near dryness under vacuum.

    Article Title: cis-Acting Signals in Encapsidation of Hantaan Virus S-Segment Viral Genomic RNA by Its N Protein
    Article Snippet: Analyses of competition assays were performed by a nonlinear fit of the data using the Origin program (MicroCal). .. One nanogram of 32 P-radiolabeled vRNA S segment, prepared as described above, was incubated with a 22.7 μM concentration of purified protein in binding buffer (20 mM HEPES [pH 7.4], 100 mM NaCl, 1 mM MgCl2 , 0.2 mM dithiothreitol, 5% glycerol, and 20 U of RNase inhibitor [Ambion]) in a final reaction volume of 20 μl and incubated at 37°C for 20 min. Two microliters of sample buffer (80% glycerol and 0.2% bromophenol blue) was added to each reaction mixture, and the reaction products were loaded onto a 1% agarose gel, separated by electrophoresis in 0.5× Tris-borate-EDTA at 120 V (constant voltage) for 1.5 h, and visualized by autoradiography. .. The optimal and suboptimal secondary structures of the HTNV S-segment RNAs were predicted with the RNA secondary structure prediction program mfold , version 3.0 ( ).

    Article Title: Population Structure of East African Relapsing Fever Borrelia spp.
    Article Snippet: A real-time TaqMan flagellin assay was used to screen samples for the presence of borrelial DNA before investigation. .. A mastermix composed of PCR working concentration buffer without MgCl2 (Invitrogen, Carlsbad, CA, USA), 0.2 mmol/L of each dNTP, 5 mmol/L MgCl2 , 0.075 nmol/L Rox, and 0.06 U Taq polymerase (Invitrogen). .. Mastermix was divided into aliquots of 23 μL to which 2 μL of extracted DNA was added.

    Article Title: Genetic and Functional Role of TNF-alpha in the Development Trypanosoma cruzi Infection
    Article Snippet: Polymorphisms in the promoter region of the TNF-alpha gene were determined by PCR amplification, followed by digestion with appropriate restriction enzymes. .. For TNF-238G/A , PCR was carried out in a volume of 30 µL containing 11.70 µL sterile and filtered Milli-Q water, 3.0 µL 10× buffer without MgCl2 (Gibco), 1.0 µL 50 mM MgCl2 (Gibco), 3.0 µL 2 mM dNTPs (Invitrogen), 3.0 µL of each primer (40 nmol 238F: 5′ GGT CCT ACA CAC AAA TCA GT 3′, and 43.2 nmol 238R: 5′ CAC TCC CCA TCC TCC TCC CTG GTC 3′) (Gibco), 0.30 µL (500 units, 5 U/µL) Taq DNA polymerase (Gibco), and 5.0 µL genomic DNA at a concentration of 20 µg/mL. .. The following PCR conditions were used: 5 min at 95°C for initial denaturation and 35 cycles at 95°C for 1 min (denaturation), 55°C for 45 s (primer annealing), and 72°C for 45 s (extension), followed by a final extension step at 72°C for 3 min. Next, RFLP was performed using 0.1 µL Ava II (10,000 U/mL) (New England Biolabs), 1.0 µL NE 4 buffer provided with the restriction enzyme, 0.4 µL sterile and filtered Milli-Q water, and 8.5 µL of the PCR product in a final volume of 10 µL.

    Article Title: Genetic and Functional Role of TNF-alpha in the Development Trypanosoma cruzi Infection
    Article Snippet: All three fragments (71, 51 and 20 bp) were present in heterozygous patients. .. For TNF-308G/A , the PCR mixture contained 11.70 µL sterile and filtered Milli-Q water, 3.0 µL 10× buffer without MgCl2 (Gibco), 1.0 µL 50 mM MgCl2 (Gibco), 3.0 µL 2 mM dNTPs (Invitrogen), and 3.0 µL of each primer (38 nmol -308F: 5′ AGG CAA TAG GTT TTG AGG GCC AT 3′, and 45 nmol -308R: TCC TCC CTG CTC CGA TTC CG 3′) (Gibco), 0.30 µL (500 units, 5 U/µL) Taq DNA polymerase (Gibco), and 5.0 µL genomic DNA at a concentration of 20 µg/mL in a final volume of 30 µL. .. The following PCR conditions were used: 5 min at 95°C for initial denaturation, followed by 35 cycles at 95°C for 1 min (denaturation), 52°C for 45 s (primer annealing), and 72°C for 45 s (extension), followed by a final extension step at 72°C for 3 min. For RFLP, the mixture contained 0.1 µL Nco I (10 U/µL) (Gibco), 1.5 µL REACT 3 buffer provided with the restriction enzyme, 10.5 µL sterile and filtered Milli-Q water, and 3.0 µL of the PCR product in a final volume of 12.1 µL.

    DNA Purification:

    Article Title: Identification of 14-α-Lanosterol Demethylase (CYP51) in Scedosporium Species
    Article Snippet: The genomic DNA extraction of yeast was performed with MasterPure yeast DNA purification kit (Biozym Scientific GmbH, Hessisch Oldendorf, Germany) ( ). .. The qPCR assay (25 μl) included 1 μl of yeast cDNA, 0.6 μM each gene-specific primer (endogenous ScereERG11 , codon-optimized ERG11/CYP51 , and S. cerevisiae actin gene; TIB Molbiol) (Table S4), 1 mM GeneAMP dNTP blend with dUTP (Thermo Fisher Scientific), 0.65 × EvaGreen dye (Biotium, Fremont, CA, USA), 1× ROX reference dye (Invitrogen), 3 mM MgCl2 (Invitrogen), 1× Platinum Taq buffer without MgCl2 , and 2 U Platinum Taq DNA polymerase (Invitrogen).

    CTG Assay:

    Article Title: Genetic and Functional Role of TNF-alpha in the Development Trypanosoma cruzi Infection
    Article Snippet: Polymorphisms in the promoter region of the TNF-alpha gene were determined by PCR amplification, followed by digestion with appropriate restriction enzymes. .. For TNF-238G/A , PCR was carried out in a volume of 30 µL containing 11.70 µL sterile and filtered Milli-Q water, 3.0 µL 10× buffer without MgCl2 (Gibco), 1.0 µL 50 mM MgCl2 (Gibco), 3.0 µL 2 mM dNTPs (Invitrogen), 3.0 µL of each primer (40 nmol 238F: 5′ GGT CCT ACA CAC AAA TCA GT 3′, and 43.2 nmol 238R: 5′ CAC TCC CCA TCC TCC TCC CTG GTC 3′) (Gibco), 0.30 µL (500 units, 5 U/µL) Taq DNA polymerase (Gibco), and 5.0 µL genomic DNA at a concentration of 20 µg/mL. .. The following PCR conditions were used: 5 min at 95°C for initial denaturation and 35 cycles at 95°C for 1 min (denaturation), 55°C for 45 s (primer annealing), and 72°C for 45 s (extension), followed by a final extension step at 72°C for 3 min. Next, RFLP was performed using 0.1 µL Ava II (10,000 U/mL) (New England Biolabs), 1.0 µL NE 4 buffer provided with the restriction enzyme, 0.4 µL sterile and filtered Milli-Q water, and 8.5 µL of the PCR product in a final volume of 10 µL.

    Article Title: Genetic and Functional Role of TNF-alpha in the Development Trypanosoma cruzi Infection
    Article Snippet: All three fragments (71, 51 and 20 bp) were present in heterozygous patients. .. For TNF-308G/A , the PCR mixture contained 11.70 µL sterile and filtered Milli-Q water, 3.0 µL 10× buffer without MgCl2 (Gibco), 1.0 µL 50 mM MgCl2 (Gibco), 3.0 µL 2 mM dNTPs (Invitrogen), and 3.0 µL of each primer (38 nmol -308F: 5′ AGG CAA TAG GTT TTG AGG GCC AT 3′, and 45 nmol -308R: TCC TCC CTG CTC CGA TTC CG 3′) (Gibco), 0.30 µL (500 units, 5 U/µL) Taq DNA polymerase (Gibco), and 5.0 µL genomic DNA at a concentration of 20 µg/mL in a final volume of 30 µL. .. The following PCR conditions were used: 5 min at 95°C for initial denaturation, followed by 35 cycles at 95°C for 1 min (denaturation), 52°C for 45 s (primer annealing), and 72°C for 45 s (extension), followed by a final extension step at 72°C for 3 min. For RFLP, the mixture contained 0.1 µL Nco I (10 U/µL) (Gibco), 1.5 µL REACT 3 buffer provided with the restriction enzyme, 10.5 µL sterile and filtered Milli-Q water, and 3.0 µL of the PCR product in a final volume of 12.1 µL.

    Staining:

    Article Title: Molecular identification of Lodoicea maldivica (coco de mer) seeds
    Article Snippet: The PRK gene was amplified with 50 ng DNA template, 1.25 μL of 5 mM dNTPs, 2.0 μL of 25 mM MgCl2 , 2.5 μL of 10× PCR buffer without MgCl2 (Applied Biosystems, USA), 1.5 μL of 10 μM specific primers (Table ), 1.25 μL of 40 ng/μL bovine serum albumin (BSA), 0.5 μL of dimethyl sulfoxide (DMSO) and 1 U of AmpliTaq Gold polymerase (Applied Biosystems, USA). .. The PRK gene was amplified with 50 ng DNA template, 1.25 μL of 5 mM dNTPs, 2.0 μL of 25 mM MgCl2 , 2.5 μL of 10× PCR buffer without MgCl2 (Applied Biosystems, USA), 1.5 μL of 10 μM specific primers (Table ), 1.25 μL of 40 ng/μL bovine serum albumin (BSA), 0.5 μL of dimethyl sulfoxide (DMSO) and 1 U of AmpliTaq Gold polymerase (Applied Biosystems, USA).

    Article Title: Genetic and Functional Role of TNF-alpha in the Development Trypanosoma cruzi Infection
    Article Snippet: For TNF-238G/A , PCR was carried out in a volume of 30 µL containing 11.70 µL sterile and filtered Milli-Q water, 3.0 µL 10× buffer without MgCl2 (Gibco), 1.0 µL 50 mM MgCl2 (Gibco), 3.0 µL 2 mM dNTPs (Invitrogen), 3.0 µL of each primer (40 nmol 238F: 5′ GGT CCT ACA CAC AAA TCA GT 3′, and 43.2 nmol 238R: 5′ CAC TCC CCA TCC TCC TCC CTG GTC 3′) (Gibco), 0.30 µL (500 units, 5 U/µL) Taq DNA polymerase (Gibco), and 5.0 µL genomic DNA at a concentration of 20 µg/mL. .. The following PCR conditions were used: 5 min at 95°C for initial denaturation and 35 cycles at 95°C for 1 min (denaturation), 55°C for 45 s (primer annealing), and 72°C for 45 s (extension), followed by a final extension step at 72°C for 3 min. Next, RFLP was performed using 0.1 µL Ava II (10,000 U/mL) (New England Biolabs), 1.0 µL NE 4 buffer provided with the restriction enzyme, 0.4 µL sterile and filtered Milli-Q water, and 8.5 µL of the PCR product in a final volume of 10 µL.

    Article Title: Genetic and Functional Role of TNF-alpha in the Development Trypanosoma cruzi Infection
    Article Snippet: For TNF-308G/A , the PCR mixture contained 11.70 µL sterile and filtered Milli-Q water, 3.0 µL 10× buffer without MgCl2 (Gibco), 1.0 µL 50 mM MgCl2 (Gibco), 3.0 µL 2 mM dNTPs (Invitrogen), and 3.0 µL of each primer (38 nmol -308F: 5′ AGG CAA TAG GTT TTG AGG GCC AT 3′, and 45 nmol -308R: TCC TCC CTG CTC CGA TTC CG 3′) (Gibco), 0.30 µL (500 units, 5 U/µL) Taq DNA polymerase (Gibco), and 5.0 µL genomic DNA at a concentration of 20 µg/mL in a final volume of 30 µL. .. For TNF-308G/A , the PCR mixture contained 11.70 µL sterile and filtered Milli-Q water, 3.0 µL 10× buffer without MgCl2 (Gibco), 1.0 µL 50 mM MgCl2 (Gibco), 3.0 µL 2 mM dNTPs (Invitrogen), and 3.0 µL of each primer (38 nmol -308F: 5′ AGG CAA TAG GTT TTG AGG GCC AT 3′, and 45 nmol -308R: TCC TCC CTG CTC CGA TTC CG 3′) (Gibco), 0.30 µL (500 units, 5 U/µL) Taq DNA polymerase (Gibco), and 5.0 µL genomic DNA at a concentration of 20 µg/mL in a final volume of 30 µL.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Thermo Fisher gene exp abca3 mm00550501 m1
    Phospholipid composition and synthesis are altered in adult <t>Abca3</t> Δ/Δ mice. Relative distribution of the phospholipid classes PC, phosphatidylglycerol (PG), and phosphatidylinositol (PI) in lung tissue (after lavage), isolated LBs, and
    Gene Exp Abca3 Mm00550501 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp abca3 mm00550501 m1/product/Thermo Fisher
    Average 95 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    gene exp abca3 mm00550501 m1 - by Bioz Stars, 2019-10
    95/100 stars
      Buy from Supplier

    91
    Thermo Fisher gene exp abcb1a mm00440761 m1
    Depiction of the humanized <t>Abcb1a</t> gene locus. Shown are the sequenced region (6089 bp, black) and the downstream adjacent mouse sequence not included in the sequencing (light grey). The human <t>ABCB1</t> CDS was fused into the TSS, which left the untranslated base pairs TSS -1 to -6 of exon 2 behind (green). ABCB1 CDS has been introduced with its 3′UTR and additional 45 bp of human genomic downstream sequence. At the 3′ transition towards the mouse genomic sequence, a loxP site has been introduced which is flanked by altogether 99 bp of unknown origin. The same is true for the 5′ situated loxP site, which is flanked by additional 37 bp, respectively, and inserted into intron 1 of mouse Abcb1a. The picture is not proportional to the genomic arrangement.
    Gene Exp Abcb1a Mm00440761 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp abcb1a mm00440761 m1/product/Thermo Fisher
    Average 91 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    gene exp abcb1a mm00440761 m1 - by Bioz Stars, 2019-10
    91/100 stars
      Buy from Supplier

    82
    Thermo Fisher gene exp agbl5 mm01220582 g1
    <t>CCP5</t> fails to rescue Purkinje cell death in pcd mice. ( a ) Schematic representation of L7-CCP5 transgenes. CCP5 cDNA (DQ867034) was inserted into a unique BamHI site in the fourth exon of the L7 gene 36 . ( b ) RT-PCR to determine transgene expression in cerebellum of wild-type (non-Tg) and different L7-CCP5 transgenic lines. The lines chosen for further investigation are boxed in red. ( c ) Accelerating rota-rod test of 2-month of age, gender balanced wild-type (WT) mice, pcd 3J −/− and pcd 3J −/− mice harboring L7-CCP5 (lines Tg1 and Tg5) showed that only the wild-type (WT) groups differed significantly ( p
    Gene Exp Agbl5 Mm01220582 G1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 82/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp agbl5 mm01220582 g1/product/Thermo Fisher
    Average 82 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    gene exp agbl5 mm01220582 g1 - by Bioz Stars, 2019-10
    82/100 stars
      Buy from Supplier

    82
    Thermo Fisher gene exp abcb1a mm00440745 m1
    Depiction of the humanized <t>Abcb1a</t> gene locus. Shown are the sequenced region (6089 bp, black) and the downstream adjacent mouse sequence not included in the sequencing (light grey). The human <t>ABCB1</t> CDS was fused into the TSS, which left the untranslated base pairs TSS -1 to -6 of exon 2 behind (green). ABCB1 CDS has been introduced with its 3′UTR and additional 45 bp of human genomic downstream sequence. At the 3′ transition towards the mouse genomic sequence, a loxP site has been introduced which is flanked by altogether 99 bp of unknown origin. The same is true for the 5′ situated loxP site, which is flanked by additional 37 bp, respectively, and inserted into intron 1 of mouse Abcb1a. The picture is not proportional to the genomic arrangement.
    Gene Exp Abcb1a Mm00440745 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 82/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp abcb1a mm00440745 m1/product/Thermo Fisher
    Average 82 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    gene exp abcb1a mm00440745 m1 - by Bioz Stars, 2019-10
    82/100 stars
      Buy from Supplier

    Image Search Results


    Phospholipid composition and synthesis are altered in adult Abca3 Δ/Δ mice. Relative distribution of the phospholipid classes PC, phosphatidylglycerol (PG), and phosphatidylinositol (PI) in lung tissue (after lavage), isolated LBs, and

    Journal:

    Article Title: Conditional deletion of Abca3 in alveolar type II cells alters surfactant homeostasis in newborn and adult mice

    doi: 10.1152/ajplung.00409.2009

    Figure Lengend Snippet: Phospholipid composition and synthesis are altered in adult Abca3 Δ/Δ mice. Relative distribution of the phospholipid classes PC, phosphatidylglycerol (PG), and phosphatidylinositol (PI) in lung tissue (after lavage), isolated LBs, and

    Article Snippet: Quantitative PCRs using Taqman probes (Applied BioSystems, Foster City, CA) were performed with primer sets specific for Abca3 (Mm00550501_m1) , surfactant protein (Sftp) Sftpa1 (Mm00499170_m1), Sftpb (Mm00455681_m1), Sftpc (Mm00488144_m1), fatty acid synthase ( Fasn, Mm01253292_m1) , stearoyl-CoA desaturase (Scd1, Mm01197142_m1) , lysophosphatidylcholine acyltransferase 1 ( Lpcat1, Mm00461015_m1) , fatty acid-binding protein 5 ( Fabp5, Mm00783731_s1) , choline phosphate cytidylyltransferase 1 ( Pcyt1a, Mm00447774_m1) , napsin A aspartic peptidase ( Napsa, Mm00492829_m1), steroidogenic acute regulatory domain protein ( Stard ) 2 ( Stard2, Mm00476629_m1) , Stard7 (Mm00460536_m1) , Stard9 (Mm00626196_m1) , Stard10 (Mm00502345_m1) , Abca1 (Mm00442646_m1) , 3-hydroxy-3-methylglutaryl-CoA synthase 1 ( Hmgcs1, 00524111_m1) , nuclear factor of activated T cells ( Nfatc3, Mm01249200_m1), NK2 homeobox 1 Nkx2.1 (Mm00447558_m1), forkhead box A2 ( Foxa2, Mm01976556_s1), CCAAT enhancer-binding protein-α ( Cebpa, Mm01265914_s1), macrophage inflammatory protein 1α ( Mip1a, Mm00441258), transforming growth factor-β1 ( Tgfb1, Mm03024053), TNFα ( Tnfa, Mm00443258_m1), IL-1β ( Il-1b, Mm01336189_m1), and matrix metallopeptidase 12 ( Mmp12, Mm00838401_g1).

    Techniques: Mouse Assay, Isolation

    Surfactant phospholipid composition is altered in newborn Abca3 Δ/Δ mice. A : saturated phosphatidylcholine (Sat PC) was decreased in whole lung tissue from PND0 Abca3 Δ/Δ mice. * P

    Journal:

    Article Title: Conditional deletion of Abca3 in alveolar type II cells alters surfactant homeostasis in newborn and adult mice

    doi: 10.1152/ajplung.00409.2009

    Figure Lengend Snippet: Surfactant phospholipid composition is altered in newborn Abca3 Δ/Δ mice. A : saturated phosphatidylcholine (Sat PC) was decreased in whole lung tissue from PND0 Abca3 Δ/Δ mice. * P

    Article Snippet: Quantitative PCRs using Taqman probes (Applied BioSystems, Foster City, CA) were performed with primer sets specific for Abca3 (Mm00550501_m1) , surfactant protein (Sftp) Sftpa1 (Mm00499170_m1), Sftpb (Mm00455681_m1), Sftpc (Mm00488144_m1), fatty acid synthase ( Fasn, Mm01253292_m1) , stearoyl-CoA desaturase (Scd1, Mm01197142_m1) , lysophosphatidylcholine acyltransferase 1 ( Lpcat1, Mm00461015_m1) , fatty acid-binding protein 5 ( Fabp5, Mm00783731_s1) , choline phosphate cytidylyltransferase 1 ( Pcyt1a, Mm00447774_m1) , napsin A aspartic peptidase ( Napsa, Mm00492829_m1), steroidogenic acute regulatory domain protein ( Stard ) 2 ( Stard2, Mm00476629_m1) , Stard7 (Mm00460536_m1) , Stard9 (Mm00626196_m1) , Stard10 (Mm00502345_m1) , Abca1 (Mm00442646_m1) , 3-hydroxy-3-methylglutaryl-CoA synthase 1 ( Hmgcs1, 00524111_m1) , nuclear factor of activated T cells ( Nfatc3, Mm01249200_m1), NK2 homeobox 1 Nkx2.1 (Mm00447558_m1), forkhead box A2 ( Foxa2, Mm01976556_s1), CCAAT enhancer-binding protein-α ( Cebpa, Mm01265914_s1), macrophage inflammatory protein 1α ( Mip1a, Mm00441258), transforming growth factor-β1 ( Tgfb1, Mm03024053), TNFα ( Tnfa, Mm00443258_m1), IL-1β ( Il-1b, Mm01336189_m1), and matrix metallopeptidase 12 ( Mmp12, Mm00838401_g1).

    Techniques: Mouse Assay

    Deletion of Abca3 influences genes regulating lipid synthesis and transport in type II epithelial cells.

    Journal:

    Article Title: Conditional deletion of Abca3 in alveolar type II cells alters surfactant homeostasis in newborn and adult mice

    doi: 10.1152/ajplung.00409.2009

    Figure Lengend Snippet: Deletion of Abca3 influences genes regulating lipid synthesis and transport in type II epithelial cells.

    Article Snippet: Quantitative PCRs using Taqman probes (Applied BioSystems, Foster City, CA) were performed with primer sets specific for Abca3 (Mm00550501_m1) , surfactant protein (Sftp) Sftpa1 (Mm00499170_m1), Sftpb (Mm00455681_m1), Sftpc (Mm00488144_m1), fatty acid synthase ( Fasn, Mm01253292_m1) , stearoyl-CoA desaturase (Scd1, Mm01197142_m1) , lysophosphatidylcholine acyltransferase 1 ( Lpcat1, Mm00461015_m1) , fatty acid-binding protein 5 ( Fabp5, Mm00783731_s1) , choline phosphate cytidylyltransferase 1 ( Pcyt1a, Mm00447774_m1) , napsin A aspartic peptidase ( Napsa, Mm00492829_m1), steroidogenic acute regulatory domain protein ( Stard ) 2 ( Stard2, Mm00476629_m1) , Stard7 (Mm00460536_m1) , Stard9 (Mm00626196_m1) , Stard10 (Mm00502345_m1) , Abca1 (Mm00442646_m1) , 3-hydroxy-3-methylglutaryl-CoA synthase 1 ( Hmgcs1, 00524111_m1) , nuclear factor of activated T cells ( Nfatc3, Mm01249200_m1), NK2 homeobox 1 Nkx2.1 (Mm00447558_m1), forkhead box A2 ( Foxa2, Mm01976556_s1), CCAAT enhancer-binding protein-α ( Cebpa, Mm01265914_s1), macrophage inflammatory protein 1α ( Mip1a, Mm00441258), transforming growth factor-β1 ( Tgfb1, Mm03024053), TNFα ( Tnfa, Mm00443258_m1), IL-1β ( Il-1b, Mm01336189_m1), and matrix metallopeptidase 12 ( Mmp12, Mm00838401_g1).

    Techniques:

    Survival after partial deletion of Abca3 . Survival rate was determined in 9-mo-old male and female control and Abca3 Δ/Δ mice ( A ). Quantitative RT-PCR was performed to estimate Abca3 ( B ) and surfactant-associated protein ( Sftpa1, Sftpb,

    Journal:

    Article Title: Conditional deletion of Abca3 in alveolar type II cells alters surfactant homeostasis in newborn and adult mice

    doi: 10.1152/ajplung.00409.2009

    Figure Lengend Snippet: Survival after partial deletion of Abca3 . Survival rate was determined in 9-mo-old male and female control and Abca3 Δ/Δ mice ( A ). Quantitative RT-PCR was performed to estimate Abca3 ( B ) and surfactant-associated protein ( Sftpa1, Sftpb,

    Article Snippet: Quantitative PCRs using Taqman probes (Applied BioSystems, Foster City, CA) were performed with primer sets specific for Abca3 (Mm00550501_m1) , surfactant protein (Sftp) Sftpa1 (Mm00499170_m1), Sftpb (Mm00455681_m1), Sftpc (Mm00488144_m1), fatty acid synthase ( Fasn, Mm01253292_m1) , stearoyl-CoA desaturase (Scd1, Mm01197142_m1) , lysophosphatidylcholine acyltransferase 1 ( Lpcat1, Mm00461015_m1) , fatty acid-binding protein 5 ( Fabp5, Mm00783731_s1) , choline phosphate cytidylyltransferase 1 ( Pcyt1a, Mm00447774_m1) , napsin A aspartic peptidase ( Napsa, Mm00492829_m1), steroidogenic acute regulatory domain protein ( Stard ) 2 ( Stard2, Mm00476629_m1) , Stard7 (Mm00460536_m1) , Stard9 (Mm00626196_m1) , Stard10 (Mm00502345_m1) , Abca1 (Mm00442646_m1) , 3-hydroxy-3-methylglutaryl-CoA synthase 1 ( Hmgcs1, 00524111_m1) , nuclear factor of activated T cells ( Nfatc3, Mm01249200_m1), NK2 homeobox 1 Nkx2.1 (Mm00447558_m1), forkhead box A2 ( Foxa2, Mm01976556_s1), CCAAT enhancer-binding protein-α ( Cebpa, Mm01265914_s1), macrophage inflammatory protein 1α ( Mip1a, Mm00441258), transforming growth factor-β1 ( Tgfb1, Mm03024053), TNFα ( Tnfa, Mm00443258_m1), IL-1β ( Il-1b, Mm01336189_m1), and matrix metallopeptidase 12 ( Mmp12, Mm00838401_g1).

    Techniques: Mouse Assay, Quantitative RT-PCR

    Deletion of Abca3 induces compensatory mechanisms in both type II cell populations present in adult Abca3 Δ / Δ mice. Flow cytofluorometric data of alveolar type II cells from adult control ( A ) and Abca3 Δ / Δ ( B ) mice stained

    Journal:

    Article Title: Conditional deletion of Abca3 in alveolar type II cells alters surfactant homeostasis in newborn and adult mice

    doi: 10.1152/ajplung.00409.2009

    Figure Lengend Snippet: Deletion of Abca3 induces compensatory mechanisms in both type II cell populations present in adult Abca3 Δ / Δ mice. Flow cytofluorometric data of alveolar type II cells from adult control ( A ) and Abca3 Δ / Δ ( B ) mice stained

    Article Snippet: Quantitative PCRs using Taqman probes (Applied BioSystems, Foster City, CA) were performed with primer sets specific for Abca3 (Mm00550501_m1) , surfactant protein (Sftp) Sftpa1 (Mm00499170_m1), Sftpb (Mm00455681_m1), Sftpc (Mm00488144_m1), fatty acid synthase ( Fasn, Mm01253292_m1) , stearoyl-CoA desaturase (Scd1, Mm01197142_m1) , lysophosphatidylcholine acyltransferase 1 ( Lpcat1, Mm00461015_m1) , fatty acid-binding protein 5 ( Fabp5, Mm00783731_s1) , choline phosphate cytidylyltransferase 1 ( Pcyt1a, Mm00447774_m1) , napsin A aspartic peptidase ( Napsa, Mm00492829_m1), steroidogenic acute regulatory domain protein ( Stard ) 2 ( Stard2, Mm00476629_m1) , Stard7 (Mm00460536_m1) , Stard9 (Mm00626196_m1) , Stard10 (Mm00502345_m1) , Abca1 (Mm00442646_m1) , 3-hydroxy-3-methylglutaryl-CoA synthase 1 ( Hmgcs1, 00524111_m1) , nuclear factor of activated T cells ( Nfatc3, Mm01249200_m1), NK2 homeobox 1 Nkx2.1 (Mm00447558_m1), forkhead box A2 ( Foxa2, Mm01976556_s1), CCAAT enhancer-binding protein-α ( Cebpa, Mm01265914_s1), macrophage inflammatory protein 1α ( Mip1a, Mm00441258), transforming growth factor-β1 ( Tgfb1, Mm03024053), TNFα ( Tnfa, Mm00443258_m1), IL-1β ( Il-1b, Mm01336189_m1), and matrix metallopeptidase 12 ( Mmp12, Mm00838401_g1).

    Techniques: Mouse Assay, Flow Cytometry, Staining

    Deletion of Abca3 influences the transcriptional program in alveolar type II cells. A : mRNAs were extracted from alveolar type II cells isolated from adult control or Abca3 Δ / Δ mice and sorted according to NR fluorescence intensity. Quantitative

    Journal:

    Article Title: Conditional deletion of Abca3 in alveolar type II cells alters surfactant homeostasis in newborn and adult mice

    doi: 10.1152/ajplung.00409.2009

    Figure Lengend Snippet: Deletion of Abca3 influences the transcriptional program in alveolar type II cells. A : mRNAs were extracted from alveolar type II cells isolated from adult control or Abca3 Δ / Δ mice and sorted according to NR fluorescence intensity. Quantitative

    Article Snippet: Quantitative PCRs using Taqman probes (Applied BioSystems, Foster City, CA) were performed with primer sets specific for Abca3 (Mm00550501_m1) , surfactant protein (Sftp) Sftpa1 (Mm00499170_m1), Sftpb (Mm00455681_m1), Sftpc (Mm00488144_m1), fatty acid synthase ( Fasn, Mm01253292_m1) , stearoyl-CoA desaturase (Scd1, Mm01197142_m1) , lysophosphatidylcholine acyltransferase 1 ( Lpcat1, Mm00461015_m1) , fatty acid-binding protein 5 ( Fabp5, Mm00783731_s1) , choline phosphate cytidylyltransferase 1 ( Pcyt1a, Mm00447774_m1) , napsin A aspartic peptidase ( Napsa, Mm00492829_m1), steroidogenic acute regulatory domain protein ( Stard ) 2 ( Stard2, Mm00476629_m1) , Stard7 (Mm00460536_m1) , Stard9 (Mm00626196_m1) , Stard10 (Mm00502345_m1) , Abca1 (Mm00442646_m1) , 3-hydroxy-3-methylglutaryl-CoA synthase 1 ( Hmgcs1, 00524111_m1) , nuclear factor of activated T cells ( Nfatc3, Mm01249200_m1), NK2 homeobox 1 Nkx2.1 (Mm00447558_m1), forkhead box A2 ( Foxa2, Mm01976556_s1), CCAAT enhancer-binding protein-α ( Cebpa, Mm01265914_s1), macrophage inflammatory protein 1α ( Mip1a, Mm00441258), transforming growth factor-β1 ( Tgfb1, Mm03024053), TNFα ( Tnfa, Mm00443258_m1), IL-1β ( Il-1b, Mm01336189_m1), and matrix metallopeptidase 12 ( Mmp12, Mm00838401_g1).

    Techniques: Isolation, Mouse Assay, Fluorescence

    Conditional deletion of ATP-binding cassette A3 ( Abca3 ) in respiratory epithelium. A : triple-transgenic mice were produced in which doxycycline (Dox) activates reverse tetracycline transactivator (rtTA) expressed under control of the surfactant protein

    Journal:

    Article Title: Conditional deletion of Abca3 in alveolar type II cells alters surfactant homeostasis in newborn and adult mice

    doi: 10.1152/ajplung.00409.2009

    Figure Lengend Snippet: Conditional deletion of ATP-binding cassette A3 ( Abca3 ) in respiratory epithelium. A : triple-transgenic mice were produced in which doxycycline (Dox) activates reverse tetracycline transactivator (rtTA) expressed under control of the surfactant protein

    Article Snippet: Quantitative PCRs using Taqman probes (Applied BioSystems, Foster City, CA) were performed with primer sets specific for Abca3 (Mm00550501_m1) , surfactant protein (Sftp) Sftpa1 (Mm00499170_m1), Sftpb (Mm00455681_m1), Sftpc (Mm00488144_m1), fatty acid synthase ( Fasn, Mm01253292_m1) , stearoyl-CoA desaturase (Scd1, Mm01197142_m1) , lysophosphatidylcholine acyltransferase 1 ( Lpcat1, Mm00461015_m1) , fatty acid-binding protein 5 ( Fabp5, Mm00783731_s1) , choline phosphate cytidylyltransferase 1 ( Pcyt1a, Mm00447774_m1) , napsin A aspartic peptidase ( Napsa, Mm00492829_m1), steroidogenic acute regulatory domain protein ( Stard ) 2 ( Stard2, Mm00476629_m1) , Stard7 (Mm00460536_m1) , Stard9 (Mm00626196_m1) , Stard10 (Mm00502345_m1) , Abca1 (Mm00442646_m1) , 3-hydroxy-3-methylglutaryl-CoA synthase 1 ( Hmgcs1, 00524111_m1) , nuclear factor of activated T cells ( Nfatc3, Mm01249200_m1), NK2 homeobox 1 Nkx2.1 (Mm00447558_m1), forkhead box A2 ( Foxa2, Mm01976556_s1), CCAAT enhancer-binding protein-α ( Cebpa, Mm01265914_s1), macrophage inflammatory protein 1α ( Mip1a, Mm00441258), transforming growth factor-β1 ( Tgfb1, Mm03024053), TNFα ( Tnfa, Mm00443258_m1), IL-1β ( Il-1b, Mm01336189_m1), and matrix metallopeptidase 12 ( Mmp12, Mm00838401_g1).

    Techniques: Binding Assay, Transgenic Assay, Mouse Assay, Produced

    Adult Abca3 Δ/Δ mice develop emphysema. Lung sections of Abca3 Δ/Δ ( B and D ) and control littermates ( A and C ) were prepared from 4-wk-old ( A and B ) and 9-mo-old ( C and D ) mice and stained with hematoxylin and eosin. While

    Journal:

    Article Title: Conditional deletion of Abca3 in alveolar type II cells alters surfactant homeostasis in newborn and adult mice

    doi: 10.1152/ajplung.00409.2009

    Figure Lengend Snippet: Adult Abca3 Δ/Δ mice develop emphysema. Lung sections of Abca3 Δ/Δ ( B and D ) and control littermates ( A and C ) were prepared from 4-wk-old ( A and B ) and 9-mo-old ( C and D ) mice and stained with hematoxylin and eosin. While

    Article Snippet: Quantitative PCRs using Taqman probes (Applied BioSystems, Foster City, CA) were performed with primer sets specific for Abca3 (Mm00550501_m1) , surfactant protein (Sftp) Sftpa1 (Mm00499170_m1), Sftpb (Mm00455681_m1), Sftpc (Mm00488144_m1), fatty acid synthase ( Fasn, Mm01253292_m1) , stearoyl-CoA desaturase (Scd1, Mm01197142_m1) , lysophosphatidylcholine acyltransferase 1 ( Lpcat1, Mm00461015_m1) , fatty acid-binding protein 5 ( Fabp5, Mm00783731_s1) , choline phosphate cytidylyltransferase 1 ( Pcyt1a, Mm00447774_m1) , napsin A aspartic peptidase ( Napsa, Mm00492829_m1), steroidogenic acute regulatory domain protein ( Stard ) 2 ( Stard2, Mm00476629_m1) , Stard7 (Mm00460536_m1) , Stard9 (Mm00626196_m1) , Stard10 (Mm00502345_m1) , Abca1 (Mm00442646_m1) , 3-hydroxy-3-methylglutaryl-CoA synthase 1 ( Hmgcs1, 00524111_m1) , nuclear factor of activated T cells ( Nfatc3, Mm01249200_m1), NK2 homeobox 1 Nkx2.1 (Mm00447558_m1), forkhead box A2 ( Foxa2, Mm01976556_s1), CCAAT enhancer-binding protein-α ( Cebpa, Mm01265914_s1), macrophage inflammatory protein 1α ( Mip1a, Mm00441258), transforming growth factor-β1 ( Tgfb1, Mm03024053), TNFα ( Tnfa, Mm00443258_m1), IL-1β ( Il-1b, Mm01336189_m1), and matrix metallopeptidase 12 ( Mmp12, Mm00838401_g1).

    Techniques: Mouse Assay, Staining

    Deletion of Abca3 influences lamellar body (LB) formation in adult type II epithelial cells. Electron microscopy was used to study lung sections from PND0 control ( A ) and Abca3 Δ/Δ ( B ) and adult control ( C ) and Abca3 Δ/Δ

    Journal:

    Article Title: Conditional deletion of Abca3 in alveolar type II cells alters surfactant homeostasis in newborn and adult mice

    doi: 10.1152/ajplung.00409.2009

    Figure Lengend Snippet: Deletion of Abca3 influences lamellar body (LB) formation in adult type II epithelial cells. Electron microscopy was used to study lung sections from PND0 control ( A ) and Abca3 Δ/Δ ( B ) and adult control ( C ) and Abca3 Δ/Δ

    Article Snippet: Quantitative PCRs using Taqman probes (Applied BioSystems, Foster City, CA) were performed with primer sets specific for Abca3 (Mm00550501_m1) , surfactant protein (Sftp) Sftpa1 (Mm00499170_m1), Sftpb (Mm00455681_m1), Sftpc (Mm00488144_m1), fatty acid synthase ( Fasn, Mm01253292_m1) , stearoyl-CoA desaturase (Scd1, Mm01197142_m1) , lysophosphatidylcholine acyltransferase 1 ( Lpcat1, Mm00461015_m1) , fatty acid-binding protein 5 ( Fabp5, Mm00783731_s1) , choline phosphate cytidylyltransferase 1 ( Pcyt1a, Mm00447774_m1) , napsin A aspartic peptidase ( Napsa, Mm00492829_m1), steroidogenic acute regulatory domain protein ( Stard ) 2 ( Stard2, Mm00476629_m1) , Stard7 (Mm00460536_m1) , Stard9 (Mm00626196_m1) , Stard10 (Mm00502345_m1) , Abca1 (Mm00442646_m1) , 3-hydroxy-3-methylglutaryl-CoA synthase 1 ( Hmgcs1, 00524111_m1) , nuclear factor of activated T cells ( Nfatc3, Mm01249200_m1), NK2 homeobox 1 Nkx2.1 (Mm00447558_m1), forkhead box A2 ( Foxa2, Mm01976556_s1), CCAAT enhancer-binding protein-α ( Cebpa, Mm01265914_s1), macrophage inflammatory protein 1α ( Mip1a, Mm00441258), transforming growth factor-β1 ( Tgfb1, Mm03024053), TNFα ( Tnfa, Mm00443258_m1), IL-1β ( Il-1b, Mm01336189_m1), and matrix metallopeptidase 12 ( Mmp12, Mm00838401_g1).

    Techniques: Electron Microscopy

    Deletion of Abca3 alters expression of mRNAs controlling lipid metabolism in adult type II epithelial cells. mRNAs for selected genes associated with lipid synthesis and transfer were assessed by quantitative RT-PCR in total lung from PND0 Abca3 Δ/Δ

    Journal:

    Article Title: Conditional deletion of Abca3 in alveolar type II cells alters surfactant homeostasis in newborn and adult mice

    doi: 10.1152/ajplung.00409.2009

    Figure Lengend Snippet: Deletion of Abca3 alters expression of mRNAs controlling lipid metabolism in adult type II epithelial cells. mRNAs for selected genes associated with lipid synthesis and transfer were assessed by quantitative RT-PCR in total lung from PND0 Abca3 Δ/Δ

    Article Snippet: Quantitative PCRs using Taqman probes (Applied BioSystems, Foster City, CA) were performed with primer sets specific for Abca3 (Mm00550501_m1) , surfactant protein (Sftp) Sftpa1 (Mm00499170_m1), Sftpb (Mm00455681_m1), Sftpc (Mm00488144_m1), fatty acid synthase ( Fasn, Mm01253292_m1) , stearoyl-CoA desaturase (Scd1, Mm01197142_m1) , lysophosphatidylcholine acyltransferase 1 ( Lpcat1, Mm00461015_m1) , fatty acid-binding protein 5 ( Fabp5, Mm00783731_s1) , choline phosphate cytidylyltransferase 1 ( Pcyt1a, Mm00447774_m1) , napsin A aspartic peptidase ( Napsa, Mm00492829_m1), steroidogenic acute regulatory domain protein ( Stard ) 2 ( Stard2, Mm00476629_m1) , Stard7 (Mm00460536_m1) , Stard9 (Mm00626196_m1) , Stard10 (Mm00502345_m1) , Abca1 (Mm00442646_m1) , 3-hydroxy-3-methylglutaryl-CoA synthase 1 ( Hmgcs1, 00524111_m1) , nuclear factor of activated T cells ( Nfatc3, Mm01249200_m1), NK2 homeobox 1 Nkx2.1 (Mm00447558_m1), forkhead box A2 ( Foxa2, Mm01976556_s1), CCAAT enhancer-binding protein-α ( Cebpa, Mm01265914_s1), macrophage inflammatory protein 1α ( Mip1a, Mm00441258), transforming growth factor-β1 ( Tgfb1, Mm03024053), TNFα ( Tnfa, Mm00443258_m1), IL-1β ( Il-1b, Mm01336189_m1), and matrix metallopeptidase 12 ( Mmp12, Mm00838401_g1).

    Techniques: Expressing, Quantitative RT-PCR

    Depiction of the humanized Abcb1a gene locus. Shown are the sequenced region (6089 bp, black) and the downstream adjacent mouse sequence not included in the sequencing (light grey). The human ABCB1 CDS was fused into the TSS, which left the untranslated base pairs TSS -1 to -6 of exon 2 behind (green). ABCB1 CDS has been introduced with its 3′UTR and additional 45 bp of human genomic downstream sequence. At the 3′ transition towards the mouse genomic sequence, a loxP site has been introduced which is flanked by altogether 99 bp of unknown origin. The same is true for the 5′ situated loxP site, which is flanked by additional 37 bp, respectively, and inserted into intron 1 of mouse Abcb1a. The picture is not proportional to the genomic arrangement.

    Journal: European Journal of Microbiology & Immunology

    Article Title: Humanization of the Blood–Brain Barrier Transporter ABCB1 in Mice Disrupts Genomic Locus — Lessons from Three Unsuccessful Approaches

    doi: 10.1556/1886.2018.00008

    Figure Lengend Snippet: Depiction of the humanized Abcb1a gene locus. Shown are the sequenced region (6089 bp, black) and the downstream adjacent mouse sequence not included in the sequencing (light grey). The human ABCB1 CDS was fused into the TSS, which left the untranslated base pairs TSS -1 to -6 of exon 2 behind (green). ABCB1 CDS has been introduced with its 3′UTR and additional 45 bp of human genomic downstream sequence. At the 3′ transition towards the mouse genomic sequence, a loxP site has been introduced which is flanked by altogether 99 bp of unknown origin. The same is true for the 5′ situated loxP site, which is flanked by additional 37 bp, respectively, and inserted into intron 1 of mouse Abcb1a. The picture is not proportional to the genomic arrangement.

    Article Snippet: Primer sets with according TaqMan probes for Abcb1a (Mm00440761_m1), human ABCB1 (Hs00184500_m1), and mouse Actb (Mm02619580_g1) genes were purchased from Thermo Fisher Scientific Inc. (USA).

    Techniques: Sequencing

    Full exonic sequence of Abcb1a. Capital letters indicate the coding sequence, lower case indicate untranslated bases. ATG start codons that could establish an open reading frame are indicated green. Exon junctions are indicated by an |. Pink letters indicate the central base of the probes of the TaqMan assays used (according manufactures information).

    Journal: European Journal of Microbiology & Immunology

    Article Title: Humanization of the Blood–Brain Barrier Transporter ABCB1 in Mice Disrupts Genomic Locus — Lessons from Three Unsuccessful Approaches

    doi: 10.1556/1886.2018.00008

    Figure Lengend Snippet: Full exonic sequence of Abcb1a. Capital letters indicate the coding sequence, lower case indicate untranslated bases. ATG start codons that could establish an open reading frame are indicated green. Exon junctions are indicated by an |. Pink letters indicate the central base of the probes of the TaqMan assays used (according manufactures information).

    Article Snippet: Primer sets with according TaqMan probes for Abcb1a (Mm00440761_m1), human ABCB1 (Hs00184500_m1), and mouse Actb (Mm02619580_g1) genes were purchased from Thermo Fisher Scientific Inc. (USA).

    Techniques: Sequencing

    ABCB1 transport activity at the BBB measured with ( R )-[ 11 C]verapamil PET imaging. Brain uptake of ( R )-[ 11 C]verapamil expressed as brain-to-blood radioactivity concentration ratio ( K b,brain ) at 60 min after radiotracer injection in female C57BL/6 mice (veh: n = 6, tariquidar: n = 5), hABCB1 mice (genOway; veh: n = 3, tariquidar: n = 3), and hABCB1 mice (Taconic; veh: n = 4, tariquidar: n = 3) treated with vehicle solution (2.5% [w/v] aq. dextrose solution) or tariquidar (15 mg/kg body weight) at 2 h before radiotracer injection. For comparison, K b,brain in vehicle-treated Abcb1a/b (–/–) mice (n = 4) is also shown [ 36 ]. Data are mean ± standard deviation. Statistical significance was determined by 2-way ANOVA with Bonferroni post-hoc test. **p

    Journal: European Journal of Microbiology & Immunology

    Article Title: Humanization of the Blood–Brain Barrier Transporter ABCB1 in Mice Disrupts Genomic Locus — Lessons from Three Unsuccessful Approaches

    doi: 10.1556/1886.2018.00008

    Figure Lengend Snippet: ABCB1 transport activity at the BBB measured with ( R )-[ 11 C]verapamil PET imaging. Brain uptake of ( R )-[ 11 C]verapamil expressed as brain-to-blood radioactivity concentration ratio ( K b,brain ) at 60 min after radiotracer injection in female C57BL/6 mice (veh: n = 6, tariquidar: n = 5), hABCB1 mice (genOway; veh: n = 3, tariquidar: n = 3), and hABCB1 mice (Taconic; veh: n = 4, tariquidar: n = 3) treated with vehicle solution (2.5% [w/v] aq. dextrose solution) or tariquidar (15 mg/kg body weight) at 2 h before radiotracer injection. For comparison, K b,brain in vehicle-treated Abcb1a/b (–/–) mice (n = 4) is also shown [ 36 ]. Data are mean ± standard deviation. Statistical significance was determined by 2-way ANOVA with Bonferroni post-hoc test. **p

    Article Snippet: Primer sets with according TaqMan probes for Abcb1a (Mm00440761_m1), human ABCB1 (Hs00184500_m1), and mouse Actb (Mm02619580_g1) genes were purchased from Thermo Fisher Scientific Inc. (USA).

    Techniques: Activity Assay, Positron Emission Tomography, Imaging, Radioactivity, Concentration Assay, Injection, Mouse Assay, Standard Deviation

    In hABCB1 mice 266 bp of Abcb1a are deleted. Alignment of hABCB1 sequence starting at the first base pair downstream of the loxP insertion site with Abcb1a starting at TSS.

    Journal: European Journal of Microbiology & Immunology

    Article Title: Humanization of the Blood–Brain Barrier Transporter ABCB1 in Mice Disrupts Genomic Locus — Lessons from Three Unsuccessful Approaches

    doi: 10.1556/1886.2018.00008

    Figure Lengend Snippet: In hABCB1 mice 266 bp of Abcb1a are deleted. Alignment of hABCB1 sequence starting at the first base pair downstream of the loxP insertion site with Abcb1a starting at TSS.

    Article Snippet: Primer sets with according TaqMan probes for Abcb1a (Mm00440761_m1), human ABCB1 (Hs00184500_m1), and mouse Actb (Mm02619580_g1) genes were purchased from Thermo Fisher Scientific Inc. (USA).

    Techniques: Mouse Assay, Sequencing

    Western blot analysis of ABCB1 expression Western blot against ABCB1 confirmed PET imaging findings in hABCB1 animals and shows drastically reduced protein expression of any ABCB1 variant in hABCB1 as well as hABCB1 –/– mice. Data are mean ± standard deviation. Statistical significance was determined by 1-way ANOVA with Tukey's Honest Significant Difference post-hoc test, significance level p

    Journal: European Journal of Microbiology & Immunology

    Article Title: Humanization of the Blood–Brain Barrier Transporter ABCB1 in Mice Disrupts Genomic Locus — Lessons from Three Unsuccessful Approaches

    doi: 10.1556/1886.2018.00008

    Figure Lengend Snippet: Western blot analysis of ABCB1 expression Western blot against ABCB1 confirmed PET imaging findings in hABCB1 animals and shows drastically reduced protein expression of any ABCB1 variant in hABCB1 as well as hABCB1 –/– mice. Data are mean ± standard deviation. Statistical significance was determined by 1-way ANOVA with Tukey's Honest Significant Difference post-hoc test, significance level p

    Article Snippet: Primer sets with according TaqMan probes for Abcb1a (Mm00440761_m1), human ABCB1 (Hs00184500_m1), and mouse Actb (Mm02619580_g1) genes were purchased from Thermo Fisher Scientific Inc. (USA).

    Techniques: Western Blot, Expressing, Positron Emission Tomography, Imaging, Variant Assay, Mouse Assay, Standard Deviation

    Relative mRNA expression of Abcb1a and ABCB1 . Human ABCB1 mRNA is expressed at very low levels in hABCB1 mice only. No decrease of Abcb1a mRNA expression was detected in hABCB1 mice compared to wild-type animals. Shown are the relative expression of mouse Abcb1a (green) and human ABCB1 (blue) mRNA in male wild-type ( n = 7) and hABCB1 ( n = 10) mice based on the comparison of ct values. Ct values were normalized to mouse Actb mRNA expression using 2 (–Δct) calculation. Data are mean ± standard deviation. Statistical significance was determined by 1-way ANOVA with Tukey's honest significant difference post-hoc test. **** p

    Journal: European Journal of Microbiology & Immunology

    Article Title: Humanization of the Blood–Brain Barrier Transporter ABCB1 in Mice Disrupts Genomic Locus — Lessons from Three Unsuccessful Approaches

    doi: 10.1556/1886.2018.00008

    Figure Lengend Snippet: Relative mRNA expression of Abcb1a and ABCB1 . Human ABCB1 mRNA is expressed at very low levels in hABCB1 mice only. No decrease of Abcb1a mRNA expression was detected in hABCB1 mice compared to wild-type animals. Shown are the relative expression of mouse Abcb1a (green) and human ABCB1 (blue) mRNA in male wild-type ( n = 7) and hABCB1 ( n = 10) mice based on the comparison of ct values. Ct values were normalized to mouse Actb mRNA expression using 2 (–Δct) calculation. Data are mean ± standard deviation. Statistical significance was determined by 1-way ANOVA with Tukey's honest significant difference post-hoc test. **** p

    Article Snippet: Primer sets with according TaqMan probes for Abcb1a (Mm00440761_m1), human ABCB1 (Hs00184500_m1), and mouse Actb (Mm02619580_g1) genes were purchased from Thermo Fisher Scientific Inc. (USA).

    Techniques: Expressing, Mouse Assay, Standard Deviation

    Abcb1a promoter region analysis. Shown are the Abcb1a loci of wild-type and hABCB1 mice in comparison. ENCODE database searches revealed the indicated hotspots of open/accessible chromatin found in mouse brains using DNAse-seq, ATAC-seq, and ChIP-seq methods. The area of highest density of overlapping hotspots (orange/light orange) covers more than 200 bp indicating the importance of this region for Abcb1a gene expression.

    Journal: European Journal of Microbiology & Immunology

    Article Title: Humanization of the Blood–Brain Barrier Transporter ABCB1 in Mice Disrupts Genomic Locus — Lessons from Three Unsuccessful Approaches

    doi: 10.1556/1886.2018.00008

    Figure Lengend Snippet: Abcb1a promoter region analysis. Shown are the Abcb1a loci of wild-type and hABCB1 mice in comparison. ENCODE database searches revealed the indicated hotspots of open/accessible chromatin found in mouse brains using DNAse-seq, ATAC-seq, and ChIP-seq methods. The area of highest density of overlapping hotspots (orange/light orange) covers more than 200 bp indicating the importance of this region for Abcb1a gene expression.

    Article Snippet: Primer sets with according TaqMan probes for Abcb1a (Mm00440761_m1), human ABCB1 (Hs00184500_m1), and mouse Actb (Mm02619580_g1) genes were purchased from Thermo Fisher Scientific Inc. (USA).

    Techniques: Mouse Assay, Chromatin Immunoprecipitation, Expressing

    Abcb1a exons 3 and 4 are unaltered. Alignment of exon 3 (a) and exon 4 (b) as sequenced from hABCB1 mice with Abcb1a reference sequence (Gene ID: 18671). Bold letters indicate exons.

    Journal: European Journal of Microbiology & Immunology

    Article Title: Humanization of the Blood–Brain Barrier Transporter ABCB1 in Mice Disrupts Genomic Locus — Lessons from Three Unsuccessful Approaches

    doi: 10.1556/1886.2018.00008

    Figure Lengend Snippet: Abcb1a exons 3 and 4 are unaltered. Alignment of exon 3 (a) and exon 4 (b) as sequenced from hABCB1 mice with Abcb1a reference sequence (Gene ID: 18671). Bold letters indicate exons.

    Article Snippet: Primer sets with according TaqMan probes for Abcb1a (Mm00440761_m1), human ABCB1 (Hs00184500_m1), and mouse Actb (Mm02619580_g1) genes were purchased from Thermo Fisher Scientific Inc. (USA).

    Techniques: Mouse Assay, Sequencing

    Exon junction-specific mRNA expression of Abcb1a. Abundance of Abcb1a mRNAs with different lengths was assessed using assays covering the indicated exon junctions in female wild-type mice ( n = 5), hABCB1 mice ( n = 5), as well as in hABCB1 mice ( n = 5) crossed to a Cre-deleter mouse strain (human ABCB1 –/– ). No differential expression between strains was found within each assay location. Data are mean ± standard deviation. Statistical significance was determined by 1-way ANOVA with Tukey's honest significant difference post-hoc test, significance level p

    Journal: European Journal of Microbiology & Immunology

    Article Title: Humanization of the Blood–Brain Barrier Transporter ABCB1 in Mice Disrupts Genomic Locus — Lessons from Three Unsuccessful Approaches

    doi: 10.1556/1886.2018.00008

    Figure Lengend Snippet: Exon junction-specific mRNA expression of Abcb1a. Abundance of Abcb1a mRNAs with different lengths was assessed using assays covering the indicated exon junctions in female wild-type mice ( n = 5), hABCB1 mice ( n = 5), as well as in hABCB1 mice ( n = 5) crossed to a Cre-deleter mouse strain (human ABCB1 –/– ). No differential expression between strains was found within each assay location. Data are mean ± standard deviation. Statistical significance was determined by 1-way ANOVA with Tukey's honest significant difference post-hoc test, significance level p

    Article Snippet: Primer sets with according TaqMan probes for Abcb1a (Mm00440761_m1), human ABCB1 (Hs00184500_m1), and mouse Actb (Mm02619580_g1) genes were purchased from Thermo Fisher Scientific Inc. (USA).

    Techniques: Expressing, Mouse Assay, Standard Deviation

    CCP5 fails to rescue Purkinje cell death in pcd mice. ( a ) Schematic representation of L7-CCP5 transgenes. CCP5 cDNA (DQ867034) was inserted into a unique BamHI site in the fourth exon of the L7 gene 36 . ( b ) RT-PCR to determine transgene expression in cerebellum of wild-type (non-Tg) and different L7-CCP5 transgenic lines. The lines chosen for further investigation are boxed in red. ( c ) Accelerating rota-rod test of 2-month of age, gender balanced wild-type (WT) mice, pcd 3J −/− and pcd 3J −/− mice harboring L7-CCP5 (lines Tg1 and Tg5) showed that only the wild-type (WT) groups differed significantly ( p

    Journal: Scientific Reports

    Article Title: Role of Cytosolic Carboxypeptidase 5 in Neuronal Survival and Spermatogenesis

    doi: 10.1038/srep41428

    Figure Lengend Snippet: CCP5 fails to rescue Purkinje cell death in pcd mice. ( a ) Schematic representation of L7-CCP5 transgenes. CCP5 cDNA (DQ867034) was inserted into a unique BamHI site in the fourth exon of the L7 gene 36 . ( b ) RT-PCR to determine transgene expression in cerebellum of wild-type (non-Tg) and different L7-CCP5 transgenic lines. The lines chosen for further investigation are boxed in red. ( c ) Accelerating rota-rod test of 2-month of age, gender balanced wild-type (WT) mice, pcd 3J −/− and pcd 3J −/− mice harboring L7-CCP5 (lines Tg1 and Tg5) showed that only the wild-type (WT) groups differed significantly ( p

    Article Snippet: CCP5 was amplified with a TaqMan® probe (Mm01220582_g1, Applied Biosystems).

    Techniques: Mouse Assay, Reverse Transcription Polymerase Chain Reaction, Expressing, Transgenic Assay

    Abnormal mature sperm in Agbl5 -KO mice. ( a – c ) Hematoxylin-Eosin staining on sperm from epididymis and vas deferens of wild-type ( a , a’ ), Agbl5 -KO ( b,b’ ), and pcd 3J ( c ) mice. The heads of sperm from Agbl5 -KO mice are abnormally bent ( b’ , arrow) and segments of their tails are not ensheathed ( b’ , arrow head). Sperm from pcd 3J mice also have aberrant heads ( c , arrow) and they frequently have multiple tails ( c ). ( d – e ) Mature sperm from epididymis and vas deferens of wild-type ( d ) and Agbl5 -KO ( e ) mice are immunostained with α-tubulin antibody (ascites fluid B-5–12, green) and the nuclei visualized with DAPI (blue) staining. While α-tubulin antibody only stains the end piece of wild-type sperm (d, arrow), a large region in the middle of the tail of Agbl5 -KO sperm is immunoreactive to the same antibody, indicating an unwrapped flagellum ( e , arrow head). Scale bars: 10 μm in ( a , b , c , d , and e ); 5 μm in ( a’ and b’ ).

    Journal: Scientific Reports

    Article Title: Role of Cytosolic Carboxypeptidase 5 in Neuronal Survival and Spermatogenesis

    doi: 10.1038/srep41428

    Figure Lengend Snippet: Abnormal mature sperm in Agbl5 -KO mice. ( a – c ) Hematoxylin-Eosin staining on sperm from epididymis and vas deferens of wild-type ( a , a’ ), Agbl5 -KO ( b,b’ ), and pcd 3J ( c ) mice. The heads of sperm from Agbl5 -KO mice are abnormally bent ( b’ , arrow) and segments of their tails are not ensheathed ( b’ , arrow head). Sperm from pcd 3J mice also have aberrant heads ( c , arrow) and they frequently have multiple tails ( c ). ( d – e ) Mature sperm from epididymis and vas deferens of wild-type ( d ) and Agbl5 -KO ( e ) mice are immunostained with α-tubulin antibody (ascites fluid B-5–12, green) and the nuclei visualized with DAPI (blue) staining. While α-tubulin antibody only stains the end piece of wild-type sperm (d, arrow), a large region in the middle of the tail of Agbl5 -KO sperm is immunoreactive to the same antibody, indicating an unwrapped flagellum ( e , arrow head). Scale bars: 10 μm in ( a , b , c , d , and e ); 5 μm in ( a’ and b’ ).

    Article Snippet: CCP5 was amplified with a TaqMan® probe (Mm01220582_g1, Applied Biosystems).

    Techniques: Gene Knockout, Mouse Assay, Staining

    Ectopic tubulin polyglutamylation in developing sperm cells of Agbl5 -KO mice. ( a ) Glutamylation and polyglutamylation levels in lysates of testis from 3-month old wild-type (WT), Agbl5 -KO and pcd 3J mice are monitored by western-blot for GT335, B3, and polyE immunoreactivities. Both GT335 and B3 signals are prominently increased in Agbl5 -KO testis compared to that of wild-type, but polyE immunoreactivity remains unchanged. B3 and polyE signals are marginally increased in pcd 3J testis. ( b – d ) Dissociated developing sperm from wild-type ( b ), Agbl5 -KO ( c ) or pcd 3J ( d ) mice are co-immunostained for α-tubulin (EP1332Y, red) and glutamylation (GT335, green) and nuclei are visualized with DAPI staining (blue). In wild-type mice, GT335 immunoreactivity is mainly detectable in the flagellum of the developing sperm ( b , arrows), whereas in Agbl5 -KO mice profound GT335 signal is detected in the cell body of developing sperm ( c ). Notably, GT335 signal is undetectable in the manchette of wild-type spermatids ( a , insert, and ref. 32 ) but is prominently expressed in manchette of Agbl5 -KO ( c , insert) mice. Similar to wild-type mice, in pcd mice GT335 immunoreactivity is largely absent in the manchette ( d , insert). Sale bar: 10 μm.

    Journal: Scientific Reports

    Article Title: Role of Cytosolic Carboxypeptidase 5 in Neuronal Survival and Spermatogenesis

    doi: 10.1038/srep41428

    Figure Lengend Snippet: Ectopic tubulin polyglutamylation in developing sperm cells of Agbl5 -KO mice. ( a ) Glutamylation and polyglutamylation levels in lysates of testis from 3-month old wild-type (WT), Agbl5 -KO and pcd 3J mice are monitored by western-blot for GT335, B3, and polyE immunoreactivities. Both GT335 and B3 signals are prominently increased in Agbl5 -KO testis compared to that of wild-type, but polyE immunoreactivity remains unchanged. B3 and polyE signals are marginally increased in pcd 3J testis. ( b – d ) Dissociated developing sperm from wild-type ( b ), Agbl5 -KO ( c ) or pcd 3J ( d ) mice are co-immunostained for α-tubulin (EP1332Y, red) and glutamylation (GT335, green) and nuclei are visualized with DAPI staining (blue). In wild-type mice, GT335 immunoreactivity is mainly detectable in the flagellum of the developing sperm ( b , arrows), whereas in Agbl5 -KO mice profound GT335 signal is detected in the cell body of developing sperm ( c ). Notably, GT335 signal is undetectable in the manchette of wild-type spermatids ( a , insert, and ref. 32 ) but is prominently expressed in manchette of Agbl5 -KO ( c , insert) mice. Similar to wild-type mice, in pcd mice GT335 immunoreactivity is largely absent in the manchette ( d , insert). Sale bar: 10 μm.

    Article Snippet: CCP5 was amplified with a TaqMan® probe (Mm01220582_g1, Applied Biosystems).

    Techniques: Gene Knockout, Mouse Assay, Western Blot, Staining

    Purified recombinant CCP5 catalyzes the deglutamylation of porcine tubulin and synthetic substrates. ( a ) SDS-PAGE of purified recombinant CCP5 (DQ867034 splice variant) stained with Coomassie brilliant blue (CBB) (left lane). The major CBB band is immunoreactive with a CCP5 specific antibody (right lane). ( b ) Recombinant CCP5 and/or Nna1 were incubated with porcine tubulin and the deglutamylation activity was monitored by immunoblotting using GT335 and polyE antibodies. CCP5, but not the heat-denatured (Boiled) enzyme, reduced the GT335 signal without altering polyE immunoreactivity, indicative of specific removal of the branching glutamate of tubulin. Nna1 alone substantially reduced polyE immunoreactivity, though it increased the GT335 signal. Co-incubation of Nna1 and CCP5 completely abolished GT335 signal and further reduced polyE signal. ( c ) CCP5 is not active against three Nna1 synthetic substrates (Biotin-3EG2E, Biotin-ΔY, and Biotin-5E 4 ), but it is active against a substrate with an exposed γ-carboxyl-linked glutamate (Biotin-EGE(E)E). When the γ-carboxyl-linked glutamate is in chain with another α-linked glutamate (Biotin-EGE(EE)E), CCP5 is no longer active. CCP5, but not Nna1, is active against Biotin-EGE(E)EY, where the only terminal glutamate is linked through a γ-carboxyl, further confirming their substrate specificities. Bars are mean ± SEM (error bars) of triplicate determinations.

    Journal: Scientific Reports

    Article Title: Role of Cytosolic Carboxypeptidase 5 in Neuronal Survival and Spermatogenesis

    doi: 10.1038/srep41428

    Figure Lengend Snippet: Purified recombinant CCP5 catalyzes the deglutamylation of porcine tubulin and synthetic substrates. ( a ) SDS-PAGE of purified recombinant CCP5 (DQ867034 splice variant) stained with Coomassie brilliant blue (CBB) (left lane). The major CBB band is immunoreactive with a CCP5 specific antibody (right lane). ( b ) Recombinant CCP5 and/or Nna1 were incubated with porcine tubulin and the deglutamylation activity was monitored by immunoblotting using GT335 and polyE antibodies. CCP5, but not the heat-denatured (Boiled) enzyme, reduced the GT335 signal without altering polyE immunoreactivity, indicative of specific removal of the branching glutamate of tubulin. Nna1 alone substantially reduced polyE immunoreactivity, though it increased the GT335 signal. Co-incubation of Nna1 and CCP5 completely abolished GT335 signal and further reduced polyE signal. ( c ) CCP5 is not active against three Nna1 synthetic substrates (Biotin-3EG2E, Biotin-ΔY, and Biotin-5E 4 ), but it is active against a substrate with an exposed γ-carboxyl-linked glutamate (Biotin-EGE(E)E). When the γ-carboxyl-linked glutamate is in chain with another α-linked glutamate (Biotin-EGE(EE)E), CCP5 is no longer active. CCP5, but not Nna1, is active against Biotin-EGE(E)EY, where the only terminal glutamate is linked through a γ-carboxyl, further confirming their substrate specificities. Bars are mean ± SEM (error bars) of triplicate determinations.

    Article Snippet: CCP5 was amplified with a TaqMan® probe (Mm01220582_g1, Applied Biosystems).

    Techniques: Purification, Recombinant, SDS Page, Variant Assay, Staining, Incubation, Activity Assay

    Agbl5 deficit does not recapitulate the neurodegeneration phenotype of pcd mice. ( a ) 2-month-old gender-balanced littermates of wild-type (WT, n = 4) and Agbl5 -KO (n = 9) were tested on an accelerating rota-rod for five consecutive days. The latency to fall in seconds for all animals of each group was recorded and presented as mean ± SEM. One-way ANOVA showed that the wild-type mice are not significantly different ( p > 0.05 ) from the Agbl5- KO. Therefore, Agbl 5 deficit does not cause the locomotor dysfunction seen in pcd 3J −/− mice. ( b ) Rota-rod test to determine whether deletion of Agbl5 exacerbates the locomotor phenotype in pcd 3J −/− mice or elicits a synthetic locomotor deficit in pcd- heterozygous mice. 2-month old gender-balanced littermates of each genotype (n = 3–7) were tested on a rota-rod as described. One-way ANOVA showed Agbl5- KO/ pcd double mutants (−/−//−/−) are indistinguishable from pcd (+/+//−/−) mice. Agbl5 -KO mice on a pcd heterozygous background (−/−//+/−) are not ataxic and have a locomotor performance comparable with that of wild-type (+/+//+/+), Agbl5 -KO (−/−//+/+) and pcd heterozygous (+/+//+/−) mice. ( c ) Calbindin D-28K immunohistochemistry and hematoxylin counterstaining of cerebellar sections from 2-month old wild-type, Agbl5- KO, and pcd 3J −/− mice. In contrast to their loss in pcd 3J −/− mice, calbindin-positive Purkinje neurons are preserved in Agbl5 -KO similar to those in wild-type animals. Scale bar: 50 μm.

    Journal: Scientific Reports

    Article Title: Role of Cytosolic Carboxypeptidase 5 in Neuronal Survival and Spermatogenesis

    doi: 10.1038/srep41428

    Figure Lengend Snippet: Agbl5 deficit does not recapitulate the neurodegeneration phenotype of pcd mice. ( a ) 2-month-old gender-balanced littermates of wild-type (WT, n = 4) and Agbl5 -KO (n = 9) were tested on an accelerating rota-rod for five consecutive days. The latency to fall in seconds for all animals of each group was recorded and presented as mean ± SEM. One-way ANOVA showed that the wild-type mice are not significantly different ( p > 0.05 ) from the Agbl5- KO. Therefore, Agbl 5 deficit does not cause the locomotor dysfunction seen in pcd 3J −/− mice. ( b ) Rota-rod test to determine whether deletion of Agbl5 exacerbates the locomotor phenotype in pcd 3J −/− mice or elicits a synthetic locomotor deficit in pcd- heterozygous mice. 2-month old gender-balanced littermates of each genotype (n = 3–7) were tested on a rota-rod as described. One-way ANOVA showed Agbl5- KO/ pcd double mutants (−/−//−/−) are indistinguishable from pcd (+/+//−/−) mice. Agbl5 -KO mice on a pcd heterozygous background (−/−//+/−) are not ataxic and have a locomotor performance comparable with that of wild-type (+/+//+/+), Agbl5 -KO (−/−//+/+) and pcd heterozygous (+/+//+/−) mice. ( c ) Calbindin D-28K immunohistochemistry and hematoxylin counterstaining of cerebellar sections from 2-month old wild-type, Agbl5- KO, and pcd 3J −/− mice. In contrast to their loss in pcd 3J −/− mice, calbindin-positive Purkinje neurons are preserved in Agbl5 -KO similar to those in wild-type animals. Scale bar: 50 μm.

    Article Snippet: CCP5 was amplified with a TaqMan® probe (Mm01220582_g1, Applied Biosystems).

    Techniques: Mouse Assay, Gene Knockout, Immunohistochemistry

    Agbl5 deficiency increases protein glutamylation in cerebellum. ( a ) Schematic representation of Agbl5 -KO allele. A region spanning exons 5, 6 and 7, which encodes ¾ of the entire carboxypeptidase domain of CCP5, is replaced by a selection cassette. ( b ) Quantitative real-time PCR using a probe spanning exon 11 and 12 shows that CCP5 RNA levels in the tissues examined are greatly reduced in heterozygous animals compared to that of wild-type littermates, and are barely detectable in the homozygous mutants. RNA levels were normalized to internal GAPDH levels and compared with the values of wild-type testis. Bars are mean ± SEM (error bars) of determinations of three animals. ( c ) Glutamylation or polyglutamylation levels in cerebellar lysates from wild-type (WT), pcd 3J −/− and Agbl5 -KO mice are monitored by immunoblotting for GT335, B3, and polyE immunoreactivities, and ( d ) quantitatively analyzed using ImageStudio with normalization to α-tubulin levels. The bars represent the mean ± SEM of 3 animals of each genotype. GT335 immunoreactivity is significantly elevated in both pcd and Agbl5- KO mice compared to that of wild-type ( p

    Journal: Scientific Reports

    Article Title: Role of Cytosolic Carboxypeptidase 5 in Neuronal Survival and Spermatogenesis

    doi: 10.1038/srep41428

    Figure Lengend Snippet: Agbl5 deficiency increases protein glutamylation in cerebellum. ( a ) Schematic representation of Agbl5 -KO allele. A region spanning exons 5, 6 and 7, which encodes ¾ of the entire carboxypeptidase domain of CCP5, is replaced by a selection cassette. ( b ) Quantitative real-time PCR using a probe spanning exon 11 and 12 shows that CCP5 RNA levels in the tissues examined are greatly reduced in heterozygous animals compared to that of wild-type littermates, and are barely detectable in the homozygous mutants. RNA levels were normalized to internal GAPDH levels and compared with the values of wild-type testis. Bars are mean ± SEM (error bars) of determinations of three animals. ( c ) Glutamylation or polyglutamylation levels in cerebellar lysates from wild-type (WT), pcd 3J −/− and Agbl5 -KO mice are monitored by immunoblotting for GT335, B3, and polyE immunoreactivities, and ( d ) quantitatively analyzed using ImageStudio with normalization to α-tubulin levels. The bars represent the mean ± SEM of 3 animals of each genotype. GT335 immunoreactivity is significantly elevated in both pcd and Agbl5- KO mice compared to that of wild-type ( p

    Article Snippet: CCP5 was amplified with a TaqMan® probe (Mm01220582_g1, Applied Biosystems).

    Techniques: Gene Knockout, Selection, Real-time Polymerase Chain Reaction, Mouse Assay

    In situ hybridization of CCP5 on testis. Digoxin-labeled RNA probes that span exon 2–7 of CCP5 cDNA are used to determine CCP5 expression on testis sections of 3-month old wild-type ( a – c ) and Agbl5 -KO ( d – f ) mice. The antisense probes reveal CCP5 is prominently expressed in developing germ cells from spermatocytes onward but is undetectable in spermatogonia (arrows) in wild-type mice ( a , b ). The same probe does not hybridize on Agbl5 -KO testis ( d , e ). The digoxin-labeled sense RNA probe hybridizes neither on wild-type nor Agbl5 -KO testis ( c , f ). Sale bars: 100 μm in ( a , c , d , f ); 20 μm in ( b and e ). ( g ) Schematic representation of spermatogenesis. Based upon their location in the testis ( Supplementary Fig. S4 ), the cells expressing CCP5 are likely primary and secondary spermatocytes.

    Journal: Scientific Reports

    Article Title: Role of Cytosolic Carboxypeptidase 5 in Neuronal Survival and Spermatogenesis

    doi: 10.1038/srep41428

    Figure Lengend Snippet: In situ hybridization of CCP5 on testis. Digoxin-labeled RNA probes that span exon 2–7 of CCP5 cDNA are used to determine CCP5 expression on testis sections of 3-month old wild-type ( a – c ) and Agbl5 -KO ( d – f ) mice. The antisense probes reveal CCP5 is prominently expressed in developing germ cells from spermatocytes onward but is undetectable in spermatogonia (arrows) in wild-type mice ( a , b ). The same probe does not hybridize on Agbl5 -KO testis ( d , e ). The digoxin-labeled sense RNA probe hybridizes neither on wild-type nor Agbl5 -KO testis ( c , f ). Sale bars: 100 μm in ( a , c , d , f ); 20 μm in ( b and e ). ( g ) Schematic representation of spermatogenesis. Based upon their location in the testis ( Supplementary Fig. S4 ), the cells expressing CCP5 are likely primary and secondary spermatocytes.

    Article Snippet: CCP5 was amplified with a TaqMan® probe (Mm01220582_g1, Applied Biosystems).

    Techniques: In Situ Hybridization, Labeling, Expressing, Gene Knockout, Mouse Assay

    Enzymatic activities of CCP5 splicing variants. ( a ) Schematic representation of alternative splicing of Agbl5 that generates three CCP5 variants. DQ867034 and DQ867035 do not contain exon 4 and use the stop codons in exon 15 and 16 respectively. DQ867036 is the only CCP5 variant that contains exon 4 and uses the stop codon in exon 16. ( b ) When porcine tubulin was incubated with the lysate of HEK293 cells transfected with CCP5 variants, DQ867034 and DQ867035, it exhibited reduced GT335 immunoreactivity compared to LacZ transfected cells, indicative of active enzyme. In contrast, lysates from DQ867036 transfected cells showed no change in tubulin GT355 immunoreactivity, indicative of an inactive enzyme under these conditions. None of the 3 CCP5 variants altered polyE immunoreactivity, indicating their inability to cleave α-carboxyl–linked glutamate. ( c ) The activity of CCP5 (DQ867034) on branching glutamate (GT335) is inhibited by addition of 5 mM 1,10-phenanthroline (OP).

    Journal: Scientific Reports

    Article Title: Role of Cytosolic Carboxypeptidase 5 in Neuronal Survival and Spermatogenesis

    doi: 10.1038/srep41428

    Figure Lengend Snippet: Enzymatic activities of CCP5 splicing variants. ( a ) Schematic representation of alternative splicing of Agbl5 that generates three CCP5 variants. DQ867034 and DQ867035 do not contain exon 4 and use the stop codons in exon 15 and 16 respectively. DQ867036 is the only CCP5 variant that contains exon 4 and uses the stop codon in exon 16. ( b ) When porcine tubulin was incubated with the lysate of HEK293 cells transfected with CCP5 variants, DQ867034 and DQ867035, it exhibited reduced GT335 immunoreactivity compared to LacZ transfected cells, indicative of active enzyme. In contrast, lysates from DQ867036 transfected cells showed no change in tubulin GT355 immunoreactivity, indicative of an inactive enzyme under these conditions. None of the 3 CCP5 variants altered polyE immunoreactivity, indicating their inability to cleave α-carboxyl–linked glutamate. ( c ) The activity of CCP5 (DQ867034) on branching glutamate (GT335) is inhibited by addition of 5 mM 1,10-phenanthroline (OP).

    Article Snippet: CCP5 was amplified with a TaqMan® probe (Mm01220582_g1, Applied Biosystems).

    Techniques: Variant Assay, Incubation, Transfection, Activity Assay

    Defective spermatogenesis in Agbl5 -KO mice. ( a ) Testes of 3-month old Agbl5 -KO and pcd 3J −/− mice are smaller than those of age-matched wild-type mice. ( b ) Comparison of the weight of testes from 3-month old wild-type (WT, n = 8), Agbl5 -KO (n = 8), and pcd 3J (n = 4) mice. Although testes from both Agbl5- KO and pcd 3J mice weigh significantly less ( p

    Journal: Scientific Reports

    Article Title: Role of Cytosolic Carboxypeptidase 5 in Neuronal Survival and Spermatogenesis

    doi: 10.1038/srep41428

    Figure Lengend Snippet: Defective spermatogenesis in Agbl5 -KO mice. ( a ) Testes of 3-month old Agbl5 -KO and pcd 3J −/− mice are smaller than those of age-matched wild-type mice. ( b ) Comparison of the weight of testes from 3-month old wild-type (WT, n = 8), Agbl5 -KO (n = 8), and pcd 3J (n = 4) mice. Although testes from both Agbl5- KO and pcd 3J mice weigh significantly less ( p

    Article Snippet: CCP5 was amplified with a TaqMan® probe (Mm01220582_g1, Applied Biosystems).

    Techniques: Gene Knockout, Mouse Assay

    Depiction of the humanized Abcb1a gene locus. Shown are the sequenced region (6089 bp, black) and the downstream adjacent mouse sequence not included in the sequencing (light grey). The human ABCB1 CDS was fused into the TSS, which left the untranslated base pairs TSS -1 to -6 of exon 2 behind (green). ABCB1 CDS has been introduced with its 3′UTR and additional 45 bp of human genomic downstream sequence. At the 3′ transition towards the mouse genomic sequence, a loxP site has been introduced which is flanked by altogether 99 bp of unknown origin. The same is true for the 5′ situated loxP site, which is flanked by additional 37 bp, respectively, and inserted into intron 1 of mouse Abcb1a. The picture is not proportional to the genomic arrangement.

    Journal: European Journal of Microbiology & Immunology

    Article Title: Humanization of the Blood–Brain Barrier Transporter ABCB1 in Mice Disrupts Genomic Locus — Lessons from Three Unsuccessful Approaches

    doi: 10.1556/1886.2018.00008

    Figure Lengend Snippet: Depiction of the humanized Abcb1a gene locus. Shown are the sequenced region (6089 bp, black) and the downstream adjacent mouse sequence not included in the sequencing (light grey). The human ABCB1 CDS was fused into the TSS, which left the untranslated base pairs TSS -1 to -6 of exon 2 behind (green). ABCB1 CDS has been introduced with its 3′UTR and additional 45 bp of human genomic downstream sequence. At the 3′ transition towards the mouse genomic sequence, a loxP site has been introduced which is flanked by altogether 99 bp of unknown origin. The same is true for the 5′ situated loxP site, which is flanked by additional 37 bp, respectively, and inserted into intron 1 of mouse Abcb1a. The picture is not proportional to the genomic arrangement.

    Article Snippet: For analyses of transcript variants, RNA of a new set of brains was prepared from female wild-type, hABCB1, and human ABCB1–/ – mice (5 each) and assayed using the mentioned assay and conditions plus assays Mm00440745_m1 and Mm00440751_m1.

    Techniques: Sequencing

    Full exonic sequence of Abcb1a. Capital letters indicate the coding sequence, lower case indicate untranslated bases. ATG start codons that could establish an open reading frame are indicated green. Exon junctions are indicated by an |. Pink letters indicate the central base of the probes of the TaqMan assays used (according manufactures information).

    Journal: European Journal of Microbiology & Immunology

    Article Title: Humanization of the Blood–Brain Barrier Transporter ABCB1 in Mice Disrupts Genomic Locus — Lessons from Three Unsuccessful Approaches

    doi: 10.1556/1886.2018.00008

    Figure Lengend Snippet: Full exonic sequence of Abcb1a. Capital letters indicate the coding sequence, lower case indicate untranslated bases. ATG start codons that could establish an open reading frame are indicated green. Exon junctions are indicated by an |. Pink letters indicate the central base of the probes of the TaqMan assays used (according manufactures information).

    Article Snippet: For analyses of transcript variants, RNA of a new set of brains was prepared from female wild-type, hABCB1, and human ABCB1–/ – mice (5 each) and assayed using the mentioned assay and conditions plus assays Mm00440745_m1 and Mm00440751_m1.

    Techniques: Sequencing

    ABCB1 transport activity at the BBB measured with ( R )-[ 11 C]verapamil PET imaging. Brain uptake of ( R )-[ 11 C]verapamil expressed as brain-to-blood radioactivity concentration ratio ( K b,brain ) at 60 min after radiotracer injection in female C57BL/6 mice (veh: n = 6, tariquidar: n = 5), hABCB1 mice (genOway; veh: n = 3, tariquidar: n = 3), and hABCB1 mice (Taconic; veh: n = 4, tariquidar: n = 3) treated with vehicle solution (2.5% [w/v] aq. dextrose solution) or tariquidar (15 mg/kg body weight) at 2 h before radiotracer injection. For comparison, K b,brain in vehicle-treated Abcb1a/b (–/–) mice (n = 4) is also shown [ 36 ]. Data are mean ± standard deviation. Statistical significance was determined by 2-way ANOVA with Bonferroni post-hoc test. **p

    Journal: European Journal of Microbiology & Immunology

    Article Title: Humanization of the Blood–Brain Barrier Transporter ABCB1 in Mice Disrupts Genomic Locus — Lessons from Three Unsuccessful Approaches

    doi: 10.1556/1886.2018.00008

    Figure Lengend Snippet: ABCB1 transport activity at the BBB measured with ( R )-[ 11 C]verapamil PET imaging. Brain uptake of ( R )-[ 11 C]verapamil expressed as brain-to-blood radioactivity concentration ratio ( K b,brain ) at 60 min after radiotracer injection in female C57BL/6 mice (veh: n = 6, tariquidar: n = 5), hABCB1 mice (genOway; veh: n = 3, tariquidar: n = 3), and hABCB1 mice (Taconic; veh: n = 4, tariquidar: n = 3) treated with vehicle solution (2.5% [w/v] aq. dextrose solution) or tariquidar (15 mg/kg body weight) at 2 h before radiotracer injection. For comparison, K b,brain in vehicle-treated Abcb1a/b (–/–) mice (n = 4) is also shown [ 36 ]. Data are mean ± standard deviation. Statistical significance was determined by 2-way ANOVA with Bonferroni post-hoc test. **p

    Article Snippet: For analyses of transcript variants, RNA of a new set of brains was prepared from female wild-type, hABCB1, and human ABCB1–/ – mice (5 each) and assayed using the mentioned assay and conditions plus assays Mm00440745_m1 and Mm00440751_m1.

    Techniques: Activity Assay, Positron Emission Tomography, Imaging, Radioactivity, Concentration Assay, Injection, Mouse Assay, Standard Deviation

    In hABCB1 mice 266 bp of Abcb1a are deleted. Alignment of hABCB1 sequence starting at the first base pair downstream of the loxP insertion site with Abcb1a starting at TSS.

    Journal: European Journal of Microbiology & Immunology

    Article Title: Humanization of the Blood–Brain Barrier Transporter ABCB1 in Mice Disrupts Genomic Locus — Lessons from Three Unsuccessful Approaches

    doi: 10.1556/1886.2018.00008

    Figure Lengend Snippet: In hABCB1 mice 266 bp of Abcb1a are deleted. Alignment of hABCB1 sequence starting at the first base pair downstream of the loxP insertion site with Abcb1a starting at TSS.

    Article Snippet: For analyses of transcript variants, RNA of a new set of brains was prepared from female wild-type, hABCB1, and human ABCB1–/ – mice (5 each) and assayed using the mentioned assay and conditions plus assays Mm00440745_m1 and Mm00440751_m1.

    Techniques: Mouse Assay, Sequencing

    Western blot analysis of ABCB1 expression Western blot against ABCB1 confirmed PET imaging findings in hABCB1 animals and shows drastically reduced protein expression of any ABCB1 variant in hABCB1 as well as hABCB1 –/– mice. Data are mean ± standard deviation. Statistical significance was determined by 1-way ANOVA with Tukey's Honest Significant Difference post-hoc test, significance level p

    Journal: European Journal of Microbiology & Immunology

    Article Title: Humanization of the Blood–Brain Barrier Transporter ABCB1 in Mice Disrupts Genomic Locus — Lessons from Three Unsuccessful Approaches

    doi: 10.1556/1886.2018.00008

    Figure Lengend Snippet: Western blot analysis of ABCB1 expression Western blot against ABCB1 confirmed PET imaging findings in hABCB1 animals and shows drastically reduced protein expression of any ABCB1 variant in hABCB1 as well as hABCB1 –/– mice. Data are mean ± standard deviation. Statistical significance was determined by 1-way ANOVA with Tukey's Honest Significant Difference post-hoc test, significance level p

    Article Snippet: For analyses of transcript variants, RNA of a new set of brains was prepared from female wild-type, hABCB1, and human ABCB1–/ – mice (5 each) and assayed using the mentioned assay and conditions plus assays Mm00440745_m1 and Mm00440751_m1.

    Techniques: Western Blot, Expressing, Positron Emission Tomography, Imaging, Variant Assay, Mouse Assay, Standard Deviation

    Relative mRNA expression of Abcb1a and ABCB1 . Human ABCB1 mRNA is expressed at very low levels in hABCB1 mice only. No decrease of Abcb1a mRNA expression was detected in hABCB1 mice compared to wild-type animals. Shown are the relative expression of mouse Abcb1a (green) and human ABCB1 (blue) mRNA in male wild-type ( n = 7) and hABCB1 ( n = 10) mice based on the comparison of ct values. Ct values were normalized to mouse Actb mRNA expression using 2 (–Δct) calculation. Data are mean ± standard deviation. Statistical significance was determined by 1-way ANOVA with Tukey's honest significant difference post-hoc test. **** p

    Journal: European Journal of Microbiology & Immunology

    Article Title: Humanization of the Blood–Brain Barrier Transporter ABCB1 in Mice Disrupts Genomic Locus — Lessons from Three Unsuccessful Approaches

    doi: 10.1556/1886.2018.00008

    Figure Lengend Snippet: Relative mRNA expression of Abcb1a and ABCB1 . Human ABCB1 mRNA is expressed at very low levels in hABCB1 mice only. No decrease of Abcb1a mRNA expression was detected in hABCB1 mice compared to wild-type animals. Shown are the relative expression of mouse Abcb1a (green) and human ABCB1 (blue) mRNA in male wild-type ( n = 7) and hABCB1 ( n = 10) mice based on the comparison of ct values. Ct values were normalized to mouse Actb mRNA expression using 2 (–Δct) calculation. Data are mean ± standard deviation. Statistical significance was determined by 1-way ANOVA with Tukey's honest significant difference post-hoc test. **** p

    Article Snippet: For analyses of transcript variants, RNA of a new set of brains was prepared from female wild-type, hABCB1, and human ABCB1–/ – mice (5 each) and assayed using the mentioned assay and conditions plus assays Mm00440745_m1 and Mm00440751_m1.

    Techniques: Expressing, Mouse Assay, Standard Deviation

    Abcb1a promoter region analysis. Shown are the Abcb1a loci of wild-type and hABCB1 mice in comparison. ENCODE database searches revealed the indicated hotspots of open/accessible chromatin found in mouse brains using DNAse-seq, ATAC-seq, and ChIP-seq methods. The area of highest density of overlapping hotspots (orange/light orange) covers more than 200 bp indicating the importance of this region for Abcb1a gene expression.

    Journal: European Journal of Microbiology & Immunology

    Article Title: Humanization of the Blood–Brain Barrier Transporter ABCB1 in Mice Disrupts Genomic Locus — Lessons from Three Unsuccessful Approaches

    doi: 10.1556/1886.2018.00008

    Figure Lengend Snippet: Abcb1a promoter region analysis. Shown are the Abcb1a loci of wild-type and hABCB1 mice in comparison. ENCODE database searches revealed the indicated hotspots of open/accessible chromatin found in mouse brains using DNAse-seq, ATAC-seq, and ChIP-seq methods. The area of highest density of overlapping hotspots (orange/light orange) covers more than 200 bp indicating the importance of this region for Abcb1a gene expression.

    Article Snippet: For analyses of transcript variants, RNA of a new set of brains was prepared from female wild-type, hABCB1, and human ABCB1–/ – mice (5 each) and assayed using the mentioned assay and conditions plus assays Mm00440745_m1 and Mm00440751_m1.

    Techniques: Mouse Assay, Chromatin Immunoprecipitation, Expressing

    Abcb1a exons 3 and 4 are unaltered. Alignment of exon 3 (a) and exon 4 (b) as sequenced from hABCB1 mice with Abcb1a reference sequence (Gene ID: 18671). Bold letters indicate exons.

    Journal: European Journal of Microbiology & Immunology

    Article Title: Humanization of the Blood–Brain Barrier Transporter ABCB1 in Mice Disrupts Genomic Locus — Lessons from Three Unsuccessful Approaches

    doi: 10.1556/1886.2018.00008

    Figure Lengend Snippet: Abcb1a exons 3 and 4 are unaltered. Alignment of exon 3 (a) and exon 4 (b) as sequenced from hABCB1 mice with Abcb1a reference sequence (Gene ID: 18671). Bold letters indicate exons.

    Article Snippet: For analyses of transcript variants, RNA of a new set of brains was prepared from female wild-type, hABCB1, and human ABCB1–/ – mice (5 each) and assayed using the mentioned assay and conditions plus assays Mm00440745_m1 and Mm00440751_m1.

    Techniques: Mouse Assay, Sequencing

    Exon junction-specific mRNA expression of Abcb1a. Abundance of Abcb1a mRNAs with different lengths was assessed using assays covering the indicated exon junctions in female wild-type mice ( n = 5), hABCB1 mice ( n = 5), as well as in hABCB1 mice ( n = 5) crossed to a Cre-deleter mouse strain (human ABCB1 –/– ). No differential expression between strains was found within each assay location. Data are mean ± standard deviation. Statistical significance was determined by 1-way ANOVA with Tukey's honest significant difference post-hoc test, significance level p

    Journal: European Journal of Microbiology & Immunology

    Article Title: Humanization of the Blood–Brain Barrier Transporter ABCB1 in Mice Disrupts Genomic Locus — Lessons from Three Unsuccessful Approaches

    doi: 10.1556/1886.2018.00008

    Figure Lengend Snippet: Exon junction-specific mRNA expression of Abcb1a. Abundance of Abcb1a mRNAs with different lengths was assessed using assays covering the indicated exon junctions in female wild-type mice ( n = 5), hABCB1 mice ( n = 5), as well as in hABCB1 mice ( n = 5) crossed to a Cre-deleter mouse strain (human ABCB1 –/– ). No differential expression between strains was found within each assay location. Data are mean ± standard deviation. Statistical significance was determined by 1-way ANOVA with Tukey's honest significant difference post-hoc test, significance level p

    Article Snippet: For analyses of transcript variants, RNA of a new set of brains was prepared from female wild-type, hABCB1, and human ABCB1–/ – mice (5 each) and assayed using the mentioned assay and conditions plus assays Mm00440745_m1 and Mm00440751_m1.

    Techniques: Expressing, Mouse Assay, Standard Deviation