mcherry  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    TaKaRa mcherry
    T. gondii ingests host cytosolic <t>mCherry</t> throughout its cell cycle. A, Experimental design for detection and localization of recently ingested host cytosolic protein ingestion. CHO-K1 cells were transiently transfected with a plasmid encoding cytosolic mCherry fluorescent protein 18–24 h before synchronous invasion for 10 min with untreated T. gondii parasites. 50 μM LHVS or DMSO added during the last 30 min of infection before being purified, stained and analyzed by fluorescence microscopy. B, Quantitation of ingestion in Cen2-EGFP parasites treated with DMSO or LHVS for 36 h or 30 min and purified at 3 h post-invasion. Shown is percentage of mCherry positive parasites, at least 200 parasites analyzed per condition, One-way ANOVA with Tukey’s multiple comparisons. C, Cell cycle phasing of LHVS-treated Cen2-EGFP parasites harvested at 4 to 6 h post-invasion to be quantitated for ingestion in D as determined by pattern of Cen2-EGFP and antibody staining for IMC1. D, Quantitation of ingestion in DMSO or LHVS-treated Cen2-EGFP parasites at 4 to 6 h post-invasion. Shown is percentage of mCherry positive parasites, at least 200 parasites analyzed per condition, ratio paired t-test. E, Representative images for detection of ingested host cytosolic mCherry in parasites in G, S or M/C phase. F, Cell cycle phase-specific analysis of ingestion pathway activity. Percentage of mCherry positive parasites in each cell cycle phase from parasites in D was determined with at least 230 parasites in G phase, at least 55 parasites in S phase and at least 24 parasites in M/C phase analyzed, one way ANOVA. All bars represent the mean of 4 biological replicates, error bars represent standard deviation, ** p
    Mcherry, supplied by TaKaRa, used in various techniques. Bioz Stars score: 86/100, based on 40 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mcherry/product/TaKaRa
    Average 86 stars, based on 40 article reviews
    Price from $9.99 to $1999.99
    mcherry - by Bioz Stars, 2022-10
    86/100 stars

    Images

    1) Product Images from "Intersection of Endocytic and Exocytic Systems in Toxoplasma gondii"

    Article Title: Intersection of Endocytic and Exocytic Systems in Toxoplasma gondii

    Journal: Traffic (Copenhagen, Denmark)

    doi: 10.1111/tra.12556

    T. gondii ingests host cytosolic mCherry throughout its cell cycle. A, Experimental design for detection and localization of recently ingested host cytosolic protein ingestion. CHO-K1 cells were transiently transfected with a plasmid encoding cytosolic mCherry fluorescent protein 18–24 h before synchronous invasion for 10 min with untreated T. gondii parasites. 50 μM LHVS or DMSO added during the last 30 min of infection before being purified, stained and analyzed by fluorescence microscopy. B, Quantitation of ingestion in Cen2-EGFP parasites treated with DMSO or LHVS for 36 h or 30 min and purified at 3 h post-invasion. Shown is percentage of mCherry positive parasites, at least 200 parasites analyzed per condition, One-way ANOVA with Tukey’s multiple comparisons. C, Cell cycle phasing of LHVS-treated Cen2-EGFP parasites harvested at 4 to 6 h post-invasion to be quantitated for ingestion in D as determined by pattern of Cen2-EGFP and antibody staining for IMC1. D, Quantitation of ingestion in DMSO or LHVS-treated Cen2-EGFP parasites at 4 to 6 h post-invasion. Shown is percentage of mCherry positive parasites, at least 200 parasites analyzed per condition, ratio paired t-test. E, Representative images for detection of ingested host cytosolic mCherry in parasites in G, S or M/C phase. F, Cell cycle phase-specific analysis of ingestion pathway activity. Percentage of mCherry positive parasites in each cell cycle phase from parasites in D was determined with at least 230 parasites in G phase, at least 55 parasites in S phase and at least 24 parasites in M/C phase analyzed, one way ANOVA. All bars represent the mean of 4 biological replicates, error bars represent standard deviation, ** p
    Figure Legend Snippet: T. gondii ingests host cytosolic mCherry throughout its cell cycle. A, Experimental design for detection and localization of recently ingested host cytosolic protein ingestion. CHO-K1 cells were transiently transfected with a plasmid encoding cytosolic mCherry fluorescent protein 18–24 h before synchronous invasion for 10 min with untreated T. gondii parasites. 50 μM LHVS or DMSO added during the last 30 min of infection before being purified, stained and analyzed by fluorescence microscopy. B, Quantitation of ingestion in Cen2-EGFP parasites treated with DMSO or LHVS for 36 h or 30 min and purified at 3 h post-invasion. Shown is percentage of mCherry positive parasites, at least 200 parasites analyzed per condition, One-way ANOVA with Tukey’s multiple comparisons. C, Cell cycle phasing of LHVS-treated Cen2-EGFP parasites harvested at 4 to 6 h post-invasion to be quantitated for ingestion in D as determined by pattern of Cen2-EGFP and antibody staining for IMC1. D, Quantitation of ingestion in DMSO or LHVS-treated Cen2-EGFP parasites at 4 to 6 h post-invasion. Shown is percentage of mCherry positive parasites, at least 200 parasites analyzed per condition, ratio paired t-test. E, Representative images for detection of ingested host cytosolic mCherry in parasites in G, S or M/C phase. F, Cell cycle phase-specific analysis of ingestion pathway activity. Percentage of mCherry positive parasites in each cell cycle phase from parasites in D was determined with at least 230 parasites in G phase, at least 55 parasites in S phase and at least 24 parasites in M/C phase analyzed, one way ANOVA. All bars represent the mean of 4 biological replicates, error bars represent standard deviation, ** p

    Techniques Used: Transfection, Plasmid Preparation, Infection, Purification, Staining, Fluorescence, Microscopy, Quantitation Assay, Activity Assay, Standard Deviation

    Endocytic trafficking is merged with microneme biogenesis in T. gondii with infection of CHO-K1 imCh cells and 200 μM LHVS treatment for 30 min to detect recently ingested mCherry only. Shown is percentage of mCherry positive parasites, at least 200 parasites analyzed per condition, unpaired t-test. B, Quantitation of ingestion pathway activity during microneme biogenesis by comparing proMIC5 positive and negative populations. Shown is percentage of mCherry positive parasites, at least 200 parasites analyzed for each proMIC5 positive and negative population, ratio paired t-test. C, Quantitation of ingestion pathway activity during rhoptry biogenesis by comparing proRON4 positive and negative populations. Shown is percentage of mCherry positive parasites, at least 200 parasites for each proRON4 positive and negative population, ratio paired t-test. D, Quantitation of colocalization of ingested mCherry with proM2AP, proMIC5, proRON4 or the apicoplast in LHVS-treated parasites from A stained with antibodies each indicated marker. At least 30 ingested mCherry puncta analyzed per marker. One-way ANOVA with Dunnet’s test for multiple comparisons to colocalization with the apicoplast. E, Representative images of localization of ingested mCherry relative to proM2AP, proMIC5, proRON4 or the apicoplast (indicated by the blue arrow head). All bars represent the mean from 3 biological replicates, error bars represent standard deviation, ** p,
    Figure Legend Snippet: Endocytic trafficking is merged with microneme biogenesis in T. gondii with infection of CHO-K1 imCh cells and 200 μM LHVS treatment for 30 min to detect recently ingested mCherry only. Shown is percentage of mCherry positive parasites, at least 200 parasites analyzed per condition, unpaired t-test. B, Quantitation of ingestion pathway activity during microneme biogenesis by comparing proMIC5 positive and negative populations. Shown is percentage of mCherry positive parasites, at least 200 parasites analyzed for each proMIC5 positive and negative population, ratio paired t-test. C, Quantitation of ingestion pathway activity during rhoptry biogenesis by comparing proRON4 positive and negative populations. Shown is percentage of mCherry positive parasites, at least 200 parasites for each proRON4 positive and negative population, ratio paired t-test. D, Quantitation of colocalization of ingested mCherry with proM2AP, proMIC5, proRON4 or the apicoplast in LHVS-treated parasites from A stained with antibodies each indicated marker. At least 30 ingested mCherry puncta analyzed per marker. One-way ANOVA with Dunnet’s test for multiple comparisons to colocalization with the apicoplast. E, Representative images of localization of ingested mCherry relative to proM2AP, proMIC5, proRON4 or the apicoplast (indicated by the blue arrow head). All bars represent the mean from 3 biological replicates, error bars represent standard deviation, ** p,

    Techniques Used: Infection, Quantitation Assay, Activity Assay, Staining, Marker, Standard Deviation

    Ingested host cytosolic mCherry is associated with the ELCs, VAC, and possibly the TGN. A, Experimental design for detection and localization of host cytosolic protein ingestion. CHO-K1 cells were transiently transfected with a plasmid encoding cytosolic mCherry fluorescent protein 18–24 h before synchronous invasion for 10 min with T. gondii parasites (pretreated with 1μM LHVS or the vehicle control DMSO for 36 h). Parasites were allowed to ingest host cytosol for 3 h in the presence of 1 μM LHVS or DMSO before being purified, stained and analyzed by fluorescence microscopy. B-D, Quantitation of ingestion of host cytosolic mCherry in WT, GalNac-YFP or ddGFP-DrpB WT parasites treated with 1 μM LHVS or DMSO. ddGFP-DrpB WT parasites were also treated with ethanol (EtOH) or 0.8μM Sh-1 for 30 min beginning at 2.5 h post-invasion to induce expression of DrpB WT. Shown is percentage of mCherry positive parasites, at least 200 parasites analyzed per condition, ratio paired t-test for B and C, one-way ANOVA with Tukey’s multiple comparisons for D. E, Representative images for localization of ingested mCherry in LHVS-treated parasites from B-D relative to the apicoplast using DAPI staining, CPB, NHE3 or proM2AP using antibody staining, GalNac-YFP or GFP-DrpB WT. Scale bars: 2μm. Blue arrowhead indicates the apicoplast, and white arrows indicate areas of colocalization when the endolysosomal marker of interest has several puncta. F, Quantitation of colocalization of ingested mCherry with the indicated markers of the endolysosomal system. At least 30 ingested mCherry puncta per marker, one-way ANOVA with Dunnet’s test for multiple comparisons to colocalization with the apicoplast. Only significant associations shown, Apicoplast vs. NHE3 is not significant. All bars represent mean from 3 or more biological replicates with standard deviation error bars. * p
    Figure Legend Snippet: Ingested host cytosolic mCherry is associated with the ELCs, VAC, and possibly the TGN. A, Experimental design for detection and localization of host cytosolic protein ingestion. CHO-K1 cells were transiently transfected with a plasmid encoding cytosolic mCherry fluorescent protein 18–24 h before synchronous invasion for 10 min with T. gondii parasites (pretreated with 1μM LHVS or the vehicle control DMSO for 36 h). Parasites were allowed to ingest host cytosol for 3 h in the presence of 1 μM LHVS or DMSO before being purified, stained and analyzed by fluorescence microscopy. B-D, Quantitation of ingestion of host cytosolic mCherry in WT, GalNac-YFP or ddGFP-DrpB WT parasites treated with 1 μM LHVS or DMSO. ddGFP-DrpB WT parasites were also treated with ethanol (EtOH) or 0.8μM Sh-1 for 30 min beginning at 2.5 h post-invasion to induce expression of DrpB WT. Shown is percentage of mCherry positive parasites, at least 200 parasites analyzed per condition, ratio paired t-test for B and C, one-way ANOVA with Tukey’s multiple comparisons for D. E, Representative images for localization of ingested mCherry in LHVS-treated parasites from B-D relative to the apicoplast using DAPI staining, CPB, NHE3 or proM2AP using antibody staining, GalNac-YFP or GFP-DrpB WT. Scale bars: 2μm. Blue arrowhead indicates the apicoplast, and white arrows indicate areas of colocalization when the endolysosomal marker of interest has several puncta. F, Quantitation of colocalization of ingested mCherry with the indicated markers of the endolysosomal system. At least 30 ingested mCherry puncta per marker, one-way ANOVA with Dunnet’s test for multiple comparisons to colocalization with the apicoplast. Only significant associations shown, Apicoplast vs. NHE3 is not significant. All bars represent mean from 3 or more biological replicates with standard deviation error bars. * p

    Techniques Used: Transfection, Plasmid Preparation, Purification, Staining, Fluorescence, Microscopy, Quantitation Assay, Expressing, Marker, Standard Deviation

    Ingestion does not require DrpB. A, Representative images for aberrant secretion of MIC3 into the PV lumen in ddGFP-DrpB K72A parasites with the addition of Shield-1 (Sh-1), but not the vehicle control ethanol (EtOH). Synchronously-infected cells were treated with 1 μM Sh-1 or the vehicle control ethanol (EtOH) for 5 h, partially permeablized with 0.02% saponin to allow staining of the PV lumen, but not the parasite interior, and stained with antibodies against MIC3 and against the dense granule protein TgPI-1 as a positive control for PV lumen staining. Scale bars: 2 μm. B, Quantitation of aberrant MIC3 secretion into the PV lumen in ddGFP-DrpB K72A parasites treated as in A with 1μM Shield-1 (Sh-1) for the last 2, 3 or 5 h of infection or 5 h for ethanol (EtOH). Shown is percentage of TgPI-1 + vacuoles that are MIC3 + , treated with 0.2% DMSO or 200 μM LHVS for 30 min and 0.1% EtOH or 1μM Sh-1 for the indicated amounts of time in C and 3 h in D. Shown is percentage of mCherry positive parasites, with at least 200 parasites analyzed for each of 2 biological replicates for DMSO+Shield-1 in C, and at least 3 biological replicates for all other samples. One-way ANOVA with Dunnet’s test for multiple comparisons of LHVS+EtOH treated samples to the DMSO+EtOH treated control are not shown, but all comparisons are significant. Unpaired, two-sample t-tests for comparison of EtOH and Sh-1 treated samples shown. E, Quantitation of colocalization of ingested mCherry with GFP-DrpB K72A, proM2AP and CPL by antibody staining, or the apicoplast by DAPI staining in LHVS-treated ddGFP-DrpB K72A parasites from D. At least 30 ingested mCherry puncta were analyzed per marker for each of 4 biological replicates for CPL and 3 biological replicates for all other markers. One-way ANOVA with Dunnet’s test for multiple comparisons of EtOH treated samples to the apicoplast are not shown, but proM2AP and CPL comparisons are significant. Unpaired two-sample t-tests for comparison of EtOH and Sh-1 treated samples for each marker and comparison of the apicoplast and ddGFP-DrpB K72A in Sh-1 treated parasites shown. F, Quantitation of colocalization of CPL with the indicated markers by antibody staining in intracellular ddGFP-DrpB K72A parasites synchronously invaded into HFF cells, treated with 0.1% EtOH or 1μM Sh-1 for 3 h and fixed at 3 h post-invasion. At least 40 CPL puncta analyzed per marker for each of 3 biological replicates. Unpaired two-sample t-tests for comparison of EtOH and Sh-1 treated samples. G and H, Representative images for colocalization of ddGFP-DrpB WT or ddGFP-DrpB K72A with the indicated markers by antibody staining, quantitated in I. White arrows indicate regions of colocalization. Scale bars: 5 μm. I, Quantitation of colocalization of Sh-1 treated ddGFP-DrpB WT or ddGFP-DrpB K72A with the indicated endolysosomal markers by antibody staining or the apicoplast by DAPI staining in intracellular parasites treated as in F with ddGFP-DrpB WT parasites treated with 0.8 μM Sh-1 for 30 min and ddGFP-DrpB K72A parasites treated with 1.0 μM Sh-1 for 3 h. At least 40 DrpB puncta analyzed per marker, per replicate for 3 biological replicates. One-way ANOVA with Dunnet’s test for multiple comparisons of each marker to the apicoplast for each ddGFP-DrpB WT and ddGFP-DrpB K72A parasites, only significant results shown. Unpaired two-sample t-tests for comparison of localization in ddGFP-DrpB WT vs. K72A. All bars represent means and error bars represent standard deviation. *p
    Figure Legend Snippet: Ingestion does not require DrpB. A, Representative images for aberrant secretion of MIC3 into the PV lumen in ddGFP-DrpB K72A parasites with the addition of Shield-1 (Sh-1), but not the vehicle control ethanol (EtOH). Synchronously-infected cells were treated with 1 μM Sh-1 or the vehicle control ethanol (EtOH) for 5 h, partially permeablized with 0.02% saponin to allow staining of the PV lumen, but not the parasite interior, and stained with antibodies against MIC3 and against the dense granule protein TgPI-1 as a positive control for PV lumen staining. Scale bars: 2 μm. B, Quantitation of aberrant MIC3 secretion into the PV lumen in ddGFP-DrpB K72A parasites treated as in A with 1μM Shield-1 (Sh-1) for the last 2, 3 or 5 h of infection or 5 h for ethanol (EtOH). Shown is percentage of TgPI-1 + vacuoles that are MIC3 + , treated with 0.2% DMSO or 200 μM LHVS for 30 min and 0.1% EtOH or 1μM Sh-1 for the indicated amounts of time in C and 3 h in D. Shown is percentage of mCherry positive parasites, with at least 200 parasites analyzed for each of 2 biological replicates for DMSO+Shield-1 in C, and at least 3 biological replicates for all other samples. One-way ANOVA with Dunnet’s test for multiple comparisons of LHVS+EtOH treated samples to the DMSO+EtOH treated control are not shown, but all comparisons are significant. Unpaired, two-sample t-tests for comparison of EtOH and Sh-1 treated samples shown. E, Quantitation of colocalization of ingested mCherry with GFP-DrpB K72A, proM2AP and CPL by antibody staining, or the apicoplast by DAPI staining in LHVS-treated ddGFP-DrpB K72A parasites from D. At least 30 ingested mCherry puncta were analyzed per marker for each of 4 biological replicates for CPL and 3 biological replicates for all other markers. One-way ANOVA with Dunnet’s test for multiple comparisons of EtOH treated samples to the apicoplast are not shown, but proM2AP and CPL comparisons are significant. Unpaired two-sample t-tests for comparison of EtOH and Sh-1 treated samples for each marker and comparison of the apicoplast and ddGFP-DrpB K72A in Sh-1 treated parasites shown. F, Quantitation of colocalization of CPL with the indicated markers by antibody staining in intracellular ddGFP-DrpB K72A parasites synchronously invaded into HFF cells, treated with 0.1% EtOH or 1μM Sh-1 for 3 h and fixed at 3 h post-invasion. At least 40 CPL puncta analyzed per marker for each of 3 biological replicates. Unpaired two-sample t-tests for comparison of EtOH and Sh-1 treated samples. G and H, Representative images for colocalization of ddGFP-DrpB WT or ddGFP-DrpB K72A with the indicated markers by antibody staining, quantitated in I. White arrows indicate regions of colocalization. Scale bars: 5 μm. I, Quantitation of colocalization of Sh-1 treated ddGFP-DrpB WT or ddGFP-DrpB K72A with the indicated endolysosomal markers by antibody staining or the apicoplast by DAPI staining in intracellular parasites treated as in F with ddGFP-DrpB WT parasites treated with 0.8 μM Sh-1 for 30 min and ddGFP-DrpB K72A parasites treated with 1.0 μM Sh-1 for 3 h. At least 40 DrpB puncta analyzed per marker, per replicate for 3 biological replicates. One-way ANOVA with Dunnet’s test for multiple comparisons of each marker to the apicoplast for each ddGFP-DrpB WT and ddGFP-DrpB K72A parasites, only significant results shown. Unpaired two-sample t-tests for comparison of localization in ddGFP-DrpB WT vs. K72A. All bars represent means and error bars represent standard deviation. *p

    Techniques Used: Infection, Staining, Positive Control, Quantitation Assay, Marker, Standard Deviation

    2) Product Images from "The regulatory factor X protein MoRfx1 is required for development and pathogenicity in the rice blast fungus Magnaporthe oryzae"

    Article Title: The regulatory factor X protein MoRfx1 is required for development and pathogenicity in the rice blast fungus Magnaporthe oryzae

    Journal: Molecular Plant Pathology

    doi: 10.1111/mpp.12461

    Localization and expression pattern of MoRfx1 in Magnaporthe oryzae . (A) Co‐localization of MoRfx1‐GFP and H2B‐mCherry fusion proteins in the hyphal cells of the wild‐type. Bar, 10 μm. (B) Expression of MoRFX1 in eight developmental stages of the wild‐type: VH, mycelia grown in liquid complete medium (CM); VH‐S, mycelia grown in liquid CM and then cultured in H 2 O for 4 h; VH‐D, mycelia grown on CM plates in the dark; VH‐L, mycelia grown on CM plates under continuous light; CO, conidia; AP‐4h, appressoria at 4 h post‐inoculation (hpi); AP‐18h, appressoria at 18 hpi; IH, invasive hyphae in barley at 2 days post‐inoculation (dpi).
    Figure Legend Snippet: Localization and expression pattern of MoRfx1 in Magnaporthe oryzae . (A) Co‐localization of MoRfx1‐GFP and H2B‐mCherry fusion proteins in the hyphal cells of the wild‐type. Bar, 10 μm. (B) Expression of MoRFX1 in eight developmental stages of the wild‐type: VH, mycelia grown in liquid complete medium (CM); VH‐S, mycelia grown in liquid CM and then cultured in H 2 O for 4 h; VH‐D, mycelia grown on CM plates in the dark; VH‐L, mycelia grown on CM plates under continuous light; CO, conidia; AP‐4h, appressoria at 4 h post‐inoculation (hpi); AP‐18h, appressoria at 18 hpi; IH, invasive hyphae in barley at 2 days post‐inoculation (dpi).

    Techniques Used: Expressing, Cell Culture

    3) Product Images from "Organelle-specific Subunit Interactions of the Vertebrate Two-pore Channel Family *"

    Article Title: Organelle-specific Subunit Interactions of the Vertebrate Two-pore Channel Family *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M114.610493

    Subcellular localization of hTPC1 stably expressed in HEK293 cells. A–F , stable cell lines were made in HEK293 cells using mCherry-tagged hTPC1 ( red ) and GFP-tagged organelle markers ( green ). The upper panels of each image show a GFP-labeled organelle ( left ) and mCherry-labeled hTPC1 ( right ). G , a stable HEK293 cell line that expressed GFP-hTPC1 ( green ; left ) and mCherry-hTPC2 ( red ; right ). The lower panels for all images show a merged image (colocalization in yellow ; left ) and a bright-field image for the cell (differential interference contrast; right ). Scale bars = 10 μm. H , Pearson coefficients for cells exemplified in A–G . Data are means ± S.E. of three cells for each pair. TfR , transferrin receptor.
    Figure Legend Snippet: Subcellular localization of hTPC1 stably expressed in HEK293 cells. A–F , stable cell lines were made in HEK293 cells using mCherry-tagged hTPC1 ( red ) and GFP-tagged organelle markers ( green ). The upper panels of each image show a GFP-labeled organelle ( left ) and mCherry-labeled hTPC1 ( right ). G , a stable HEK293 cell line that expressed GFP-hTPC1 ( green ; left ) and mCherry-hTPC2 ( red ; right ). The lower panels for all images show a merged image (colocalization in yellow ; left ) and a bright-field image for the cell (differential interference contrast; right ). Scale bars = 10 μm. H , Pearson coefficients for cells exemplified in A–G . Data are means ± S.E. of three cells for each pair. TfR , transferrin receptor.

    Techniques Used: Stable Transfection, Labeling

    Subcellular localization of hTPC2 stably expressed in HEK293 cells. A–G , stable cell lines were made in HEK293 cells using mCherry-tagged hTPC2 ( red ) and GFP-tagged organelle markers ( green ). The upper panels of each image show a GFP-labeled organelle ( left ) and mCherry-labeled hTPC2 ( right ). The lower panels show a merged image (colocalization in yellow ; left ) and a bright-field image for the cell ( right ). Scale bars = 10 μm. H , Pearson coefficients for cells exemplified in A–G . Data are means ± S.E. of three cells for each pair. TfR , transferrin receptor.
    Figure Legend Snippet: Subcellular localization of hTPC2 stably expressed in HEK293 cells. A–G , stable cell lines were made in HEK293 cells using mCherry-tagged hTPC2 ( red ) and GFP-tagged organelle markers ( green ). The upper panels of each image show a GFP-labeled organelle ( left ) and mCherry-labeled hTPC2 ( right ). The lower panels show a merged image (colocalization in yellow ; left ) and a bright-field image for the cell ( right ). Scale bars = 10 μm. H , Pearson coefficients for cells exemplified in A–G . Data are means ± S.E. of three cells for each pair. TfR , transferrin receptor.

    Techniques Used: Stable Transfection, Labeling

    Interaction between hTPC2 and other TPC isoforms when coexpressed in HEK293 cells. A , expression levels detected by immunoblotting ( IB ) of HA-hTPC2 ( upper panel ), mCherry ( middle left panel ), and mCherry-tagged TPC isoforms ( middle right panel ) in stable HA-hTPC2 cells transiently transfected with the cDNA for mCherry ( vec ) and N-terminal mCherry-tagged hTPC1 ( h1 ), hTPC2 ( h2 ), rTPC3 ( r3 ), or cTPC3 ( c3 ). Actin was used as a loading control ( lower panel ). B , co-IP of HA-hTPC2 by the anti-mCherry antibody. The immunoprecipitants were left untreated ( left panel ) or treated with PNGase F ( right panel ). Samples from mCherry-hTPC2-transfected cells ( h2 ) were loaded as 1/10 ( h2/10 ) and equivalent (h2) amounts compared with the other samples for immunoblotting. Open triangles indicate possible dimers. The filled arrowhead indicates reduced size of possible dimers after deglycosylation by PNGase F. Open arrows indicate the ∼85-kDa band mostly unaffected by PNGase F except for the mCherry-hTPC2-transfected cell samples. The filled arrow indicates the reduced size from the ∼85-kDa band. C , FRET efficiency between GFP and mCherry in HEK293 cells that coexpressed GFP-tagged hTPC2 (either N- or C-terminal tag) and N-terminal mCherry-tagged TPC isoforms as indicated. Data are means ± S.E. for the number of cells indicated in parentheses . ***, p
    Figure Legend Snippet: Interaction between hTPC2 and other TPC isoforms when coexpressed in HEK293 cells. A , expression levels detected by immunoblotting ( IB ) of HA-hTPC2 ( upper panel ), mCherry ( middle left panel ), and mCherry-tagged TPC isoforms ( middle right panel ) in stable HA-hTPC2 cells transiently transfected with the cDNA for mCherry ( vec ) and N-terminal mCherry-tagged hTPC1 ( h1 ), hTPC2 ( h2 ), rTPC3 ( r3 ), or cTPC3 ( c3 ). Actin was used as a loading control ( lower panel ). B , co-IP of HA-hTPC2 by the anti-mCherry antibody. The immunoprecipitants were left untreated ( left panel ) or treated with PNGase F ( right panel ). Samples from mCherry-hTPC2-transfected cells ( h2 ) were loaded as 1/10 ( h2/10 ) and equivalent (h2) amounts compared with the other samples for immunoblotting. Open triangles indicate possible dimers. The filled arrowhead indicates reduced size of possible dimers after deglycosylation by PNGase F. Open arrows indicate the ∼85-kDa band mostly unaffected by PNGase F except for the mCherry-hTPC2-transfected cell samples. The filled arrow indicates the reduced size from the ∼85-kDa band. C , FRET efficiency between GFP and mCherry in HEK293 cells that coexpressed GFP-tagged hTPC2 (either N- or C-terminal tag) and N-terminal mCherry-tagged TPC isoforms as indicated. Data are means ± S.E. for the number of cells indicated in parentheses . ***, p

    Techniques Used: Expressing, Transfection, Co-Immunoprecipitation Assay

    Different subcellular localizations of cTPC3 and rTPC3 when stably expressed in HEK293 cells. Stable cell lines were made in HEK293 cells using mCherry-tagged ( red ) cTPC3 ( A ) or rTPC3 ( B ) and GFP-tagged organelle markers ( green ). The upper panels of each image show a GFP-labeled organelle ( left ) and mCherry-labeled TPC3 ( right ). The lower panels show a merged image (colocalization in yellow ; left ) and a bright-field image ( right ). Scale bars = 10 μm. Pearson coefficients for cells exemplified in the images are shown on the right. Data are means ± S.E. of three cells for each pair. TfR , transferrin receptor.
    Figure Legend Snippet: Different subcellular localizations of cTPC3 and rTPC3 when stably expressed in HEK293 cells. Stable cell lines were made in HEK293 cells using mCherry-tagged ( red ) cTPC3 ( A ) or rTPC3 ( B ) and GFP-tagged organelle markers ( green ). The upper panels of each image show a GFP-labeled organelle ( left ) and mCherry-labeled TPC3 ( right ). The lower panels show a merged image (colocalization in yellow ; left ) and a bright-field image ( right ). Scale bars = 10 μm. Pearson coefficients for cells exemplified in the images are shown on the right. Data are means ± S.E. of three cells for each pair. TfR , transferrin receptor.

    Techniques Used: Stable Transfection, Labeling

    4) Product Images from "Removal of Hepatitis C Virus-Infected Cells by a Zymogenized Bacterial Toxin"

    Article Title: Removal of Hepatitis C Virus-Infected Cells by a Zymogenized Bacterial Toxin

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0032320

    Inhibition of de-novo protein synthesis by NS3-activated MazF based zymoxin in NS3-expressing cells. 1×10 5 Tet-NS3/activated MazF or Tet-NS3/uncleavable MazF cells were seeded per well in 24-wells plate. 24 or 48 h later, cells were supplemented with tetracycline to a final concentration of 1000 ng/ml, or left untreated (48 h tet, 24 h tet and no tet, respectively). 72 h after seeding, levels of de-novo protein synthesis were determined by [ 3 H]-leucine incorporation assay, as described in “ materials and methods ”. Results are expressed as percent of the value obtained for cells which were not induced to express the NS3 protease (No tet). Each bar represents the mean ± SD of a set of data determined in triplicates. Numbers above each bar represent mean counts per minute (CPM) values for 7 micrograms total protein samples (upper panel). 30 micrograms of total protein from lysates of the described cells were analyzed by immunoblotting with mouse anti-mCherry (for detection of the zymoxin), mouse anti-GFP (for the detection of EGFP-NS3) and mouse anti actin antibodies (loading control) followed by HRP-conjugated secondary antibodies and ECL development. Solid arrow: full length zymoxin. Hollow arrow: N' terminal portion of NS3-cleaved zymoxin (lower panel).
    Figure Legend Snippet: Inhibition of de-novo protein synthesis by NS3-activated MazF based zymoxin in NS3-expressing cells. 1×10 5 Tet-NS3/activated MazF or Tet-NS3/uncleavable MazF cells were seeded per well in 24-wells plate. 24 or 48 h later, cells were supplemented with tetracycline to a final concentration of 1000 ng/ml, or left untreated (48 h tet, 24 h tet and no tet, respectively). 72 h after seeding, levels of de-novo protein synthesis were determined by [ 3 H]-leucine incorporation assay, as described in “ materials and methods ”. Results are expressed as percent of the value obtained for cells which were not induced to express the NS3 protease (No tet). Each bar represents the mean ± SD of a set of data determined in triplicates. Numbers above each bar represent mean counts per minute (CPM) values for 7 micrograms total protein samples (upper panel). 30 micrograms of total protein from lysates of the described cells were analyzed by immunoblotting with mouse anti-mCherry (for detection of the zymoxin), mouse anti-GFP (for the detection of EGFP-NS3) and mouse anti actin antibodies (loading control) followed by HRP-conjugated secondary antibodies and ECL development. Solid arrow: full length zymoxin. Hollow arrow: N' terminal portion of NS3-cleaved zymoxin (lower panel).

    Techniques Used: Inhibition, Expressing, Concentration Assay

    Eradication of HCV-infected hepatocytes by recombinant-adenovirus delivered MazF based zymoxin. 3×10 4 cells from mixed HCV infected and uninfected culture (at 1∶1 ratio) were seeded per well into 8-well chamber slides. 24 h later, cells were treated with recombinant adenoviruses (MOI of ∼3) encoding for the mCherry fused NS3-activated MazF or uncleavable-MazF zymoxins. Control cells remained untreated. 72 h post treatment, cells were fixed, permeabilized and immunostained with mouse anti-HCV core and FITC-conjugated goat anti mouse antibodies for visualization of infected cells (green). Cell nuclei were then stained with DAPI (cyan) and slides were visualized by fluorescence microscopy. The bar represents 100 µm (upper panel). The fraction (given in percentage) of HCV-infected cells from the general cell population was evaluated, for each treatment, by dividing the number of the green, HCV-core positive cells by the general number of cells (DAPI stained) (lower panel). Each bar represents the mean ±SD of a set of data collected from five representative microscopic fields. Numbers in brackets represent the percentage of the HCV-infected cells in each treatment relatively to their percentage in the untreated culture.
    Figure Legend Snippet: Eradication of HCV-infected hepatocytes by recombinant-adenovirus delivered MazF based zymoxin. 3×10 4 cells from mixed HCV infected and uninfected culture (at 1∶1 ratio) were seeded per well into 8-well chamber slides. 24 h later, cells were treated with recombinant adenoviruses (MOI of ∼3) encoding for the mCherry fused NS3-activated MazF or uncleavable-MazF zymoxins. Control cells remained untreated. 72 h post treatment, cells were fixed, permeabilized and immunostained with mouse anti-HCV core and FITC-conjugated goat anti mouse antibodies for visualization of infected cells (green). Cell nuclei were then stained with DAPI (cyan) and slides were visualized by fluorescence microscopy. The bar represents 100 µm (upper panel). The fraction (given in percentage) of HCV-infected cells from the general cell population was evaluated, for each treatment, by dividing the number of the green, HCV-core positive cells by the general number of cells (DAPI stained) (lower panel). Each bar represents the mean ±SD of a set of data collected from five representative microscopic fields. Numbers in brackets represent the percentage of the HCV-infected cells in each treatment relatively to their percentage in the untreated culture.

    Techniques Used: Infection, Recombinant, Staining, Fluorescence, Microscopy

    Treatment of HCV infected/uninfected mixed cell culture with recombinant adenovirus-delivered MazF based zymoxin. Uninfected (HCV-negative) Huh7.5 cells and a mixed culture of HCV infected and uninfected cells at 1∶1 ratio (50% infected culture) were seeded in 96-well plates (1×10 4 cells/well). After 24 h, cells were treated with recombinant adenoviruses (MOI of ∼3) encoding for the mCherry fused NS3-activated MazF or uncleavable-MazF zymoxins. Control cells remained untreated. Upper panel: MTT viability assay: 72 h post treatment, the fraction of viable cells (relatively to untreated controls) was determined using an enzymatic MTT assay. A representative graph of three independent experiments is shown. Each bar represents the mean ±SD of a set of data determined in triplicates. Lower panel: Microscopic examination: 72 h post treatment, the uninfected (HCV-negative) Huh7.5 cells, the mixed culture of HCV infected and uninfected cells and the control untreated cells were fixed and subjected to microscopic examination. Hollow arrows point to cells that are characterized by a “typical” Huh7.5 cell morphology. Filled arrows point to partially detached cells with round, condensed or distorted shape. The bar represents 200 µm.
    Figure Legend Snippet: Treatment of HCV infected/uninfected mixed cell culture with recombinant adenovirus-delivered MazF based zymoxin. Uninfected (HCV-negative) Huh7.5 cells and a mixed culture of HCV infected and uninfected cells at 1∶1 ratio (50% infected culture) were seeded in 96-well plates (1×10 4 cells/well). After 24 h, cells were treated with recombinant adenoviruses (MOI of ∼3) encoding for the mCherry fused NS3-activated MazF or uncleavable-MazF zymoxins. Control cells remained untreated. Upper panel: MTT viability assay: 72 h post treatment, the fraction of viable cells (relatively to untreated controls) was determined using an enzymatic MTT assay. A representative graph of three independent experiments is shown. Each bar represents the mean ±SD of a set of data determined in triplicates. Lower panel: Microscopic examination: 72 h post treatment, the uninfected (HCV-negative) Huh7.5 cells, the mixed culture of HCV infected and uninfected cells and the control untreated cells were fixed and subjected to microscopic examination. Hollow arrows point to cells that are characterized by a “typical” Huh7.5 cell morphology. Filled arrows point to partially detached cells with round, condensed or distorted shape. The bar represents 200 µm.

    Techniques Used: Infection, Cell Culture, Recombinant, MTT Assay, Viability Assay

    Eradication of NS3-expressing Huh7.5 cells by recombinant adenovirus-mediated delivery of mCherry-NS3 activated MazF encoding cassette. 1×10 4 wild-type (W.T) or EGFP-full NS3-4A expressing Huh7.5 cells were seeded per well in 96 well plates. After 24 h, recombinant adenoviruses encoding for mCherry-fused NS3 activated MazF or uncleavable-MazF zymoxins were added at the indicated MOI's. Control cells remained untreated. (A) MTT viability assay: 4 days post infection, the fraction of viable cells (relatively to uninfected controls) was determined using an enzymatic MTT assay. A representative graph of three independent experiments is shown. Each bar represents the mean ±SD of a set of data determined in triplicates. (B) Microscopic examination: 4 days post infection, wild-type (lower panel) or EGFP-full NS3-4A expressing Huh7.5 cells (upper panel), uninfected or infected with recombinant adenoviruses encoding for mCherry fused NS3-activated MazF zymoxin (at MOI of ∼3), were fixed and subjected to microscopic examination. The bar represents 200 µm.
    Figure Legend Snippet: Eradication of NS3-expressing Huh7.5 cells by recombinant adenovirus-mediated delivery of mCherry-NS3 activated MazF encoding cassette. 1×10 4 wild-type (W.T) or EGFP-full NS3-4A expressing Huh7.5 cells were seeded per well in 96 well plates. After 24 h, recombinant adenoviruses encoding for mCherry-fused NS3 activated MazF or uncleavable-MazF zymoxins were added at the indicated MOI's. Control cells remained untreated. (A) MTT viability assay: 4 days post infection, the fraction of viable cells (relatively to uninfected controls) was determined using an enzymatic MTT assay. A representative graph of three independent experiments is shown. Each bar represents the mean ±SD of a set of data determined in triplicates. (B) Microscopic examination: 4 days post infection, wild-type (lower panel) or EGFP-full NS3-4A expressing Huh7.5 cells (upper panel), uninfected or infected with recombinant adenoviruses encoding for mCherry fused NS3-activated MazF zymoxin (at MOI of ∼3), were fixed and subjected to microscopic examination. The bar represents 200 µm.

    Techniques Used: Expressing, Recombinant, MTT Assay, Viability Assay, Infection

    Eradication of NS3 expressing cells by mCherry-NS3 activated MazF. Upper panel: Tet-inducible full NS3-4A (No MazF), Tet-NS3/activated MazF (NS3-activated MazF) or Tet-NS3/uncleavable MazF (uncleavable MazF) cells were seeded in 96 well plates (2×10 4 cells per well). After 24 h, cells were supplemented with 3 fold dilutions of tetracycline starting with concentration of 1000 ng/ml, or left untreated. 72 hours later, the fraction of viable cells (relatively to the untreated controls) was determined using an enzymatic MTT assay. Each bar represents the mean ±SD of a set of data from six wells. Lower panel: 30 ng of total protein from lysates of Tet-NS3/uncleavable MazF cells that were supplemented with 3 fold dilutions of tetracycline for 48 h were analyzed by immunoblotting with mouse anti-GFP (for the detection of EGFP-NS3) and mouse anti-actin antibodies (loading control) followed by HRP-conjugated secondary antibodies and ECL development.
    Figure Legend Snippet: Eradication of NS3 expressing cells by mCherry-NS3 activated MazF. Upper panel: Tet-inducible full NS3-4A (No MazF), Tet-NS3/activated MazF (NS3-activated MazF) or Tet-NS3/uncleavable MazF (uncleavable MazF) cells were seeded in 96 well plates (2×10 4 cells per well). After 24 h, cells were supplemented with 3 fold dilutions of tetracycline starting with concentration of 1000 ng/ml, or left untreated. 72 hours later, the fraction of viable cells (relatively to the untreated controls) was determined using an enzymatic MTT assay. Each bar represents the mean ±SD of a set of data from six wells. Lower panel: 30 ng of total protein from lysates of Tet-NS3/uncleavable MazF cells that were supplemented with 3 fold dilutions of tetracycline for 48 h were analyzed by immunoblotting with mouse anti-GFP (for the detection of EGFP-NS3) and mouse anti-actin antibodies (loading control) followed by HRP-conjugated secondary antibodies and ECL development.

    Techniques Used: Expressing, Concentration Assay, MTT Assay

    Colony formation assay for the assessment of “mCherry-NS3 activated MazF” cytotoxicity toward naïve cells. A day before transfection, 7.5×10 5 HEK293 T-REx cells where seeded per well in 6 wells plate and subsequently transfected with 2 µg of plasmids encoding either mCherry-NS3 activated MazF, mCherry (only the fluorescent protein) or EGFP- MazF (where MazF is not fused to its inhibitory peptide). 48 hours later, transfection efficiency was assessed by fluorescence microscopy and was determined as equal between the plasmids. Transfected cells were than trypsinized, counted and seeded in 3 fold dilutions (starting from 150,000 cells/well) in 6 well plates and were incubated for 10 days in the presence of 1 mg/ml of G418 (to which all three plasmids confer resistance). Surviving colonies were fixed and stained with Giemsa (upper panel). Number of surviving Colonies from wells that were seeded with 5556 cells was determined by manual counting. Each bar represents the mean ± standard deviation (SD) of a set of data from two wells (lower panel).
    Figure Legend Snippet: Colony formation assay for the assessment of “mCherry-NS3 activated MazF” cytotoxicity toward naïve cells. A day before transfection, 7.5×10 5 HEK293 T-REx cells where seeded per well in 6 wells plate and subsequently transfected with 2 µg of plasmids encoding either mCherry-NS3 activated MazF, mCherry (only the fluorescent protein) or EGFP- MazF (where MazF is not fused to its inhibitory peptide). 48 hours later, transfection efficiency was assessed by fluorescence microscopy and was determined as equal between the plasmids. Transfected cells were than trypsinized, counted and seeded in 3 fold dilutions (starting from 150,000 cells/well) in 6 well plates and were incubated for 10 days in the presence of 1 mg/ml of G418 (to which all three plasmids confer resistance). Surviving colonies were fixed and stained with Giemsa (upper panel). Number of surviving Colonies from wells that were seeded with 5556 cells was determined by manual counting. Each bar represents the mean ± standard deviation (SD) of a set of data from two wells (lower panel).

    Techniques Used: Colony Assay, Transfection, Fluorescence, Microscopy, Incubation, Staining, Standard Deviation

    Schematic representation of the construct “mCherry-NS3 activated MazF” and hypothetical mechanism of activation by NS3 protease. The NS3-activated MazF zymoxin was constructed by fusing 5 elements in the following order (from the N terminus): monomeric red fluorescence protein mCherry, E. coli MazF ribonuclease, HCV P10-P10' NS3 cleavage sequence derived from 2a genotype (strain JFH1) NS5A/B junction, a short inhibitory peptide corresponding to MazE C-terminal 35 amino-acids (which encompass the 23 amino-acids inhibitory peptide (MazEp) that has been described by Li et al. [25] ) and the C-terminal ER membrane anchor of the tyrosine phosphatase PTP1B [28] . After being anchored to the ER membrane, the NS3 cleavage site that is located between the ribonuclease and the inhibitory peptide in the “mCherry-NS3 activated MazF” construct (which is active as a dimer but for convenience is illustrated here in its monomeric form) is cleaved by the HCV- NS3 protease which is also localized to the cytoplasmic side of the ER membrane. The toxic ribonuclease, no longer covalently tethered to its ER-anchored inhibitor, is now free to diffuse to the cytoplasm (which lacks the antidote) and exert its destructive activity.
    Figure Legend Snippet: Schematic representation of the construct “mCherry-NS3 activated MazF” and hypothetical mechanism of activation by NS3 protease. The NS3-activated MazF zymoxin was constructed by fusing 5 elements in the following order (from the N terminus): monomeric red fluorescence protein mCherry, E. coli MazF ribonuclease, HCV P10-P10' NS3 cleavage sequence derived from 2a genotype (strain JFH1) NS5A/B junction, a short inhibitory peptide corresponding to MazE C-terminal 35 amino-acids (which encompass the 23 amino-acids inhibitory peptide (MazEp) that has been described by Li et al. [25] ) and the C-terminal ER membrane anchor of the tyrosine phosphatase PTP1B [28] . After being anchored to the ER membrane, the NS3 cleavage site that is located between the ribonuclease and the inhibitory peptide in the “mCherry-NS3 activated MazF” construct (which is active as a dimer but for convenience is illustrated here in its monomeric form) is cleaved by the HCV- NS3 protease which is also localized to the cytoplasmic side of the ER membrane. The toxic ribonuclease, no longer covalently tethered to its ER-anchored inhibitor, is now free to diffuse to the cytoplasm (which lacks the antidote) and exert its destructive activity.

    Techniques Used: Construct, Activation Assay, Fluorescence, Sequencing, Derivative Assay, Activity Assay

    Expression of mCherry-NS3 activated MazF results in growth inhibition and morphological changes in NS3-expressing cells. 1×10 5 Tet-NS3/activated MazF or Tet-NS3/uncleavable MazF cells were seeded on poly-L-lysine coated cover-slips in a 24 well-plate. 12 h later, cells were supplemented with 10 ng/ml or 1000 ng/ml of tetracycline, or left untreated. 36 h later, cells were fixed. Following nuclear staining by Hoechst 33258 (Blue), slides were examined by fluorescence microscopy. The bar represents 50 µm.
    Figure Legend Snippet: Expression of mCherry-NS3 activated MazF results in growth inhibition and morphological changes in NS3-expressing cells. 1×10 5 Tet-NS3/activated MazF or Tet-NS3/uncleavable MazF cells were seeded on poly-L-lysine coated cover-slips in a 24 well-plate. 12 h later, cells were supplemented with 10 ng/ml or 1000 ng/ml of tetracycline, or left untreated. 36 h later, cells were fixed. Following nuclear staining by Hoechst 33258 (Blue), slides were examined by fluorescence microscopy. The bar represents 50 µm.

    Techniques Used: Expressing, Inhibition, Staining, Fluorescence, Microscopy

    5) Product Images from "Adenosine Deaminase Acting on RNA 1 Associates with Orf Virus OV20.0 and Enhances Viral Replication"

    Article Title: Adenosine Deaminase Acting on RNA 1 Associates with Orf Virus OV20.0 and Enhances Viral Replication

    Journal: Journal of Virology

    doi: 10.1128/JVI.01912-18

    Cellular distribution of ADAR1 in the presence of OV20.0. The expression of endogenous ADAR1 and ADAR1 fused with mCherry was determined by an immunofluorescence assay using an ADAR1 antibody or autofluorescence, respectively. The molecular weight and integrity of mCherry (lane 1) and ADAR1-mCherry (lane 2) were determined by Western blot analysis using an mCherry antibody. (B) Colocalization of ORFV OV20.0 isoforms with ADAR1. HEK 293T cells were cotransfected with one of the eGFP-tagged OV20.0 variants (K20-eGFP, sh20-eGFP, or ΔC-eGFP) and the ADAR1-mCherry constructs. The cellular distribution of ADAR1 and OV20.0 was examined by fluorescence microscopy. White arrows indicate cytoplasmic distribution of ADAR1.
    Figure Legend Snippet: Cellular distribution of ADAR1 in the presence of OV20.0. The expression of endogenous ADAR1 and ADAR1 fused with mCherry was determined by an immunofluorescence assay using an ADAR1 antibody or autofluorescence, respectively. The molecular weight and integrity of mCherry (lane 1) and ADAR1-mCherry (lane 2) were determined by Western blot analysis using an mCherry antibody. (B) Colocalization of ORFV OV20.0 isoforms with ADAR1. HEK 293T cells were cotransfected with one of the eGFP-tagged OV20.0 variants (K20-eGFP, sh20-eGFP, or ΔC-eGFP) and the ADAR1-mCherry constructs. The cellular distribution of ADAR1 and OV20.0 was examined by fluorescence microscopy. White arrows indicate cytoplasmic distribution of ADAR1.

    Techniques Used: Expressing, Immunofluorescence, Molecular Weight, Western Blot, Construct, Fluorescence, Microscopy

    OV20.0 interferes with ADAR1-dependent A-to-I-editing activity. (A) An illustration of the mCherry-based reporter system for monitoring A-to-I-editing activity. The GluR-B amber/W editing site, which contains target sequences for ADAR1-mediated RNA editing, was inserted near the C terminus of the mCherry coding region. The built-in UAG codon insertion leads to the translation of a truncated version of mCherry, while the ADAR1 enzyme likely converts A to I to yield full-length mCherry. (B) The ADAR1 enzyme edits the sequence of the reporter transcript in a dose-dependent manner. HEK 293T cells were transfected with the reporter plasmid, along with increasing amounts of HA-tagged ADAR1 (0, 0.2, 0.4, and 0.8 μg). At 24 h after transfection, A-to-I-editing activity was assessed by Western blot analysis using antibodies against HA and mCherry. (C) The effect of OV20.0 on ADAR1-mediated A-to-I editing. HEK 293T cells were cotransfected with the mCherry reporter plasmid and HA-tagged ADAR1 alone or with FLAG-tagged OV20.0 for 24 h. (D) The effect of OV20.0 on A-to-I-editing activity was measured based on the ratio of edited to the total of unedited plus edited products with increasing amounts of OV20.0 (as labeled) in the presence of ADAR1. The experiment was conducted with three independent repeats. **, P
    Figure Legend Snippet: OV20.0 interferes with ADAR1-dependent A-to-I-editing activity. (A) An illustration of the mCherry-based reporter system for monitoring A-to-I-editing activity. The GluR-B amber/W editing site, which contains target sequences for ADAR1-mediated RNA editing, was inserted near the C terminus of the mCherry coding region. The built-in UAG codon insertion leads to the translation of a truncated version of mCherry, while the ADAR1 enzyme likely converts A to I to yield full-length mCherry. (B) The ADAR1 enzyme edits the sequence of the reporter transcript in a dose-dependent manner. HEK 293T cells were transfected with the reporter plasmid, along with increasing amounts of HA-tagged ADAR1 (0, 0.2, 0.4, and 0.8 μg). At 24 h after transfection, A-to-I-editing activity was assessed by Western blot analysis using antibodies against HA and mCherry. (C) The effect of OV20.0 on ADAR1-mediated A-to-I editing. HEK 293T cells were cotransfected with the mCherry reporter plasmid and HA-tagged ADAR1 alone or with FLAG-tagged OV20.0 for 24 h. (D) The effect of OV20.0 on A-to-I-editing activity was measured based on the ratio of edited to the total of unedited plus edited products with increasing amounts of OV20.0 (as labeled) in the presence of ADAR1. The experiment was conducted with three independent repeats. **, P

    Techniques Used: Activity Assay, Sequencing, Transfection, Plasmid Preparation, Western Blot, Labeling

    6) Product Images from "Rapalogs can promote cancer cell stemness in vitro in a Galectin-1 and H-ras-dependent manner"

    Article Title: Rapalogs can promote cancer cell stemness in vitro in a Galectin-1 and H-ras-dependent manner

    Journal: Oncotarget

    doi: 10.18632/oncotarget.17819

    A galectin-1-dependent FKBP12 rescue-loop is activated upon rapalog-induced FKBP12 downmodulation (A and B) Nanoclustering-FRET analysis in FKBP12 knockdown/overexpressing HEK cells co-expressing mGFP- and mCherry-tagged (A) H-rasG12V or (B) K-rasG12V. The numbers in the bars indicate the number of analyzed cells (mean ± SEM, n=4). (C and D) Western blot analysis in HEK cells transfected with the indicated FKBP12 or Gal-1 siRNAs, and in addition expressing (C) mGFP-H-rasG12V or (D) mGFP-K-rasG12V. Control is transfected with empty vector, while pcDNA marks exogenous expression of protein indicated on top of the blots. Numbers indicate β-actin normalized protein levels (n=4). (E and F) Western blot analysis of Ras and mTORC1 signaling in HEK cells expressing (E) mGFP-H-rasG12V or (F) mGFP-K-rasG12V under indicated FKBP12 or Gal-1 manipulations as in (C and D) . Numbers indicate the ratio of phosphorylated to respective total protein levels (n=3).
    Figure Legend Snippet: A galectin-1-dependent FKBP12 rescue-loop is activated upon rapalog-induced FKBP12 downmodulation (A and B) Nanoclustering-FRET analysis in FKBP12 knockdown/overexpressing HEK cells co-expressing mGFP- and mCherry-tagged (A) H-rasG12V or (B) K-rasG12V. The numbers in the bars indicate the number of analyzed cells (mean ± SEM, n=4). (C and D) Western blot analysis in HEK cells transfected with the indicated FKBP12 or Gal-1 siRNAs, and in addition expressing (C) mGFP-H-rasG12V or (D) mGFP-K-rasG12V. Control is transfected with empty vector, while pcDNA marks exogenous expression of protein indicated on top of the blots. Numbers indicate β-actin normalized protein levels (n=4). (E and F) Western blot analysis of Ras and mTORC1 signaling in HEK cells expressing (E) mGFP-H-rasG12V or (F) mGFP-K-rasG12V under indicated FKBP12 or Gal-1 manipulations as in (C and D) . Numbers indicate the ratio of phosphorylated to respective total protein levels (n=3).

    Techniques Used: Expressing, Western Blot, Transfection, Plasmid Preparation

    Rapalogs specifically activate H-ras nanoclustering and can drive PC12 cell differentiation (A) Schematic illustration of the nanoclustering-FRET assay. FRET is increased due to the formation of transiently immobile signaling complexes, which lead to nanoscale clustering of Ras in the plasma membrane. (B) Representative FLIM-FRET images of HEK cells expressing mGFP/mCherry-H-rasG12V or mGFP/mCherry-K-rasG12V FRET pairs. Image color look-up table on the right shows fluorescence lifetimes, with low lifetimes indicating high FRET and high lifetimes indicating low FRET. Scale bar in the images represents approximately 20 μm. (C and D) Nanoclustering-FRET analysis in HEK cells co-expressing mGFP- and mCherry-tagged (C) H-rasG12V or (D) K-rasG12V. Cells were treated for 24 h with DMSO control, 0.5 μM rapamycin or 2 μM everolimus. In addition, co-expression of FRET pairs with Galectin-1 was used for comparison. The numbers in the bars indicate the number of analyzed cells (mean ± SEM, n=3). (E and F) Electron microscopic nanoclustering analysis of BHK cells expressing mGFP-tagged (E) H-rasG12V, (F) K-rasG12V with or without 0.5 μM of rapamycin. Intact apical plasma membrane sheets were immunolabeled with 4.5 nm gold nanoparticles coupled to anti-GFP antibody. The spatial distribution of gold particles was evaluated using univariate K-function, where L(r)–r values indicate the extent of nanoclustering as a function of the length scale, r, in nm. At least 15 images were analysed for each condition. Statistical significance between different conditions was evaluated using bootstrap tests. Averaged curves are shown for each condition. (G) PC12 cells transiently transfected with ( left ) mGFP-H-rasG12V or ( right ) mGFP-K-rasG12V were incubated with DMSO control or 0.5 μM rapamycin. After 72 h, GFP-positive cells were scored for neurites. Results ( top ) are plotted as percent of cells (mean ± SEM, n = 4) with neurite outgrowth > 1.5 times the diameter of the cell body. Representative images of cells ( bottom ) scored for neurites are shown. Bar represents 200 μm.
    Figure Legend Snippet: Rapalogs specifically activate H-ras nanoclustering and can drive PC12 cell differentiation (A) Schematic illustration of the nanoclustering-FRET assay. FRET is increased due to the formation of transiently immobile signaling complexes, which lead to nanoscale clustering of Ras in the plasma membrane. (B) Representative FLIM-FRET images of HEK cells expressing mGFP/mCherry-H-rasG12V or mGFP/mCherry-K-rasG12V FRET pairs. Image color look-up table on the right shows fluorescence lifetimes, with low lifetimes indicating high FRET and high lifetimes indicating low FRET. Scale bar in the images represents approximately 20 μm. (C and D) Nanoclustering-FRET analysis in HEK cells co-expressing mGFP- and mCherry-tagged (C) H-rasG12V or (D) K-rasG12V. Cells were treated for 24 h with DMSO control, 0.5 μM rapamycin or 2 μM everolimus. In addition, co-expression of FRET pairs with Galectin-1 was used for comparison. The numbers in the bars indicate the number of analyzed cells (mean ± SEM, n=3). (E and F) Electron microscopic nanoclustering analysis of BHK cells expressing mGFP-tagged (E) H-rasG12V, (F) K-rasG12V with or without 0.5 μM of rapamycin. Intact apical plasma membrane sheets were immunolabeled with 4.5 nm gold nanoparticles coupled to anti-GFP antibody. The spatial distribution of gold particles was evaluated using univariate K-function, where L(r)–r values indicate the extent of nanoclustering as a function of the length scale, r, in nm. At least 15 images were analysed for each condition. Statistical significance between different conditions was evaluated using bootstrap tests. Averaged curves are shown for each condition. (G) PC12 cells transiently transfected with ( left ) mGFP-H-rasG12V or ( right ) mGFP-K-rasG12V were incubated with DMSO control or 0.5 μM rapamycin. After 72 h, GFP-positive cells were scored for neurites. Results ( top ) are plotted as percent of cells (mean ± SEM, n = 4) with neurite outgrowth > 1.5 times the diameter of the cell body. Representative images of cells ( bottom ) scored for neurites are shown. Bar represents 200 μm.

    Techniques Used: Cell Differentiation, Expressing, Fluorescence, Immunolabeling, Transfection, Incubation

    7) Product Images from "Viral Bcl-2 Encoded by the Kaposi's Sarcoma-Associated Herpesvirus Is Vital for Virus Reactivation"

    Article Title: Viral Bcl-2 Encoded by the Kaposi's Sarcoma-Associated Herpesvirus Is Vital for Virus Reactivation

    Journal: Journal of Virology

    doi: 10.1128/JVI.00098-15

    Comparison of the levels of KSHV gene expression in iSLK cells infected with BAC16 and BAC16-mCherry-vBcl-2. iSLK cells harboring BAC16 and BAC16-mCherry-vBcl-2 were induced to undergo lytic virus reactivation using sodium butyrate and doxycycline. At 0, 48, 72, and 96 h following induction, whole-cell lysates were prepared and protein expression by viral genes was analyzed by immunoblotting with the indicated antibodies against viral proteins, as well as GFP. The same blot was reprobed with anti-tubulin as a loading control. Results from one experiment are shown and are representative of those from two experiments providing similar results.
    Figure Legend Snippet: Comparison of the levels of KSHV gene expression in iSLK cells infected with BAC16 and BAC16-mCherry-vBcl-2. iSLK cells harboring BAC16 and BAC16-mCherry-vBcl-2 were induced to undergo lytic virus reactivation using sodium butyrate and doxycycline. At 0, 48, 72, and 96 h following induction, whole-cell lysates were prepared and protein expression by viral genes was analyzed by immunoblotting with the indicated antibodies against viral proteins, as well as GFP. The same blot was reprobed with anti-tubulin as a loading control. Results from one experiment are shown and are representative of those from two experiments providing similar results.

    Techniques Used: Expressing, Infection

    Comparison of the levels of KSHV DNA replication in iSLK cells infected with wild-type or vBcl-2 stop mutants. High-molecular-weight DNA was extracted at 0, 24, 48, and 72 h postinduction, and the number of KSHV genomes copies relative to the amount of cellular DNA was determined by quantitative TaqMan PCR. Values were normalized to the value for noninduced BAC16 (A) or BAC16-mCherry-vBcl-2 (B), which was defined as 1. The KSHV DNA level was normalized to the level of the human RNase P gene. Results from one experiment are shown and are representative of those from three experiments providing similar results.
    Figure Legend Snippet: Comparison of the levels of KSHV DNA replication in iSLK cells infected with wild-type or vBcl-2 stop mutants. High-molecular-weight DNA was extracted at 0, 24, 48, and 72 h postinduction, and the number of KSHV genomes copies relative to the amount of cellular DNA was determined by quantitative TaqMan PCR. Values were normalized to the value for noninduced BAC16 (A) or BAC16-mCherry-vBcl-2 (B), which was defined as 1. The KSHV DNA level was normalized to the level of the human RNase P gene. Results from one experiment are shown and are representative of those from three experiments providing similar results.

    Techniques Used: Infection, Molecular Weight, Polymerase Chain Reaction

    Reduced production of infectious virions by vBcl-2-stop recombinant viruses. Supernatants from iSLK cells infected with the different BAC16 recombinant viruses (BAC16 and BAC16-vBcl-2-stop [A] or BAC16-mCherry-vBcl-2 and BAC16-mCherry-vBcl-2-stop [B]) were collected at 96 h following lytic induction. Infectious virus titers were determined by FACS analysis of GFP-positive cells. Error bars represent standard deviations from 3 to 4 repeats. Results from one experiment are shown and are representative of those from three experiments providing similar results. IU, infectious units.
    Figure Legend Snippet: Reduced production of infectious virions by vBcl-2-stop recombinant viruses. Supernatants from iSLK cells infected with the different BAC16 recombinant viruses (BAC16 and BAC16-vBcl-2-stop [A] or BAC16-mCherry-vBcl-2 and BAC16-mCherry-vBcl-2-stop [B]) were collected at 96 h following lytic induction. Infectious virus titers were determined by FACS analysis of GFP-positive cells. Error bars represent standard deviations from 3 to 4 repeats. Results from one experiment are shown and are representative of those from three experiments providing similar results. IU, infectious units.

    Techniques Used: Recombinant, Infection, FACS

    Quantification of effects of vBcl-2 on KSHV gene expression by RT-qPCR. RNA was isolated from iSLK cells that were infected with the indicated recombinant viruses (BAC16 and BAC16-vBcl-2-stop [A] or BAC16-mCherry-vBcl-2 and BAC16-mCherry-vBcl-2-stop [B]), and the abundance of specific viral mRNAs ( orf50 [RTA], orf59 , orf65 , orf16 , and beta-actin) was measured by RT-qPCR. Analysis was performed with RNA harvested 24, 48, and 72 h after induction of lytic replication with doxycycline and sodium butyrate, while the corresponding untreated cells were used as controls. Each bar represents the average of the results from three repeats. The fold increase in mRNA abundance after induction relative to the amount of mRNA from wild-type virus at 24 h postinduction, which was defined as 1 after normalization to the amount of beta-actin, is shown. RQ, relative quantity. Results from one experiment are shown and are representative of those from three experiments providing similar results.
    Figure Legend Snippet: Quantification of effects of vBcl-2 on KSHV gene expression by RT-qPCR. RNA was isolated from iSLK cells that were infected with the indicated recombinant viruses (BAC16 and BAC16-vBcl-2-stop [A] or BAC16-mCherry-vBcl-2 and BAC16-mCherry-vBcl-2-stop [B]), and the abundance of specific viral mRNAs ( orf50 [RTA], orf59 , orf65 , orf16 , and beta-actin) was measured by RT-qPCR. Analysis was performed with RNA harvested 24, 48, and 72 h after induction of lytic replication with doxycycline and sodium butyrate, while the corresponding untreated cells were used as controls. Each bar represents the average of the results from three repeats. The fold increase in mRNA abundance after induction relative to the amount of mRNA from wild-type virus at 24 h postinduction, which was defined as 1 after normalization to the amount of beta-actin, is shown. RQ, relative quantity. Results from one experiment are shown and are representative of those from three experiments providing similar results.

    Techniques Used: Expressing, Quantitative RT-PCR, Isolation, Infection, Recombinant

    8) Product Images from "Metastasis-suppressor transcript destabilization through TARBP2 binding of mRNA hairpins"

    Article Title: Metastasis-suppressor transcript destabilization through TARBP2 binding of mRNA hairpins

    Journal: Nature

    doi: 10.1038/nature13466

    In vitro secondary structure probing of the sRSE1 decoy and measuring the functionality of exemplary sRSE variants in reporter systems a, We used a medium-throughput approach to probe the secondary structure of a given sRSE1 decoy sequence (see Methods). Shown here are in silico and in vitro secondary structure prediction for a functional sRSE instance. The histogram for each nuclease digestion shows the percentage of clones (from a total of ~15 tested clones) with truncation at each specific site. The in silico folding was constrained based on the digestion sites. b, The reporter construct used for testing the functionality of the engineered elements. A Gateway site in the 3’ UTR of mCherry was used to insert elements downstream of the mCherry coding sequence; acGFP served as the internal control. qRT-PCR of mCherry and GFP transcripts was then used to assay the effects of the cloned sRSE variants. c, Decoy, scrambled, structured and unstructured sequences (along with their predicted secondary structure) that were used in the mCherry/GFP reporter system. In the scrambled sequence, the nucleotides were shuffled in order to compromise both the sequence and the structure of the element. In the structured mimetic sequence, the nucleotides in the stem are swapped while maintaining the sequence of the loop, ensuring that the structure of the stem is maintained while its sequence is changed. In the unstructured mimetic sequence, only the nucleotides in the stem are mutated to disrupt the structure while maintaining the sequence identity of the loop. The in silico folding was guided based on the information provided by batch V1/S1 digestion of RNA variants followed by cloning and sequencing.
    Figure Legend Snippet: In vitro secondary structure probing of the sRSE1 decoy and measuring the functionality of exemplary sRSE variants in reporter systems a, We used a medium-throughput approach to probe the secondary structure of a given sRSE1 decoy sequence (see Methods). Shown here are in silico and in vitro secondary structure prediction for a functional sRSE instance. The histogram for each nuclease digestion shows the percentage of clones (from a total of ~15 tested clones) with truncation at each specific site. The in silico folding was constrained based on the digestion sites. b, The reporter construct used for testing the functionality of the engineered elements. A Gateway site in the 3’ UTR of mCherry was used to insert elements downstream of the mCherry coding sequence; acGFP served as the internal control. qRT-PCR of mCherry and GFP transcripts was then used to assay the effects of the cloned sRSE variants. c, Decoy, scrambled, structured and unstructured sequences (along with their predicted secondary structure) that were used in the mCherry/GFP reporter system. In the scrambled sequence, the nucleotides were shuffled in order to compromise both the sequence and the structure of the element. In the structured mimetic sequence, the nucleotides in the stem are swapped while maintaining the sequence of the loop, ensuring that the structure of the stem is maintained while its sequence is changed. In the unstructured mimetic sequence, only the nucleotides in the stem are mutated to disrupt the structure while maintaining the sequence identity of the loop. The in silico folding was guided based on the information provided by batch V1/S1 digestion of RNA variants followed by cloning and sequencing.

    Techniques Used: In Vitro, Sequencing, In Silico, Functional Assay, Clone Assay, Construct, Quantitative RT-PCR

    TARBP2 binds and post-transcriptionally destabilizes sRSE-carrying transcripts a, sRSE-carrying transcripts were enriched among those up-regulated in the RNAi-mediated TARBP2 knock-down in MDA-LM2 cells (compared to siControl-transfected cells). Transcripts were divided into up-regulated and background groups based on their expression levels in TARBP2 knock-down cells relative to control (see Methods). b, The enrichment of sRSEcarrying transcripts among those whose stabilities were enhanced in TARBP2 knock-down cells. Samples taken at 0- and 18-hr time-points post α-amanitin treatment were used to estimate relative stability (see Methods). c, The sRSE-regulon was enriched among transcripts down-regulated in MDA-LM2 cells over-expressing TARBP2 (relative to GFP-transfected cells). d, Significant enrichment of sRSE elements among the TARBP2 binding sites (determined using HITS-CLIP). e, The expression levels of sRSE/scrambled-fused mCherry reporters assayed in control and TARBP2 knock-down cells. (n=6 per sample; two independent sets of biological triplicates). f, Relative TARBP2 mRNA expression in MDA/MDA-LM2 and CN34/CN-LM1a cells determined using qRT-PCR (n=7 per sample; three independent sets of two biological replicates and a triplicate). In this figure, error bars indicate s.e.m. **, P
    Figure Legend Snippet: TARBP2 binds and post-transcriptionally destabilizes sRSE-carrying transcripts a, sRSE-carrying transcripts were enriched among those up-regulated in the RNAi-mediated TARBP2 knock-down in MDA-LM2 cells (compared to siControl-transfected cells). Transcripts were divided into up-regulated and background groups based on their expression levels in TARBP2 knock-down cells relative to control (see Methods). b, The enrichment of sRSEcarrying transcripts among those whose stabilities were enhanced in TARBP2 knock-down cells. Samples taken at 0- and 18-hr time-points post α-amanitin treatment were used to estimate relative stability (see Methods). c, The sRSE-regulon was enriched among transcripts down-regulated in MDA-LM2 cells over-expressing TARBP2 (relative to GFP-transfected cells). d, Significant enrichment of sRSE elements among the TARBP2 binding sites (determined using HITS-CLIP). e, The expression levels of sRSE/scrambled-fused mCherry reporters assayed in control and TARBP2 knock-down cells. (n=6 per sample; two independent sets of biological triplicates). f, Relative TARBP2 mRNA expression in MDA/MDA-LM2 and CN34/CN-LM1a cells determined using qRT-PCR (n=7 per sample; three independent sets of two biological replicates and a triplicate). In this figure, error bars indicate s.e.m. **, P

    Techniques Used: Multiple Displacement Amplification, Transfection, Expressing, Binding Assay, Cross-linking Immunoprecipitation, Quantitative RT-PCR

    A family of GC-rich structural cis -regulatory RNA elements are enriched in transcripts destabilized in metastatic breast cancer cells a, , gold entries correspond to bins with over-representation of sRSE-carrying transcripts, while blue bins mark under-representation. Statistically significant enrichments and depletions are marked with red and dark-blue borders, respectively. The sRSE elements are collectively depicted as a generic stem-loop with blue and red circles marking nucleotides with low and high GC-content, respectively (black positions are unconstrained regarding the number and identity of nucleotides from these positions onward; also see Methods). Also included are mutual information (MI) values and their associated z -scores. b, The significant enrichment of sRSE-carrying transcripts among the genes with lower expression in metastatic MDA-LM2 cells relative to the parental MDA. Transcripts were sorted according to the logFC of their expression levels in MDA-LM2 versus MDA cells and divided into equally populated bins from lower expression in MDA-LM2 cells (left) to higher expression (right). c, The enrichment of sRSE-carrying transcripts among the genes up-regulated upon transfection of decoy RNA molecules harboring engineered sRSE1 instances compared to scrambled controls. d, Transcript stability quantification for mCherry (normalized to GFP as internal control) carrying four different forms of the sRSE, namely, sRSE1, structured mimetic, unstructured mimetic, and scrambled control. α-amanitin treatments at 0- and 8-hr time-points followed by total RNA extraction and cDNA synthesis were used to estimate relative stability between variants (n=6 per sample per time-point; two independent sets of biological triplicate). Error bars indicate s.e.m. **, P
    Figure Legend Snippet: A family of GC-rich structural cis -regulatory RNA elements are enriched in transcripts destabilized in metastatic breast cancer cells a, , gold entries correspond to bins with over-representation of sRSE-carrying transcripts, while blue bins mark under-representation. Statistically significant enrichments and depletions are marked with red and dark-blue borders, respectively. The sRSE elements are collectively depicted as a generic stem-loop with blue and red circles marking nucleotides with low and high GC-content, respectively (black positions are unconstrained regarding the number and identity of nucleotides from these positions onward; also see Methods). Also included are mutual information (MI) values and their associated z -scores. b, The significant enrichment of sRSE-carrying transcripts among the genes with lower expression in metastatic MDA-LM2 cells relative to the parental MDA. Transcripts were sorted according to the logFC of their expression levels in MDA-LM2 versus MDA cells and divided into equally populated bins from lower expression in MDA-LM2 cells (left) to higher expression (right). c, The enrichment of sRSE-carrying transcripts among the genes up-regulated upon transfection of decoy RNA molecules harboring engineered sRSE1 instances compared to scrambled controls. d, Transcript stability quantification for mCherry (normalized to GFP as internal control) carrying four different forms of the sRSE, namely, sRSE1, structured mimetic, unstructured mimetic, and scrambled control. α-amanitin treatments at 0- and 8-hr time-points followed by total RNA extraction and cDNA synthesis were used to estimate relative stability between variants (n=6 per sample per time-point; two independent sets of biological triplicate). Error bars indicate s.e.m. **, P

    Techniques Used: Expressing, Multiple Displacement Amplification, Transfection, RNA Extraction

    9) Product Images from "Intersection of Endocytic and Exocytic Systems in Toxoplasma gondii"

    Article Title: Intersection of Endocytic and Exocytic Systems in Toxoplasma gondii

    Journal: Traffic (Copenhagen, Denmark)

    doi: 10.1111/tra.12556

    T. gondii ingests host cytosolic mCherry throughout its cell cycle. A, Experimental design for detection and localization of recently ingested host cytosolic protein ingestion. CHO-K1 cells were transiently transfected with a plasmid encoding cytosolic mCherry fluorescent protein 18–24 h before synchronous invasion for 10 min with untreated T. gondii parasites. 50 μM LHVS or DMSO added during the last 30 min of infection before being purified, stained and analyzed by fluorescence microscopy. B, Quantitation of ingestion in Cen2-EGFP parasites treated with DMSO or LHVS for 36 h or 30 min and purified at 3 h post-invasion. Shown is percentage of mCherry positive parasites, at least 200 parasites analyzed per condition, One-way ANOVA with Tukey’s multiple comparisons. C, Cell cycle phasing of LHVS-treated Cen2-EGFP parasites harvested at 4 to 6 h post-invasion to be quantitated for ingestion in D as determined by pattern of Cen2-EGFP and antibody staining for IMC1. D, Quantitation of ingestion in DMSO or LHVS-treated Cen2-EGFP parasites at 4 to 6 h post-invasion. Shown is percentage of mCherry positive parasites, at least 200 parasites analyzed per condition, ratio paired t-test. E, Representative images for detection of ingested host cytosolic mCherry in parasites in G, S or M/C phase. F, Cell cycle phase-specific analysis of ingestion pathway activity. Percentage of mCherry positive parasites in each cell cycle phase from parasites in D was determined with at least 230 parasites in G phase, at least 55 parasites in S phase and at least 24 parasites in M/C phase analyzed, one way ANOVA. All bars represent the mean of 4 biological replicates, error bars represent standard deviation, ** p
    Figure Legend Snippet: T. gondii ingests host cytosolic mCherry throughout its cell cycle. A, Experimental design for detection and localization of recently ingested host cytosolic protein ingestion. CHO-K1 cells were transiently transfected with a plasmid encoding cytosolic mCherry fluorescent protein 18–24 h before synchronous invasion for 10 min with untreated T. gondii parasites. 50 μM LHVS or DMSO added during the last 30 min of infection before being purified, stained and analyzed by fluorescence microscopy. B, Quantitation of ingestion in Cen2-EGFP parasites treated with DMSO or LHVS for 36 h or 30 min and purified at 3 h post-invasion. Shown is percentage of mCherry positive parasites, at least 200 parasites analyzed per condition, One-way ANOVA with Tukey’s multiple comparisons. C, Cell cycle phasing of LHVS-treated Cen2-EGFP parasites harvested at 4 to 6 h post-invasion to be quantitated for ingestion in D as determined by pattern of Cen2-EGFP and antibody staining for IMC1. D, Quantitation of ingestion in DMSO or LHVS-treated Cen2-EGFP parasites at 4 to 6 h post-invasion. Shown is percentage of mCherry positive parasites, at least 200 parasites analyzed per condition, ratio paired t-test. E, Representative images for detection of ingested host cytosolic mCherry in parasites in G, S or M/C phase. F, Cell cycle phase-specific analysis of ingestion pathway activity. Percentage of mCherry positive parasites in each cell cycle phase from parasites in D was determined with at least 230 parasites in G phase, at least 55 parasites in S phase and at least 24 parasites in M/C phase analyzed, one way ANOVA. All bars represent the mean of 4 biological replicates, error bars represent standard deviation, ** p

    Techniques Used: Transfection, Plasmid Preparation, Infection, Purification, Staining, Fluorescence, Microscopy, Quantitation Assay, Activity Assay, Standard Deviation

    Endocytic trafficking is merged with microneme biogenesis in T. gondii with infection of CHO-K1 imCh cells and 200 μM LHVS treatment for 30 min to detect recently ingested mCherry only. Shown is percentage of mCherry positive parasites, at least 200 parasites analyzed per condition, unpaired t-test. B, Quantitation of ingestion pathway activity during microneme biogenesis by comparing proMIC5 positive and negative populations. Shown is percentage of mCherry positive parasites, at least 200 parasites analyzed for each proMIC5 positive and negative population, ratio paired t-test. C, Quantitation of ingestion pathway activity during rhoptry biogenesis by comparing proRON4 positive and negative populations. Shown is percentage of mCherry positive parasites, at least 200 parasites for each proRON4 positive and negative population, ratio paired t-test. D, Quantitation of colocalization of ingested mCherry with proM2AP, proMIC5, proRON4 or the apicoplast in LHVS-treated parasites from A stained with antibodies each indicated marker. At least 30 ingested mCherry puncta analyzed per marker. One-way ANOVA with Dunnet’s test for multiple comparisons to colocalization with the apicoplast. E, Representative images of localization of ingested mCherry relative to proM2AP, proMIC5, proRON4 or the apicoplast (indicated by the blue arrow head). All bars represent the mean from 3 biological replicates, error bars represent standard deviation, ** p,
    Figure Legend Snippet: Endocytic trafficking is merged with microneme biogenesis in T. gondii with infection of CHO-K1 imCh cells and 200 μM LHVS treatment for 30 min to detect recently ingested mCherry only. Shown is percentage of mCherry positive parasites, at least 200 parasites analyzed per condition, unpaired t-test. B, Quantitation of ingestion pathway activity during microneme biogenesis by comparing proMIC5 positive and negative populations. Shown is percentage of mCherry positive parasites, at least 200 parasites analyzed for each proMIC5 positive and negative population, ratio paired t-test. C, Quantitation of ingestion pathway activity during rhoptry biogenesis by comparing proRON4 positive and negative populations. Shown is percentage of mCherry positive parasites, at least 200 parasites for each proRON4 positive and negative population, ratio paired t-test. D, Quantitation of colocalization of ingested mCherry with proM2AP, proMIC5, proRON4 or the apicoplast in LHVS-treated parasites from A stained with antibodies each indicated marker. At least 30 ingested mCherry puncta analyzed per marker. One-way ANOVA with Dunnet’s test for multiple comparisons to colocalization with the apicoplast. E, Representative images of localization of ingested mCherry relative to proM2AP, proMIC5, proRON4 or the apicoplast (indicated by the blue arrow head). All bars represent the mean from 3 biological replicates, error bars represent standard deviation, ** p,

    Techniques Used: Infection, Quantitation Assay, Activity Assay, Staining, Marker, Standard Deviation

    Ingested host cytosolic mCherry is associated with the ELCs, VAC, and possibly the TGN. A, Experimental design for detection and localization of host cytosolic protein ingestion. CHO-K1 cells were transiently transfected with a plasmid encoding cytosolic mCherry fluorescent protein 18–24 h before synchronous invasion for 10 min with T. gondii parasites (pretreated with 1μM LHVS or the vehicle control DMSO for 36 h). Parasites were allowed to ingest host cytosol for 3 h in the presence of 1 μM LHVS or DMSO before being purified, stained and analyzed by fluorescence microscopy. B-D, Quantitation of ingestion of host cytosolic mCherry in WT, GalNac-YFP or ddGFP-DrpB WT parasites treated with 1 μM LHVS or DMSO. ddGFP-DrpB WT parasites were also treated with ethanol (EtOH) or 0.8μM Sh-1 for 30 min beginning at 2.5 h post-invasion to induce expression of DrpB WT. Shown is percentage of mCherry positive parasites, at least 200 parasites analyzed per condition, ratio paired t-test for B and C, one-way ANOVA with Tukey’s multiple comparisons for D. E, Representative images for localization of ingested mCherry in LHVS-treated parasites from B-D relative to the apicoplast using DAPI staining, CPB, NHE3 or proM2AP using antibody staining, GalNac-YFP or GFP-DrpB WT. Scale bars: 2μm. Blue arrowhead indicates the apicoplast, and white arrows indicate areas of colocalization when the endolysosomal marker of interest has several puncta. F, Quantitation of colocalization of ingested mCherry with the indicated markers of the endolysosomal system. At least 30 ingested mCherry puncta per marker, one-way ANOVA with Dunnet’s test for multiple comparisons to colocalization with the apicoplast. Only significant associations shown, Apicoplast vs. NHE3 is not significant. All bars represent mean from 3 or more biological replicates with standard deviation error bars. * p
    Figure Legend Snippet: Ingested host cytosolic mCherry is associated with the ELCs, VAC, and possibly the TGN. A, Experimental design for detection and localization of host cytosolic protein ingestion. CHO-K1 cells were transiently transfected with a plasmid encoding cytosolic mCherry fluorescent protein 18–24 h before synchronous invasion for 10 min with T. gondii parasites (pretreated with 1μM LHVS or the vehicle control DMSO for 36 h). Parasites were allowed to ingest host cytosol for 3 h in the presence of 1 μM LHVS or DMSO before being purified, stained and analyzed by fluorescence microscopy. B-D, Quantitation of ingestion of host cytosolic mCherry in WT, GalNac-YFP or ddGFP-DrpB WT parasites treated with 1 μM LHVS or DMSO. ddGFP-DrpB WT parasites were also treated with ethanol (EtOH) or 0.8μM Sh-1 for 30 min beginning at 2.5 h post-invasion to induce expression of DrpB WT. Shown is percentage of mCherry positive parasites, at least 200 parasites analyzed per condition, ratio paired t-test for B and C, one-way ANOVA with Tukey’s multiple comparisons for D. E, Representative images for localization of ingested mCherry in LHVS-treated parasites from B-D relative to the apicoplast using DAPI staining, CPB, NHE3 or proM2AP using antibody staining, GalNac-YFP or GFP-DrpB WT. Scale bars: 2μm. Blue arrowhead indicates the apicoplast, and white arrows indicate areas of colocalization when the endolysosomal marker of interest has several puncta. F, Quantitation of colocalization of ingested mCherry with the indicated markers of the endolysosomal system. At least 30 ingested mCherry puncta per marker, one-way ANOVA with Dunnet’s test for multiple comparisons to colocalization with the apicoplast. Only significant associations shown, Apicoplast vs. NHE3 is not significant. All bars represent mean from 3 or more biological replicates with standard deviation error bars. * p

    Techniques Used: Transfection, Plasmid Preparation, Purification, Staining, Fluorescence, Microscopy, Quantitation Assay, Expressing, Marker, Standard Deviation

    Ingestion does not require DrpB. A, Representative images for aberrant secretion of MIC3 into the PV lumen in ddGFP-DrpB K72A parasites with the addition of Shield-1 (Sh-1), but not the vehicle control ethanol (EtOH). Synchronously-infected cells were treated with 1 μM Sh-1 or the vehicle control ethanol (EtOH) for 5 h, partially permeablized with 0.02% saponin to allow staining of the PV lumen, but not the parasite interior, and stained with antibodies against MIC3 and against the dense granule protein TgPI-1 as a positive control for PV lumen staining. Scale bars: 2 μm. B, Quantitation of aberrant MIC3 secretion into the PV lumen in ddGFP-DrpB K72A parasites treated as in A with 1μM Shield-1 (Sh-1) for the last 2, 3 or 5 h of infection or 5 h for ethanol (EtOH). Shown is percentage of TgPI-1 + vacuoles that are MIC3 + , treated with 0.2% DMSO or 200 μM LHVS for 30 min and 0.1% EtOH or 1μM Sh-1 for the indicated amounts of time in C and 3 h in D. Shown is percentage of mCherry positive parasites, with at least 200 parasites analyzed for each of 2 biological replicates for DMSO+Shield-1 in C, and at least 3 biological replicates for all other samples. One-way ANOVA with Dunnet’s test for multiple comparisons of LHVS+EtOH treated samples to the DMSO+EtOH treated control are not shown, but all comparisons are significant. Unpaired, two-sample t-tests for comparison of EtOH and Sh-1 treated samples shown. E, Quantitation of colocalization of ingested mCherry with GFP-DrpB K72A, proM2AP and CPL by antibody staining, or the apicoplast by DAPI staining in LHVS-treated ddGFP-DrpB K72A parasites from D. At least 30 ingested mCherry puncta were analyzed per marker for each of 4 biological replicates for CPL and 3 biological replicates for all other markers. One-way ANOVA with Dunnet’s test for multiple comparisons of EtOH treated samples to the apicoplast are not shown, but proM2AP and CPL comparisons are significant. Unpaired two-sample t-tests for comparison of EtOH and Sh-1 treated samples for each marker and comparison of the apicoplast and ddGFP-DrpB K72A in Sh-1 treated parasites shown. F, Quantitation of colocalization of CPL with the indicated markers by antibody staining in intracellular ddGFP-DrpB K72A parasites synchronously invaded into HFF cells, treated with 0.1% EtOH or 1μM Sh-1 for 3 h and fixed at 3 h post-invasion. At least 40 CPL puncta analyzed per marker for each of 3 biological replicates. Unpaired two-sample t-tests for comparison of EtOH and Sh-1 treated samples. G and H, Representative images for colocalization of ddGFP-DrpB WT or ddGFP-DrpB K72A with the indicated markers by antibody staining, quantitated in I. White arrows indicate regions of colocalization. Scale bars: 5 μm. I, Quantitation of colocalization of Sh-1 treated ddGFP-DrpB WT or ddGFP-DrpB K72A with the indicated endolysosomal markers by antibody staining or the apicoplast by DAPI staining in intracellular parasites treated as in F with ddGFP-DrpB WT parasites treated with 0.8 μM Sh-1 for 30 min and ddGFP-DrpB K72A parasites treated with 1.0 μM Sh-1 for 3 h. At least 40 DrpB puncta analyzed per marker, per replicate for 3 biological replicates. One-way ANOVA with Dunnet’s test for multiple comparisons of each marker to the apicoplast for each ddGFP-DrpB WT and ddGFP-DrpB K72A parasites, only significant results shown. Unpaired two-sample t-tests for comparison of localization in ddGFP-DrpB WT vs. K72A. All bars represent means and error bars represent standard deviation. *p
    Figure Legend Snippet: Ingestion does not require DrpB. A, Representative images for aberrant secretion of MIC3 into the PV lumen in ddGFP-DrpB K72A parasites with the addition of Shield-1 (Sh-1), but not the vehicle control ethanol (EtOH). Synchronously-infected cells were treated with 1 μM Sh-1 or the vehicle control ethanol (EtOH) for 5 h, partially permeablized with 0.02% saponin to allow staining of the PV lumen, but not the parasite interior, and stained with antibodies against MIC3 and against the dense granule protein TgPI-1 as a positive control for PV lumen staining. Scale bars: 2 μm. B, Quantitation of aberrant MIC3 secretion into the PV lumen in ddGFP-DrpB K72A parasites treated as in A with 1μM Shield-1 (Sh-1) for the last 2, 3 or 5 h of infection or 5 h for ethanol (EtOH). Shown is percentage of TgPI-1 + vacuoles that are MIC3 + , treated with 0.2% DMSO or 200 μM LHVS for 30 min and 0.1% EtOH or 1μM Sh-1 for the indicated amounts of time in C and 3 h in D. Shown is percentage of mCherry positive parasites, with at least 200 parasites analyzed for each of 2 biological replicates for DMSO+Shield-1 in C, and at least 3 biological replicates for all other samples. One-way ANOVA with Dunnet’s test for multiple comparisons of LHVS+EtOH treated samples to the DMSO+EtOH treated control are not shown, but all comparisons are significant. Unpaired, two-sample t-tests for comparison of EtOH and Sh-1 treated samples shown. E, Quantitation of colocalization of ingested mCherry with GFP-DrpB K72A, proM2AP and CPL by antibody staining, or the apicoplast by DAPI staining in LHVS-treated ddGFP-DrpB K72A parasites from D. At least 30 ingested mCherry puncta were analyzed per marker for each of 4 biological replicates for CPL and 3 biological replicates for all other markers. One-way ANOVA with Dunnet’s test for multiple comparisons of EtOH treated samples to the apicoplast are not shown, but proM2AP and CPL comparisons are significant. Unpaired two-sample t-tests for comparison of EtOH and Sh-1 treated samples for each marker and comparison of the apicoplast and ddGFP-DrpB K72A in Sh-1 treated parasites shown. F, Quantitation of colocalization of CPL with the indicated markers by antibody staining in intracellular ddGFP-DrpB K72A parasites synchronously invaded into HFF cells, treated with 0.1% EtOH or 1μM Sh-1 for 3 h and fixed at 3 h post-invasion. At least 40 CPL puncta analyzed per marker for each of 3 biological replicates. Unpaired two-sample t-tests for comparison of EtOH and Sh-1 treated samples. G and H, Representative images for colocalization of ddGFP-DrpB WT or ddGFP-DrpB K72A with the indicated markers by antibody staining, quantitated in I. White arrows indicate regions of colocalization. Scale bars: 5 μm. I, Quantitation of colocalization of Sh-1 treated ddGFP-DrpB WT or ddGFP-DrpB K72A with the indicated endolysosomal markers by antibody staining or the apicoplast by DAPI staining in intracellular parasites treated as in F with ddGFP-DrpB WT parasites treated with 0.8 μM Sh-1 for 30 min and ddGFP-DrpB K72A parasites treated with 1.0 μM Sh-1 for 3 h. At least 40 DrpB puncta analyzed per marker, per replicate for 3 biological replicates. One-way ANOVA with Dunnet’s test for multiple comparisons of each marker to the apicoplast for each ddGFP-DrpB WT and ddGFP-DrpB K72A parasites, only significant results shown. Unpaired two-sample t-tests for comparison of localization in ddGFP-DrpB WT vs. K72A. All bars represent means and error bars represent standard deviation. *p

    Techniques Used: Infection, Staining, Positive Control, Quantitation Assay, Marker, Standard Deviation

    10) Product Images from "A dual fluorescent reporter for the investigation of methionine mistranslation in live cells"

    Article Title: A dual fluorescent reporter for the investigation of methionine mistranslation in live cells

    Journal: RNA

    doi: 10.1261/rna.054163.115

    mCherry fluorescent reporter for mistranslation. One of the three amino acid residues that form the fluorophore in mCherry is Met72. ( A ) mCherry lost fluorescence in E. coli when Met72 was mutated to Lys (AAA, AAG), Asp (GAC, GAT), and Glu (GAG, GAA),
    Figure Legend Snippet: mCherry fluorescent reporter for mistranslation. One of the three amino acid residues that form the fluorophore in mCherry is Met72. ( A ) mCherry lost fluorescence in E. coli when Met72 was mutated to Lys (AAA, AAG), Asp (GAC, GAT), and Glu (GAG, GAA),

    Techniques Used: Fluorescence

    Oxidative stress increases mistranslation of GAA (Glu) and GAG (Glu) mCherry stable lines. ( A ) tRNA microarrays showing increase of misacylation upon arsenite treatment. Array grid shows the spots for cognate Met-tRNAs. ( B ) Histogram shows the distribution
    Figure Legend Snippet: Oxidative stress increases mistranslation of GAA (Glu) and GAG (Glu) mCherry stable lines. ( A ) tRNA microarrays showing increase of misacylation upon arsenite treatment. Array grid shows the spots for cognate Met-tRNAs. ( B ) Histogram shows the distribution

    Techniques Used:

    11) Product Images from "Mitochondrial Calcium Uptake Modulates Synaptic Vesicle Endocytosis in Central Nerve Terminals *"

    Article Title: Mitochondrial Calcium Uptake Modulates Synaptic Vesicle Endocytosis in Central Nerve Terminals *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M115.686956

    MCU overexpression slows SV endocytosis. A and B , neurons transfected with syp-pHluorin and either shRNA targeting MCU ( shMcu1 ) or a scrambled control ( shScr ) and also MCU tagged with tDimer (MCU) or a control protein (mCherry) were stimulated with an action potential train (10 Hz, 30 s, indicated by the bar ). A , average traces for syp-pHluorin fluorescence (ΔF/F 0 ± S.E.) under each condition normalized to maximal fluorescence during stimulation. B , average syp-pHluorin τ ± S.E. (shScr + mCherry, n = 11; shMcu1 + mCherry, n = 9; shMcu1 + MCU, n = 8; one-way ANOVA with Holm-Šídák post hoc tests; ***, p
    Figure Legend Snippet: MCU overexpression slows SV endocytosis. A and B , neurons transfected with syp-pHluorin and either shRNA targeting MCU ( shMcu1 ) or a scrambled control ( shScr ) and also MCU tagged with tDimer (MCU) or a control protein (mCherry) were stimulated with an action potential train (10 Hz, 30 s, indicated by the bar ). A , average traces for syp-pHluorin fluorescence (ΔF/F 0 ± S.E.) under each condition normalized to maximal fluorescence during stimulation. B , average syp-pHluorin τ ± S.E. (shScr + mCherry, n = 11; shMcu1 + mCherry, n = 9; shMcu1 + MCU, n = 8; one-way ANOVA with Holm-Šídák post hoc tests; ***, p

    Techniques Used: Over Expression, Transfection, shRNA, Fluorescence

    12) Product Images from "Infant and adult SCA13 mutations differentially affect Purkinje cell excitability, maturation, and viability in vivo"

    Article Title: Infant and adult SCA13 mutations differentially affect Purkinje cell excitability, maturation, and viability in vivo

    Journal: eLife

    doi: 10.7554/eLife.57358

    iR4H disrupts distal branching and synaptogenesis in the axonal compartment of CaP motor neurons. Representative confocal image stacks of CaP neurons expressing EGFP, or EGFP fusion proteins of iR4H or aR3H were traced using Imaris software. Projected traces are shown from sagittal and transverse perspectives. Red dots indicate presynaptic specializations labeled by a co-expressed synaptophysin-mCherry fusion protein.
    Figure Legend Snippet: iR4H disrupts distal branching and synaptogenesis in the axonal compartment of CaP motor neurons. Representative confocal image stacks of CaP neurons expressing EGFP, or EGFP fusion proteins of iR4H or aR3H were traced using Imaris software. Projected traces are shown from sagittal and transverse perspectives. Red dots indicate presynaptic specializations labeled by a co-expressed synaptophysin-mCherry fusion protein.

    Techniques Used: Expressing, Software, Labeling

    iR4H but not aR3H significantly impairs presynaptic development. ( A ) The cartoon illustrates the stereotyped morphology of CaP motor neurons, which have a large cell body located dorsally in the spinal cord and an axon that grows into the ventral myotome where it branches and forms synapses on fast twitch muscle fibers ( Myers et al., 1986 ; Westerfield et al., 1986 ). ( B ) EGFP (left column), or iR4H (middle column) or aR3H (right column) fusion proteins with EGFP (green) were co-expressed in motor neurons with a presynaptic marker, synaptophysin-mCherry (Syn-mCherry, red). Live images of CaP motor neurons were obtained at 48 hpf using a laser scanning confocal microscope. Representative maximum intensity projections are shown. Top row, EGFP fluorescence; middle row, mCherry fluorescence; bottom row, merged images. Images were traced for three-dimensional reconstruction and synapses were counted using Imaris software. ( C–H ) Panels show mean values ± SEM obtained from traced images for ( C ) synapse number; ( D ) distal branch number, where distal indicates below the midline (dashed line in cartoon shown in part A); ( E ) distal branch length; ( F ) length of the main axon shaft; ( G ) proximal branch number, where proximal indicates at or above the midline (dashed line shown in cartoon in part A); and ( H ) proximal branch length. Statistical significance was assessed by one-way ANOVA Kruskal-Wallis test, followed by Dunn’s multiple comparison test. *, p
    Figure Legend Snippet: iR4H but not aR3H significantly impairs presynaptic development. ( A ) The cartoon illustrates the stereotyped morphology of CaP motor neurons, which have a large cell body located dorsally in the spinal cord and an axon that grows into the ventral myotome where it branches and forms synapses on fast twitch muscle fibers ( Myers et al., 1986 ; Westerfield et al., 1986 ). ( B ) EGFP (left column), or iR4H (middle column) or aR3H (right column) fusion proteins with EGFP (green) were co-expressed in motor neurons with a presynaptic marker, synaptophysin-mCherry (Syn-mCherry, red). Live images of CaP motor neurons were obtained at 48 hpf using a laser scanning confocal microscope. Representative maximum intensity projections are shown. Top row, EGFP fluorescence; middle row, mCherry fluorescence; bottom row, merged images. Images were traced for three-dimensional reconstruction and synapses were counted using Imaris software. ( C–H ) Panels show mean values ± SEM obtained from traced images for ( C ) synapse number; ( D ) distal branch number, where distal indicates below the midline (dashed line in cartoon shown in part A); ( E ) distal branch length; ( F ) length of the main axon shaft; ( G ) proximal branch number, where proximal indicates at or above the midline (dashed line shown in cartoon in part A); and ( H ) proximal branch length. Statistical significance was assessed by one-way ANOVA Kruskal-Wallis test, followed by Dunn’s multiple comparison test. *, p

    Techniques Used: Marker, Microscopy, Fluorescence, Software

    13) Product Images from "Imprecision and DNA Break Repair Biased Towards Incompatible End Joining in Leukemia"

    Article Title: Imprecision and DNA Break Repair Biased Towards Incompatible End Joining in Leukemia

    Journal: Molecular cancer research : MCR

    doi: 10.1158/1541-7786.MCR-17-0373

    DNA DSB repair of non-resected DNA substrates. (A) Expression values for factors involved in MMEJ (left panel) and c-NHEJ (right panel) are shown as fold change between CLL and B lymphocytes. > 2-fold differences are shaded grey. Significances are indicated above each bar. (CLL n=100; B cells n=11). (B) schematic representation of plasmids (GFP-1 and GFP-2) used to detect intermolecular repair of blunt/5’overhang junctions. Direct intermolecular repair of non-resected plasmids leads to GFP expression. (C) 293 cells were transfected using plasmids GFP-1 and GFP-2 shown in (B) together with a plasmid expressing mCherry. Representative FACS plots show GFP/mCherry expression in presence of inhibitors. Data within plots gives percentage of GFP + -cells within all mCherry + -cells. Graph shows the results from three independent FACS experiments. UTR1: untreated cells transfected using GeneJuice (controls for NU7441, Olaparib treated cells). UTR2: untreated cells transfected using nucleofection (controls for L67 treated cells). neg: cells transfected with mCherry plasmids only. Significant differences in comparison to untreated controls is indicated above the respective dataset (two-tailed t-test with unequal variances).
    Figure Legend Snippet: DNA DSB repair of non-resected DNA substrates. (A) Expression values for factors involved in MMEJ (left panel) and c-NHEJ (right panel) are shown as fold change between CLL and B lymphocytes. > 2-fold differences are shaded grey. Significances are indicated above each bar. (CLL n=100; B cells n=11). (B) schematic representation of plasmids (GFP-1 and GFP-2) used to detect intermolecular repair of blunt/5’overhang junctions. Direct intermolecular repair of non-resected plasmids leads to GFP expression. (C) 293 cells were transfected using plasmids GFP-1 and GFP-2 shown in (B) together with a plasmid expressing mCherry. Representative FACS plots show GFP/mCherry expression in presence of inhibitors. Data within plots gives percentage of GFP + -cells within all mCherry + -cells. Graph shows the results from three independent FACS experiments. UTR1: untreated cells transfected using GeneJuice (controls for NU7441, Olaparib treated cells). UTR2: untreated cells transfected using nucleofection (controls for L67 treated cells). neg: cells transfected with mCherry plasmids only. Significant differences in comparison to untreated controls is indicated above the respective dataset (two-tailed t-test with unequal variances).

    Techniques Used: Expressing, Non-Homologous End Joining, Transfection, Plasmid Preparation, FACS, Two Tailed Test

    14) Product Images from "Spatiotemporal regulation of autophagy during Caenorhabditis elegans aging"

    Article Title: Spatiotemporal regulation of autophagy during Caenorhabditis elegans aging

    Journal: eLife

    doi: 10.7554/eLife.18459

    Germline-less glp-1 mutants display a different autophagic activity profile than daf-2 mutants. ( A–D ) Quantification of autophagosomes (AP) and autolysosomes (AL) in adult Days 1, 3, 5, 7, and 10 glp-1(e2141) animals expressing mCherry::gfp::lgg-1 and injected with DMSO (control, dark blue lines) or Bafliomycin A (BafA, light blue lines). Tissues examined were the intestine ( A ), body-wall muscle ( B ), pharynx ( C ), and nerve-ring neurons ( D ). The black dashed lines in ( A–D ) show data from wild-type (WT) control animals from Figure 3 for comparison (animals were analyzed in parallel). Data are the mean ± SEM of ≥25 animals combined from three independent experiments. ∧ , WT + control vs. glp-1 control at Days 1, 3, 5, 7, and 10; *, glp-1 control vs. glp-1 + BafA at Days 1, 3, 5, 7, and 10, # , glp-1 control at Days 3, 5, 7, and 10 vs. glp-1 control at Day 1. ***/ ∧∧∧ / ### p
    Figure Legend Snippet: Germline-less glp-1 mutants display a different autophagic activity profile than daf-2 mutants. ( A–D ) Quantification of autophagosomes (AP) and autolysosomes (AL) in adult Days 1, 3, 5, 7, and 10 glp-1(e2141) animals expressing mCherry::gfp::lgg-1 and injected with DMSO (control, dark blue lines) or Bafliomycin A (BafA, light blue lines). Tissues examined were the intestine ( A ), body-wall muscle ( B ), pharynx ( C ), and nerve-ring neurons ( D ). The black dashed lines in ( A–D ) show data from wild-type (WT) control animals from Figure 3 for comparison (animals were analyzed in parallel). Data are the mean ± SEM of ≥25 animals combined from three independent experiments. ∧ , WT + control vs. glp-1 control at Days 1, 3, 5, 7, and 10; *, glp-1 control vs. glp-1 + BafA at Days 1, 3, 5, 7, and 10, # , glp-1 control at Days 3, 5, 7, and 10 vs. glp-1 control at Day 1. ***/ ∧∧∧ / ### p

    Techniques Used: Activity Assay, Expressing, Injection

    Additional validation of new mCherry::GFP::LGG-1 reporter. ( A,B ) Fluorescence microscopy of wild-type (WT) animals expressing mCherry::gfp::lgg-1 treated with LysoTracker and injected with DMSO (control) ( A ) or Bafilomycin A (BafA) ( B ) at Day 1 (D1) of adulthood. White arrowhead, mCherry/LysoTracker punctae; yellow arrowhead, mCherry/GFP punctae. ( C ) Quantification of autophagosomes (AP, mCherry/GFP punctae) and autolysosomes (AL, mCherry-only punctae) in hypodermal seam cells of transgenic WT or cst-1(tm1900) animals expressing mCherry::gfp::lgg-1 and injected with DMSO (control) or BafA. Data are the mean ± SEM of ≥35 animals combined from two experiments. ***p
    Figure Legend Snippet: Additional validation of new mCherry::GFP::LGG-1 reporter. ( A,B ) Fluorescence microscopy of wild-type (WT) animals expressing mCherry::gfp::lgg-1 treated with LysoTracker and injected with DMSO (control) ( A ) or Bafilomycin A (BafA) ( B ) at Day 1 (D1) of adulthood. White arrowhead, mCherry/LysoTracker punctae; yellow arrowhead, mCherry/GFP punctae. ( C ) Quantification of autophagosomes (AP, mCherry/GFP punctae) and autolysosomes (AL, mCherry-only punctae) in hypodermal seam cells of transgenic WT or cst-1(tm1900) animals expressing mCherry::gfp::lgg-1 and injected with DMSO (control) or BafA. Data are the mean ± SEM of ≥35 animals combined from two experiments. ***p

    Techniques Used: Fluorescence, Microscopy, Expressing, Injection, Transgenic Assay

    mCherry::GFP::LGG-1 reporter is expressed in multiple tissues. ( A–E’ ) GFP (green) and mCherry (red) fluorescence images from Day 1 ( A–E ) and Day 10 ( B’–E’ ) adult wild-type (WT) transgenic animals expressing the mCherry::gfp::lgg-1 reporter. The merged images are shown in Figure 2 . Tissues tested were hypodermal seam cells ( A ), intestine ( B,B’ ), body-wall muscle ( C,C’ ), pharynx ( D,D’ ), and nerve-ring neurons ( E,E’ ). Autophagosomes (AP, mCherry/GFP) are indicated by yellow arrowheads, and autolysosomes (AL, mCherry only) are indicated by white arrowheads. ( F–I’ ) Confocal images of animals with tissue-specific expression of gfp::lgg-1 in the intestine ( F,F’ ), body-wall muscle ( G,G’ ), pharynx ( H,H’ ), and nerve-ring neurons ( I,I’ ) at Day 1 ( F–I ) and Day 10 ( F’–I’ ) of adulthood. Arrows indicate APs (GFP punctae). Dotted lines outline individual intestinal cells ( B,B’,F,F’ ) and pharyngeal bulbs ( D,D’,E,E’,H,H’,I,I’ ). AB, anterior pharyngeal bulb; TB, terminal pharyngeal bulb. Scale bars = 20 µm except in ( A ) = 10 µm. DOI: http://dx.doi.org/10.7554/eLife.18459.006
    Figure Legend Snippet: mCherry::GFP::LGG-1 reporter is expressed in multiple tissues. ( A–E’ ) GFP (green) and mCherry (red) fluorescence images from Day 1 ( A–E ) and Day 10 ( B’–E’ ) adult wild-type (WT) transgenic animals expressing the mCherry::gfp::lgg-1 reporter. The merged images are shown in Figure 2 . Tissues tested were hypodermal seam cells ( A ), intestine ( B,B’ ), body-wall muscle ( C,C’ ), pharynx ( D,D’ ), and nerve-ring neurons ( E,E’ ). Autophagosomes (AP, mCherry/GFP) are indicated by yellow arrowheads, and autolysosomes (AL, mCherry only) are indicated by white arrowheads. ( F–I’ ) Confocal images of animals with tissue-specific expression of gfp::lgg-1 in the intestine ( F,F’ ), body-wall muscle ( G,G’ ), pharynx ( H,H’ ), and nerve-ring neurons ( I,I’ ) at Day 1 ( F–I ) and Day 10 ( F’–I’ ) of adulthood. Arrows indicate APs (GFP punctae). Dotted lines outline individual intestinal cells ( B,B’,F,F’ ) and pharyngeal bulbs ( D,D’,E,E’,H,H’,I,I’ ). AB, anterior pharyngeal bulb; TB, terminal pharyngeal bulb. Scale bars = 20 µm except in ( A ) = 10 µm. DOI: http://dx.doi.org/10.7554/eLife.18459.006

    Techniques Used: Fluorescence, Transgenic Assay, Expressing

    Quantification of autophagosomes and autolysosomes following Inhibition of lysosomal genes cup-5 and laat-1 . ( A-D ) Quantification of autophagosomes (AP) and autolysosomes (AL) in hypodermal seam cells ( A ), intestine ( B ), pharynx ( C ), and muscle ( D ) of adult Day 1 wild-type (WT) animals expressing mCherry::gfp::lgg-1 fed for two generations with bacteria expressing empty vector (control) or cup-5 or laat-1 dsRNA. Data are the mean ± SEM of ≥45 animals combined from three experiments. ****p
    Figure Legend Snippet: Quantification of autophagosomes and autolysosomes following Inhibition of lysosomal genes cup-5 and laat-1 . ( A-D ) Quantification of autophagosomes (AP) and autolysosomes (AL) in hypodermal seam cells ( A ), intestine ( B ), pharynx ( C ), and muscle ( D ) of adult Day 1 wild-type (WT) animals expressing mCherry::gfp::lgg-1 fed for two generations with bacteria expressing empty vector (control) or cup-5 or laat-1 dsRNA. Data are the mean ± SEM of ≥45 animals combined from three experiments. ****p

    Techniques Used: Inhibition, Expressing, Plasmid Preparation

    Hypodermal seam cells in daf-2 mutants display increased autophagy, whereas lipidation-independent punctate structures are present in these cells in glp-1 mutants. ( A–C ) Quantification of autophagosomes (AP) ( A–B ) and autolysosomes (AL) ( C ) in hypodermal seam cells of adult Day 1 wild-type (WT), daf-2(e1370) , and glp-1(e2141) transgenic animals expressing gfp::lgg-1 ( A ) or mCherry::gfp::lgg-1 ( B–C ) and injected with DMSO (control) or Bafilomycin A (BafA). Data are the mean ± SEM of ≥25 animals combined from at least three independent experiments. ***p
    Figure Legend Snippet: Hypodermal seam cells in daf-2 mutants display increased autophagy, whereas lipidation-independent punctate structures are present in these cells in glp-1 mutants. ( A–C ) Quantification of autophagosomes (AP) ( A–B ) and autolysosomes (AL) ( C ) in hypodermal seam cells of adult Day 1 wild-type (WT), daf-2(e1370) , and glp-1(e2141) transgenic animals expressing gfp::lgg-1 ( A ) or mCherry::gfp::lgg-1 ( B–C ) and injected with DMSO (control) or Bafilomycin A (BafA). Data are the mean ± SEM of ≥25 animals combined from at least three independent experiments. ***p

    Techniques Used: Transgenic Assay, Expressing, Injection

    Characterization of intestinal RNAi strains. ( A ) Differential interference contrast (DIC) images of Day 3 adult wild-type (WT, ( N2 ), daf-2 (e1370) , daf-2(e1370); sid-1(qt9) , sid-1(qt9); vha-6p::sid-1cDNA , daf-2(e1370); sid-1(qt9); vha-6p::sid-1cDNA , glp-1(e2141) , glp-1(e2141); sid-1(qt9) , and glp-1(e2141); sid-1(qt9); vha-6p::sid-1cDNA animals fed from hatching with bacteria containing empty vector (control) or elt-2 dsRNA ( elt-2i ). Similar results were obtained with animals subjected to pept-1 RNAi, whereas no response was obtained following RNAi knockdown of the muscle-specific gene, unc-112, and hypodermis-specific genes bli-3, bli-4 , and lin-26 in sid-1 , daf-2; sid-1, or glp-1; sid-1 strains expressing sid-1 in the intestine (data not shown). Scale bar = 400 µm. Data representative of at least two independent experiments. ( B ) Fluorescence images (GFP), strains express vha-6p::sid-1::sl2::gfp and DIC images (insets) of Day 3 adult animals fed from hatching with bacteria containing empty vector (control) or gfp -encoding dsRNA. Scale bar = 200 µm. Data representative of at least two independent experiments. ( C ) Schematic of sid-1 gene with primers 1, 2, and 3 indicated by arrows. Black boxes and lines indicate exons and introns, respectively. ( D,E ) PCR analysis using primers 1 and 3 ( D ), or 1 and 2 ( E ) to detect sid-1 transgene expression in ( a ) glp-1(e2141); sid-1(qt9), ( b ) daf-2(e1370); sid-1(qt9), ( c ) glp-1(e2141); sid-1(qt9); myo-3p::sid-1, ( d ) daf-2(e1370); sid-1(qt9); myo-3p::sid-1, ( e ) glp-1(e2141); sid-1(qt9); vha-6p::sid-1, ( f ) daf-2(e1370); sid-1(qt9); vha-6p::sid-1, ( g ) sid-1(qt9); vha-6p::sid-1, and ( h ) WT animals. Data are representative of at least two independent experiments. Units are number of base pairs. ( F ) Fluorescence images (mCherry) of Day 1 adult WT or daf-2(e1370) transgenic animals expressing atg-18p::atg-18::mCherry fed from hatching with bacteria containing empty vector (control) or atg-18/Wipi dsRNA. ( G ) Quantification of fluorescence intensity in the anterior intestine of Day 1 adult WT or daf-2(e1370) animals expressing atg-18p::atg-18::mCherry fed from hatching with bacteria containing empty vector (control) or atg-18/Wipi- encoding dsRNA. Data are the mean ± SEM and are representative of three independent experiments, each with ≥10 animals. ****p
    Figure Legend Snippet: Characterization of intestinal RNAi strains. ( A ) Differential interference contrast (DIC) images of Day 3 adult wild-type (WT, ( N2 ), daf-2 (e1370) , daf-2(e1370); sid-1(qt9) , sid-1(qt9); vha-6p::sid-1cDNA , daf-2(e1370); sid-1(qt9); vha-6p::sid-1cDNA , glp-1(e2141) , glp-1(e2141); sid-1(qt9) , and glp-1(e2141); sid-1(qt9); vha-6p::sid-1cDNA animals fed from hatching with bacteria containing empty vector (control) or elt-2 dsRNA ( elt-2i ). Similar results were obtained with animals subjected to pept-1 RNAi, whereas no response was obtained following RNAi knockdown of the muscle-specific gene, unc-112, and hypodermis-specific genes bli-3, bli-4 , and lin-26 in sid-1 , daf-2; sid-1, or glp-1; sid-1 strains expressing sid-1 in the intestine (data not shown). Scale bar = 400 µm. Data representative of at least two independent experiments. ( B ) Fluorescence images (GFP), strains express vha-6p::sid-1::sl2::gfp and DIC images (insets) of Day 3 adult animals fed from hatching with bacteria containing empty vector (control) or gfp -encoding dsRNA. Scale bar = 200 µm. Data representative of at least two independent experiments. ( C ) Schematic of sid-1 gene with primers 1, 2, and 3 indicated by arrows. Black boxes and lines indicate exons and introns, respectively. ( D,E ) PCR analysis using primers 1 and 3 ( D ), or 1 and 2 ( E ) to detect sid-1 transgene expression in ( a ) glp-1(e2141); sid-1(qt9), ( b ) daf-2(e1370); sid-1(qt9), ( c ) glp-1(e2141); sid-1(qt9); myo-3p::sid-1, ( d ) daf-2(e1370); sid-1(qt9); myo-3p::sid-1, ( e ) glp-1(e2141); sid-1(qt9); vha-6p::sid-1, ( f ) daf-2(e1370); sid-1(qt9); vha-6p::sid-1, ( g ) sid-1(qt9); vha-6p::sid-1, and ( h ) WT animals. Data are representative of at least two independent experiments. Units are number of base pairs. ( F ) Fluorescence images (mCherry) of Day 1 adult WT or daf-2(e1370) transgenic animals expressing atg-18p::atg-18::mCherry fed from hatching with bacteria containing empty vector (control) or atg-18/Wipi dsRNA. ( G ) Quantification of fluorescence intensity in the anterior intestine of Day 1 adult WT or daf-2(e1370) animals expressing atg-18p::atg-18::mCherry fed from hatching with bacteria containing empty vector (control) or atg-18/Wipi- encoding dsRNA. Data are the mean ± SEM and are representative of three independent experiments, each with ≥10 animals. ****p

    Techniques Used: Plasmid Preparation, Expressing, Fluorescence, Polymerase Chain Reaction, Transgenic Assay

    mCherry and GFP co-localize with endogenous LGG-1 in transgenic animals expressing mCherry::gfp::lgg-1. ( A-B ) Immunofluorescence to detect endogenous LGG-1 (green, rabbit anti-LGG-1 antibody made by Abgent) and GFP (A; red, mouse anti-GFP from Santa Cruz Biotechnology) or mCherry (B; red, mouse anti-mCherry from Clonetech) in dissected intestines of wild-type (WT, top, data also in Figure 1—figure supplement 1D, E ) or daf-2(e1370) animals (bottom). Data representative of ≥2 experiments (N≥5 animals in each). Scale bars = 20 µM.
    Figure Legend Snippet: mCherry and GFP co-localize with endogenous LGG-1 in transgenic animals expressing mCherry::gfp::lgg-1. ( A-B ) Immunofluorescence to detect endogenous LGG-1 (green, rabbit anti-LGG-1 antibody made by Abgent) and GFP (A; red, mouse anti-GFP from Santa Cruz Biotechnology) or mCherry (B; red, mouse anti-mCherry from Clonetech) in dissected intestines of wild-type (WT, top, data also in Figure 1—figure supplement 1D, E ) or daf-2(e1370) animals (bottom). Data representative of ≥2 experiments (N≥5 animals in each). Scale bars = 20 µM.

    Techniques Used: Transgenic Assay, Expressing, Immunofluorescence

    mCherry::GFP::LGG-1 reporter produces a full-length protein. ( A–C ) Immunoblot analysis of lysates from Day 1 transgenic animals expressing mCherry::gfp::lgg-1 or gfp::lgg-1. Blots were probed with anti-LGG-1 ( A ), anti-mCherry ( B ), and anti-GFP ( C ) antibodies. Data are representative of at least two experiments. The lower band of the mCherry::GFP::LGG-1 reporter (*) may be due to cleavage of the N-terminus as it has previously been published that the first 11 amino acids of mCherry are susceptible to cleavage resulting in something that is slightly smaller than the full length protein ( Huang et al., 2014 ). ( D–E ) Immunofluorescence to detect endogenous LGG-1 (green) and GFP (D; red) or mCherry (E; red) in dissected intestines of wild-type (WT) animals. Data are representative of at least two independent experiments, each with ≥5 animals. Scale bars = 20 µm. Full-length protein was detected at Day 10 (data not shown). DOI: http://dx.doi.org/10.7554/eLife.18459.005
    Figure Legend Snippet: mCherry::GFP::LGG-1 reporter produces a full-length protein. ( A–C ) Immunoblot analysis of lysates from Day 1 transgenic animals expressing mCherry::gfp::lgg-1 or gfp::lgg-1. Blots were probed with anti-LGG-1 ( A ), anti-mCherry ( B ), and anti-GFP ( C ) antibodies. Data are representative of at least two experiments. The lower band of the mCherry::GFP::LGG-1 reporter (*) may be due to cleavage of the N-terminus as it has previously been published that the first 11 amino acids of mCherry are susceptible to cleavage resulting in something that is slightly smaller than the full length protein ( Huang et al., 2014 ). ( D–E ) Immunofluorescence to detect endogenous LGG-1 (green) and GFP (D; red) or mCherry (E; red) in dissected intestines of wild-type (WT) animals. Data are representative of at least two independent experiments, each with ≥5 animals. Scale bars = 20 µm. Full-length protein was detected at Day 10 (data not shown). DOI: http://dx.doi.org/10.7554/eLife.18459.005

    Techniques Used: Transgenic Assay, Expressing, Immunofluorescence

    Antibody staining in N2 (Wild Type) animals. ( A-B ) Day 1 WT animals stained with rabbit anti-LGG-1 (green middle) and either mouse anti-mCherry ( A ), or mouse anti-GFP ( B ) (which here functioned as negative controls). Secondary antibody control had no fluorescence in either green or red channels (data not shown). Left column is merged image DIC, anti-LGG-1 and anti-mCherry or anti-GFP, middle is anti-LGG-1 only (green), and right is either anti-mCherry ( A ) or anti-GFP ( B ). Data representative of one experiment (N≥5 animals in each condition).
    Figure Legend Snippet: Antibody staining in N2 (Wild Type) animals. ( A-B ) Day 1 WT animals stained with rabbit anti-LGG-1 (green middle) and either mouse anti-mCherry ( A ), or mouse anti-GFP ( B ) (which here functioned as negative controls). Secondary antibody control had no fluorescence in either green or red channels (data not shown). Left column is merged image DIC, anti-LGG-1 and anti-mCherry or anti-GFP, middle is anti-LGG-1 only (green), and right is either anti-mCherry ( A ) or anti-GFP ( B ). Data representative of one experiment (N≥5 animals in each condition).

    Techniques Used: Staining, Fluorescence

    atg-3 and atg-18 mutants have more APs and less ALs compared to wild type. ( A ) Hypodermal seam cells in wild-type (WT), atg-3(bp412) and atg-18(gk378) transgenic animals expressing mCherry::gfp::lgg-1, imaged using confocal microscopy at Day 1 of adulthood. (B-C) Quantification of autophagosomes (AP) and autolysosomes (AL) in hypodermal seam cells ( B ) and intestine ( C ) of adult Day 1 WT, atg-3(bp412) , and atg-18(gk378) animals expressing mCherry::gfp::lgg-1 . Data are the mean ± SEM of ≥29 animals combined from three experiments. ****p
    Figure Legend Snippet: atg-3 and atg-18 mutants have more APs and less ALs compared to wild type. ( A ) Hypodermal seam cells in wild-type (WT), atg-3(bp412) and atg-18(gk378) transgenic animals expressing mCherry::gfp::lgg-1, imaged using confocal microscopy at Day 1 of adulthood. (B-C) Quantification of autophagosomes (AP) and autolysosomes (AL) in hypodermal seam cells ( B ) and intestine ( C ) of adult Day 1 WT, atg-3(bp412) , and atg-18(gk378) animals expressing mCherry::gfp::lgg-1 . Data are the mean ± SEM of ≥29 animals combined from three experiments. ****p

    Techniques Used: Transgenic Assay, Expressing, Confocal Microscopy

    15) Product Images from "Timing of ESCRT-III protein recruitment and membrane scission during HIV-1 assembly"

    Article Title: Timing of ESCRT-III protein recruitment and membrane scission during HIV-1 assembly

    Journal: bioRxiv

    doi: 10.1101/281774

    ESCRT-IIIs and VPS4A transiently recruited prior to scission. ( A ) Example trace of Gag-pHluorin assembling into single VLP while the pCO 2 in the imaging media was repeatedly switched between 0% and 10% every 10 s. Moment of scission is indicated by red dashed line. CHMP4B-mCherry was temporarily recruited (indicated by grey zone) to the site of VLP assembly following the loss of pH modulation sensitivity. ( B ) Histograms of appearance and disappearance of CHMP4B prior to scission. ( C-H ) Example traces and histograms of appearance and disappearance, relative to scission of the VLP, for mCherry-CHMP2A (C and D), mCherry-CHMP2B (E and F) and mCherry-VPS4A (G and H).
    Figure Legend Snippet: ESCRT-IIIs and VPS4A transiently recruited prior to scission. ( A ) Example trace of Gag-pHluorin assembling into single VLP while the pCO 2 in the imaging media was repeatedly switched between 0% and 10% every 10 s. Moment of scission is indicated by red dashed line. CHMP4B-mCherry was temporarily recruited (indicated by grey zone) to the site of VLP assembly following the loss of pH modulation sensitivity. ( B ) Histograms of appearance and disappearance of CHMP4B prior to scission. ( C-H ) Example traces and histograms of appearance and disappearance, relative to scission of the VLP, for mCherry-CHMP2A (C and D), mCherry-CHMP2B (E and F) and mCherry-VPS4A (G and H).

    Techniques Used: Imaging

    Example traces of scission relative to recruitment of ESCRT- III or VPS4A. ( A ) Gag-pHluorin was observed as pCO 2 was cycled between 0% and 10% every 10 s. VLP scission time (red dashed line) was characterized by half drop in lock-in signal. mCherry-CHMP4B, mCherry-CHMP2A, mCherry-CHMP2B and mCherry-VPS4A recruitment (left to right panels, recruitment highlighted in grey) were simultaneously monitored during Gag assembly. ( B ) Additional traces of VLP scission during recruitment of mCherry-CHMP4B, mCherry-CHMP2A, mCherry-CHMP2B, and mCherry-VPS4A (left to right columns).
    Figure Legend Snippet: Example traces of scission relative to recruitment of ESCRT- III or VPS4A. ( A ) Gag-pHluorin was observed as pCO 2 was cycled between 0% and 10% every 10 s. VLP scission time (red dashed line) was characterized by half drop in lock-in signal. mCherry-CHMP4B, mCherry-CHMP2A, mCherry-CHMP2B and mCherry-VPS4A recruitment (left to right panels, recruitment highlighted in grey) were simultaneously monitored during Gag assembly. ( B ) Additional traces of VLP scission during recruitment of mCherry-CHMP4B, mCherry-CHMP2A, mCherry-CHMP2B, and mCherry-VPS4A (left to right columns).

    Techniques Used:

    16) Product Images from "Timing of ESCRT-III protein recruitment and membrane scission during HIV-1 assembly"

    Article Title: Timing of ESCRT-III protein recruitment and membrane scission during HIV-1 assembly

    Journal: bioRxiv

    doi: 10.1101/281774

    ESCRT-IIIs and VPS4A transiently recruited prior to scission. ( A ) Example trace of Gag-pHluorin assembling into single VLP while the pCO 2 in the imaging media was repeatedly switched between 0% and 10% every 10 s. Moment of scission is indicated by red dashed line. CHMP4B-mCherry was temporarily recruited (indicated by grey zone) to the site of VLP assembly following the loss of pH modulation sensitivity. ( B ) Histograms of appearance and disappearance of CHMP4B prior to scission. ( C-H ) Example traces and histograms of appearance and disappearance, relative to scission of the VLP, for mCherry-CHMP2A (C and D), mCherry-CHMP2B (E and F) and mCherry-VPS4A (G and H).
    Figure Legend Snippet: ESCRT-IIIs and VPS4A transiently recruited prior to scission. ( A ) Example trace of Gag-pHluorin assembling into single VLP while the pCO 2 in the imaging media was repeatedly switched between 0% and 10% every 10 s. Moment of scission is indicated by red dashed line. CHMP4B-mCherry was temporarily recruited (indicated by grey zone) to the site of VLP assembly following the loss of pH modulation sensitivity. ( B ) Histograms of appearance and disappearance of CHMP4B prior to scission. ( C-H ) Example traces and histograms of appearance and disappearance, relative to scission of the VLP, for mCherry-CHMP2A (C and D), mCherry-CHMP2B (E and F) and mCherry-VPS4A (G and H).

    Techniques Used: Imaging

    Example traces of scission relative to recruitment of ESCRT- III or VPS4A. ( A ) Gag-pHluorin was observed as pCO 2 was cycled between 0% and 10% every 10 s. VLP scission time (red dashed line) was characterized by half drop in lock-in signal. mCherry-CHMP4B, mCherry-CHMP2A, mCherry-CHMP2B and mCherry-VPS4A recruitment (left to right panels, recruitment highlighted in grey) were simultaneously monitored during Gag assembly. ( B ) Additional traces of VLP scission during recruitment of mCherry-CHMP4B, mCherry-CHMP2A, mCherry-CHMP2B, and mCherry-VPS4A (left to right columns).
    Figure Legend Snippet: Example traces of scission relative to recruitment of ESCRT- III or VPS4A. ( A ) Gag-pHluorin was observed as pCO 2 was cycled between 0% and 10% every 10 s. VLP scission time (red dashed line) was characterized by half drop in lock-in signal. mCherry-CHMP4B, mCherry-CHMP2A, mCherry-CHMP2B and mCherry-VPS4A recruitment (left to right panels, recruitment highlighted in grey) were simultaneously monitored during Gag assembly. ( B ) Additional traces of VLP scission during recruitment of mCherry-CHMP4B, mCherry-CHMP2A, mCherry-CHMP2B, and mCherry-VPS4A (left to right columns).

    Techniques Used:

    17) Product Images from "Asymmetric Mbc, active Rac1 and F-actin foci in the fusion-competent myoblasts during myoblast fusion in Drosophila"

    Article Title: Asymmetric Mbc, active Rac1 and F-actin foci in the fusion-competent myoblasts during myoblast fusion in Drosophila

    Journal: Development (Cambridge, England)

    doi: 10.1242/dev.057653

    Timelapse imaging reveals actin foci in fusion-competent myoblasts prior to fusion, and their disorganization in embryos lacking mbc . Stage 13 embryos expressed Gap-GFP and Actin-mCherry under twi-Gal4 control. ( A-G ) Wild type; single optical sections
    Figure Legend Snippet: Timelapse imaging reveals actin foci in fusion-competent myoblasts prior to fusion, and their disorganization in embryos lacking mbc . Stage 13 embryos expressed Gap-GFP and Actin-mCherry under twi-Gal4 control. ( A-G ) Wild type; single optical sections

    Techniques Used: Imaging

    18) Product Images from "Molecular basis for multimerization in the activation of the epidermal growth factor receptor"

    Article Title: Molecular basis for multimerization in the activation of the epidermal growth factor receptor

    Journal: eLife

    doi: 10.7554/eLife.14107

    Proximal and distal tail phosphorylation of EGFR in co-transfections with activator-impaired and receiver-impaired mutants. In these experiments, activator-impaired EGFR (V924R; denoted VR; salmon subunit) is fused to EGFP at the C-terminus and receiver-impaired EGFR (I682Q; denoted IQ; yellow subunit) is fused to mCherry. Phosphorylation is measured after co-transfection of both constructs, with and without EGF. ( A ) Tyr 1173, located in the distal portion of the tail, is present in both tails (denoted 1), in only the tail of receiver-impaired EGFR (denoted 2) or in only the activator-impaired tail (denoted 3). The bar graphs show phosphorylation levels for Tyr 1173. ( B ) As in Panel A, for a site in the proximal part of the tail, Tyr 992. Note that addition of EGF leads to only a very small increase in phosphorylation of Tyr 992 when the kinase bearing that residue is receiver-impaired. DOI: http://dx.doi.org/10.7554/eLife.14107.014
    Figure Legend Snippet: Proximal and distal tail phosphorylation of EGFR in co-transfections with activator-impaired and receiver-impaired mutants. In these experiments, activator-impaired EGFR (V924R; denoted VR; salmon subunit) is fused to EGFP at the C-terminus and receiver-impaired EGFR (I682Q; denoted IQ; yellow subunit) is fused to mCherry. Phosphorylation is measured after co-transfection of both constructs, with and without EGF. ( A ) Tyr 1173, located in the distal portion of the tail, is present in both tails (denoted 1), in only the tail of receiver-impaired EGFR (denoted 2) or in only the activator-impaired tail (denoted 3). The bar graphs show phosphorylation levels for Tyr 1173. ( B ) As in Panel A, for a site in the proximal part of the tail, Tyr 992. Note that addition of EGF leads to only a very small increase in phosphorylation of Tyr 992 when the kinase bearing that residue is receiver-impaired. DOI: http://dx.doi.org/10.7554/eLife.14107.014

    Techniques Used: Transfection, Cotransfection, Construct

    Dimerization of the isolated transmembrane helix. The EGFR transmembrane helix was fused to mCherry at the N-terminus and to EGFP at the C-terminus. The fraction of one-step and two-step photobleaching events of EGFP in Xenopus oocytes is shown for this construct. No multistep photobleaching events were observed. DOI: http://dx.doi.org/10.7554/eLife.14107.007
    Figure Legend Snippet: Dimerization of the isolated transmembrane helix. The EGFR transmembrane helix was fused to mCherry at the N-terminus and to EGFP at the C-terminus. The fraction of one-step and two-step photobleaching events of EGFP in Xenopus oocytes is shown for this construct. No multistep photobleaching events were observed. DOI: http://dx.doi.org/10.7554/eLife.14107.007

    Techniques Used: Isolation, Construct

    19) Product Images from "Filamin A interacting protein 1- like inhibits WNT signaling and MMP expression to suppress cancer cell invasion and metastasis"

    Article Title: Filamin A interacting protein 1- like inhibits WNT signaling and MMP expression to suppress cancer cell invasion and metastasis

    Journal: International journal of cancer. Journal international du cancer

    doi: 10.1002/ijc.28662

    Inhibition of spontaneous lung metastasis by FILIP1L A-B , Immunoblot analysis for mCherry ( A ) and FILIP1L ( B ) in the tumor lysates from tumors used in spontaneous lung metastasis assay. The numbers indicate each mouse ID. C-D , Primary tumor growth ( C ) and spontaneous lung metastasis ( D ) were measured from the mice injected with either control or FILIP1L clone following ±DOX treatment ( n .
    Figure Legend Snippet: Inhibition of spontaneous lung metastasis by FILIP1L A-B , Immunoblot analysis for mCherry ( A ) and FILIP1L ( B ) in the tumor lysates from tumors used in spontaneous lung metastasis assay. The numbers indicate each mouse ID. C-D , Primary tumor growth ( C ) and spontaneous lung metastasis ( D ) were measured from the mice injected with either control or FILIP1L clone following ±DOX treatment ( n .

    Techniques Used: Inhibition, Mouse Assay, Injection

    Development of inducible stable clones and the ovarian orthotopic model A , mCherry fluorescence measurement for control and FILIP1L clones treated with DOX for the indicated concentration. The y axis represents mCherry fluorescence measured at 587/610 nm (excitation/emission) ( n =3). B , Immunoblot analysis for FILIP1L in FILIP1L clone treated with DOX for the indicated concentration (ng/ml) and time. C , WST1 cell proliferation assay for the same cells used in section A . The y axis represents cell proliferation measured with OD 440-650nm ( n =3). D , Ovarian orthotopic model. Mouse ovary from uninjected control (left) and FILIP1L clone-injected (right) 17 days after injection. E , H E staining of ovarian orthotopic tumor shown in section D. F , qRT-PCR analysis for FILIP1L conducted on cDNA from FILIP1L clone-derived tumors (top). Drinking water containing the indicated concentration of DOX (mg/ml) was used to induce FILIP1L expression in mice. The numbers on the x axis indicate each mouse ID. The y axis represents fold change of each tumor over uninduced tumors (n=2), where each value was standardized with the housekeeping gene hRPL7. Immunoblot analysis for FILIP1L in the same tumor lysates used for qRT-PCR analysis (bottom). G , mCherry fluorescence of lungs from control clone-derived tumor-bearing mice 14 days after injection. Lungs were taken two days after giving mice drinking water containing 0.1 mg/ml DOX. White signals indicate lung metastases. H , H E staining of the same lungs used in section G . Arrows indicate large (more than 50 cells)-, medium (6-50 cells)- and small (2-5 cells)-sized lung metastases, which were subjected to counting.
    Figure Legend Snippet: Development of inducible stable clones and the ovarian orthotopic model A , mCherry fluorescence measurement for control and FILIP1L clones treated with DOX for the indicated concentration. The y axis represents mCherry fluorescence measured at 587/610 nm (excitation/emission) ( n =3). B , Immunoblot analysis for FILIP1L in FILIP1L clone treated with DOX for the indicated concentration (ng/ml) and time. C , WST1 cell proliferation assay for the same cells used in section A . The y axis represents cell proliferation measured with OD 440-650nm ( n =3). D , Ovarian orthotopic model. Mouse ovary from uninjected control (left) and FILIP1L clone-injected (right) 17 days after injection. E , H E staining of ovarian orthotopic tumor shown in section D. F , qRT-PCR analysis for FILIP1L conducted on cDNA from FILIP1L clone-derived tumors (top). Drinking water containing the indicated concentration of DOX (mg/ml) was used to induce FILIP1L expression in mice. The numbers on the x axis indicate each mouse ID. The y axis represents fold change of each tumor over uninduced tumors (n=2), where each value was standardized with the housekeeping gene hRPL7. Immunoblot analysis for FILIP1L in the same tumor lysates used for qRT-PCR analysis (bottom). G , mCherry fluorescence of lungs from control clone-derived tumor-bearing mice 14 days after injection. Lungs were taken two days after giving mice drinking water containing 0.1 mg/ml DOX. White signals indicate lung metastases. H , H E staining of the same lungs used in section G . Arrows indicate large (more than 50 cells)-, medium (6-50 cells)- and small (2-5 cells)-sized lung metastases, which were subjected to counting.

    Techniques Used: Clone Assay, Fluorescence, Concentration Assay, Proliferation Assay, Injection, Staining, Quantitative RT-PCR, Derivative Assay, Expressing, Mouse Assay

    20) Product Images from "A Brucella effector modulates the Arf6‐Rab8a GTPase cascade to promote intravacuolar replication"

    Article Title: A Brucella effector modulates the Arf6‐Rab8a GTPase cascade to promote intravacuolar replication

    Journal: The EMBO Journal

    doi: 10.15252/embj.2021107664

    Retrograde transport of Cholera toxin depends upon Arf6, Rab8a, and Rab6a′ in HeLa cells and BMMs Quantification of CTxB transport to the Golgi apparatus in either HeLa cells producing either mCherry, Arf6 T27N ‐mCherry, mCherry‐Rab8a T22N , or mCherry‐Rab6a′ T27N (A), or in BMMs producing either mCherry, Arf6 Q67L ‐mCherry, or Arf6 T27N ‐mCherry (B). Cells were transfected for 24 h (A) or transduced for 48 h (B) then incubated on ice with AlexaFluor488™‐Cholera Toxin subunit B (CTxB) for binding followed by a 20‐min (A) or 30‐min (B) incubation at 37°C to allow for CTxB retrograde transport to the Golgi apparatus (stained using an anti‐GM130 antibody). CTxB retrograde transport is expressed as percentages of cells in which CTxB colocalized with the GM130 Golgi marker. Data are means ± SD from n = 3 to 4 independent experiments, in which 100 cells were analyzed per experiment. Asterisks indicate statistically significant differences compared with mCherry‐producing cells as determined by a one‐way ANOVA with Dunnett’s multiple comparisons test ( P
    Figure Legend Snippet: Retrograde transport of Cholera toxin depends upon Arf6, Rab8a, and Rab6a′ in HeLa cells and BMMs Quantification of CTxB transport to the Golgi apparatus in either HeLa cells producing either mCherry, Arf6 T27N ‐mCherry, mCherry‐Rab8a T22N , or mCherry‐Rab6a′ T27N (A), or in BMMs producing either mCherry, Arf6 Q67L ‐mCherry, or Arf6 T27N ‐mCherry (B). Cells were transfected for 24 h (A) or transduced for 48 h (B) then incubated on ice with AlexaFluor488™‐Cholera Toxin subunit B (CTxB) for binding followed by a 20‐min (A) or 30‐min (B) incubation at 37°C to allow for CTxB retrograde transport to the Golgi apparatus (stained using an anti‐GM130 antibody). CTxB retrograde transport is expressed as percentages of cells in which CTxB colocalized with the GM130 Golgi marker. Data are means ± SD from n = 3 to 4 independent experiments, in which 100 cells were analyzed per experiment. Asterisks indicate statistically significant differences compared with mCherry‐producing cells as determined by a one‐way ANOVA with Dunnett’s multiple comparisons test ( P

    Techniques Used: Transfection, Incubation, Binding Assay, Staining, Marker

    BspF modulates an Arf6/Rab8a‐dependent TGN‐RE transport pathway that is required for Brucella replication Representative confocal fluorescence micrographs of HeLa cells transfected for 24 h to produce either mCherry or mCherry‐BspF (grayscale panels), incubated on ice with AlexaFluor™488‐Cholera Toxin subunit B (CTxB; green) and shifted to 37°C for 20 min to allow for CTxB retrograde transport to the Golgi apparatus (stained using an anti‐GM130 antibody; purple). CTxB accumulation within Golgi structures appears white in overlays. Scale bars: 10 and 2 µm (insets). Quantification of CTxB transport to the Golgi apparatus in HeLa cells producing either mCherry, mCherry‐BspF, or HA‐BspF over a 30‐min time course, expressed as percentages of cells in which CTxB colocalized with the GM130 Golgi marker, as in (A). Data are means ± SD from n = 3 independent experiments, in which 100 cells were analyzed per experiment. Asterisks indicate statistically significant differences compared with mCherry‐producing cells as determined by a two‐way ANOVA with Tukey’s multiple comparisons test ( P
    Figure Legend Snippet: BspF modulates an Arf6/Rab8a‐dependent TGN‐RE transport pathway that is required for Brucella replication Representative confocal fluorescence micrographs of HeLa cells transfected for 24 h to produce either mCherry or mCherry‐BspF (grayscale panels), incubated on ice with AlexaFluor™488‐Cholera Toxin subunit B (CTxB; green) and shifted to 37°C for 20 min to allow for CTxB retrograde transport to the Golgi apparatus (stained using an anti‐GM130 antibody; purple). CTxB accumulation within Golgi structures appears white in overlays. Scale bars: 10 and 2 µm (insets). Quantification of CTxB transport to the Golgi apparatus in HeLa cells producing either mCherry, mCherry‐BspF, or HA‐BspF over a 30‐min time course, expressed as percentages of cells in which CTxB colocalized with the GM130 Golgi marker, as in (A). Data are means ± SD from n = 3 independent experiments, in which 100 cells were analyzed per experiment. Asterisks indicate statistically significant differences compared with mCherry‐producing cells as determined by a two‐way ANOVA with Tukey’s multiple comparisons test ( P

    Techniques Used: Fluorescence, Transfection, Incubation, Staining, Marker

    Localization of Arf6‐GFP alleles to mCherry‐BspF‐labeled tubules Representative confocal fluorescence micrographs of HeLa cells co‐transfected for 24 h to produce mCherry‐BspF and either Arf6‐GFP, Arf6 Q67L ‐GFP, or Arf6 T27N ‐GFP and treated with Cytochalasin D (200 nM) for 30 min prior to fixation. Scale bars: 10 and 2 µm (insets). Localization of Arf6‐GFP, Arf6 Q67L ‐GFP, or Arf6 T27N ‐GFP to mCherry‐BspF‐labeled tubules was quantified in at least 300 individual cells per experiment. Data are means ± SD from n = 3 independent experiments.
    Figure Legend Snippet: Localization of Arf6‐GFP alleles to mCherry‐BspF‐labeled tubules Representative confocal fluorescence micrographs of HeLa cells co‐transfected for 24 h to produce mCherry‐BspF and either Arf6‐GFP, Arf6 Q67L ‐GFP, or Arf6 T27N ‐GFP and treated with Cytochalasin D (200 nM) for 30 min prior to fixation. Scale bars: 10 and 2 µm (insets). Localization of Arf6‐GFP, Arf6 Q67L ‐GFP, or Arf6 T27N ‐GFP to mCherry‐BspF‐labeled tubules was quantified in at least 300 individual cells per experiment. Data are means ± SD from n = 3 independent experiments.

    Techniques Used: Labeling, Fluorescence, Transfection

    BspF interacts with the Arf6 GTPase‐activating protein ACAP1 Yeast two‐hybrid mating screen showing interaction of BspF with a fragment of ACAP1 (amino acid residues 460–740; ACAP1 Lib ) or full‐length ACAP1 (ACAP1 FL ), compared with positive (p53/T antigen) and negative (empty vectors) control matings plated on permissive double dropout (DDO) or selective quadruple dropout (QDO) media. ACAP1 schematic indicates the region of interaction initially identified (ACAP1 Lib ). Representative co‐immunoprecipitations of HA‐BspF and myc‐ACAP1 in HeLa cells. HeLa cells were transfected to either co‐produce or individually produce HA‐BspF and myc‐ACAP1 and either HA‐BspF or myc‐ACAP1 were immunoprecipitated using either anti‐HA‐conjugated (upper panel) or anti‐myc‐conjugated (lower panel) magnetic beads following cross‐linking (+DSP) or not (‐DSP) with dithiobis[succinimidylpropionate]. Input lysates (10% of the post‐nuclear supernatant) and co‐immunoprecipitates were separated by SDS–PAGE and probed for HA‐BspF and myc‐ACAP1 by Western blotting. Representative confocal micrographs of HeLa cells transfected to produce mCherry‐BspF and GFP‐ACAP1 and treated with Cytochalasin D (200 nM) for 30 min and quantification of colocalization between mCherry‐BspF and GFP‐ACAP1. Arrows indicate areas of BspF and ACAP1 colocalization. Scale bars: 10 µm and 2 µm (insets). Data are means ± SD from n = 3 independent experiments in which 10 cells were analyzed per experiment. Pearson’s correlation coefficients were calculated from whole cells using NIH Fiji image analysis software and Coloc_2 plug‐in. Source data are available online for this figure.
    Figure Legend Snippet: BspF interacts with the Arf6 GTPase‐activating protein ACAP1 Yeast two‐hybrid mating screen showing interaction of BspF with a fragment of ACAP1 (amino acid residues 460–740; ACAP1 Lib ) or full‐length ACAP1 (ACAP1 FL ), compared with positive (p53/T antigen) and negative (empty vectors) control matings plated on permissive double dropout (DDO) or selective quadruple dropout (QDO) media. ACAP1 schematic indicates the region of interaction initially identified (ACAP1 Lib ). Representative co‐immunoprecipitations of HA‐BspF and myc‐ACAP1 in HeLa cells. HeLa cells were transfected to either co‐produce or individually produce HA‐BspF and myc‐ACAP1 and either HA‐BspF or myc‐ACAP1 were immunoprecipitated using either anti‐HA‐conjugated (upper panel) or anti‐myc‐conjugated (lower panel) magnetic beads following cross‐linking (+DSP) or not (‐DSP) with dithiobis[succinimidylpropionate]. Input lysates (10% of the post‐nuclear supernatant) and co‐immunoprecipitates were separated by SDS–PAGE and probed for HA‐BspF and myc‐ACAP1 by Western blotting. Representative confocal micrographs of HeLa cells transfected to produce mCherry‐BspF and GFP‐ACAP1 and treated with Cytochalasin D (200 nM) for 30 min and quantification of colocalization between mCherry‐BspF and GFP‐ACAP1. Arrows indicate areas of BspF and ACAP1 colocalization. Scale bars: 10 µm and 2 µm (insets). Data are means ± SD from n = 3 independent experiments in which 10 cells were analyzed per experiment. Pearson’s correlation coefficients were calculated from whole cells using NIH Fiji image analysis software and Coloc_2 plug‐in. Source data are available online for this figure.

    Techniques Used: Transfection, Immunoprecipitation, Magnetic Beads, SDS Page, Western Blot, Software

    BspF targets the tubular recycling endosome‐to‐TGN transport pathway Quantification of ss‐eGFP‐FKBP F36 M trafficking in HeLa(M)‐C1 cells transfected for 24 h with pmCherry (mCherry) or pmCherry‐BspF (mCherry‐BspF). Rapamycin was added to initiate secretory traffic of ss‐eGFP‐FKBP F36 M and its colocalization with Calnexin (ER), ERGIC‐53 (ERGIC), GM130 (Golgi), p230 (TGN), or secretory vesicles (SV) were scored over a 60‐min time course. Data are means ± SD from n = 3 independent experiments. Asterisks indicate statistically significant differences between mCherry‐ and mCherry‐BspF‐expressing cells as determined by a two‐way ANOVA with Sidak’s multiple comparisons test ( P
    Figure Legend Snippet: BspF targets the tubular recycling endosome‐to‐TGN transport pathway Quantification of ss‐eGFP‐FKBP F36 M trafficking in HeLa(M)‐C1 cells transfected for 24 h with pmCherry (mCherry) or pmCherry‐BspF (mCherry‐BspF). Rapamycin was added to initiate secretory traffic of ss‐eGFP‐FKBP F36 M and its colocalization with Calnexin (ER), ERGIC‐53 (ERGIC), GM130 (Golgi), p230 (TGN), or secretory vesicles (SV) were scored over a 60‐min time course. Data are means ± SD from n = 3 independent experiments. Asterisks indicate statistically significant differences between mCherry‐ and mCherry‐BspF‐expressing cells as determined by a two‐way ANOVA with Sidak’s multiple comparisons test ( P

    Techniques Used: Transfection, Expressing

    BspF interferes with ACAP1 to modulate Arf6 activity Representative confocal micrograph of HeLa cells transfected to produce either mCherry (red), GFP‐ACAP1 (green), and Arf6‐HA (blue; left hand panels) or mCherry‐BspF (red), GFP‐ACAP1 (green), and HA‐Arf6 (blue; right hand panels) and treated with Cytochalasin D (200 nM) for 30 min prior to fixation. Scale bars: 10 µm and 2 µm (insets). Representative Western blot analysis of co‐immunoprecipitations of myc‐ACAP1 and Arf6‐HA in the presence or absence of HA‐BspF. HeLa cells were transfected to produce Arf6‐HA and combinations of myc‐ACAP1 and HA‐BspF, or not, and myc‐ACAP1 was immunoprecipitated using anti‐myc‐conjugated magnetic beads. Input lysates (6% of post‐nuclear supernatants) and co‐immunoprecipitates were separated by SDS–PAGE and probed for Arf6‐HA, HA‐BspF and myc‐ACAP1 by Western blotting. Quantification of the Arf6/ACAP1 ratio was performed by densitometric analysis. Data are means ± SD of 3 independent experiments. The asterisk indicates a statistically significant difference ( P = 0.0017, unpaired Student’s t ‐test) between BspF‐producing and control conditions. Quantification of Arf6 activity (GTP‐Arf6) in HeLa cells transfected to produce either mCherry and Arf6‐HA or mCherry‐BspF and Arf6‐HA by G‐LISA. Data are means ± SD of n = 3 independent experiments, normalized to mCherry‐producing controls. The asterisk indicates a statistically significant difference ( P = 0.0026, unpaired Student’s t ‐test) between BspF‐producing and control conditions. Bacterial replication in BMMs transduced to either produce GFP, Arf6 Q67L ‐GFP, or Arf6 T27N ‐GFP and infected with either wild‐type (2308), Δ bspF , or complemented ∆ bspF (Δ bspF::bspF ) bacteria for 24 h. Data are means ± SD of n = 4 independent experiments, in which at least 100 cells were analyzed per experiment. Gray dots represent individual cells analyzed ( n > 300); black dots indicate means of individual experiments. Asterisks indicate statistically significant differences ( P
    Figure Legend Snippet: BspF interferes with ACAP1 to modulate Arf6 activity Representative confocal micrograph of HeLa cells transfected to produce either mCherry (red), GFP‐ACAP1 (green), and Arf6‐HA (blue; left hand panels) or mCherry‐BspF (red), GFP‐ACAP1 (green), and HA‐Arf6 (blue; right hand panels) and treated with Cytochalasin D (200 nM) for 30 min prior to fixation. Scale bars: 10 µm and 2 µm (insets). Representative Western blot analysis of co‐immunoprecipitations of myc‐ACAP1 and Arf6‐HA in the presence or absence of HA‐BspF. HeLa cells were transfected to produce Arf6‐HA and combinations of myc‐ACAP1 and HA‐BspF, or not, and myc‐ACAP1 was immunoprecipitated using anti‐myc‐conjugated magnetic beads. Input lysates (6% of post‐nuclear supernatants) and co‐immunoprecipitates were separated by SDS–PAGE and probed for Arf6‐HA, HA‐BspF and myc‐ACAP1 by Western blotting. Quantification of the Arf6/ACAP1 ratio was performed by densitometric analysis. Data are means ± SD of 3 independent experiments. The asterisk indicates a statistically significant difference ( P = 0.0017, unpaired Student’s t ‐test) between BspF‐producing and control conditions. Quantification of Arf6 activity (GTP‐Arf6) in HeLa cells transfected to produce either mCherry and Arf6‐HA or mCherry‐BspF and Arf6‐HA by G‐LISA. Data are means ± SD of n = 3 independent experiments, normalized to mCherry‐producing controls. The asterisk indicates a statistically significant difference ( P = 0.0026, unpaired Student’s t ‐test) between BspF‐producing and control conditions. Bacterial replication in BMMs transduced to either produce GFP, Arf6 Q67L ‐GFP, or Arf6 T27N ‐GFP and infected with either wild‐type (2308), Δ bspF , or complemented ∆ bspF (Δ bspF::bspF ) bacteria for 24 h. Data are means ± SD of n = 4 independent experiments, in which at least 100 cells were analyzed per experiment. Gray dots represent individual cells analyzed ( n > 300); black dots indicate means of individual experiments. Asterisks indicate statistically significant differences ( P

    Techniques Used: Activity Assay, Transfection, Western Blot, Immunoprecipitation, Magnetic Beads, SDS Page, Infection

    BspF localizes to the endosomal recycling compartment Representative confocal fluorescence micrograph of HeLa cells co‐transfected for 24 h to produce mCherry‐BspF and GFP‐BspF and treated with Cytochalasin D (200 nM) for 30 min prior to fixation. Scale bars: 10 and 2 µm (insets). Representative confocal fluorescence micrographs of HeLa cells co‐transfected for 24 h to produce mCherry‐BspF and either GFP‐MICAL‐L1, GFP‐STX16, GFP‐STX6, or GFP‐VAMP3 and treated with Cytochalasin D (200 nM) for 30 min prior to fixation. Scale bars: 10 and 2 µm (insets). Localization of GFP‐MICAL‐L1, GFP‐STX16, GFP‐STX6, or GFP‐VAMP3 to mCherry‐BspF‐labeled tubules was quantified in at least 300 individual cells per experiment. Data are means ± SD from n = 3 independent experiments. Representative confocal fluorescence micrographs of HeLa cells co‐transfected for 24 h to produce mCherry‐BspF and either GFP‐Rab11a or VAMP4‐GFP and treated with Cytochalasin D (200 nM) for 30 min prior to fixation. Scale bars: 10 and 2 µm (insets). Localization of GFP‐Rab11a or VAMP4‐GFP to mCherry‐BspF‐labeled tubules was quantified in at least 300 individual cells per experiment. Data are means ± SD from n = 3 independent experiments.
    Figure Legend Snippet: BspF localizes to the endosomal recycling compartment Representative confocal fluorescence micrograph of HeLa cells co‐transfected for 24 h to produce mCherry‐BspF and GFP‐BspF and treated with Cytochalasin D (200 nM) for 30 min prior to fixation. Scale bars: 10 and 2 µm (insets). Representative confocal fluorescence micrographs of HeLa cells co‐transfected for 24 h to produce mCherry‐BspF and either GFP‐MICAL‐L1, GFP‐STX16, GFP‐STX6, or GFP‐VAMP3 and treated with Cytochalasin D (200 nM) for 30 min prior to fixation. Scale bars: 10 and 2 µm (insets). Localization of GFP‐MICAL‐L1, GFP‐STX16, GFP‐STX6, or GFP‐VAMP3 to mCherry‐BspF‐labeled tubules was quantified in at least 300 individual cells per experiment. Data are means ± SD from n = 3 independent experiments. Representative confocal fluorescence micrographs of HeLa cells co‐transfected for 24 h to produce mCherry‐BspF and either GFP‐Rab11a or VAMP4‐GFP and treated with Cytochalasin D (200 nM) for 30 min prior to fixation. Scale bars: 10 and 2 µm (insets). Localization of GFP‐Rab11a or VAMP4‐GFP to mCherry‐BspF‐labeled tubules was quantified in at least 300 individual cells per experiment. Data are means ± SD from n = 3 independent experiments.

    Techniques Used: Fluorescence, Transfection, Labeling

    21) Product Images from "Nr2f-dependent allocation of ventricular cardiomyocyte and pharyngeal muscle progenitors"

    Article Title: Nr2f-dependent allocation of ventricular cardiomyocyte and pharyngeal muscle progenitors

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1007962

    Nr2f1a functions redundantly with Nr2f2 to restrict ventricular CM number. (A-D) Frontal view of hearts from nr2f1a wt ; nr2f2 wt , nr2f1a mut ; nr2f2 wt , nr2f1a mut ; nr2f2 het , and nr2f1a mut ; nr2f2 mut embryos at 48 hpf with immunohistochemistry (IHC). Atria (AMHC)—green. Ventricles (MHC)—red. (E) CM number from hearts of nr2f1a ctrl ; nr2f2 ctrl (n = 24), nr2f1a mut ; nr2f2 wt (n = 10), and nr2f1a mut ; nr2f2 het (n = 16), and nr2f1a mut ; nr2f2 mut (n = 10) embryos with the myl7 : h2afva-mCherry transgene at 48 hpf. Although embryos WT for nr2f1a and nr2f2 alleles are shown in all images for comparison to nr2f1a ; nr2f2 mutants, other allele combinations were indistinguishable from WT and pooled for data analysis. Therefore, nr2f1a ctrl ; nr2f2 ctrl indicates analysis performed with the combination of nr2f1a wt ; nr2f2 wt ; nr2f1a het ; nr2f2 wt , nr2f1a wt ; nr2f2 het , and nr2f1a het ; nr2f2 het embryos.
    Figure Legend Snippet: Nr2f1a functions redundantly with Nr2f2 to restrict ventricular CM number. (A-D) Frontal view of hearts from nr2f1a wt ; nr2f2 wt , nr2f1a mut ; nr2f2 wt , nr2f1a mut ; nr2f2 het , and nr2f1a mut ; nr2f2 mut embryos at 48 hpf with immunohistochemistry (IHC). Atria (AMHC)—green. Ventricles (MHC)—red. (E) CM number from hearts of nr2f1a ctrl ; nr2f2 ctrl (n = 24), nr2f1a mut ; nr2f2 wt (n = 10), and nr2f1a mut ; nr2f2 het (n = 16), and nr2f1a mut ; nr2f2 mut (n = 10) embryos with the myl7 : h2afva-mCherry transgene at 48 hpf. Although embryos WT for nr2f1a and nr2f2 alleles are shown in all images for comparison to nr2f1a ; nr2f2 mutants, other allele combinations were indistinguishable from WT and pooled for data analysis. Therefore, nr2f1a ctrl ; nr2f2 ctrl indicates analysis performed with the combination of nr2f1a wt ; nr2f2 wt ; nr2f1a het ; nr2f2 wt , nr2f1a wt ; nr2f2 het , and nr2f1a het ; nr2f2 het embryos.

    Techniques Used: Immunohistochemistry

    22) Product Images from "Ca2+ signals initiate at immobile IP3 receptors adjacent to ER-plasma membrane junctions"

    Article Title: Ca2+ signals initiate at immobile IP3 receptors adjacent to ER-plasma membrane junctions

    Journal: Nature Communications

    doi: 10.1038/s41467-017-01644-8

    STIM1 translocates to ER-PM junctions adjacent to immobile IP 3 R puncta. a , b TIRFM images show that thapsigargin (Tg, 1 µM, 5 min) causes formation of STIM1-mCherry puncta at ER-PM junctions (i). Immobile IP 3 Rs (ii, white, identified from overlays of pseudocoloured EGFP-IP 3 R distribution at 30-s intervals) abut STIM1 puncta (iii). Enlarged image of the boxed area shows all immobile EGFP-IP 3 R1 (arrows) and STIM1-mCherry without pseudocolours for clarity (iv). Scale bars = 10 µm (i–iii), 2 µm (iv). c Similar overlay images from three additional Tg-treated cells, with all immobile IP 3 R punta identified with arrows. Scale bars = 2 µm. d Fluorescence intensity profiles for EGFP-IP 3 R1 measured at 30-s intervals (green and magenta) and STIM1-mCherry for transects drawn across Tg-treated cells. Results show that immobile IP 3 Rs (white, where green and magenta coincide) and STIM1 after store depletion are juxtaposed, but not perfectly aligned. Distances (μm) between the peaks of the fluorescence intensity for STIM1 and immobile IP 3 R are shown; 84 ± 9% (mean ± SD, n = 3 cells) of the centroids of immobile EGFP-IP 3 R1 puncta were within twice their radius (2 r = 0.64–0.96 μm) of a STIM1 punctum. e STIM1-mCherry fluorescence was measured before ( F 0 ) and after Tg treatment ( F Tg ) at ROI with twice the radius of underlying mobile or immobile EGFP-IP 3 R1 puncta. Summary results show the change in mCherry fluorescence (Δ F = ( F Tg − F 0 )/ F 0 , mean ± SEM, n = 3 cells, 29–33 puncta). * P
    Figure Legend Snippet: STIM1 translocates to ER-PM junctions adjacent to immobile IP 3 R puncta. a , b TIRFM images show that thapsigargin (Tg, 1 µM, 5 min) causes formation of STIM1-mCherry puncta at ER-PM junctions (i). Immobile IP 3 Rs (ii, white, identified from overlays of pseudocoloured EGFP-IP 3 R distribution at 30-s intervals) abut STIM1 puncta (iii). Enlarged image of the boxed area shows all immobile EGFP-IP 3 R1 (arrows) and STIM1-mCherry without pseudocolours for clarity (iv). Scale bars = 10 µm (i–iii), 2 µm (iv). c Similar overlay images from three additional Tg-treated cells, with all immobile IP 3 R punta identified with arrows. Scale bars = 2 µm. d Fluorescence intensity profiles for EGFP-IP 3 R1 measured at 30-s intervals (green and magenta) and STIM1-mCherry for transects drawn across Tg-treated cells. Results show that immobile IP 3 Rs (white, where green and magenta coincide) and STIM1 after store depletion are juxtaposed, but not perfectly aligned. Distances (μm) between the peaks of the fluorescence intensity for STIM1 and immobile IP 3 R are shown; 84 ± 9% (mean ± SD, n = 3 cells) of the centroids of immobile EGFP-IP 3 R1 puncta were within twice their radius (2 r = 0.64–0.96 μm) of a STIM1 punctum. e STIM1-mCherry fluorescence was measured before ( F 0 ) and after Tg treatment ( F Tg ) at ROI with twice the radius of underlying mobile or immobile EGFP-IP 3 R1 puncta. Summary results show the change in mCherry fluorescence (Δ F = ( F Tg − F 0 )/ F 0 , mean ± SEM, n = 3 cells, 29–33 puncta). * P

    Techniques Used: Fluorescence

    Depletion of ER Ca 2+ stores causes native STIM1 to accumulate at functional ER-PM junctions adjacent to immobile IP 3 R puncta. a , b Representative TIRFM images of EGFP-IP 3 R1 HeLa cells fixed and immunostained for STIM1 before ( a ) or after treatment with thapsigargin (Tg, 1 µM, 15 min) to deplete the ER of Ca 2+ ( b ). Overlaid images of Tg-treated cells show no significant co-localization of STIM1 and IP 3 R puncta (Pearson’s coefficient with Costes’ automatic threshold: 0.331 ± 0.026, n = 7 cells). c Distribution of mobile (green and magenta) and immobile (white) IP 3 R puncta in Tg-treated cell. Scale bars ( a – c ) = 10 µm. d Enlargements of the boxed regions in b show that immobile IP 3 R puncta (identified before fixation ( c ), with all shown by arrowheads) abut STIM1 puncta without coinciding with them. Scale bars = 2 µm. e Fluorescence intensity profiles for EGFP-IP 3 R1 and STIM1 across the lines shown in d . Distances (μm) between the peaks of the fluorescence intensity for STIM1 and immobile IP 3 R are shown. f Co-localization of CFP-STIM1 (pseudocoloured green) and mCherry-Orai1 (red) puncta in a Tg-treated HeLa cell. We used tagged proteins because available antibodies do not reliably detect endogenous Orai1. Scale bar = 10 µm (2 μm in enlargement)
    Figure Legend Snippet: Depletion of ER Ca 2+ stores causes native STIM1 to accumulate at functional ER-PM junctions adjacent to immobile IP 3 R puncta. a , b Representative TIRFM images of EGFP-IP 3 R1 HeLa cells fixed and immunostained for STIM1 before ( a ) or after treatment with thapsigargin (Tg, 1 µM, 15 min) to deplete the ER of Ca 2+ ( b ). Overlaid images of Tg-treated cells show no significant co-localization of STIM1 and IP 3 R puncta (Pearson’s coefficient with Costes’ automatic threshold: 0.331 ± 0.026, n = 7 cells). c Distribution of mobile (green and magenta) and immobile (white) IP 3 R puncta in Tg-treated cell. Scale bars ( a – c ) = 10 µm. d Enlargements of the boxed regions in b show that immobile IP 3 R puncta (identified before fixation ( c ), with all shown by arrowheads) abut STIM1 puncta without coinciding with them. Scale bars = 2 µm. e Fluorescence intensity profiles for EGFP-IP 3 R1 and STIM1 across the lines shown in d . Distances (μm) between the peaks of the fluorescence intensity for STIM1 and immobile IP 3 R are shown. f Co-localization of CFP-STIM1 (pseudocoloured green) and mCherry-Orai1 (red) puncta in a Tg-treated HeLa cell. We used tagged proteins because available antibodies do not reliably detect endogenous Orai1. Scale bar = 10 µm (2 μm in enlargement)

    Techniques Used: Functional Assay, Fluorescence

    Endogenous IP 3 R1s form puncta. a In-gel fluorescence of lysates from EGFP-IP 3 R1 HeLa cells (GR) and control (WT) cells demonstrates that the only fluorescence is associated with EGFP-IP 3 R1 (green arrow). Results typical of four gels. Positions of selected M r markers (kDa) are shown ( a , c , d ). b TIRFM images of EGFP-IP 3 R1 HeLa cells showing a marker for the ER lumen (mCherry-ER). The merged image and an enlargement of the boxed area show co-localization of EGFP-IP 3 R1 with mCherry-ER (Pearson’s coefficient with Costes’ automatic threshold = 0.93 ± 0.02; Costes P value = 1.00, n = 4 cells). Scale bar = 5 µm (2 µm for enlargement). c Western blots (WBs) for IP 3 R1-3 show expression of tagged (green arrow, ~290 kDa) and untagged (black arrow, ~260 kDa) IP 3 R1 in GR and WT cells, respectively. Expression of IP 3 R subtypes in GR cells is shown relative to control (WT) cells (%, mean ± SD, n = 3 for IP 3 R2 and IP 3 R3, n = 4 for IP 3 R1). Comparisons of band intensities using paired Student’s t -tests indicated no significant differences between WT and EGFP-IP 3 R1 cells. d WB (IP 3 R1-3 antibodies) from lysates of EGFP-IP 3 R1 HeLa cells after immunoprecipitation with GFP-Trap. Eluate lanes were loaded with sample equivalent to 1.5 times the amounts loaded in the lysate lanes. Numbers show % of each subtype detected in the pull-down ( n = 2). e Photobleaching of a punctum showing the final bleaching step (bracket) and the initial fluorescence (dashed line) used to calculate the total number of fluorophores ( n ). FU, fluorescence units. f Single-step photobleaching results (284 puncta from five cells, Supplementary Fig. 5 ) were used to calculate the number of tetrameric IP 3 Rs per punctum (8.4 ± 7)
    Figure Legend Snippet: Endogenous IP 3 R1s form puncta. a In-gel fluorescence of lysates from EGFP-IP 3 R1 HeLa cells (GR) and control (WT) cells demonstrates that the only fluorescence is associated with EGFP-IP 3 R1 (green arrow). Results typical of four gels. Positions of selected M r markers (kDa) are shown ( a , c , d ). b TIRFM images of EGFP-IP 3 R1 HeLa cells showing a marker for the ER lumen (mCherry-ER). The merged image and an enlargement of the boxed area show co-localization of EGFP-IP 3 R1 with mCherry-ER (Pearson’s coefficient with Costes’ automatic threshold = 0.93 ± 0.02; Costes P value = 1.00, n = 4 cells). Scale bar = 5 µm (2 µm for enlargement). c Western blots (WBs) for IP 3 R1-3 show expression of tagged (green arrow, ~290 kDa) and untagged (black arrow, ~260 kDa) IP 3 R1 in GR and WT cells, respectively. Expression of IP 3 R subtypes in GR cells is shown relative to control (WT) cells (%, mean ± SD, n = 3 for IP 3 R2 and IP 3 R3, n = 4 for IP 3 R1). Comparisons of band intensities using paired Student’s t -tests indicated no significant differences between WT and EGFP-IP 3 R1 cells. d WB (IP 3 R1-3 antibodies) from lysates of EGFP-IP 3 R1 HeLa cells after immunoprecipitation with GFP-Trap. Eluate lanes were loaded with sample equivalent to 1.5 times the amounts loaded in the lysate lanes. Numbers show % of each subtype detected in the pull-down ( n = 2). e Photobleaching of a punctum showing the final bleaching step (bracket) and the initial fluorescence (dashed line) used to calculate the total number of fluorophores ( n ). FU, fluorescence units. f Single-step photobleaching results (284 puncta from five cells, Supplementary Fig. 5 ) were used to calculate the number of tetrameric IP 3 Rs per punctum (8.4 ± 7)

    Techniques Used: Fluorescence, Marker, Western Blot, Expressing, Immunoprecipitation

    IP 3 Rs form mobile and immobile puncta. a Time-lapse TIRFM images (0.6-s intervals) of EGFP-IP 3 R1 in cells expressing mCherry-ER. Track of a single particle, with the first and last positions shown by white and yellow arrows, respectively. Scale bar = 5 µm. b Representative epifluorescence image of an EGFP-IP 3 R1 HeLa cell with perinuclear (blue) and peripheral (magenta) regions highlighted for FRAP analysis (circular bleached area, radius = 1.84 μm). The boxed area is enlarged to show pre- and post-bleach (after 120 s) images of the peripheral region. Scale bars = 5 µm. c Normalized fluorescence intensities recorded from peripheral or perinuclear regions in a typical FRAP experiment with live and fixed EGFP-IP 3 R1 HeLa cells. d , e Summary results show mobile fractions ( M f , mean ± SEM) ( d ) and diffusion coefficients ( D , mean and all values) ( e ) for perinuclear (25 cells) and peripheral regions (26 cells). **** P
    Figure Legend Snippet: IP 3 Rs form mobile and immobile puncta. a Time-lapse TIRFM images (0.6-s intervals) of EGFP-IP 3 R1 in cells expressing mCherry-ER. Track of a single particle, with the first and last positions shown by white and yellow arrows, respectively. Scale bar = 5 µm. b Representative epifluorescence image of an EGFP-IP 3 R1 HeLa cell with perinuclear (blue) and peripheral (magenta) regions highlighted for FRAP analysis (circular bleached area, radius = 1.84 μm). The boxed area is enlarged to show pre- and post-bleach (after 120 s) images of the peripheral region. Scale bars = 5 µm. c Normalized fluorescence intensities recorded from peripheral or perinuclear regions in a typical FRAP experiment with live and fixed EGFP-IP 3 R1 HeLa cells. d , e Summary results show mobile fractions ( M f , mean ± SEM) ( d ) and diffusion coefficients ( D , mean and all values) ( e ) for perinuclear (25 cells) and peripheral regions (26 cells). **** P

    Techniques Used: Expressing, Fluorescence, Diffusion-based Assay

    23) Product Images from "Rab35 GTPase recruits NPD52 to autophagy targets"

    Article Title: Rab35 GTPase recruits NPD52 to autophagy targets

    Journal: The EMBO Journal

    doi: 10.15252/embj.201796463

    Analysis of knockdown and knockout of Rab35 A, B Knockout of Rab27 (A) and Rab35 (B) in HeLa cells. C HeLa wild‐type and Rab35 knockout cells were infected with GAS for 4 h, fixed, immunostained with anti‐Rab35 antibody, and stained with DAPI. Arrowheads indicate Rab35‐positive GAS. D Time course of Rab35‐dependent NDP52 recruitment to GAS. HeLa wild‐type and Rab35 knockout cells expressing mCherry‐NDP52 were infected with GAS. The percentages of cells with NDP52‐positive GAS were quantified. E miR‐RNAi knockdown of Rab35. F, G Control (miR‐Control) and Rab35‐knocked down (miR‐Rab35) HeLa cells expressing mCherry‐NDP52 (F) or mCherry‐LC3 (G) were infected with GAS. Cells were analyzed with confocal microscopy and quantified the percentages of cells with NDP52‐positive or LC3‐positive GAS. H Subcellular localization of endogenous Rab35. I HeLa wild‐type and Rab35 knockout cells were treated with Magic Red Cathepsin B (Magic Red CatB, in red) for 2 h. Quantification of the intensity of the Magic Red Cathepsin B signal, presented as a percentage of control (wild‐type cells). J Wild‐type and Rab35 knockout HeLa cells were immunostained with against EEA1 and LAMP1 (left images) or treated with Lysotracker (100 nM) for 90 min (right images). K Knockout of ATG5 in HeLa cells. Data information: Data in (D, F, G, and I) are mean ± SEM from three independent experiments. Data were tested by two‐tailed Student's t ‐test: * P
    Figure Legend Snippet: Analysis of knockdown and knockout of Rab35 A, B Knockout of Rab27 (A) and Rab35 (B) in HeLa cells. C HeLa wild‐type and Rab35 knockout cells were infected with GAS for 4 h, fixed, immunostained with anti‐Rab35 antibody, and stained with DAPI. Arrowheads indicate Rab35‐positive GAS. D Time course of Rab35‐dependent NDP52 recruitment to GAS. HeLa wild‐type and Rab35 knockout cells expressing mCherry‐NDP52 were infected with GAS. The percentages of cells with NDP52‐positive GAS were quantified. E miR‐RNAi knockdown of Rab35. F, G Control (miR‐Control) and Rab35‐knocked down (miR‐Rab35) HeLa cells expressing mCherry‐NDP52 (F) or mCherry‐LC3 (G) were infected with GAS. Cells were analyzed with confocal microscopy and quantified the percentages of cells with NDP52‐positive or LC3‐positive GAS. H Subcellular localization of endogenous Rab35. I HeLa wild‐type and Rab35 knockout cells were treated with Magic Red Cathepsin B (Magic Red CatB, in red) for 2 h. Quantification of the intensity of the Magic Red Cathepsin B signal, presented as a percentage of control (wild‐type cells). J Wild‐type and Rab35 knockout HeLa cells were immunostained with against EEA1 and LAMP1 (left images) or treated with Lysotracker (100 nM) for 90 min (right images). K Knockout of ATG5 in HeLa cells. Data information: Data in (D, F, G, and I) are mean ± SEM from three independent experiments. Data were tested by two‐tailed Student's t ‐test: * P

    Techniques Used: Knock-Out, Infection, Staining, Expressing, Confocal Microscopy, Two Tailed Test

    Rab35 localizes to bacteria‐containing endosomes prior to membrane damage A HeLa cells were infected with GAS for 4 h and stained with anti‐galectin 3 and anti‐Rab35. Scale bars, 10 μm. B Immunoelectron microscopy analysis revealed colloidal gold particles, indicating the presence of GFP‐Rab35 around invading GAS. Scale bars, 0.5 μm. C Live cell images of HeLa cells expressing EmGFP‐Rab35 and mCherry‐galectin 3, or mCherry‐Rab35, and EmGFP‐galectin 3 during GAS infection. Arrowheads indicate Rab35‐positive GAS. Scale bars, 2 μm. D, E HeLa cells expressed mCherry‐NDP52 or‐Rab35 were treated with DMSO or 4 μM BX795 for 24 h and infected with GAS for indicated times. The percentages of cells with NDP52 (D)‐ or Rab35 (E)‐positive bacteria were quantified. F, G HEK293T cells transfected with mKGN‐NDP52 and mKGC‐Rab35 or mKGN‐NDP52ΔZn and mKGC‐Rab35 were treated or untreated with BX795, and the green fluorescence was analyzed by microscopy. Representative micrographs (F) and quantification of fluorescence intensity (G). Scale bars, 10 μm. White lines indicate the outline of the cells. Data information: Date in (D, E and G) were tested by two‐tailed Student's t ‐test and error bars indicate the mean ± SEM from three independent experiments: ** P
    Figure Legend Snippet: Rab35 localizes to bacteria‐containing endosomes prior to membrane damage A HeLa cells were infected with GAS for 4 h and stained with anti‐galectin 3 and anti‐Rab35. Scale bars, 10 μm. B Immunoelectron microscopy analysis revealed colloidal gold particles, indicating the presence of GFP‐Rab35 around invading GAS. Scale bars, 0.5 μm. C Live cell images of HeLa cells expressing EmGFP‐Rab35 and mCherry‐galectin 3, or mCherry‐Rab35, and EmGFP‐galectin 3 during GAS infection. Arrowheads indicate Rab35‐positive GAS. Scale bars, 2 μm. D, E HeLa cells expressed mCherry‐NDP52 or‐Rab35 were treated with DMSO or 4 μM BX795 for 24 h and infected with GAS for indicated times. The percentages of cells with NDP52 (D)‐ or Rab35 (E)‐positive bacteria were quantified. F, G HEK293T cells transfected with mKGN‐NDP52 and mKGC‐Rab35 or mKGN‐NDP52ΔZn and mKGC‐Rab35 were treated or untreated with BX795, and the green fluorescence was analyzed by microscopy. Representative micrographs (F) and quantification of fluorescence intensity (G). Scale bars, 10 μm. White lines indicate the outline of the cells. Data information: Date in (D, E and G) were tested by two‐tailed Student's t ‐test and error bars indicate the mean ± SEM from three independent experiments: ** P

    Techniques Used: Infection, Staining, Immuno-Electron Microscopy, Expressing, Transfection, Fluorescence, Microscopy, Two Tailed Test

    24) Product Images from "Identification of SH2B1? as a focal adhesion protein that regulates focal adhesion size and number"

    Article Title: Identification of SH2B1? as a focal adhesion protein that regulates focal adhesion size and number

    Journal: Journal of Cell Science

    doi: 10.1242/jcs.081547

    Ser161 and/or Ser165 regulate the focal adhesion dynamics of SH2B1β . ( A ) Live 3T3-F442A cells expressing mCherry–vinculin and GFP-tagged SH2B1β, SH2B1β (S161A, S165A) or SH2B1β (S165E) were imaged by confocal microscopy.
    Figure Legend Snippet: Ser161 and/or Ser165 regulate the focal adhesion dynamics of SH2B1β . ( A ) Live 3T3-F442A cells expressing mCherry–vinculin and GFP-tagged SH2B1β, SH2B1β (S161A, S165A) or SH2B1β (S165E) were imaged by confocal microscopy.

    Techniques Used: Expressing, Confocal Microscopy

    25) Product Images from "Imaging endogenous synaptic proteins in primary neurons at single-cell resolution using CRISPR/Cas9"

    Article Title: Imaging endogenous synaptic proteins in primary neurons at single-cell resolution using CRISPR/Cas9

    Journal: Molecular Biology of the Cell

    doi: 10.1091/mbc.E19-04-0223

    Application of CRISPR/Cas9-mediated fluorescent tag knock-in for monitoring transcriptional and translational expression changes. (A) Western blot analysis of whole-cell lysates from 21 DIV primary hippocampal neurons nucleofected with PSD-95 targeting vector (EGFP), CAG-mCherry, and CBh-Cas9/U6-gRNA (PSD-95), and treated with BDNF (50 ng/ml) or the corresponding vehicle control for 1 d prior to harvest. Immunoblots were probed with indicated antibodies, and densitometric analysis of blots was performed to determine the fold differences in endogenous PSD-95 protein expression tagged with EGFP. (B) Western blot analysis of whole-cell lysates from 16 DIV primary cortical neurons nucleofected with PSD-95 targeting vector (EGFP), CAG-mCherry, and CBh-Cas9/U6-gRNA (PSD-95), and treated with 20 mM KCl or the corresponding vehicle control for 15 min at 15 DIV. Immunoblots were probed with indicated antibodies, and densitometric analysis of blots was performed to determine the fold differences in endogenous PSD-95 protein expression tagged with EGFP. The graphs show quantitative densitometry and statistical analysis of the Western blot bands; n = 3 (3 blot membranes from 3 sample sets); mean ± SEM (error bars); *p
    Figure Legend Snippet: Application of CRISPR/Cas9-mediated fluorescent tag knock-in for monitoring transcriptional and translational expression changes. (A) Western blot analysis of whole-cell lysates from 21 DIV primary hippocampal neurons nucleofected with PSD-95 targeting vector (EGFP), CAG-mCherry, and CBh-Cas9/U6-gRNA (PSD-95), and treated with BDNF (50 ng/ml) or the corresponding vehicle control for 1 d prior to harvest. Immunoblots were probed with indicated antibodies, and densitometric analysis of blots was performed to determine the fold differences in endogenous PSD-95 protein expression tagged with EGFP. (B) Western blot analysis of whole-cell lysates from 16 DIV primary cortical neurons nucleofected with PSD-95 targeting vector (EGFP), CAG-mCherry, and CBh-Cas9/U6-gRNA (PSD-95), and treated with 20 mM KCl or the corresponding vehicle control for 15 min at 15 DIV. Immunoblots were probed with indicated antibodies, and densitometric analysis of blots was performed to determine the fold differences in endogenous PSD-95 protein expression tagged with EGFP. The graphs show quantitative densitometry and statistical analysis of the Western blot bands; n = 3 (3 blot membranes from 3 sample sets); mean ± SEM (error bars); *p

    Techniques Used: CRISPR, Knock-In, Expressing, Western Blot, Plasmid Preparation

    Correlations between expression levels of pre- and postsynaptic proteins in cultured neurons where synaptic proteins are ectopically overexpressed. (A) Western blot analysis of whole-cell lysates from 16 DIV rat primary hippocampal neurons nucleofected with CAG-mCherry alone or CAG-mCherry plus CAG-PSD-95-EGFP. Immunoblots were probed with indicated antibodies, and densitometric analysis of blots was performed to determine the fold differences in endogenous Syp expression. (B) Western blot analysis of whole-cell lysates from 16 DIV rat primary hippocampal neurons nucleofected with CAG-EGFP alone or CAG-EGFP plus CAG-Syp-mCherry. Immunoblots were probed with indicated antibodies, and densitometric analysis of blots was performed to determine the fold differences in endogenous PSD-95 expression. The graphs show quantitative densitometry and statistical analysis of the Western blot bands; n = 3 (three blot membranes from three sample sets); mean ± SEM (error bars); * p
    Figure Legend Snippet: Correlations between expression levels of pre- and postsynaptic proteins in cultured neurons where synaptic proteins are ectopically overexpressed. (A) Western blot analysis of whole-cell lysates from 16 DIV rat primary hippocampal neurons nucleofected with CAG-mCherry alone or CAG-mCherry plus CAG-PSD-95-EGFP. Immunoblots were probed with indicated antibodies, and densitometric analysis of blots was performed to determine the fold differences in endogenous Syp expression. (B) Western blot analysis of whole-cell lysates from 16 DIV rat primary hippocampal neurons nucleofected with CAG-EGFP alone or CAG-EGFP plus CAG-Syp-mCherry. Immunoblots were probed with indicated antibodies, and densitometric analysis of blots was performed to determine the fold differences in endogenous PSD-95 expression. The graphs show quantitative densitometry and statistical analysis of the Western blot bands; n = 3 (three blot membranes from three sample sets); mean ± SEM (error bars); * p

    Techniques Used: Expressing, Cell Culture, Western Blot

    Fluorescent tag knock-in in primary cultured rat neurons using a combined method of CRISPR/Cas9 genome-editing and nucleofection. (A) Schematic overview of the protocol for fluorescent tag knock-in in rat primary cortical and hippocampal neurons. (B) Structures of the rat PSD-95 locus and the knock-in targeting vector to produce a PSD-95-mCherry fusion protein. The predicted Cas9-gRNA cutting positions are indicated with scissor-cutting symbols. (C) Structures of the rat Syp locus and the knock-in targeting vector to produce a Syp-EGFP fusion protein. The predicted Cas9-gRNA cutting positions are indicated with scissor-cutting symbols. (D, E) Western blot analysis of whole-cell lysates from 21 DIV rat primary cortical or hippocampal neurons nucleofected with the indicated plasmids. Immunoblots were probed with indicated antibodies. A PSD-95-mCherry fusion protein (∼110 kDa) was detected only in the presence of CBh-Cas9/U6-gRNA (PSD-95), and a Syp-EGFP fusion protein (∼65 kDa) was detected only in the presence of CBh-Cas9/U6-gRNA (Syp). Intensities of Western blot bands corresponding to tagged and wild-type PSD-95 (a, b and c, d) or Syp (e, f and g, h) were quantified by densitometric analysis, and the tagging efficiency (a/b, c/d, e/f, and g/h) were calculated and shown at the bottom. (F) Cortical (top panels) or hippocampal (bottom panels) neurons nucleofected with the indicated plasmids were cultured for 21 d. Fixed neurons were stained with anti-GFP (green), anti-mCherry (magenta in color panels, or black in black and white panels), and anti-PSD-95 (blue) antibodies. mCherry-positive cells were observed only in the presence of CBh-Cas9/U6-gRNA (PSD-95). Bar, 50 μm. Residual background signals observed in the mCherry channel were derived from nonspecific antibody staining background (see Supplemental Figure S2). (G) Cortical (top panels) or hippocampal (bottom panels) neurons nucleofected with the indicated plasmids were cultured for 21 d. Fixed neurons were stained with anti-GFP (green in color panels, or black in black and white panels), anti-mCherry (magenta), and anti-Syp (blue) antibodies. EGFP-positive cells were observed only in the presence of CBh-Cas9/U6-gRNA (Syp). Bar, 100 μm. Residual background signals observed in the GFP channel were derived from nonspecific antibody staining background (see Supplemental Figure S2).
    Figure Legend Snippet: Fluorescent tag knock-in in primary cultured rat neurons using a combined method of CRISPR/Cas9 genome-editing and nucleofection. (A) Schematic overview of the protocol for fluorescent tag knock-in in rat primary cortical and hippocampal neurons. (B) Structures of the rat PSD-95 locus and the knock-in targeting vector to produce a PSD-95-mCherry fusion protein. The predicted Cas9-gRNA cutting positions are indicated with scissor-cutting symbols. (C) Structures of the rat Syp locus and the knock-in targeting vector to produce a Syp-EGFP fusion protein. The predicted Cas9-gRNA cutting positions are indicated with scissor-cutting symbols. (D, E) Western blot analysis of whole-cell lysates from 21 DIV rat primary cortical or hippocampal neurons nucleofected with the indicated plasmids. Immunoblots were probed with indicated antibodies. A PSD-95-mCherry fusion protein (∼110 kDa) was detected only in the presence of CBh-Cas9/U6-gRNA (PSD-95), and a Syp-EGFP fusion protein (∼65 kDa) was detected only in the presence of CBh-Cas9/U6-gRNA (Syp). Intensities of Western blot bands corresponding to tagged and wild-type PSD-95 (a, b and c, d) or Syp (e, f and g, h) were quantified by densitometric analysis, and the tagging efficiency (a/b, c/d, e/f, and g/h) were calculated and shown at the bottom. (F) Cortical (top panels) or hippocampal (bottom panels) neurons nucleofected with the indicated plasmids were cultured for 21 d. Fixed neurons were stained with anti-GFP (green), anti-mCherry (magenta in color panels, or black in black and white panels), and anti-PSD-95 (blue) antibodies. mCherry-positive cells were observed only in the presence of CBh-Cas9/U6-gRNA (PSD-95). Bar, 50 μm. Residual background signals observed in the mCherry channel were derived from nonspecific antibody staining background (see Supplemental Figure S2). (G) Cortical (top panels) or hippocampal (bottom panels) neurons nucleofected with the indicated plasmids were cultured for 21 d. Fixed neurons were stained with anti-GFP (green in color panels, or black in black and white panels), anti-mCherry (magenta), and anti-Syp (blue) antibodies. EGFP-positive cells were observed only in the presence of CBh-Cas9/U6-gRNA (Syp). Bar, 100 μm. Residual background signals observed in the GFP channel were derived from nonspecific antibody staining background (see Supplemental Figure S2).

    Techniques Used: Knock-In, Cell Culture, CRISPR, Plasmid Preparation, Western Blot, Staining, Derivative Assay

    Morphological analysis of hippocampal neurons expressing fluorescently tagged PSD-95. (A) Primary cultured hippocampal neurons nucleofected with the indicated plasmid constructs were treated with BDNF (50 ng/ml) or the corresponding vehicle control for 1 d prior to fixation at 21 DIV. Fixed neurons were stained with anti-GFP (green), anti-mCherry (magenta), and anti-PSD-95 (blue) antibodies. Global morphology of dendrites is visualized by CAG-mCherry fluorescence. Bar, 20 μm. (B, C) Quantitative analysis of the numbers of dendritic spines in neurons in A. Dendritic spines were defined as
    Figure Legend Snippet: Morphological analysis of hippocampal neurons expressing fluorescently tagged PSD-95. (A) Primary cultured hippocampal neurons nucleofected with the indicated plasmid constructs were treated with BDNF (50 ng/ml) or the corresponding vehicle control for 1 d prior to fixation at 21 DIV. Fixed neurons were stained with anti-GFP (green), anti-mCherry (magenta), and anti-PSD-95 (blue) antibodies. Global morphology of dendrites is visualized by CAG-mCherry fluorescence. Bar, 20 μm. (B, C) Quantitative analysis of the numbers of dendritic spines in neurons in A. Dendritic spines were defined as

    Techniques Used: Expressing, Cell Culture, Plasmid Preparation, Construct, Staining, Fluorescence

    Validation of CRISPR/Cas9-mediated knock-in of fluorescent genes into cultured neurons. (A, F) Structures of the rat PSD-95 (A) and Syp (F) loci and the knock-in constructs to produce EGFP and mCherry fusion proteins. The gRNA targeting sequences are underlined, and the PAM sequences are shown in red. The predicted Cas9-gRNA cutting positions are indicated with a scissor-cutting symbols. These two gRNAs for each gene were used together to increase the knock-in efficiency. Locations of genotyping primers sets to detect EGFP or mCherry knock-in alleles of PSD-95 (EGFP: rPsd-F1 and EGFP-R1; mCherry: rPSD-F1 and mCherry-R1) and Syp (EGFP: rSyp-F1 and EGFP-R1; mCherry: rSyp-F1 and mCherry-R1) are shown. (B–E) Genomic PCR analysis of nucleofected neurons. Cortical (B, D) or hippocampal (C, E) neurons were nucleofected with three plasmids: PSD-95 targeting vector (EGFP), CAG-mCherry, and CBh-Cas9 with or without gRNAs for PSD-95 (B, C), or PSD-95 targeting vector (mCherry), CAG-EGFP, and CBh-Cas9 with or without gRNAs for PSD-95 (D, E). Genomic DNA samples extracted from the cultured neurons at 21 DIV were subjected to PCR analysis. PCR primer sets were used to detect the fluorescent protein knock-in alleles, transfected targeting vectors, and endogenous rat Actb , respectively. Agarose gel electrophoresis of PCR products are shown: lane 1, DNA prepared from the primary neuron cultures nucleofected without CBh-Cas9/U6-gRNA (PSD-95); lane 2, DNA prepared from the neuron primary cultures nucleofected with CBh-Cas9/U6-gRNA (PSD-95); lane 3, wild-type rat genomic DNA; lane 4, PSD-95 targeting vector plasmid DNA. (G–J) Genomic PCR analysis of nucleofected neurons. Cortical (G, I) or hippocampal (H, J) neurons were nucleofected with three plasmids: Syp targeting vector (EGFP), CAG-mCherry, and CBh-Cas9 with or without gRNAs for Syp (G, H), or Syp targeting vector (mCherry), CAG-EGFP, and CBh-Cas9 with or without gRNAs for Syp (I, J). Genomic DNA samples extracted from the cultured neurons at 21 DIV were subjected to PCR analysis. PCR primer sets were used to detect the fluorescent protein knock-in alleles, transfected targeting vectors, and endogenous rat Actb , respectively. Agarose gel electrophoresis of PCR products are shown: lane 1, DNA prepared from the primary neuron cultures nucleofected without CBh-Cas9/U6-gRNA (Syp); lane 2, DNA prepared from the neuron primary cultures nucleofected with CBh-Cas9/U6-gRNA (Syp); lane 3, wild-type rat genomic DNA; lane 4, Syp targeting vector plasmid DNA.
    Figure Legend Snippet: Validation of CRISPR/Cas9-mediated knock-in of fluorescent genes into cultured neurons. (A, F) Structures of the rat PSD-95 (A) and Syp (F) loci and the knock-in constructs to produce EGFP and mCherry fusion proteins. The gRNA targeting sequences are underlined, and the PAM sequences are shown in red. The predicted Cas9-gRNA cutting positions are indicated with a scissor-cutting symbols. These two gRNAs for each gene were used together to increase the knock-in efficiency. Locations of genotyping primers sets to detect EGFP or mCherry knock-in alleles of PSD-95 (EGFP: rPsd-F1 and EGFP-R1; mCherry: rPSD-F1 and mCherry-R1) and Syp (EGFP: rSyp-F1 and EGFP-R1; mCherry: rSyp-F1 and mCherry-R1) are shown. (B–E) Genomic PCR analysis of nucleofected neurons. Cortical (B, D) or hippocampal (C, E) neurons were nucleofected with three plasmids: PSD-95 targeting vector (EGFP), CAG-mCherry, and CBh-Cas9 with or without gRNAs for PSD-95 (B, C), or PSD-95 targeting vector (mCherry), CAG-EGFP, and CBh-Cas9 with or without gRNAs for PSD-95 (D, E). Genomic DNA samples extracted from the cultured neurons at 21 DIV were subjected to PCR analysis. PCR primer sets were used to detect the fluorescent protein knock-in alleles, transfected targeting vectors, and endogenous rat Actb , respectively. Agarose gel electrophoresis of PCR products are shown: lane 1, DNA prepared from the primary neuron cultures nucleofected without CBh-Cas9/U6-gRNA (PSD-95); lane 2, DNA prepared from the neuron primary cultures nucleofected with CBh-Cas9/U6-gRNA (PSD-95); lane 3, wild-type rat genomic DNA; lane 4, PSD-95 targeting vector plasmid DNA. (G–J) Genomic PCR analysis of nucleofected neurons. Cortical (G, I) or hippocampal (H, J) neurons were nucleofected with three plasmids: Syp targeting vector (EGFP), CAG-mCherry, and CBh-Cas9 with or without gRNAs for Syp (G, H), or Syp targeting vector (mCherry), CAG-EGFP, and CBh-Cas9 with or without gRNAs for Syp (I, J). Genomic DNA samples extracted from the cultured neurons at 21 DIV were subjected to PCR analysis. PCR primer sets were used to detect the fluorescent protein knock-in alleles, transfected targeting vectors, and endogenous rat Actb , respectively. Agarose gel electrophoresis of PCR products are shown: lane 1, DNA prepared from the primary neuron cultures nucleofected without CBh-Cas9/U6-gRNA (Syp); lane 2, DNA prepared from the neuron primary cultures nucleofected with CBh-Cas9/U6-gRNA (Syp); lane 3, wild-type rat genomic DNA; lane 4, Syp targeting vector plasmid DNA.

    Techniques Used: CRISPR, Knock-In, Cell Culture, Construct, Polymerase Chain Reaction, Plasmid Preparation, Transfection, Agarose Gel Electrophoresis

    Multiplex labeling of endogenous PSD-95 and Syp with fluorescent reporters in a single neuron. (A) Primary cultured hippocampal neurons nucleofected with Syp targeting vector (EGFP), PSD-95 targeting vector (mCherry), CBh-Cas9/gRNA (Syp), and CBh-Cas9/gRNA (PSD-95) were fixed at 21 DIV and stained with anti-GFP, anti-mCherry, and anti-MAP2 (blue; somatodendritic marker) antibodies. With epifluorescence microscopy, a small number of EGFP and mCherry double-positive neurons were observed. Bar, 50 μm. (B) Localizations of fluorescently labeled Syp and PSD-95 proteins within a single neuron of primary cultured hippocampal neurons at 21 DIV. Immunofluorescently labeled endogenous ones (left panels), ectopically expressed ones in a single neuron nucleofected with CAG-Syp-mCherry and CAG-PSD-95-EGFP (middle panels), and genetically labeled endogenous ones in a single neuron nucleofected with Syp targeting vector (mCherry), PSD-95 targeting vector (EGFP), CBh-Cas9/gRNAs (Syp), and CBh-Cas9/gRNAs (PSD-95) (right panels) were observed with confocal laser scanning microscopy. Fixed cells were stained with anti-PSD-95 (green) and anti-Syp (red) antibodies (left panels) or anti-GFP (green) and anti-mCherry (red) antibodies (middle and right panels). F-actin was stained with Alexa-647–conjugated phalloidin to visualize neuronal morphology (blue). Bar, 20 μm. (C) Dual-color superresolution microscopy of a primary cultured hippocampal neuron to observe protein localization of Syp (red) and PSD-95 (green) within a single process. Bar, 1 μm. (D) Live-cell TIRF microscopy of a single hippocampal neuron that underwent simultaneous knock-in of the EGFP and mCherry fluorescent genes into PSD-95 and Syp loci, respectively. Images were acquired every 3 min starting from 1 h before until 1 h after the onset of 50 ng/ml BDNF application. See Supplemental Video S1. Images of a single process at the starting time of the video ((–) BDNF 0 min), at 1 h ((–) BDNF 60 min), at the onset of the BDNF application ((+) BDNF 0 min), and at 1 h after the BDNF application ((+) BDNF 60 min) are shown. Arrows indicate distal and proximal directions of a process. Newly formed fluorescent puncta emerged after BDNF treatment are labeled with arrowheads and capital letters, and preexisting puncta before BDNF treatment are labeled with arrows and small letters. Bar, 3 μm.
    Figure Legend Snippet: Multiplex labeling of endogenous PSD-95 and Syp with fluorescent reporters in a single neuron. (A) Primary cultured hippocampal neurons nucleofected with Syp targeting vector (EGFP), PSD-95 targeting vector (mCherry), CBh-Cas9/gRNA (Syp), and CBh-Cas9/gRNA (PSD-95) were fixed at 21 DIV and stained with anti-GFP, anti-mCherry, and anti-MAP2 (blue; somatodendritic marker) antibodies. With epifluorescence microscopy, a small number of EGFP and mCherry double-positive neurons were observed. Bar, 50 μm. (B) Localizations of fluorescently labeled Syp and PSD-95 proteins within a single neuron of primary cultured hippocampal neurons at 21 DIV. Immunofluorescently labeled endogenous ones (left panels), ectopically expressed ones in a single neuron nucleofected with CAG-Syp-mCherry and CAG-PSD-95-EGFP (middle panels), and genetically labeled endogenous ones in a single neuron nucleofected with Syp targeting vector (mCherry), PSD-95 targeting vector (EGFP), CBh-Cas9/gRNAs (Syp), and CBh-Cas9/gRNAs (PSD-95) (right panels) were observed with confocal laser scanning microscopy. Fixed cells were stained with anti-PSD-95 (green) and anti-Syp (red) antibodies (left panels) or anti-GFP (green) and anti-mCherry (red) antibodies (middle and right panels). F-actin was stained with Alexa-647–conjugated phalloidin to visualize neuronal morphology (blue). Bar, 20 μm. (C) Dual-color superresolution microscopy of a primary cultured hippocampal neuron to observe protein localization of Syp (red) and PSD-95 (green) within a single process. Bar, 1 μm. (D) Live-cell TIRF microscopy of a single hippocampal neuron that underwent simultaneous knock-in of the EGFP and mCherry fluorescent genes into PSD-95 and Syp loci, respectively. Images were acquired every 3 min starting from 1 h before until 1 h after the onset of 50 ng/ml BDNF application. See Supplemental Video S1. Images of a single process at the starting time of the video ((–) BDNF 0 min), at 1 h ((–) BDNF 60 min), at the onset of the BDNF application ((+) BDNF 0 min), and at 1 h after the BDNF application ((+) BDNF 60 min) are shown. Arrows indicate distal and proximal directions of a process. Newly formed fluorescent puncta emerged after BDNF treatment are labeled with arrowheads and capital letters, and preexisting puncta before BDNF treatment are labeled with arrows and small letters. Bar, 3 μm.

    Techniques Used: Multiplex Assay, Labeling, Cell Culture, Plasmid Preparation, Staining, Marker, Epifluorescence Microscopy, Confocal Laser Scanning Microscopy, Microscopy, Knock-In

    26) Product Images from "Precise Mapping of the CD95 Pre-Ligand Assembly Domain"

    Article Title: Precise Mapping of the CD95 Pre-Ligand Assembly Domain

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0046236

    The CD95 self-association domain covers the residues 43 to 66. A. Schematic representation of the different CD95-mCherry constructs. B. Supernatants from HEK cells transfected with the constructs depicted in A were fractionated by gel filtration using a S-300 HR column. Seventeen fractions were harvested and analyzed by immunoblot analysis (anti-DsRed). C. Densitometry analyses were performed on the immunoblots shown in B using Fiji software. For each construct, the estimated quaternary structure is depicted. D. Supernatants from HEK cells transfected with the constructs depicted in A were fractionated by gel filtration using a S-200 HR column. Twenty-one fractions were harvested and analyzed by immunoblot analysis (anti-DsRed). E. Densitometry analyses were performed on the immunoblots shown in D using Fiji software. For each construct, the estimated quaternary structure is depicted.
    Figure Legend Snippet: The CD95 self-association domain covers the residues 43 to 66. A. Schematic representation of the different CD95-mCherry constructs. B. Supernatants from HEK cells transfected with the constructs depicted in A were fractionated by gel filtration using a S-300 HR column. Seventeen fractions were harvested and analyzed by immunoblot analysis (anti-DsRed). C. Densitometry analyses were performed on the immunoblots shown in B using Fiji software. For each construct, the estimated quaternary structure is depicted. D. Supernatants from HEK cells transfected with the constructs depicted in A were fractionated by gel filtration using a S-200 HR column. Twenty-one fractions were harvested and analyzed by immunoblot analysis (anti-DsRed). E. Densitometry analyses were performed on the immunoblots shown in D using Fiji software. For each construct, the estimated quaternary structure is depicted.

    Techniques Used: Construct, Transfection, Filtration, Western Blot, Software

    27) Product Images from "Seipin Is a Discrete Homooligomer †"

    Article Title: Seipin Is a Discrete Homooligomer †

    Journal: Biochemistry

    doi: 10.1021/bi1013003

    Hydrodynamic behavior of seipin-mCherry and seipin[G225P]-mCherry. (A) Rows 1 and 2: Immunoblots of fractions from detergent H 2 O– or D 2 O–sucrose gradients of seipin-mCherry (“wild-type” column) and seipin[G225P]-mCherry
    Figure Legend Snippet: Hydrodynamic behavior of seipin-mCherry and seipin[G225P]-mCherry. (A) Rows 1 and 2: Immunoblots of fractions from detergent H 2 O– or D 2 O–sucrose gradients of seipin-mCherry (“wild-type” column) and seipin[G225P]-mCherry

    Techniques Used: Western Blot

    Hydrodynamic behavior of seipin-myc13 and seipin[G225P]-myc13. Identical to except seipins were tagged with 13 tandem copies of the myc epitope (in the chromosome to use the endogenous promoter) instead of overexpressing seipin-mCherry forms
    Figure Legend Snippet: Hydrodynamic behavior of seipin-myc13 and seipin[G225P]-myc13. Identical to except seipins were tagged with 13 tandem copies of the myc epitope (in the chromosome to use the endogenous promoter) instead of overexpressing seipin-mCherry forms

    Techniques Used:

    Seipin can self-associate. Anti-myc immunoblots from detergent glycerol gradients. Besides expressing seipin-myc13 from the endogenous chromosomal promoter, cells also oveexpressed either seipin-mCherry (top row) or seipin[G225P]-mCherry (bottom row).
    Figure Legend Snippet: Seipin can self-associate. Anti-myc immunoblots from detergent glycerol gradients. Besides expressing seipin-myc13 from the endogenous chromosomal promoter, cells also oveexpressed either seipin-mCherry (top row) or seipin[G225P]-mCherry (bottom row).

    Techniques Used: Western Blot, Expressing

    28) Product Images from "High content screening identifies monensin as an EMT-selective cytotoxic compound"

    Article Title: High content screening identifies monensin as an EMT-selective cytotoxic compound

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-38019-y

    High content screen for EMT-selective compounds. ( a ) High content screen design. ( b ) Assay performance was assessed with a half-half plate using following parameters: the signal-to-noise (S/N) ratio = (µn − µp)/SDn, the signal-to-background (S/B) ratio = µn/µp, and the Z’ factor. ( c ) Results of the screen representing relative cell viability of TEM 4-18 mCherry (y axis) and PC-3E GFP (x axis) cells. Positions of selected compounds evaluated are indicated. ( d – f ) Cells cultured separately were treated for 72 h with serial dilution of salinomycin (n ≥ 5) ( d ), monensin (n ≥ 24) ( e ) or nigericin (n ≥ 5) ( f ). Relative cell viability was plotted against the logarithm of drug concentration. Data represent mean values ± SEM.
    Figure Legend Snippet: High content screen for EMT-selective compounds. ( a ) High content screen design. ( b ) Assay performance was assessed with a half-half plate using following parameters: the signal-to-noise (S/N) ratio = (µn − µp)/SDn, the signal-to-background (S/B) ratio = µn/µp, and the Z’ factor. ( c ) Results of the screen representing relative cell viability of TEM 4-18 mCherry (y axis) and PC-3E GFP (x axis) cells. Positions of selected compounds evaluated are indicated. ( d – f ) Cells cultured separately were treated for 72 h with serial dilution of salinomycin (n ≥ 5) ( d ), monensin (n ≥ 24) ( e ) or nigericin (n ≥ 5) ( f ). Relative cell viability was plotted against the logarithm of drug concentration. Data represent mean values ± SEM.

    Techniques Used: Transmission Electron Microscopy, Cell Culture, Serial Dilution, Concentration Assay

    29) Product Images from "Genetic inducible fate mapping in larval zebrafish reveals origins of adult insulin-producing ?-cells"

    Article Title: Genetic inducible fate mapping in larval zebrafish reveals origins of adult insulin-producing ?-cells

    Journal: Development (Cambridge, England)

    doi: 10.1242/dev.059097

    Regulation of Cre-recombinase activity in the pancreas. ( A ) Schematic of Notch responsive Cre-driver transgene Tp1:creER T2 and ( B ) the Cre-responder transgene β actin:loxP-stop-loxP-hmgb1-mCherry . (A) Tol2 arms (open triangles) flank 12 RBP-Jκ-binding
    Figure Legend Snippet: Regulation of Cre-recombinase activity in the pancreas. ( A ) Schematic of Notch responsive Cre-driver transgene Tp1:creER T2 and ( B ) the Cre-responder transgene β actin:loxP-stop-loxP-hmgb1-mCherry . (A) Tol2 arms (open triangles) flank 12 RBP-Jκ-binding

    Techniques Used: Activity Assay, Binding Assay

    Ventral bud forms from distinct populations of Notch-responsive progenitors and Ptf1a-expressing cells. ptf1a:eGFP; Tp1:hmgb1-mCherry embryo imaged by confocal microscopy at 33 hpf (A,B) and 37 hpf (C). Embryo is positioned at 45° (halfway between
    Figure Legend Snippet: Ventral bud forms from distinct populations of Notch-responsive progenitors and Ptf1a-expressing cells. ptf1a:eGFP; Tp1:hmgb1-mCherry embryo imaged by confocal microscopy at 33 hpf (A,B) and 37 hpf (C). Embryo is positioned at 45° (halfway between

    Techniques Used: Expressing, Confocal Microscopy

    30) Product Images from "A molecular toggle after exocytosis sequesters the presynaptic syntaxin1a molecules involved in prior vesicle fusion"

    Article Title: A molecular toggle after exocytosis sequesters the presynaptic syntaxin1a molecules involved in prior vesicle fusion

    Journal: Nature Communications

    doi: 10.1038/ncomms6774

    Syntaxin1a and Munc18-1 are in an immobile complex in resting synapses. ( a ) FCS and FCCS were used to probe syntaxin1a–munc18-1 interaction in synapses on a rapid timescale. The dimensions of the excitation spot ( W 0 and Z 0 ) are determined experimentally using purified fluorescent proteins ( Supplementary Fig. 3 ). FCS provides high spatiotemporal resolution of protein diffusion rate and mode (i) interaction (ii) and reaction kinetics (iii). ( b ) Representative cortical neuron transfected with munc18-1-EGFP (left panel) showing varicosities (white circles) where measurements were acquired. Scale bar, 5 μm. Example spontaneous mEPSC trace (right panel). ( c ) Representative autocorrelation fits of unfused EGFP and mCherry molecules in neuronal synapses, autocorrelation trace of the same data (insert). No cross-correlation could be detected. ( d ) Fit residuals of the data in c . ( e ) Box plot of EGFP and mCherry diffusion in resting synapses. ( f ) Representative autocorrelation and cross-correlation fit (blue) result of syntaxin1a (green) and munc18-1 (red), raw autocorrelation trace of the same data (insert). ( h ) Fit residuals of the data in f . ( i ) Box plot of syntaxin1a and munc18-1 diffusion data in resting synapses (simplified bar charts showing means and s.e.m. for each treatment are presented in Supplementary Fig. 3 ). The rates of diffusion were calculated from the derived autocorrelation curves; centre lines represent the median; cross indicates the mean; box limits indicate the 25th and 75th percentiles and whiskers extend to minimum and maximum points. Notches are 95% confidence intervals that two medians differ. There are no statistical differences between groups. ( j ) Graphical representation of the calculated deviation from Brownian motion of each sample diffusion data. EGFP and mCherry in synapses diffuse with a Brownian motion (indicated by the blue dashed line), indicative of free diffusion in the synaptic cytosol, whereas syntaxin1a and munc18-1 molecules deviate from this behavior, indicative of membrane anchoring and thus interaction (as monomeric munc18-1 is a soluble protein). In this plot (left), the central black bars indicate the median, with error bars indicating s.e.m. Right panel: plotting ‘Deviation from Brownian motion’ against diffusion rate reveals two populations of mCherry-munc18-1 behaviours in synapses; both populations have low diffusion rates but differ in diffusional behavior — one group of molecules diffuse in a directed manner and the other appears caged.
    Figure Legend Snippet: Syntaxin1a and Munc18-1 are in an immobile complex in resting synapses. ( a ) FCS and FCCS were used to probe syntaxin1a–munc18-1 interaction in synapses on a rapid timescale. The dimensions of the excitation spot ( W 0 and Z 0 ) are determined experimentally using purified fluorescent proteins ( Supplementary Fig. 3 ). FCS provides high spatiotemporal resolution of protein diffusion rate and mode (i) interaction (ii) and reaction kinetics (iii). ( b ) Representative cortical neuron transfected with munc18-1-EGFP (left panel) showing varicosities (white circles) where measurements were acquired. Scale bar, 5 μm. Example spontaneous mEPSC trace (right panel). ( c ) Representative autocorrelation fits of unfused EGFP and mCherry molecules in neuronal synapses, autocorrelation trace of the same data (insert). No cross-correlation could be detected. ( d ) Fit residuals of the data in c . ( e ) Box plot of EGFP and mCherry diffusion in resting synapses. ( f ) Representative autocorrelation and cross-correlation fit (blue) result of syntaxin1a (green) and munc18-1 (red), raw autocorrelation trace of the same data (insert). ( h ) Fit residuals of the data in f . ( i ) Box plot of syntaxin1a and munc18-1 diffusion data in resting synapses (simplified bar charts showing means and s.e.m. for each treatment are presented in Supplementary Fig. 3 ). The rates of diffusion were calculated from the derived autocorrelation curves; centre lines represent the median; cross indicates the mean; box limits indicate the 25th and 75th percentiles and whiskers extend to minimum and maximum points. Notches are 95% confidence intervals that two medians differ. There are no statistical differences between groups. ( j ) Graphical representation of the calculated deviation from Brownian motion of each sample diffusion data. EGFP and mCherry in synapses diffuse with a Brownian motion (indicated by the blue dashed line), indicative of free diffusion in the synaptic cytosol, whereas syntaxin1a and munc18-1 molecules deviate from this behavior, indicative of membrane anchoring and thus interaction (as monomeric munc18-1 is a soluble protein). In this plot (left), the central black bars indicate the median, with error bars indicating s.e.m. Right panel: plotting ‘Deviation from Brownian motion’ against diffusion rate reveals two populations of mCherry-munc18-1 behaviours in synapses; both populations have low diffusion rates but differ in diffusional behavior — one group of molecules diffuse in a directed manner and the other appears caged.

    Techniques Used: Purification, Diffusion-based Assay, Transfection, Derivative Assay

    Munc18-1 interacts with syntaxin1a in varicosities via the syntaxin1a N-terminal peptide motif but can use alternative interaction modes in neuronal processes. ( a ) BoNT/C-treated neurons transfected with mCherry-munc18-1 and EGFP-Syntaxin1a S14E CR; both proteins have a localization not dissimilar from the non-treated mCherry-munc18-1-EGFP-syntaxin1a. Scale bar, 1 μm. The boxed area is zoomed in the right panels (scale bar, 1 μm). ( b ) Munc18-1 and syntaxin1a diffusion rates measured in synaptic regions. The diffusion rate of munc18-1 increased significantly compared with syntaxin1a S14E CR indicating that the two proteins no longer interact. In axons, the interaction between the two proteins is stabilized with both co-diffusing with an identical rate and mode. ( c ) Representative autocorrelation fits of mCherry-munc18-1 and EGFP-syntaxin1a S14E CR in synapses. The diffusion curve of munc18-1 no longer has a sharp decay indicating a switch in behaviour to free diffusion. ( d ) Representative autocorrelation fits of mCherry-munc18-1 and EGFP-syntaxin1a S14E CR in neuronal processes. Both proteins have similar rates and modes of diffusion. ( e ) Cartoon summarizing this finding: in the resting synapse, munc18-1 is predominantly associated with open syntaxin1a via the N-peptide interaction.
    Figure Legend Snippet: Munc18-1 interacts with syntaxin1a in varicosities via the syntaxin1a N-terminal peptide motif but can use alternative interaction modes in neuronal processes. ( a ) BoNT/C-treated neurons transfected with mCherry-munc18-1 and EGFP-Syntaxin1a S14E CR; both proteins have a localization not dissimilar from the non-treated mCherry-munc18-1-EGFP-syntaxin1a. Scale bar, 1 μm. The boxed area is zoomed in the right panels (scale bar, 1 μm). ( b ) Munc18-1 and syntaxin1a diffusion rates measured in synaptic regions. The diffusion rate of munc18-1 increased significantly compared with syntaxin1a S14E CR indicating that the two proteins no longer interact. In axons, the interaction between the two proteins is stabilized with both co-diffusing with an identical rate and mode. ( c ) Representative autocorrelation fits of mCherry-munc18-1 and EGFP-syntaxin1a S14E CR in synapses. The diffusion curve of munc18-1 no longer has a sharp decay indicating a switch in behaviour to free diffusion. ( d ) Representative autocorrelation fits of mCherry-munc18-1 and EGFP-syntaxin1a S14E CR in neuronal processes. Both proteins have similar rates and modes of diffusion. ( e ) Cartoon summarizing this finding: in the resting synapse, munc18-1 is predominantly associated with open syntaxin1a via the N-peptide interaction.

    Techniques Used: Transfection, Diffusion-based Assay

    Syntaxin1a and munc18-1 interaction mode switches dynamically post exocytosis. ( a ) Left panel — FCS autocorrelation data show identical diffusion rates of syntaxin1a and munc18-1 in synapses before and during maximal stimulation. Right panel—Syntaxin1a and munc18-1 molecular diffusion models differ before and during maximal stimulation, with a 100% enrichment of molecular complexes exhibiting caged motion and low diffusion rates during stimulation (lower left quandrant of graph). ( b ) Destabilizing the N-peptide interaction results in a dissociation of syntaxin1a and munc18-1 specifically in synapses but a rapid interaction mode switch occurs during maximal stimulation. Left panel—FCS autocorrelation data deliver significantly different diffusion rates for munc18-1 and syntaxin1a in resting synapse, that converge during depolarizations. Right panel — EGFP-syntaxin1a S14E CR and munc18-1 molecular diffusion during maximal stimulation: munc18-1 molecules significantly slow during stimulation. Inset: expanded axes scales showing munc18-1 and EGFP-syntaxin1a S14E CR diffusion rates and modes in resting synapses. Symbols are as for a . Notably, the slow, caged population of molecules is absent during stimulations, in contrast to the wild-type syntaxin1a system. ( c ) Representative FLIM analyses of FRET between wt EGFP-syntaxin1a (donor) and mCherry-munc18-1 (acceptor); molecular interaction was reported as a mean donor fluorescence lifetime shorter than the mean non-FRET control across neurons (blue line); this threshold (solid vertical line) did not alter during maximal stimulation. Reduced FRET was detected between EGFP-syntaxin1a S14E CR and mCherry-munc18-1 before stimulation (red line) but this increased significantly after maximal stimulation (dashed grey line). This induction of interaction was abolished in the presence of NEM to inhibit SNARE disassembly post exocytosis (grey line). ( d ) FLIM maps illustrating spatial restriction of syntaxin1a S14E CR – munc18-1 interactions to varicosities after maximal stimulation are dependent on SNARE disassembly. Colour bar indicates donor fluorescence lifetime — shorter (blue) values indicate FRET and direct protein–protein interaction. Scale 1 ns (blue) — 2 ns (red). Scale bar, 5 μm. ( e ) Cartoon incorporating our data into a refined model of the syntaxin1a – munc18-1 interaction pathway.
    Figure Legend Snippet: Syntaxin1a and munc18-1 interaction mode switches dynamically post exocytosis. ( a ) Left panel — FCS autocorrelation data show identical diffusion rates of syntaxin1a and munc18-1 in synapses before and during maximal stimulation. Right panel—Syntaxin1a and munc18-1 molecular diffusion models differ before and during maximal stimulation, with a 100% enrichment of molecular complexes exhibiting caged motion and low diffusion rates during stimulation (lower left quandrant of graph). ( b ) Destabilizing the N-peptide interaction results in a dissociation of syntaxin1a and munc18-1 specifically in synapses but a rapid interaction mode switch occurs during maximal stimulation. Left panel—FCS autocorrelation data deliver significantly different diffusion rates for munc18-1 and syntaxin1a in resting synapse, that converge during depolarizations. Right panel — EGFP-syntaxin1a S14E CR and munc18-1 molecular diffusion during maximal stimulation: munc18-1 molecules significantly slow during stimulation. Inset: expanded axes scales showing munc18-1 and EGFP-syntaxin1a S14E CR diffusion rates and modes in resting synapses. Symbols are as for a . Notably, the slow, caged population of molecules is absent during stimulations, in contrast to the wild-type syntaxin1a system. ( c ) Representative FLIM analyses of FRET between wt EGFP-syntaxin1a (donor) and mCherry-munc18-1 (acceptor); molecular interaction was reported as a mean donor fluorescence lifetime shorter than the mean non-FRET control across neurons (blue line); this threshold (solid vertical line) did not alter during maximal stimulation. Reduced FRET was detected between EGFP-syntaxin1a S14E CR and mCherry-munc18-1 before stimulation (red line) but this increased significantly after maximal stimulation (dashed grey line). This induction of interaction was abolished in the presence of NEM to inhibit SNARE disassembly post exocytosis (grey line). ( d ) FLIM maps illustrating spatial restriction of syntaxin1a S14E CR – munc18-1 interactions to varicosities after maximal stimulation are dependent on SNARE disassembly. Colour bar indicates donor fluorescence lifetime — shorter (blue) values indicate FRET and direct protein–protein interaction. Scale 1 ns (blue) — 2 ns (red). Scale bar, 5 μm. ( e ) Cartoon incorporating our data into a refined model of the syntaxin1a – munc18-1 interaction pathway.

    Techniques Used: Diffusion-based Assay, Fluorescence

    Munc18-1 and syntaxin1a single-molecule distribution in neurons. ( a ) Model of the proposed munc18-1 (red) and syntaxin1a (green) interactions at a synapse. Munc18-1 binds syntaxin1a in closed confirmation, preventing syntaxin1a from entering the SNARE complex and inhibiting membrane fusion (i) The binding mode of munc18-1 bound to syntaxin1a switches from the closed to open mode, allowing the formation of the binary t-SNARE complex (ii) SNARE binary complex with t-SNARE partner SNAP-25 in grey (iii). Ternary complex of open syntaxin1a, SNAP-25 and synaptobrevin required for membrane fusion (iv). Question marks represent uncertain points of syntaxin-munc18-1 molecular interaction in the synaptic vesicle cycle. ( b ) Schematic illustrating the syntaxin1a and munc18-1 constructs used in this study. ( c ) dSTORM map of immunodetected syntaxin1a (Alexa-647, upper left) and synapsin-EGFP (upper right) in cortical neurons. A merged image (grey, upper right) shows overlap. Lower panel: a dSTORM molecular map from the boxed area in the merge image shows the locations of single immunodetected syntaxin1a molecules concentrated in synapsin-positive synapses with sparse distribution elsewhere in the neuron. ( d ) PALM localization maps show single molecules of PA-mCherry-syntaxin1a or PA-mCherry-munc18-1 co-clustering with either EGFP-munc18-1 or EGFP-syntaxin1a, respectively. The boxed regions are displayed at a higher zoom (top panels). Scale bars, 500 nm. The distribution of heterologous munc18-1 and syntaxin1a fluorescent fusion protein molecules is similar to the endogenous pattern.
    Figure Legend Snippet: Munc18-1 and syntaxin1a single-molecule distribution in neurons. ( a ) Model of the proposed munc18-1 (red) and syntaxin1a (green) interactions at a synapse. Munc18-1 binds syntaxin1a in closed confirmation, preventing syntaxin1a from entering the SNARE complex and inhibiting membrane fusion (i) The binding mode of munc18-1 bound to syntaxin1a switches from the closed to open mode, allowing the formation of the binary t-SNARE complex (ii) SNARE binary complex with t-SNARE partner SNAP-25 in grey (iii). Ternary complex of open syntaxin1a, SNAP-25 and synaptobrevin required for membrane fusion (iv). Question marks represent uncertain points of syntaxin-munc18-1 molecular interaction in the synaptic vesicle cycle. ( b ) Schematic illustrating the syntaxin1a and munc18-1 constructs used in this study. ( c ) dSTORM map of immunodetected syntaxin1a (Alexa-647, upper left) and synapsin-EGFP (upper right) in cortical neurons. A merged image (grey, upper right) shows overlap. Lower panel: a dSTORM molecular map from the boxed area in the merge image shows the locations of single immunodetected syntaxin1a molecules concentrated in synapsin-positive synapses with sparse distribution elsewhere in the neuron. ( d ) PALM localization maps show single molecules of PA-mCherry-syntaxin1a or PA-mCherry-munc18-1 co-clustering with either EGFP-munc18-1 or EGFP-syntaxin1a, respectively. The boxed regions are displayed at a higher zoom (top panels). Scale bars, 500 nm. The distribution of heterologous munc18-1 and syntaxin1a fluorescent fusion protein molecules is similar to the endogenous pattern.

    Techniques Used: Binding Assay, Construct

    31) Product Images from "Establishment of a fluorescent reporter of RNA-polymerase II activity to identify dormant cells"

    Article Title: Establishment of a fluorescent reporter of RNA-polymerase II activity to identify dormant cells

    Journal: Nature Communications

    doi: 10.1038/s41467-021-23580-4

    Characterization of OSCAR in vitro. a Design of the OSCAR ratiometric reporter vector. Wild-type mCherry and VeN90 are expressed from a single mRNA encoding a self-cleaving P2A peptide and a nuclear localization signal fused to VeN90. During translation, mCherry and VeN90 proteins are cleaved in a 1:1 ratio allowing for normalization of VeN90 expression even if VeN90 is phosphorylated by CDK9/CCNT1 and dim in active cells. Absence of CDK9/CCNT1 in dormant cells results in gain of green fluorescence due to VeN90 lack of phosphorylation. Transcriptionally low (dormant) cells thus appear more green that non-dormant cells. Low transcription in dormant cells leads to reduced mRNA expression of the reporter leading to low mCherry and VeN90 protein expression, but reduced phosphorylation of VeN90 enhances (or rescues) its fluorescence intensity. b Representative image of a mouse small intestinal organoid infected with a lentivirus encoding OSCAR. After infection, the organoid was fixed, permeabilized and stained for RNApII-pSer2 and DAPI and visualized for endogenous mCherry and VeN90 fluorescence. Scale bar = 20 μM. c Enlarged image corresponding to white box in ( b ). Empty arrowheads indicate cells with high VeN90/Low RNApII-pSer2, while filled arrowheads indicate RNApII-pSer2-positive cells showing low VeN90 fluorescence. d Single cell quantification of the fluorescence signal of all fluorescent cells in ( b ) shows inverse correlation of OSCAR (VeN90/mCherry) to RNApII-pSer2 normalized to DAPI. e – h Time-lapse imaging of a mouse small intestinal crypt infected with OSCAR lentivirus (movie in Supplementary Information). Upper panels correspond to fluorescent images of the brightfield images below. All the experiments were repeated at least three times with similar results. Source data are provided as a Source Data file.
    Figure Legend Snippet: Characterization of OSCAR in vitro. a Design of the OSCAR ratiometric reporter vector. Wild-type mCherry and VeN90 are expressed from a single mRNA encoding a self-cleaving P2A peptide and a nuclear localization signal fused to VeN90. During translation, mCherry and VeN90 proteins are cleaved in a 1:1 ratio allowing for normalization of VeN90 expression even if VeN90 is phosphorylated by CDK9/CCNT1 and dim in active cells. Absence of CDK9/CCNT1 in dormant cells results in gain of green fluorescence due to VeN90 lack of phosphorylation. Transcriptionally low (dormant) cells thus appear more green that non-dormant cells. Low transcription in dormant cells leads to reduced mRNA expression of the reporter leading to low mCherry and VeN90 protein expression, but reduced phosphorylation of VeN90 enhances (or rescues) its fluorescence intensity. b Representative image of a mouse small intestinal organoid infected with a lentivirus encoding OSCAR. After infection, the organoid was fixed, permeabilized and stained for RNApII-pSer2 and DAPI and visualized for endogenous mCherry and VeN90 fluorescence. Scale bar = 20 μM. c Enlarged image corresponding to white box in ( b ). Empty arrowheads indicate cells with high VeN90/Low RNApII-pSer2, while filled arrowheads indicate RNApII-pSer2-positive cells showing low VeN90 fluorescence. d Single cell quantification of the fluorescence signal of all fluorescent cells in ( b ) shows inverse correlation of OSCAR (VeN90/mCherry) to RNApII-pSer2 normalized to DAPI. e – h Time-lapse imaging of a mouse small intestinal crypt infected with OSCAR lentivirus (movie in Supplementary Information). Upper panels correspond to fluorescent images of the brightfield images below. All the experiments were repeated at least three times with similar results. Source data are provided as a Source Data file.

    Techniques Used: In Vitro, Plasmid Preparation, Expressing, Fluorescence, Infection, Staining, Imaging

    FACS analysis of OSCAR in vivo. a FACS analysis of EF1-OSCAR mouse small intestinal EpCAM+ live cells shows several populations of OSCAR high (VeN90 high mCherry low ) and OSCAR low (VeN90 low mCherry high ). In addition, populations with a higher or lower general transgene expression can be detected. b FACS gating strategy used for FACS sorting of populations P1 to P5. c Population P2 contains OSCAR high cells. Populations P1 and P3 contain OSCAR low cells, with P3 having higher VeN90 and mCherry fluorescence. Populations P4 and P5 are OSCAR med , with P5 having higher VeN90 and mCherry fluorescence. n = 4 mice were analyzed. Data are presented as mean value ± SD. d Percentage of cells in each of the indicated gates with respect to their parental gate. n = 4 mice were analyzed. Data are presented as mean value ± SD. e Hierarchical clustering and heatmap of the Pearson correlation of the RNAseq datasets from the different OSCAR cell populations. f Principal component analysis (PCA) of the RNAseq datasets as in ( e ). Source data are provided as a Source Data file.
    Figure Legend Snippet: FACS analysis of OSCAR in vivo. a FACS analysis of EF1-OSCAR mouse small intestinal EpCAM+ live cells shows several populations of OSCAR high (VeN90 high mCherry low ) and OSCAR low (VeN90 low mCherry high ). In addition, populations with a higher or lower general transgene expression can be detected. b FACS gating strategy used for FACS sorting of populations P1 to P5. c Population P2 contains OSCAR high cells. Populations P1 and P3 contain OSCAR low cells, with P3 having higher VeN90 and mCherry fluorescence. Populations P4 and P5 are OSCAR med , with P5 having higher VeN90 and mCherry fluorescence. n = 4 mice were analyzed. Data are presented as mean value ± SD. d Percentage of cells in each of the indicated gates with respect to their parental gate. n = 4 mice were analyzed. Data are presented as mean value ± SD. e Hierarchical clustering and heatmap of the Pearson correlation of the RNAseq datasets from the different OSCAR cell populations. f Principal component analysis (PCA) of the RNAseq datasets as in ( e ). Source data are provided as a Source Data file.

    Techniques Used: FACS, In Vivo, Expressing, Fluorescence, Mouse Assay

    Immunofluorescence analysis of OSCAR in vivo. a Crypts of the small intestine of an EF1a-OSCAR mouse were stained with DAPI and anti-RNApII-pSer2 antibody. Endogenous fluorescence of VeN90 and mCherry was recorded at the same time. Arrowheads show OSCAR high (VeN90 high mCherry low ) and RNApII-pSer2 low cells. b Top 10% of OSCAR high cells stain negative for RNApII-pSer2, while the top 10% of OSCAR low cells stain positive for RNApII-pSer2. Data are presented as mean value ± SD. *** p
    Figure Legend Snippet: Immunofluorescence analysis of OSCAR in vivo. a Crypts of the small intestine of an EF1a-OSCAR mouse were stained with DAPI and anti-RNApII-pSer2 antibody. Endogenous fluorescence of VeN90 and mCherry was recorded at the same time. Arrowheads show OSCAR high (VeN90 high mCherry low ) and RNApII-pSer2 low cells. b Top 10% of OSCAR high cells stain negative for RNApII-pSer2, while the top 10% of OSCAR low cells stain positive for RNApII-pSer2. Data are presented as mean value ± SD. *** p

    Techniques Used: Immunofluorescence, In Vivo, Staining, Fluorescence

    32) Product Images from "Chemical-genetic induction of Malonyl-CoA decarboxylase in skeletal muscle"

    Article Title: Chemical-genetic induction of Malonyl-CoA decarboxylase in skeletal muscle

    Journal: BMC Biochemistry

    doi: 10.1186/1471-2091-15-20

    MCD transgene expression and Shield-1 stabilization is specific to skeletal muscle. Western blot of (A) liver (B) pancreas and (C) heart tissue extracted from Tg-fMCD skel and control mice on HFD and LFD treated with Shield-1 (5 doses at 60 mg/kg) or vehicle. Samples were blotted for FKBP12 (for transgene stabilization), MCD (endogenous expression), mCherry (transgene expression), and alpha Tubulin (loading control). Positive controls for mCherry and FKBP are derived from skeletal muscle of Tg-fMCD skel mice treated with vehicle or Shield-1.
    Figure Legend Snippet: MCD transgene expression and Shield-1 stabilization is specific to skeletal muscle. Western blot of (A) liver (B) pancreas and (C) heart tissue extracted from Tg-fMCD skel and control mice on HFD and LFD treated with Shield-1 (5 doses at 60 mg/kg) or vehicle. Samples were blotted for FKBP12 (for transgene stabilization), MCD (endogenous expression), mCherry (transgene expression), and alpha Tubulin (loading control). Positive controls for mCherry and FKBP are derived from skeletal muscle of Tg-fMCD skel mice treated with vehicle or Shield-1.

    Techniques Used: Expressing, Western Blot, Mouse Assay, Derivative Assay

    MCD induction suppresses the fatty acid oxidative pathway. Western blot of gastrocnemius muscle for isolated from Tg-fMCD skel and control mice on LFD or HFD given Shield-1 (60 mg/kg) or vehicle for 5 days. (A) CPT1B and OXPHOS complexes (as indicated) were normalized to alpha Tubulin and quantified. Samples were blotted with FKBP12 (for transgene stabilization), mCherry (transgene expression) and alpha Tubulin (loading control). (B) MCAD and (C) HADHA were normalized to alpha Tubulin and quantified (D) AMPK Thr 172 phophorylation was determined, normalized for total AMPK and quantified. Data are expressed as means +/- SEM. *p
    Figure Legend Snippet: MCD induction suppresses the fatty acid oxidative pathway. Western blot of gastrocnemius muscle for isolated from Tg-fMCD skel and control mice on LFD or HFD given Shield-1 (60 mg/kg) or vehicle for 5 days. (A) CPT1B and OXPHOS complexes (as indicated) were normalized to alpha Tubulin and quantified. Samples were blotted with FKBP12 (for transgene stabilization), mCherry (transgene expression) and alpha Tubulin (loading control). (B) MCAD and (C) HADHA were normalized to alpha Tubulin and quantified (D) AMPK Thr 172 phophorylation was determined, normalized for total AMPK and quantified. Data are expressed as means +/- SEM. *p

    Techniques Used: Western Blot, Isolation, Mouse Assay, Expressing

    33) Product Images from "A method for detailed analysis of the structure of mast cell secretory granules by negative contrast imaging"

    Article Title: A method for detailed analysis of the structure of mast cell secretory granules by negative contrast imaging

    Journal: Scientific Reports

    doi: 10.1038/srep23369

    Negative contrast imaging of secretory granules in live mast cells. ( a ) Horizontal (top) and lateral (bottom) views of a live RBL-2H3 cell expressing GFP. Inset is a high-magnification view of the boxed region, and dashed lines indicate cross sections. Scale bars are 10 μm in the main image and 2 μm in inset. ( b,c ) Confocal image of a live RBL-2H3 cell co-expressing GFP and NPY–mCherry ( b ) or GFP and CD63–mCherry ( c ). Arrowheads highlight negatively stained organelles unmarked with mCherry. Scale bar, 10 μm.
    Figure Legend Snippet: Negative contrast imaging of secretory granules in live mast cells. ( a ) Horizontal (top) and lateral (bottom) views of a live RBL-2H3 cell expressing GFP. Inset is a high-magnification view of the boxed region, and dashed lines indicate cross sections. Scale bars are 10 μm in the main image and 2 μm in inset. ( b,c ) Confocal image of a live RBL-2H3 cell co-expressing GFP and NPY–mCherry ( b ) or GFP and CD63–mCherry ( c ). Arrowheads highlight negatively stained organelles unmarked with mCherry. Scale bar, 10 μm.

    Techniques Used: Imaging, Expressing, Staining

    Visualization of SG-SG fusion in PMA-activated RBL-2H3 cells. ( a ) Lateral view of a representative cell expressing GFP and NPY–mCherry. Images of the same cell were acquired 14 (top), 17 (middle), and 20 (bottom) min after PMA activation. Arrowheads highlight SG–SG fusion events. ( b ) High-magnification view (top) and 3D image (bottom) of the boxed region in ( a ), which shows SGs with (magenta) or without (white) NPY. Dashed lines are cross sections. Scale bar, 5 μm.
    Figure Legend Snippet: Visualization of SG-SG fusion in PMA-activated RBL-2H3 cells. ( a ) Lateral view of a representative cell expressing GFP and NPY–mCherry. Images of the same cell were acquired 14 (top), 17 (middle), and 20 (bottom) min after PMA activation. Arrowheads highlight SG–SG fusion events. ( b ) High-magnification view (top) and 3D image (bottom) of the boxed region in ( a ), which shows SGs with (magenta) or without (white) NPY. Dashed lines are cross sections. Scale bar, 5 μm.

    Techniques Used: Expressing, Activation Assay

    34) Product Images from "Rab35 controls cilium length, function and membrane composition"

    Article Title: Rab35 controls cilium length, function and membrane composition

    Journal: EMBO Reports

    doi: 10.15252/embr.201847625

    Rab35 interacts with Arl13b HEK293T cells were transiently co‐transfected with ARL13B‐FLAG and GFP or GFP‐RAB35. Cells were cultured either in full growth medium (+serum) or serum‐starved for the final 8 h before harvesting. Immunoprecipitations (IP) were performed using anti‐GFP beads. Cell lysates (2.5% of input) and immunoprecipitates were loaded on the same gel, subjected to immunoblot (IB) analysis with indicated antibodies and detected with the same exposure. Schematic representation of the human ARL13B structure depicting the guanine nucleotide‐binding (G), coiled coil (CC) and proline‐rich (PR) domains as well as the point mutations affecting N‐terminal palmitoylation or C‐terminal ciliary‐targeting RVEP motif. HEK293T cells were transiently co‐transfected with mCherry‐RAB35 together with GFP or indicated ARL13B‐GFP wild‐type, mutant or truncation constructs. Cells were serum‐starved for the final 8 h before harvesting. IPs were performed using anti‐GFP beads and interacting proteins detected by immunoblotting (IB). HEK293T cells were transiently transfected with ARL13B‐FLAG and serum‐starved for the final 8 h before harvesting. HEK293T cell lysates expressing ARL13B‐FLAG were subjected to pull‐down with GFP‐RAB35 bound to anti‐GFP beads and preloaded with either no nucleotide, GTPγS or GDP. Bound proteins and cell lysates (1% of input) were analysed by immunoblotting. The graph shows the ratio of precipitated ARL13B and RAB35, normalised to the no nucleotide control. Data are mean ± SEM of three independent experiments. Statistical significance according ANOVA followed by Tukey post hoc test (* P = 0.0333). HEK293T cells were transiently transfected with mCherry‐RAB35 and serum‐starved for the final 8 h before harvesting. HEK293T cell lysates expressing ARL13B‐FLAG were subjected to pull‐down with ARL13B‐GFP bound to anti‐GFP beads and preloaded with either no nucleotide, GTPγS or GDP. Bound proteins and cell lysates (1% of input) were analysed by immunoblotting. The graph shows the ratio of precipitated ARL13B and RAB35, normalised to the no nucleotide control. Data are mean ± SEM of three independent experiments. Statistical significance according ANOVA followed by Tukey post hoc test (* P = 0.0466). Source data are available online for this figure.
    Figure Legend Snippet: Rab35 interacts with Arl13b HEK293T cells were transiently co‐transfected with ARL13B‐FLAG and GFP or GFP‐RAB35. Cells were cultured either in full growth medium (+serum) or serum‐starved for the final 8 h before harvesting. Immunoprecipitations (IP) were performed using anti‐GFP beads. Cell lysates (2.5% of input) and immunoprecipitates were loaded on the same gel, subjected to immunoblot (IB) analysis with indicated antibodies and detected with the same exposure. Schematic representation of the human ARL13B structure depicting the guanine nucleotide‐binding (G), coiled coil (CC) and proline‐rich (PR) domains as well as the point mutations affecting N‐terminal palmitoylation or C‐terminal ciliary‐targeting RVEP motif. HEK293T cells were transiently co‐transfected with mCherry‐RAB35 together with GFP or indicated ARL13B‐GFP wild‐type, mutant or truncation constructs. Cells were serum‐starved for the final 8 h before harvesting. IPs were performed using anti‐GFP beads and interacting proteins detected by immunoblotting (IB). HEK293T cells were transiently transfected with ARL13B‐FLAG and serum‐starved for the final 8 h before harvesting. HEK293T cell lysates expressing ARL13B‐FLAG were subjected to pull‐down with GFP‐RAB35 bound to anti‐GFP beads and preloaded with either no nucleotide, GTPγS or GDP. Bound proteins and cell lysates (1% of input) were analysed by immunoblotting. The graph shows the ratio of precipitated ARL13B and RAB35, normalised to the no nucleotide control. Data are mean ± SEM of three independent experiments. Statistical significance according ANOVA followed by Tukey post hoc test (* P = 0.0333). HEK293T cells were transiently transfected with mCherry‐RAB35 and serum‐starved for the final 8 h before harvesting. HEK293T cell lysates expressing ARL13B‐FLAG were subjected to pull‐down with ARL13B‐GFP bound to anti‐GFP beads and preloaded with either no nucleotide, GTPγS or GDP. Bound proteins and cell lysates (1% of input) were analysed by immunoblotting. The graph shows the ratio of precipitated ARL13B and RAB35, normalised to the no nucleotide control. Data are mean ± SEM of three independent experiments. Statistical significance according ANOVA followed by Tukey post hoc test (* P = 0.0466). Source data are available online for this figure.

    Techniques Used: Transfection, Cell Culture, Binding Assay, Mutagenesis, Construct, Expressing

    35) Product Images from "Noninvasive optical activation of Flp recombinase for genetic manipulation in deep mouse brain regions"

    Article Title: Noninvasive optical activation of Flp recombinase for genetic manipulation in deep mouse brain regions

    Journal: Nature Communications

    doi: 10.1038/s41467-018-08282-8

    Noninvasive LED illumination activates PA-Flp in deep brain structures down to the hippocampus and MS. a , d Schematic depicting AAV-EF1a-PA-Flp targeting in the hippocampus ( a ) or MS ( d ) followed by LED illumination. b , e Representative images of mCherry (PA-Flp) and GFP (Flp reporter) signals from RCE:FRT mice (8–12-wk-old), with (w/) and without (w/o) LED illumination. Two wks after infection, light was illuminated noninvasively with white LED at an intensity of 1 mW mm −2 ( b ) or 2 mW mm −2 ( e ) for 30 s through the intact skull and skin. Mice were maintained under room light as described in Methods. All mice were sacrificed 3 wks after infection. Scale bar: 500 μm. c , f GFP positive cells among both DAPI and mCherry positive (GFP+/DAPI+mCh+) cells were measured in the hippocampus ( c ) and MS ( f ) region of 4–7 coronal slices, as shown in b and e , respectively. Data represent means ± s.e.m. ( c , n = 4 mice/group, **** P
    Figure Legend Snippet: Noninvasive LED illumination activates PA-Flp in deep brain structures down to the hippocampus and MS. a , d Schematic depicting AAV-EF1a-PA-Flp targeting in the hippocampus ( a ) or MS ( d ) followed by LED illumination. b , e Representative images of mCherry (PA-Flp) and GFP (Flp reporter) signals from RCE:FRT mice (8–12-wk-old), with (w/) and without (w/o) LED illumination. Two wks after infection, light was illuminated noninvasively with white LED at an intensity of 1 mW mm −2 ( b ) or 2 mW mm −2 ( e ) for 30 s through the intact skull and skin. Mice were maintained under room light as described in Methods. All mice were sacrificed 3 wks after infection. Scale bar: 500 μm. c , f GFP positive cells among both DAPI and mCherry positive (GFP+/DAPI+mCh+) cells were measured in the hippocampus ( c ) and MS ( f ) region of 4–7 coronal slices, as shown in b and e , respectively. Data represent means ± s.e.m. ( c , n = 4 mice/group, **** P

    Techniques Used: Mass Spectrometry, Mouse Assay, Infection

    Development of PA-Flp. a Schematic depicting PA-Flp reconstitution and activation upon blue light illumination, and detection of GFP signals by PA-Flp-mediated deletion of a stop cassette in a Frt-floxed construct. b PA-Flp and fDIO-YFP (Flp reporter) expression plasmids were electroporated into an embryonic mouse brain (E15), with (w/) subsequent noninvasive light stimulation (0.5 mW mm −2 , blue fluorescent gun) at postnatal day 1–2 (P1–2) or maintained in dark conditions. Pup brains were harvested at P3-4. c AAV-EF1a-PA-Flp and AAV-EF1a-fDIO-YFP were co-infected into the hippocampus of 8-wk-old mice, with 30 min light (0.4 mW mm −2 , 20 Hz, 20% duty cycle) or without (w/o) light stimulation 2 wks after infection and sacrificed 1 wk after light stimulation. A blue line indicates laser light path through implanted optic fiber. b , c Measurement of GFP positive cells among both mCherry and iRFP positive (GFP+/mCh+iRFP+) cells or among both DAPI and mCherry positive (GFP+/DAPI+mCh+) cells in 4–8 coronal slices at each group. Scale bar: 100 μm. Data represent means ± s.e.m. ( n = 2 mice/group; *** P
    Figure Legend Snippet: Development of PA-Flp. a Schematic depicting PA-Flp reconstitution and activation upon blue light illumination, and detection of GFP signals by PA-Flp-mediated deletion of a stop cassette in a Frt-floxed construct. b PA-Flp and fDIO-YFP (Flp reporter) expression plasmids were electroporated into an embryonic mouse brain (E15), with (w/) subsequent noninvasive light stimulation (0.5 mW mm −2 , blue fluorescent gun) at postnatal day 1–2 (P1–2) or maintained in dark conditions. Pup brains were harvested at P3-4. c AAV-EF1a-PA-Flp and AAV-EF1a-fDIO-YFP were co-infected into the hippocampus of 8-wk-old mice, with 30 min light (0.4 mW mm −2 , 20 Hz, 20% duty cycle) or without (w/o) light stimulation 2 wks after infection and sacrificed 1 wk after light stimulation. A blue line indicates laser light path through implanted optic fiber. b , c Measurement of GFP positive cells among both mCherry and iRFP positive (GFP+/mCh+iRFP+) cells or among both DAPI and mCherry positive (GFP+/DAPI+mCh+) cells in 4–8 coronal slices at each group. Scale bar: 100 μm. Data represent means ± s.e.m. ( n = 2 mice/group; *** P

    Techniques Used: Activation Assay, Construct, Expressing, Infection, Mouse Assay

    36) Product Images from "AgRP to Kiss1 neuron signaling links nutritional state and fertility"

    Article Title: AgRP to Kiss1 neuron signaling links nutritional state and fertility

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.1621065114

    Chronic activation of AgRP neurons using chemogenetics. ( A ) Experimental and control Agrp Cre mice were transduced with a conditional viral vector expressing either an hM3Dq DREADD receptor fused to a fluorescent reporter or a fluorescent reporter. ( A , Left ) Histology of viral expression in AgRP neurons. (Scale bar, 200 μm.) ( B ) Prescreening: CNO-induced food intake (1 mg/kg i.p.). Animals included in the study consumed > 1.0 g of food, 4 h post-CNO. ( C–E ) Chronic administration of CNO in the drinking water (gray highlight, administered at ∼5 mg/kg/day assuming an average body weight of 22 g and daily water intake of 3.5 mL). ( C ) Fluid intake change over time. mCherry ( n = 7), hM3Dq ( n = 5). Two-way ANOVA, main effect of interaction: F (13,140) = 2.26, P = 0.01; main effect of time: F (13,140) = 2.24, P = 0.02; main effect of experimental condition: F (1,140) = 5.60, P = 0.01; post hoc: day 14, * P
    Figure Legend Snippet: Chronic activation of AgRP neurons using chemogenetics. ( A ) Experimental and control Agrp Cre mice were transduced with a conditional viral vector expressing either an hM3Dq DREADD receptor fused to a fluorescent reporter or a fluorescent reporter. ( A , Left ) Histology of viral expression in AgRP neurons. (Scale bar, 200 μm.) ( B ) Prescreening: CNO-induced food intake (1 mg/kg i.p.). Animals included in the study consumed > 1.0 g of food, 4 h post-CNO. ( C–E ) Chronic administration of CNO in the drinking water (gray highlight, administered at ∼5 mg/kg/day assuming an average body weight of 22 g and daily water intake of 3.5 mL). ( C ) Fluid intake change over time. mCherry ( n = 7), hM3Dq ( n = 5). Two-way ANOVA, main effect of interaction: F (13,140) = 2.26, P = 0.01; main effect of time: F (13,140) = 2.24, P = 0.02; main effect of experimental condition: F (1,140) = 5.60, P = 0.01; post hoc: day 14, * P

    Techniques Used: Activation Assay, Mouse Assay, Transduction, Plasmid Preparation, Expressing

    There is not a direct connection between AgRP and GnRH neurons. ( A ) Sagittal diagram and matching fluorescent image indicating the location of AgRP neurons (red) and GnRH neurons (green). ( B ) Trace from whole-cell patched recording of fluorescently labeled GnRH soma during AgRP fiber stimulation (Vhold = −60 mV). Histology demonstrating GFP-expressing GnRH neurons and ChR2:mCherry-expressing AgRP fibers in the medial preoptic (MPO). (Scale bar, 50 μm.) ( C ) Light-evoked response from a neighboring neuron in the AVPV. Post hoc transcriptional profiling of the recorded cell in B confirmed expression of Kiss1 transcript.
    Figure Legend Snippet: There is not a direct connection between AgRP and GnRH neurons. ( A ) Sagittal diagram and matching fluorescent image indicating the location of AgRP neurons (red) and GnRH neurons (green). ( B ) Trace from whole-cell patched recording of fluorescently labeled GnRH soma during AgRP fiber stimulation (Vhold = −60 mV). Histology demonstrating GFP-expressing GnRH neurons and ChR2:mCherry-expressing AgRP fibers in the medial preoptic (MPO). (Scale bar, 50 μm.) ( C ) Light-evoked response from a neighboring neuron in the AVPV. Post hoc transcriptional profiling of the recorded cell in B confirmed expression of Kiss1 transcript.

    Techniques Used: Labeling, Expressing

    37) Product Images from "Epistatic Interplay between Type IV Secretion Effectors Engages the Small GTPase Rab2 in the Brucella Intracellular Cycle"

    Article Title: Epistatic Interplay between Type IV Secretion Effectors Engages the Small GTPase Rab2 in the Brucella Intracellular Cycle

    Journal: mBio

    doi: 10.1128/mBio.03350-19

    BspB and RicA modulate Golgi apparatus-associated vesicular traffic in a Rab2a-dependent manner. (A) Representative confocal micrographs of GS15 steady-state distribution in Brucella- infected BMMs transduced to express GFP-GS15, showing either Golgi apparatus-localized (normal) or diffuse patterns. Golgi structures were labeled using an anti-GM130 antibody. Scale bar, 10 μm. (B) Representative Western blotting of Rab2a depletion in BMMs. BMMs were nucleofected with either nontargeting (siNT) or siRab2a siRNAs, and Rab2 levels were evaluated after 72 h via Western blotting of Rab2a and β-actin as a control. (C) Quantification of GFP-GS15 redistribution from the Golgi apparatus in BMMs treated with either nontargeting (siNT) or siRab2a siRNAs and then left uninfected (control) or infected for 24 h with wild-type (2308), Δ bspB , Δ ricA , Δ bspB Δ ricA , or Δ bspB Δ ricA :: ricA B. abortus strains. Values are means ± SD of results from 3 independent experiments. Asterisks indicate a statistically significant difference between tested conditions, assessed using one-way analysis of variance (ANOVA) followed by a Dunnett’s multicomparison test. ns, not significant. (D) Representative confocal micrographs of BMMs cotransduced to express GFP-GS15 with mCherry (control), HA-BspB, or myc-RicA, showing normal or diffuse distributions of GFP-GS15. Scale bar, 10 μm. (E) Quantification of GS15 redistribution in BMMs cotransduced to express GFP-GS15 with mCherry, HA-BspB, myc-RicA, or HA-BspB and myc-RicA. Values are means ± SD of results from 3 independent experiments. Asterisks indicate a statistically significant difference compared to control cells, assessed using one-way analysis of variance (ANOVA) followed by a Dunnett’s multicomparison test. ns, not significant.
    Figure Legend Snippet: BspB and RicA modulate Golgi apparatus-associated vesicular traffic in a Rab2a-dependent manner. (A) Representative confocal micrographs of GS15 steady-state distribution in Brucella- infected BMMs transduced to express GFP-GS15, showing either Golgi apparatus-localized (normal) or diffuse patterns. Golgi structures were labeled using an anti-GM130 antibody. Scale bar, 10 μm. (B) Representative Western blotting of Rab2a depletion in BMMs. BMMs were nucleofected with either nontargeting (siNT) or siRab2a siRNAs, and Rab2 levels were evaluated after 72 h via Western blotting of Rab2a and β-actin as a control. (C) Quantification of GFP-GS15 redistribution from the Golgi apparatus in BMMs treated with either nontargeting (siNT) or siRab2a siRNAs and then left uninfected (control) or infected for 24 h with wild-type (2308), Δ bspB , Δ ricA , Δ bspB Δ ricA , or Δ bspB Δ ricA :: ricA B. abortus strains. Values are means ± SD of results from 3 independent experiments. Asterisks indicate a statistically significant difference between tested conditions, assessed using one-way analysis of variance (ANOVA) followed by a Dunnett’s multicomparison test. ns, not significant. (D) Representative confocal micrographs of BMMs cotransduced to express GFP-GS15 with mCherry (control), HA-BspB, or myc-RicA, showing normal or diffuse distributions of GFP-GS15. Scale bar, 10 μm. (E) Quantification of GS15 redistribution in BMMs cotransduced to express GFP-GS15 with mCherry, HA-BspB, myc-RicA, or HA-BspB and myc-RicA. Values are means ± SD of results from 3 independent experiments. Asterisks indicate a statistically significant difference compared to control cells, assessed using one-way analysis of variance (ANOVA) followed by a Dunnett’s multicomparison test. ns, not significant.

    Techniques Used: Infection, Labeling, Western Blot

    BspB-mediated alterations of ER-to-Golgi transport are independent of RicA and Rab2a. (A) Representative confocal micrographs of GFP-p58 steady-state distribution in Brucella- infected BMMs transduced to express GFP-p58, showing either normal or Golgi apparatus-localized patterns. Golgi structures were labeled using an anti-GM130 antibody. Scale bar, 10 μm. (B) Representative Western blotting of Rab2a depletion in BMMs. BMMs were nucleofected with either nontargeting (siNT) or siRab2a siRNAs, and Rab2 levels were evaluated after 72 h via Western blotting of Rab2a and β-actin as a control. (C) Quantification of GFP-p58 redistribution to the Golgi apparatus in BMMs treated with either nontargeting (siNT) or siRab2a siRNAs and then left uninfected (control) or infected for 24 h with wild-type (2308), Δ bspB , Δ ricA , Δ bspB Δ ricA , or Δ bspB Δ ricA :: ricA B. abortus strains. Values are means ± SD of results from 3 independent experiments. Asterisks indicate a statistically significant difference between tested conditions, assessed using one-way analysis of variance (ANOVA) followed by a Dunnett’s multicomparison test. ns, not significant. (D) Representative confocal micrographs of BMMs cotransduced to express GFP-p58 with mCherry, HA-BspB, or myc-RicA, showing normal or Golgi apparatus-localized distribution of GFP-p58. Scale bar, 10 μm. (E) Quantification of GFP-p58 redistribution to the Golgi apparatus in BMMs cotransduced to express GFP-p58 with mCherry, HA-BspB, myc-RicA, or HA-BspB and myc-RicA. Values are means ± SD of results from 3 independent experiments. Asterisks indicate a statistically significant difference compared to control (mCherry) cells, assessed using one-way analysis of variance (ANOVA) followed by a Dunnett’s multicomparison test. ns, not significant.
    Figure Legend Snippet: BspB-mediated alterations of ER-to-Golgi transport are independent of RicA and Rab2a. (A) Representative confocal micrographs of GFP-p58 steady-state distribution in Brucella- infected BMMs transduced to express GFP-p58, showing either normal or Golgi apparatus-localized patterns. Golgi structures were labeled using an anti-GM130 antibody. Scale bar, 10 μm. (B) Representative Western blotting of Rab2a depletion in BMMs. BMMs were nucleofected with either nontargeting (siNT) or siRab2a siRNAs, and Rab2 levels were evaluated after 72 h via Western blotting of Rab2a and β-actin as a control. (C) Quantification of GFP-p58 redistribution to the Golgi apparatus in BMMs treated with either nontargeting (siNT) or siRab2a siRNAs and then left uninfected (control) or infected for 24 h with wild-type (2308), Δ bspB , Δ ricA , Δ bspB Δ ricA , or Δ bspB Δ ricA :: ricA B. abortus strains. Values are means ± SD of results from 3 independent experiments. Asterisks indicate a statistically significant difference between tested conditions, assessed using one-way analysis of variance (ANOVA) followed by a Dunnett’s multicomparison test. ns, not significant. (D) Representative confocal micrographs of BMMs cotransduced to express GFP-p58 with mCherry, HA-BspB, or myc-RicA, showing normal or Golgi apparatus-localized distribution of GFP-p58. Scale bar, 10 μm. (E) Quantification of GFP-p58 redistribution to the Golgi apparatus in BMMs cotransduced to express GFP-p58 with mCherry, HA-BspB, myc-RicA, or HA-BspB and myc-RicA. Values are means ± SD of results from 3 independent experiments. Asterisks indicate a statistically significant difference compared to control (mCherry) cells, assessed using one-way analysis of variance (ANOVA) followed by a Dunnett’s multicomparison test. ns, not significant.

    Techniques Used: Infection, Labeling, Western Blot

    38) Product Images from "Rescue of Tomato spotted wilt tospovirus entirely from cDNA clones, establishment of the first reverse genetics system for a segmented (-)RNA plant virus"

    Article Title: Rescue of Tomato spotted wilt tospovirus entirely from cDNA clones, establishment of the first reverse genetics system for a segmented (-)RNA plant virus

    Journal: bioRxiv

    doi: 10.1101/680900

    The role of 5’-UTR, 3’-UTR and IGR on viral RNA synthesis from the SR (-)mCherry eGFP mini-replicon. ( A ) Schematic representation of TSWV SR (-)mCherry eGFP and derivatives with deletions of the 5’UTR, IGR or 3’UTR. ( B ) eGFP and mCherry fluorescence expressed from TSWV SR (-)mCherry eGFP and mutant derivatives in N. benthamiana . The SR (-)mCherry eGFP or its mutants were coexpressed with N, RdRp and the four VSRs in N. benthamiana leaves. The agroinfiltrated leaves were examined and photographed at 5 dpi under a fluorescence microscope using GFP and RFP filters, respectively. Bars represent 200 μm. ( C ) Western immunoblot detection of the N and eGFP proteins expressed from the SR (-)mCherry eGFP mini-replicon and mutant derivatives, using specific antibodies against N and GFP, respectively. Ponceau S staining was used as protein loading control. ( D ) Northern blot analysis of viral RNA synthesis from SR (-)mCherry eGFP and mutant derivatives. The anti-genomic RNAs (red arrow), genomic RNAs (blue arrow) and eGFP mRNA transcripts (green arrow) were detected with DIG–labeled sense eGFP or anti-sense eGFP probes. Ethidium bromide staining was used as RNA loading control.
    Figure Legend Snippet: The role of 5’-UTR, 3’-UTR and IGR on viral RNA synthesis from the SR (-)mCherry eGFP mini-replicon. ( A ) Schematic representation of TSWV SR (-)mCherry eGFP and derivatives with deletions of the 5’UTR, IGR or 3’UTR. ( B ) eGFP and mCherry fluorescence expressed from TSWV SR (-)mCherry eGFP and mutant derivatives in N. benthamiana . The SR (-)mCherry eGFP or its mutants were coexpressed with N, RdRp and the four VSRs in N. benthamiana leaves. The agroinfiltrated leaves were examined and photographed at 5 dpi under a fluorescence microscope using GFP and RFP filters, respectively. Bars represent 200 μm. ( C ) Western immunoblot detection of the N and eGFP proteins expressed from the SR (-)mCherry eGFP mini-replicon and mutant derivatives, using specific antibodies against N and GFP, respectively. Ponceau S staining was used as protein loading control. ( D ) Northern blot analysis of viral RNA synthesis from SR (-)mCherry eGFP and mutant derivatives. The anti-genomic RNAs (red arrow), genomic RNAs (blue arrow) and eGFP mRNA transcripts (green arrow) were detected with DIG–labeled sense eGFP or anti-sense eGFP probes. Ethidium bromide staining was used as RNA loading control.

    Techniques Used: Fluorescence, Mutagenesis, Microscopy, Western Blot, Staining, Northern Blot, Labeling

    Time course analysis on gene expression from the SR (-)mCherry eGFP mini-replicon in N. benthamiana leaves. ( A ) Foci of eGFP and mCherry fluorescence expressed from SR (-)mCherry eGFP in N. benthamiana leaves co-expressing N, RdRp and the VSRs at 3, 6, 9 and 12 dpi, respectively. Fluorescence of eGFP and mCherry were photographed under a fluorescence microscope using GFP and RFP filters, respectively. Bars represent 400 μm. ( B ) Western immunoblot detection of the N, eGFP and mCherry proteins in leaves shown in panel A, using specific antibodies against N, GFP and mCherry, respectively. The empty vector (Vec) was used as a negative control. Ponceau S staining was used as protein loading control.
    Figure Legend Snippet: Time course analysis on gene expression from the SR (-)mCherry eGFP mini-replicon in N. benthamiana leaves. ( A ) Foci of eGFP and mCherry fluorescence expressed from SR (-)mCherry eGFP in N. benthamiana leaves co-expressing N, RdRp and the VSRs at 3, 6, 9 and 12 dpi, respectively. Fluorescence of eGFP and mCherry were photographed under a fluorescence microscope using GFP and RFP filters, respectively. Bars represent 400 μm. ( B ) Western immunoblot detection of the N, eGFP and mCherry proteins in leaves shown in panel A, using specific antibodies against N, GFP and mCherry, respectively. The empty vector (Vec) was used as a negative control. Ponceau S staining was used as protein loading control.

    Techniques Used: Expressing, Fluorescence, Microscopy, Western Blot, Plasmid Preparation, Negative Control, Staining

    Construction of a TSWV S (-) RNA-based mini-replicon system in N. benthamiana . ( A ) Schematic representation of binary constructs to express TSWV S (-) mini-replicon, TSWV N, RdRp and four RNA silencing suppressors (VSRs: NSs, P19, HcPro and γb) proteins by agroinfiltration into N. benthamiana . The S (-) -gRNA of TSWV is shown on the top. SR (-)mCherry eGFP : the NSs and N of S (-) -gRNA were replaced by mCherry and eGFP, respectively. (-) refers to the negative (genomic)-strand of S RNA; 2×35S: a double 35S promoter; HH: hammerhead ribozyme; RZ: Hepatitis Delta virus (HDV) ribozyme; NOS: nopaline synthase terminator. ( B ) Foci of eGFP and mCherry fluorescence in N. benthamiana leaves co-expressing SR (-)mCherry eGFP , RdRp, N and four VSRs at 5 days post infiltration (dpi) under a fluorescence microscope. The bar represents 400 μm. ( C ) Analysis of RdRp and N requirement for SR (-)mCherry eGFP mini-genome replication in N. benthamiana leaves. SR (-)mCherry eGFP was coexpressed with pCB301 empty vector (Vec), N, RdRp or both in N. benthamiana leaves by agroinfiltration. Agro-infiltrated leaves were examined and photographed at 5 dpi under a fluorescence microscope. Signal shown reflects a merge of mCherry and eGFP fluorescence from both reporter genes. Bar represents 400 μm. ( D ) Immunoblot analysis on the expression of N and eGFP proteins in the leaves shown in panel ( C ) using specific antibodies against N and GFP, respectively. Ponceau S staining of rubisco large subunit is shown for protein loading control. ( E ) Northern blot analysis of S (-) -mini-replicon replication and transcription in the presence of N, RdRp or both in N. benthamiana . The S RNA genomic, anti-genomic and subgenomic transcripts (eGFP mRNA) were detected by DIG-labeled sense eGFP or anti-sense eGFP probes. The red and blue arrows indicate the anti-genomic and genomic RNAs of SR (-)mCherry eGFP , respectively. The green arrow indicates the eGFP mRNA transcript. Ethidium bromide staining of ribosomal RNA (rRNA) was used as RNA loading control.
    Figure Legend Snippet: Construction of a TSWV S (-) RNA-based mini-replicon system in N. benthamiana . ( A ) Schematic representation of binary constructs to express TSWV S (-) mini-replicon, TSWV N, RdRp and four RNA silencing suppressors (VSRs: NSs, P19, HcPro and γb) proteins by agroinfiltration into N. benthamiana . The S (-) -gRNA of TSWV is shown on the top. SR (-)mCherry eGFP : the NSs and N of S (-) -gRNA were replaced by mCherry and eGFP, respectively. (-) refers to the negative (genomic)-strand of S RNA; 2×35S: a double 35S promoter; HH: hammerhead ribozyme; RZ: Hepatitis Delta virus (HDV) ribozyme; NOS: nopaline synthase terminator. ( B ) Foci of eGFP and mCherry fluorescence in N. benthamiana leaves co-expressing SR (-)mCherry eGFP , RdRp, N and four VSRs at 5 days post infiltration (dpi) under a fluorescence microscope. The bar represents 400 μm. ( C ) Analysis of RdRp and N requirement for SR (-)mCherry eGFP mini-genome replication in N. benthamiana leaves. SR (-)mCherry eGFP was coexpressed with pCB301 empty vector (Vec), N, RdRp or both in N. benthamiana leaves by agroinfiltration. Agro-infiltrated leaves were examined and photographed at 5 dpi under a fluorescence microscope. Signal shown reflects a merge of mCherry and eGFP fluorescence from both reporter genes. Bar represents 400 μm. ( D ) Immunoblot analysis on the expression of N and eGFP proteins in the leaves shown in panel ( C ) using specific antibodies against N and GFP, respectively. Ponceau S staining of rubisco large subunit is shown for protein loading control. ( E ) Northern blot analysis of S (-) -mini-replicon replication and transcription in the presence of N, RdRp or both in N. benthamiana . The S RNA genomic, anti-genomic and subgenomic transcripts (eGFP mRNA) were detected by DIG-labeled sense eGFP or anti-sense eGFP probes. The red and blue arrows indicate the anti-genomic and genomic RNAs of SR (-)mCherry eGFP , respectively. The green arrow indicates the eGFP mRNA transcript. Ethidium bromide staining of ribosomal RNA (rRNA) was used as RNA loading control.

    Techniques Used: Construct, Fluorescence, Expressing, Microscopy, Plasmid Preparation, Staining, Northern Blot, Labeling

    Optimization of the SR (-)mCherry eGFP mini-replicon system. ( A ) Optimizing the concentration of N and RdRp proteins for replication and transcription of SR (-)mCherry eGFP in N. benthamiana leaves. Increasing amounts of Agrobacterium, from OD 600 = 0.2 to 0.8 and containing the binary expression constructs for N (upper panels) or RdRp (bottom panels), were mixed with fixed amounts of Agrobacterium containing the RdRp or N construct (OD 600 0.2), respectively, and their effects on eGFP reporter expression were visualized under a fluorescence microscope at 5 dpi. Bars represent 400 μm. ( B ) and ( C ) Western immunoblot detection of the N and eGFP proteins expressed in the leaves shown in panel ( A ) using specific antibodies against N and GFP, respectively. ( D ) Optimization of RNA silencing suppressors (VSRs) on SR (-)mCherry eGFP mini-reporter replication and transcriptions as measured by eGFP and mCherry expression. The SR (-)mCherry eGFP , N and RdRp proteins were co-expressed with pCB301 empty vector (Vec), NSs, P19-HcPro-γb or all four VSRs in N. benthamiana leaves. Foci expressing eGFP and mCherry in agroinfiltrated leaves were visualized under a fluorescence microscope at 5 dpi. Bars represent 400 μm. ( E ) Western immunoblot detection of N and eGFP protein synthesis in the leaves shown in panel ( D ) using N and GFP-specific antibodies, respectively. Ponceau S staining was used as protein loading control.
    Figure Legend Snippet: Optimization of the SR (-)mCherry eGFP mini-replicon system. ( A ) Optimizing the concentration of N and RdRp proteins for replication and transcription of SR (-)mCherry eGFP in N. benthamiana leaves. Increasing amounts of Agrobacterium, from OD 600 = 0.2 to 0.8 and containing the binary expression constructs for N (upper panels) or RdRp (bottom panels), were mixed with fixed amounts of Agrobacterium containing the RdRp or N construct (OD 600 0.2), respectively, and their effects on eGFP reporter expression were visualized under a fluorescence microscope at 5 dpi. Bars represent 400 μm. ( B ) and ( C ) Western immunoblot detection of the N and eGFP proteins expressed in the leaves shown in panel ( A ) using specific antibodies against N and GFP, respectively. ( D ) Optimization of RNA silencing suppressors (VSRs) on SR (-)mCherry eGFP mini-reporter replication and transcriptions as measured by eGFP and mCherry expression. The SR (-)mCherry eGFP , N and RdRp proteins were co-expressed with pCB301 empty vector (Vec), NSs, P19-HcPro-γb or all four VSRs in N. benthamiana leaves. Foci expressing eGFP and mCherry in agroinfiltrated leaves were visualized under a fluorescence microscope at 5 dpi. Bars represent 400 μm. ( E ) Western immunoblot detection of N and eGFP protein synthesis in the leaves shown in panel ( D ) using N and GFP-specific antibodies, respectively. Ponceau S staining was used as protein loading control.

    Techniques Used: Concentration Assay, Expressing, Construct, Fluorescence, Microscopy, Western Blot, Plasmid Preparation, Staining

    Establishment of a systemic infection in N. benthamiana with replicons S (+) and M (-) co-expressed with full length antigenomic L (+)opt . ( A ) Schematic representation of constructs expressing TSWV full length antigenomic L (+)opt with optimized RdRp, full length genomic M (-)opt with optimized GP, MR (-)eGFP , MR (-)mCherry , full length antigenomic S (+) and SR (+)eGFP . Primary viral RNA transcripts are transcribed from a double 35S promoter (2×35S) and flanked by a HH and HDV ribozyme (RZ). ( B ) eGFP and mCherry fluorescence in N. benthamiana resulting from systemic infection of agroinfiltrated SR (+)eGFP , MR (-)mCherry and L (+)opt constructs. The systemic infected plants ( a and b ) and leaves ( c and d ) were photographed at 21 dpi under white light and (hand-held) ultraviolet (UV) light. Foci of eGFP and mCherry fluorescence in leaves shown in panel d as visualized under a fluorescence microscope. Bar represents 400 μm. ( C ) eGFP fluorescence in N. benthamiana resulting from systemic infection of agroinfiltrated SR (+)eGFP , M (-)opt and L (+)opt constructs. Infected plants ( a and b ) and leaves ( c and d ) were photographed at 18 dpi under white light and (hand-held) UV light, respectively. ( D ) eGFP fluorescence in N. benthamiana resulting from systemic infection of agroinfiltrated S (+) , MR (-)eGFP and L (+)opt constructs. Infected plants ( a and b ) and leaves ( c and d ) were photographed at 50 dpi under white light and (hand-held) UV light, respectively.
    Figure Legend Snippet: Establishment of a systemic infection in N. benthamiana with replicons S (+) and M (-) co-expressed with full length antigenomic L (+)opt . ( A ) Schematic representation of constructs expressing TSWV full length antigenomic L (+)opt with optimized RdRp, full length genomic M (-)opt with optimized GP, MR (-)eGFP , MR (-)mCherry , full length antigenomic S (+) and SR (+)eGFP . Primary viral RNA transcripts are transcribed from a double 35S promoter (2×35S) and flanked by a HH and HDV ribozyme (RZ). ( B ) eGFP and mCherry fluorescence in N. benthamiana resulting from systemic infection of agroinfiltrated SR (+)eGFP , MR (-)mCherry and L (+)opt constructs. The systemic infected plants ( a and b ) and leaves ( c and d ) were photographed at 21 dpi under white light and (hand-held) ultraviolet (UV) light. Foci of eGFP and mCherry fluorescence in leaves shown in panel d as visualized under a fluorescence microscope. Bar represents 400 μm. ( C ) eGFP fluorescence in N. benthamiana resulting from systemic infection of agroinfiltrated SR (+)eGFP , M (-)opt and L (+)opt constructs. Infected plants ( a and b ) and leaves ( c and d ) were photographed at 18 dpi under white light and (hand-held) UV light, respectively. ( D ) eGFP fluorescence in N. benthamiana resulting from systemic infection of agroinfiltrated S (+) , MR (-)eGFP and L (+)opt constructs. Infected plants ( a and b ) and leaves ( c and d ) were photographed at 50 dpi under white light and (hand-held) UV light, respectively.

    Techniques Used: Infection, Construct, Expressing, Fluorescence, Microscopy

    Functional analysis of RdRp expressed from TSWV L (+)opt , NSm from MR (-)eGFP and N from SR (+)eGFP using the mini-genome replication system in N. benthamiana . ( A ) Functional analysis of RdRp expressed from TSWV L (+)opt using the S RNA mini-replicon system in N. benthamiana . The L (+)opt , RdRp, or pCB301 empty vector (Vec) was co-expressed with N, SR (-)mCherry eGFP and the four VSRs in N. benthamiana leaves. ( B ) Functional analysis of N expressed from SR (+)eGFP in N. benthamiana. SR (+)eGFP was co-expressed with the empty vector (Vec), N, RdRp or N+L (+)opt in N. benthamiana leaves in the presence of four VSRs. ( C ) Functional analysis of NSm expressed from MR (-)eGFP in N. benthamiana. MR (-)eGFP was co-expressed with the empty vector (Vec), N, RdRp or N+L (+)opt in N. benthamiana leaves in the presence of four VSRs. Foci showing mCherry and eGFP fluorescence in agroinfiltrated N. benthamiana leaves were examined at 3 dpi by a fluorescence microscope. Bars represent 400 μm.
    Figure Legend Snippet: Functional analysis of RdRp expressed from TSWV L (+)opt , NSm from MR (-)eGFP and N from SR (+)eGFP using the mini-genome replication system in N. benthamiana . ( A ) Functional analysis of RdRp expressed from TSWV L (+)opt using the S RNA mini-replicon system in N. benthamiana . The L (+)opt , RdRp, or pCB301 empty vector (Vec) was co-expressed with N, SR (-)mCherry eGFP and the four VSRs in N. benthamiana leaves. ( B ) Functional analysis of N expressed from SR (+)eGFP in N. benthamiana. SR (+)eGFP was co-expressed with the empty vector (Vec), N, RdRp or N+L (+)opt in N. benthamiana leaves in the presence of four VSRs. ( C ) Functional analysis of NSm expressed from MR (-)eGFP in N. benthamiana. MR (-)eGFP was co-expressed with the empty vector (Vec), N, RdRp or N+L (+)opt in N. benthamiana leaves in the presence of four VSRs. Foci showing mCherry and eGFP fluorescence in agroinfiltrated N. benthamiana leaves were examined at 3 dpi by a fluorescence microscope. Bars represent 400 μm.

    Techniques Used: Functional Assay, Plasmid Preparation, Fluorescence, Microscopy

    39) Product Images from "Composition, Formation, and Regulation of the Cytosolic C-ring, a Dynamic Component of the Type III Secretion Injectisome"

    Article Title: Composition, Formation, and Regulation of the Cytosolic C-ring, a Dynamic Component of the Type III Secretion Injectisome

    Journal: PLoS Biology

    doi: 10.1371/journal.pbio.1002039

    The C-ring subunit YscQ is a dynamic element of the injectisome. Fluorescent foci formed by EGFP-YscQ, but not by YscC-mCherry or YscV-mCherry show exchange with a cytosolic pool. (A) Position of the three studied components in the injectisome. Secretin YscC, blue; IM export apparatus component YscV, green; C-ring YscQ, red. Conformation and localization of the dashed components have not been experimentally determined. (B) Activity of strains expressing the indicated fusion proteins in an export kinetics assay based on the translocation of an artificial export substrate, YopH 1–17 -β-lactamase (Yop-bla). Wild-type control, set to 100%, black; negative controls (bla fused to the non-T3SS substrate glutathione-S-transferase GST and T3SS defective strain ΔYscN), grey. Error bars represent standard errors of the mean of n = 5 measurements ( n = 4 for ΔYscN) in technical triplicates. (C) Micrographs showing representative images before and after photobleaching of a single fluorescent spot (marked by red circle) of YscC-mCherry, YscV-mCherry, and EGFP-YscQ. (D) Fluorescence recovery over time. Circles indicate the relative spot intensity in single frames for the micrographs shown in (C). (E) Localization of single PAmCherry-YscQ molecules in PALM. (F) Cellular distribution of motile (blue) and stationary (red) PAmCherry-YscQ molecules. (G) Single step diffusion coefficients for PAmCherry-YscQ and YscV-PAmCherry. See Materials and Methods for details. Scale bars, 1 μm. Numerical values and raw data (B, D, G) can be found in S1 Data .
    Figure Legend Snippet: The C-ring subunit YscQ is a dynamic element of the injectisome. Fluorescent foci formed by EGFP-YscQ, but not by YscC-mCherry or YscV-mCherry show exchange with a cytosolic pool. (A) Position of the three studied components in the injectisome. Secretin YscC, blue; IM export apparatus component YscV, green; C-ring YscQ, red. Conformation and localization of the dashed components have not been experimentally determined. (B) Activity of strains expressing the indicated fusion proteins in an export kinetics assay based on the translocation of an artificial export substrate, YopH 1–17 -β-lactamase (Yop-bla). Wild-type control, set to 100%, black; negative controls (bla fused to the non-T3SS substrate glutathione-S-transferase GST and T3SS defective strain ΔYscN), grey. Error bars represent standard errors of the mean of n = 5 measurements ( n = 4 for ΔYscN) in technical triplicates. (C) Micrographs showing representative images before and after photobleaching of a single fluorescent spot (marked by red circle) of YscC-mCherry, YscV-mCherry, and EGFP-YscQ. (D) Fluorescence recovery over time. Circles indicate the relative spot intensity in single frames for the micrographs shown in (C). (E) Localization of single PAmCherry-YscQ molecules in PALM. (F) Cellular distribution of motile (blue) and stationary (red) PAmCherry-YscQ molecules. (G) Single step diffusion coefficients for PAmCherry-YscQ and YscV-PAmCherry. See Materials and Methods for details. Scale bars, 1 μm. Numerical values and raw data (B, D, G) can be found in S1 Data .

    Techniques Used: Activity Assay, Expressing, Translocation Assay, Fluorescence, Diffusion-based Assay

    YscQ C , the product from an internal translation initiation site in yscQ , is required for the formation of C-ring foci, which is cooperative. Strains expressing YscQ M218A from the native promoter and therefore lacking YscQ C do not secrete effectors and YscQ M218A requires YscQ C for localization at the injectisome. YscQ C and YscQ M218A colocalize; increased expression levels of mCherry-YscQ C lead to an increase in spot number, but not spot intensity for EGFP-YscQ M218A . (A) Secretion assay showing the secreted proteins in a wild-type (WT) strain, and YscQ M218A , uncomplemented or complemented in trans with YscQ C , EGFP-YscQ C , or mCherry-YscQ C . (B) Fluorescence micrographs showing the distribution of EGFP-YscQ, EGFP-YscQ C , and EGFP-YscQ M218A , uncomplemented or complemented by YscQ C in trans . (C) Cellular distribution of EGFP-YscQ M218A (expressed from its native promoter on the virulence plasmid, second row) and mCherry-YscQ C (expressed in increasing amounts in trans induced by the given concentrations of arabinose, third row). The overlay (bottom row) displays the colocalization of both YscQ versions. Scale bars, 2 μm. (D) Number of detected EGFP-YscQ M218A foci per bacterium in cells expressing increasing amounts of mCherry-YscQ C (as in (C)). n > 170 cells per condition (see Materials and Methods for details). Black lines represent the average number of foci per bacterium; circles represent the number of foci per single bacterium (arranged in groups of ten). ***, p
    Figure Legend Snippet: YscQ C , the product from an internal translation initiation site in yscQ , is required for the formation of C-ring foci, which is cooperative. Strains expressing YscQ M218A from the native promoter and therefore lacking YscQ C do not secrete effectors and YscQ M218A requires YscQ C for localization at the injectisome. YscQ C and YscQ M218A colocalize; increased expression levels of mCherry-YscQ C lead to an increase in spot number, but not spot intensity for EGFP-YscQ M218A . (A) Secretion assay showing the secreted proteins in a wild-type (WT) strain, and YscQ M218A , uncomplemented or complemented in trans with YscQ C , EGFP-YscQ C , or mCherry-YscQ C . (B) Fluorescence micrographs showing the distribution of EGFP-YscQ, EGFP-YscQ C , and EGFP-YscQ M218A , uncomplemented or complemented by YscQ C in trans . (C) Cellular distribution of EGFP-YscQ M218A (expressed from its native promoter on the virulence plasmid, second row) and mCherry-YscQ C (expressed in increasing amounts in trans induced by the given concentrations of arabinose, third row). The overlay (bottom row) displays the colocalization of both YscQ versions. Scale bars, 2 μm. (D) Number of detected EGFP-YscQ M218A foci per bacterium in cells expressing increasing amounts of mCherry-YscQ C (as in (C)). n > 170 cells per condition (see Materials and Methods for details). Black lines represent the average number of foci per bacterium; circles represent the number of foci per single bacterium (arranged in groups of ten). ***, p

    Techniques Used: Expressing, Fluorescence, Plasmid Preparation

    40) Product Images from "A Genetically-Defined Circuit for Arousal from Sleep during Hypercapnia"

    Article Title: A Genetically-Defined Circuit for Arousal from Sleep during Hypercapnia

    Journal: Neuron

    doi: 10.1016/j.neuron.2017.10.009

    Chemogenetic activation of the PBel CGRP neurons produces wakefulness CGRP-Cre-ER mice were crossed with td-Tomato reporter mice, resulting in nearly all of the Cre-containing cells in the PBel (red in A1) also expressing CGRP (green in A2), as seen in the merged image (A3). B, a drawing schematically showing the experimental strategy for chemogenetic activation of PBel CGRP and C the construct of the AAV-FLEX-hM3Dq- mcherry used in the study. D is a photomicrograph of coronal section of a mouse brain immunostained for mcherry (co-expressed with hM3Dq) localized to the CGRP positive neurons in the PBel. Panels E–G are further magnifications of the section shown in D (E right side, F, G left side). Panel H compares the percentage time spent in wake, non-REM and REM sleep (mean ± SEM) during the light dark phase, after either saline (black) or two different doses of CNO (0.1 mg/kg pink or 0.3mg/kg red); while hourly comparison (mean ± SEM) is shown in I-K for the 0.3 mg/kg dose. L and M are representative hypnograms from a mouse injected with saline (L) and CNO (0.3mg/kg, M) on two different days at the beginning of light phase (marked by black and red triangles). The upper trace in each panel shows time spent in wake (W), Non-Rem (NR), and REM sleep (R). The middle trace shows the delta power in the EEG, with bouts of NREM sleep shown in green, REM sleep in red, and wake in black. The lowest trace, EMG, show periods of movement, mostly seen during wake. Abbreviations: PB, parabrachial nucleus, el external lateral, cl central lateral, dl dorsal lateral, m medial PB subnuclei; scp, superior cerebellar peduncle. (***- P
    Figure Legend Snippet: Chemogenetic activation of the PBel CGRP neurons produces wakefulness CGRP-Cre-ER mice were crossed with td-Tomato reporter mice, resulting in nearly all of the Cre-containing cells in the PBel (red in A1) also expressing CGRP (green in A2), as seen in the merged image (A3). B, a drawing schematically showing the experimental strategy for chemogenetic activation of PBel CGRP and C the construct of the AAV-FLEX-hM3Dq- mcherry used in the study. D is a photomicrograph of coronal section of a mouse brain immunostained for mcherry (co-expressed with hM3Dq) localized to the CGRP positive neurons in the PBel. Panels E–G are further magnifications of the section shown in D (E right side, F, G left side). Panel H compares the percentage time spent in wake, non-REM and REM sleep (mean ± SEM) during the light dark phase, after either saline (black) or two different doses of CNO (0.1 mg/kg pink or 0.3mg/kg red); while hourly comparison (mean ± SEM) is shown in I-K for the 0.3 mg/kg dose. L and M are representative hypnograms from a mouse injected with saline (L) and CNO (0.3mg/kg, M) on two different days at the beginning of light phase (marked by black and red triangles). The upper trace in each panel shows time spent in wake (W), Non-Rem (NR), and REM sleep (R). The middle trace shows the delta power in the EEG, with bouts of NREM sleep shown in green, REM sleep in red, and wake in black. The lowest trace, EMG, show periods of movement, mostly seen during wake. Abbreviations: PB, parabrachial nucleus, el external lateral, cl central lateral, dl dorsal lateral, m medial PB subnuclei; scp, superior cerebellar peduncle. (***- P

    Techniques Used: Activation Assay, Mouse Assay, Expressing, Construct, Injection

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    TaKaRa mcherry
    Localization and expression pattern of MoRfx1 in Magnaporthe oryzae . (A) Co‐localization of MoRfx1‐GFP and <t>H2B‐mCherry</t> fusion proteins in the hyphal cells of the wild‐type. Bar, 10 μm. (B) Expression of MoRFX1 in eight developmental stages of the wild‐type: VH, mycelia grown in liquid complete medium (CM); VH‐S, mycelia grown in liquid CM and then cultured in H 2 O for 4 h; VH‐D, mycelia grown on CM plates in the dark; VH‐L, mycelia grown on CM plates under continuous light; CO, conidia; AP‐4h, appressoria at 4 h post‐inoculation (hpi); AP‐18h, appressoria at 18 hpi; IH, invasive hyphae in barley at 2 days post‐inoculation (dpi).
    Mcherry, supplied by TaKaRa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mcherry/product/TaKaRa
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mcherry - by Bioz Stars, 2022-10
    86/100 stars
      Buy from Supplier

    86
    TaKaRa retroviral transfer vector pbmn i mcherry
    Establishment of an SBP-CSN1 expressing cell line. ( A ) Representation of <t>pBMN.SBP-CSN1.i.mCherry,</t> the <t>pBMN.i.mCherry</t> <t>retroviral</t> vector harboring the SBP sequence fused to the N′ terminus of CSN subunit 1. ( B ) Retroviral particles produced from pBMN.SBP-CSN1.i.mCherry were used to infect naive SupT1 cells. The flow cytometry plot shows the analysis of infected cells sorted on the basis of mCherry expression. ( C ) Individual sorted cells were grown in 96-well plates, and the brightest clone was selected to establish the SBP-CSN1 cell line. The fluorescence microscopy images of the cell line obtained shows high expression of mCherry. ( D ) Expression of SBP-CSN1 was confirmed by Western blot analysis. The SBP-Citrine cell line was used as control. The arrows show SBP-CSN1 and endogenous CSN1 (eCSN1) only in the SBP-CSN1 cell line.
    Retroviral Transfer Vector Pbmn I Mcherry, supplied by TaKaRa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/retroviral transfer vector pbmn i mcherry/product/TaKaRa
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    retroviral transfer vector pbmn i mcherry - by Bioz Stars, 2022-10
    86/100 stars
      Buy from Supplier

    Image Search Results


    Localization and expression pattern of MoRfx1 in Magnaporthe oryzae . (A) Co‐localization of MoRfx1‐GFP and H2B‐mCherry fusion proteins in the hyphal cells of the wild‐type. Bar, 10 μm. (B) Expression of MoRFX1 in eight developmental stages of the wild‐type: VH, mycelia grown in liquid complete medium (CM); VH‐S, mycelia grown in liquid CM and then cultured in H 2 O for 4 h; VH‐D, mycelia grown on CM plates in the dark; VH‐L, mycelia grown on CM plates under continuous light; CO, conidia; AP‐4h, appressoria at 4 h post‐inoculation (hpi); AP‐18h, appressoria at 18 hpi; IH, invasive hyphae in barley at 2 days post‐inoculation (dpi).

    Journal: Molecular Plant Pathology

    Article Title: The regulatory factor X protein MoRfx1 is required for development and pathogenicity in the rice blast fungus Magnaporthe oryzae

    doi: 10.1111/mpp.12461

    Figure Lengend Snippet: Localization and expression pattern of MoRfx1 in Magnaporthe oryzae . (A) Co‐localization of MoRfx1‐GFP and H2B‐mCherry fusion proteins in the hyphal cells of the wild‐type. Bar, 10 μm. (B) Expression of MoRFX1 in eight developmental stages of the wild‐type: VH, mycelia grown in liquid complete medium (CM); VH‐S, mycelia grown in liquid CM and then cultured in H 2 O for 4 h; VH‐D, mycelia grown on CM plates in the dark; VH‐L, mycelia grown on CM plates under continuous light; CO, conidia; AP‐4h, appressoria at 4 h post‐inoculation (hpi); AP‐18h, appressoria at 18 hpi; IH, invasive hyphae in barley at 2 days post‐inoculation (dpi).

    Article Snippet: GFP in pKD9‐GFP was replaced by mCherry amplified from pmCherry (Clontech) using the p9mcherryF/p9mcherryR primer pair (Table S4) to produce pKD9‐mCherry.

    Techniques: Expressing, Cell Culture

    Subcellular localization of hTPC1 stably expressed in HEK293 cells. A–F , stable cell lines were made in HEK293 cells using mCherry-tagged hTPC1 ( red ) and GFP-tagged organelle markers ( green ). The upper panels of each image show a GFP-labeled organelle ( left ) and mCherry-labeled hTPC1 ( right ). G , a stable HEK293 cell line that expressed GFP-hTPC1 ( green ; left ) and mCherry-hTPC2 ( red ; right ). The lower panels for all images show a merged image (colocalization in yellow ; left ) and a bright-field image for the cell (differential interference contrast; right ). Scale bars = 10 μm. H , Pearson coefficients for cells exemplified in A–G . Data are means ± S.E. of three cells for each pair. TfR , transferrin receptor.

    Journal: The Journal of Biological Chemistry

    Article Title: Organelle-specific Subunit Interactions of the Vertebrate Two-pore Channel Family *

    doi: 10.1074/jbc.M114.610493

    Figure Lengend Snippet: Subcellular localization of hTPC1 stably expressed in HEK293 cells. A–F , stable cell lines were made in HEK293 cells using mCherry-tagged hTPC1 ( red ) and GFP-tagged organelle markers ( green ). The upper panels of each image show a GFP-labeled organelle ( left ) and mCherry-labeled hTPC1 ( right ). G , a stable HEK293 cell line that expressed GFP-hTPC1 ( green ; left ) and mCherry-hTPC2 ( red ; right ). The lower panels for all images show a merged image (colocalization in yellow ; left ) and a bright-field image for the cell (differential interference contrast; right ). Scale bars = 10 μm. H , Pearson coefficients for cells exemplified in A–G . Data are means ± S.E. of three cells for each pair. TfR , transferrin receptor.

    Article Snippet: For expression of an mCherry-GFP concatemer, the coding sequence of mCherry was inserted in pEGFP-C1 (Clontech).

    Techniques: Stable Transfection, Labeling

    Subcellular localization of hTPC2 stably expressed in HEK293 cells. A–G , stable cell lines were made in HEK293 cells using mCherry-tagged hTPC2 ( red ) and GFP-tagged organelle markers ( green ). The upper panels of each image show a GFP-labeled organelle ( left ) and mCherry-labeled hTPC2 ( right ). The lower panels show a merged image (colocalization in yellow ; left ) and a bright-field image for the cell ( right ). Scale bars = 10 μm. H , Pearson coefficients for cells exemplified in A–G . Data are means ± S.E. of three cells for each pair. TfR , transferrin receptor.

    Journal: The Journal of Biological Chemistry

    Article Title: Organelle-specific Subunit Interactions of the Vertebrate Two-pore Channel Family *

    doi: 10.1074/jbc.M114.610493

    Figure Lengend Snippet: Subcellular localization of hTPC2 stably expressed in HEK293 cells. A–G , stable cell lines were made in HEK293 cells using mCherry-tagged hTPC2 ( red ) and GFP-tagged organelle markers ( green ). The upper panels of each image show a GFP-labeled organelle ( left ) and mCherry-labeled hTPC2 ( right ). The lower panels show a merged image (colocalization in yellow ; left ) and a bright-field image for the cell ( right ). Scale bars = 10 μm. H , Pearson coefficients for cells exemplified in A–G . Data are means ± S.E. of three cells for each pair. TfR , transferrin receptor.

    Article Snippet: For expression of an mCherry-GFP concatemer, the coding sequence of mCherry was inserted in pEGFP-C1 (Clontech).

    Techniques: Stable Transfection, Labeling

    Interaction between hTPC2 and other TPC isoforms when coexpressed in HEK293 cells. A , expression levels detected by immunoblotting ( IB ) of HA-hTPC2 ( upper panel ), mCherry ( middle left panel ), and mCherry-tagged TPC isoforms ( middle right panel ) in stable HA-hTPC2 cells transiently transfected with the cDNA for mCherry ( vec ) and N-terminal mCherry-tagged hTPC1 ( h1 ), hTPC2 ( h2 ), rTPC3 ( r3 ), or cTPC3 ( c3 ). Actin was used as a loading control ( lower panel ). B , co-IP of HA-hTPC2 by the anti-mCherry antibody. The immunoprecipitants were left untreated ( left panel ) or treated with PNGase F ( right panel ). Samples from mCherry-hTPC2-transfected cells ( h2 ) were loaded as 1/10 ( h2/10 ) and equivalent (h2) amounts compared with the other samples for immunoblotting. Open triangles indicate possible dimers. The filled arrowhead indicates reduced size of possible dimers after deglycosylation by PNGase F. Open arrows indicate the ∼85-kDa band mostly unaffected by PNGase F except for the mCherry-hTPC2-transfected cell samples. The filled arrow indicates the reduced size from the ∼85-kDa band. C , FRET efficiency between GFP and mCherry in HEK293 cells that coexpressed GFP-tagged hTPC2 (either N- or C-terminal tag) and N-terminal mCherry-tagged TPC isoforms as indicated. Data are means ± S.E. for the number of cells indicated in parentheses . ***, p

    Journal: The Journal of Biological Chemistry

    Article Title: Organelle-specific Subunit Interactions of the Vertebrate Two-pore Channel Family *

    doi: 10.1074/jbc.M114.610493

    Figure Lengend Snippet: Interaction between hTPC2 and other TPC isoforms when coexpressed in HEK293 cells. A , expression levels detected by immunoblotting ( IB ) of HA-hTPC2 ( upper panel ), mCherry ( middle left panel ), and mCherry-tagged TPC isoforms ( middle right panel ) in stable HA-hTPC2 cells transiently transfected with the cDNA for mCherry ( vec ) and N-terminal mCherry-tagged hTPC1 ( h1 ), hTPC2 ( h2 ), rTPC3 ( r3 ), or cTPC3 ( c3 ). Actin was used as a loading control ( lower panel ). B , co-IP of HA-hTPC2 by the anti-mCherry antibody. The immunoprecipitants were left untreated ( left panel ) or treated with PNGase F ( right panel ). Samples from mCherry-hTPC2-transfected cells ( h2 ) were loaded as 1/10 ( h2/10 ) and equivalent (h2) amounts compared with the other samples for immunoblotting. Open triangles indicate possible dimers. The filled arrowhead indicates reduced size of possible dimers after deglycosylation by PNGase F. Open arrows indicate the ∼85-kDa band mostly unaffected by PNGase F except for the mCherry-hTPC2-transfected cell samples. The filled arrow indicates the reduced size from the ∼85-kDa band. C , FRET efficiency between GFP and mCherry in HEK293 cells that coexpressed GFP-tagged hTPC2 (either N- or C-terminal tag) and N-terminal mCherry-tagged TPC isoforms as indicated. Data are means ± S.E. for the number of cells indicated in parentheses . ***, p

    Article Snippet: For expression of an mCherry-GFP concatemer, the coding sequence of mCherry was inserted in pEGFP-C1 (Clontech).

    Techniques: Expressing, Transfection, Co-Immunoprecipitation Assay

    Different subcellular localizations of cTPC3 and rTPC3 when stably expressed in HEK293 cells. Stable cell lines were made in HEK293 cells using mCherry-tagged ( red ) cTPC3 ( A ) or rTPC3 ( B ) and GFP-tagged organelle markers ( green ). The upper panels of each image show a GFP-labeled organelle ( left ) and mCherry-labeled TPC3 ( right ). The lower panels show a merged image (colocalization in yellow ; left ) and a bright-field image ( right ). Scale bars = 10 μm. Pearson coefficients for cells exemplified in the images are shown on the right. Data are means ± S.E. of three cells for each pair. TfR , transferrin receptor.

    Journal: The Journal of Biological Chemistry

    Article Title: Organelle-specific Subunit Interactions of the Vertebrate Two-pore Channel Family *

    doi: 10.1074/jbc.M114.610493

    Figure Lengend Snippet: Different subcellular localizations of cTPC3 and rTPC3 when stably expressed in HEK293 cells. Stable cell lines were made in HEK293 cells using mCherry-tagged ( red ) cTPC3 ( A ) or rTPC3 ( B ) and GFP-tagged organelle markers ( green ). The upper panels of each image show a GFP-labeled organelle ( left ) and mCherry-labeled TPC3 ( right ). The lower panels show a merged image (colocalization in yellow ; left ) and a bright-field image ( right ). Scale bars = 10 μm. Pearson coefficients for cells exemplified in the images are shown on the right. Data are means ± S.E. of three cells for each pair. TfR , transferrin receptor.

    Article Snippet: For expression of an mCherry-GFP concatemer, the coding sequence of mCherry was inserted in pEGFP-C1 (Clontech).

    Techniques: Stable Transfection, Labeling

    Inhibition of de-novo protein synthesis by NS3-activated MazF based zymoxin in NS3-expressing cells. 1×10 5 Tet-NS3/activated MazF or Tet-NS3/uncleavable MazF cells were seeded per well in 24-wells plate. 24 or 48 h later, cells were supplemented with tetracycline to a final concentration of 1000 ng/ml, or left untreated (48 h tet, 24 h tet and no tet, respectively). 72 h after seeding, levels of de-novo protein synthesis were determined by [ 3 H]-leucine incorporation assay, as described in “ materials and methods ”. Results are expressed as percent of the value obtained for cells which were not induced to express the NS3 protease (No tet). Each bar represents the mean ± SD of a set of data determined in triplicates. Numbers above each bar represent mean counts per minute (CPM) values for 7 micrograms total protein samples (upper panel). 30 micrograms of total protein from lysates of the described cells were analyzed by immunoblotting with mouse anti-mCherry (for detection of the zymoxin), mouse anti-GFP (for the detection of EGFP-NS3) and mouse anti actin antibodies (loading control) followed by HRP-conjugated secondary antibodies and ECL development. Solid arrow: full length zymoxin. Hollow arrow: N' terminal portion of NS3-cleaved zymoxin (lower panel).

    Journal: PLoS ONE

    Article Title: Removal of Hepatitis C Virus-Infected Cells by a Zymogenized Bacterial Toxin

    doi: 10.1371/journal.pone.0032320

    Figure Lengend Snippet: Inhibition of de-novo protein synthesis by NS3-activated MazF based zymoxin in NS3-expressing cells. 1×10 5 Tet-NS3/activated MazF or Tet-NS3/uncleavable MazF cells were seeded per well in 24-wells plate. 24 or 48 h later, cells were supplemented with tetracycline to a final concentration of 1000 ng/ml, or left untreated (48 h tet, 24 h tet and no tet, respectively). 72 h after seeding, levels of de-novo protein synthesis were determined by [ 3 H]-leucine incorporation assay, as described in “ materials and methods ”. Results are expressed as percent of the value obtained for cells which were not induced to express the NS3 protease (No tet). Each bar represents the mean ± SD of a set of data determined in triplicates. Numbers above each bar represent mean counts per minute (CPM) values for 7 micrograms total protein samples (upper panel). 30 micrograms of total protein from lysates of the described cells were analyzed by immunoblotting with mouse anti-mCherry (for detection of the zymoxin), mouse anti-GFP (for the detection of EGFP-NS3) and mouse anti actin antibodies (loading control) followed by HRP-conjugated secondary antibodies and ECL development. Solid arrow: full length zymoxin. Hollow arrow: N' terminal portion of NS3-cleaved zymoxin (lower panel).

    Article Snippet: The eukaryotic CMV promoter-based GFP-fusion expression vector pEGFP C2, which was used for expression of mCherry, MazF and MazF-based zymoxins, was from Clontech (USA).

    Techniques: Inhibition, Expressing, Concentration Assay

    Eradication of HCV-infected hepatocytes by recombinant-adenovirus delivered MazF based zymoxin. 3×10 4 cells from mixed HCV infected and uninfected culture (at 1∶1 ratio) were seeded per well into 8-well chamber slides. 24 h later, cells were treated with recombinant adenoviruses (MOI of ∼3) encoding for the mCherry fused NS3-activated MazF or uncleavable-MazF zymoxins. Control cells remained untreated. 72 h post treatment, cells were fixed, permeabilized and immunostained with mouse anti-HCV core and FITC-conjugated goat anti mouse antibodies for visualization of infected cells (green). Cell nuclei were then stained with DAPI (cyan) and slides were visualized by fluorescence microscopy. The bar represents 100 µm (upper panel). The fraction (given in percentage) of HCV-infected cells from the general cell population was evaluated, for each treatment, by dividing the number of the green, HCV-core positive cells by the general number of cells (DAPI stained) (lower panel). Each bar represents the mean ±SD of a set of data collected from five representative microscopic fields. Numbers in brackets represent the percentage of the HCV-infected cells in each treatment relatively to their percentage in the untreated culture.

    Journal: PLoS ONE

    Article Title: Removal of Hepatitis C Virus-Infected Cells by a Zymogenized Bacterial Toxin

    doi: 10.1371/journal.pone.0032320

    Figure Lengend Snippet: Eradication of HCV-infected hepatocytes by recombinant-adenovirus delivered MazF based zymoxin. 3×10 4 cells from mixed HCV infected and uninfected culture (at 1∶1 ratio) were seeded per well into 8-well chamber slides. 24 h later, cells were treated with recombinant adenoviruses (MOI of ∼3) encoding for the mCherry fused NS3-activated MazF or uncleavable-MazF zymoxins. Control cells remained untreated. 72 h post treatment, cells were fixed, permeabilized and immunostained with mouse anti-HCV core and FITC-conjugated goat anti mouse antibodies for visualization of infected cells (green). Cell nuclei were then stained with DAPI (cyan) and slides were visualized by fluorescence microscopy. The bar represents 100 µm (upper panel). The fraction (given in percentage) of HCV-infected cells from the general cell population was evaluated, for each treatment, by dividing the number of the green, HCV-core positive cells by the general number of cells (DAPI stained) (lower panel). Each bar represents the mean ±SD of a set of data collected from five representative microscopic fields. Numbers in brackets represent the percentage of the HCV-infected cells in each treatment relatively to their percentage in the untreated culture.

    Article Snippet: The eukaryotic CMV promoter-based GFP-fusion expression vector pEGFP C2, which was used for expression of mCherry, MazF and MazF-based zymoxins, was from Clontech (USA).

    Techniques: Infection, Recombinant, Staining, Fluorescence, Microscopy

    Treatment of HCV infected/uninfected mixed cell culture with recombinant adenovirus-delivered MazF based zymoxin. Uninfected (HCV-negative) Huh7.5 cells and a mixed culture of HCV infected and uninfected cells at 1∶1 ratio (50% infected culture) were seeded in 96-well plates (1×10 4 cells/well). After 24 h, cells were treated with recombinant adenoviruses (MOI of ∼3) encoding for the mCherry fused NS3-activated MazF or uncleavable-MazF zymoxins. Control cells remained untreated. Upper panel: MTT viability assay: 72 h post treatment, the fraction of viable cells (relatively to untreated controls) was determined using an enzymatic MTT assay. A representative graph of three independent experiments is shown. Each bar represents the mean ±SD of a set of data determined in triplicates. Lower panel: Microscopic examination: 72 h post treatment, the uninfected (HCV-negative) Huh7.5 cells, the mixed culture of HCV infected and uninfected cells and the control untreated cells were fixed and subjected to microscopic examination. Hollow arrows point to cells that are characterized by a “typical” Huh7.5 cell morphology. Filled arrows point to partially detached cells with round, condensed or distorted shape. The bar represents 200 µm.

    Journal: PLoS ONE

    Article Title: Removal of Hepatitis C Virus-Infected Cells by a Zymogenized Bacterial Toxin

    doi: 10.1371/journal.pone.0032320

    Figure Lengend Snippet: Treatment of HCV infected/uninfected mixed cell culture with recombinant adenovirus-delivered MazF based zymoxin. Uninfected (HCV-negative) Huh7.5 cells and a mixed culture of HCV infected and uninfected cells at 1∶1 ratio (50% infected culture) were seeded in 96-well plates (1×10 4 cells/well). After 24 h, cells were treated with recombinant adenoviruses (MOI of ∼3) encoding for the mCherry fused NS3-activated MazF or uncleavable-MazF zymoxins. Control cells remained untreated. Upper panel: MTT viability assay: 72 h post treatment, the fraction of viable cells (relatively to untreated controls) was determined using an enzymatic MTT assay. A representative graph of three independent experiments is shown. Each bar represents the mean ±SD of a set of data determined in triplicates. Lower panel: Microscopic examination: 72 h post treatment, the uninfected (HCV-negative) Huh7.5 cells, the mixed culture of HCV infected and uninfected cells and the control untreated cells were fixed and subjected to microscopic examination. Hollow arrows point to cells that are characterized by a “typical” Huh7.5 cell morphology. Filled arrows point to partially detached cells with round, condensed or distorted shape. The bar represents 200 µm.

    Article Snippet: The eukaryotic CMV promoter-based GFP-fusion expression vector pEGFP C2, which was used for expression of mCherry, MazF and MazF-based zymoxins, was from Clontech (USA).

    Techniques: Infection, Cell Culture, Recombinant, MTT Assay, Viability Assay

    Eradication of NS3-expressing Huh7.5 cells by recombinant adenovirus-mediated delivery of mCherry-NS3 activated MazF encoding cassette. 1×10 4 wild-type (W.T) or EGFP-full NS3-4A expressing Huh7.5 cells were seeded per well in 96 well plates. After 24 h, recombinant adenoviruses encoding for mCherry-fused NS3 activated MazF or uncleavable-MazF zymoxins were added at the indicated MOI's. Control cells remained untreated. (A) MTT viability assay: 4 days post infection, the fraction of viable cells (relatively to uninfected controls) was determined using an enzymatic MTT assay. A representative graph of three independent experiments is shown. Each bar represents the mean ±SD of a set of data determined in triplicates. (B) Microscopic examination: 4 days post infection, wild-type (lower panel) or EGFP-full NS3-4A expressing Huh7.5 cells (upper panel), uninfected or infected with recombinant adenoviruses encoding for mCherry fused NS3-activated MazF zymoxin (at MOI of ∼3), were fixed and subjected to microscopic examination. The bar represents 200 µm.

    Journal: PLoS ONE

    Article Title: Removal of Hepatitis C Virus-Infected Cells by a Zymogenized Bacterial Toxin

    doi: 10.1371/journal.pone.0032320

    Figure Lengend Snippet: Eradication of NS3-expressing Huh7.5 cells by recombinant adenovirus-mediated delivery of mCherry-NS3 activated MazF encoding cassette. 1×10 4 wild-type (W.T) or EGFP-full NS3-4A expressing Huh7.5 cells were seeded per well in 96 well plates. After 24 h, recombinant adenoviruses encoding for mCherry-fused NS3 activated MazF or uncleavable-MazF zymoxins were added at the indicated MOI's. Control cells remained untreated. (A) MTT viability assay: 4 days post infection, the fraction of viable cells (relatively to uninfected controls) was determined using an enzymatic MTT assay. A representative graph of three independent experiments is shown. Each bar represents the mean ±SD of a set of data determined in triplicates. (B) Microscopic examination: 4 days post infection, wild-type (lower panel) or EGFP-full NS3-4A expressing Huh7.5 cells (upper panel), uninfected or infected with recombinant adenoviruses encoding for mCherry fused NS3-activated MazF zymoxin (at MOI of ∼3), were fixed and subjected to microscopic examination. The bar represents 200 µm.

    Article Snippet: The eukaryotic CMV promoter-based GFP-fusion expression vector pEGFP C2, which was used for expression of mCherry, MazF and MazF-based zymoxins, was from Clontech (USA).

    Techniques: Expressing, Recombinant, MTT Assay, Viability Assay, Infection

    Eradication of NS3 expressing cells by mCherry-NS3 activated MazF. Upper panel: Tet-inducible full NS3-4A (No MazF), Tet-NS3/activated MazF (NS3-activated MazF) or Tet-NS3/uncleavable MazF (uncleavable MazF) cells were seeded in 96 well plates (2×10 4 cells per well). After 24 h, cells were supplemented with 3 fold dilutions of tetracycline starting with concentration of 1000 ng/ml, or left untreated. 72 hours later, the fraction of viable cells (relatively to the untreated controls) was determined using an enzymatic MTT assay. Each bar represents the mean ±SD of a set of data from six wells. Lower panel: 30 ng of total protein from lysates of Tet-NS3/uncleavable MazF cells that were supplemented with 3 fold dilutions of tetracycline for 48 h were analyzed by immunoblotting with mouse anti-GFP (for the detection of EGFP-NS3) and mouse anti-actin antibodies (loading control) followed by HRP-conjugated secondary antibodies and ECL development.

    Journal: PLoS ONE

    Article Title: Removal of Hepatitis C Virus-Infected Cells by a Zymogenized Bacterial Toxin

    doi: 10.1371/journal.pone.0032320

    Figure Lengend Snippet: Eradication of NS3 expressing cells by mCherry-NS3 activated MazF. Upper panel: Tet-inducible full NS3-4A (No MazF), Tet-NS3/activated MazF (NS3-activated MazF) or Tet-NS3/uncleavable MazF (uncleavable MazF) cells were seeded in 96 well plates (2×10 4 cells per well). After 24 h, cells were supplemented with 3 fold dilutions of tetracycline starting with concentration of 1000 ng/ml, or left untreated. 72 hours later, the fraction of viable cells (relatively to the untreated controls) was determined using an enzymatic MTT assay. Each bar represents the mean ±SD of a set of data from six wells. Lower panel: 30 ng of total protein from lysates of Tet-NS3/uncleavable MazF cells that were supplemented with 3 fold dilutions of tetracycline for 48 h were analyzed by immunoblotting with mouse anti-GFP (for the detection of EGFP-NS3) and mouse anti-actin antibodies (loading control) followed by HRP-conjugated secondary antibodies and ECL development.

    Article Snippet: The eukaryotic CMV promoter-based GFP-fusion expression vector pEGFP C2, which was used for expression of mCherry, MazF and MazF-based zymoxins, was from Clontech (USA).

    Techniques: Expressing, Concentration Assay, MTT Assay

    Colony formation assay for the assessment of “mCherry-NS3 activated MazF” cytotoxicity toward naïve cells. A day before transfection, 7.5×10 5 HEK293 T-REx cells where seeded per well in 6 wells plate and subsequently transfected with 2 µg of plasmids encoding either mCherry-NS3 activated MazF, mCherry (only the fluorescent protein) or EGFP- MazF (where MazF is not fused to its inhibitory peptide). 48 hours later, transfection efficiency was assessed by fluorescence microscopy and was determined as equal between the plasmids. Transfected cells were than trypsinized, counted and seeded in 3 fold dilutions (starting from 150,000 cells/well) in 6 well plates and were incubated for 10 days in the presence of 1 mg/ml of G418 (to which all three plasmids confer resistance). Surviving colonies were fixed and stained with Giemsa (upper panel). Number of surviving Colonies from wells that were seeded with 5556 cells was determined by manual counting. Each bar represents the mean ± standard deviation (SD) of a set of data from two wells (lower panel).

    Journal: PLoS ONE

    Article Title: Removal of Hepatitis C Virus-Infected Cells by a Zymogenized Bacterial Toxin

    doi: 10.1371/journal.pone.0032320

    Figure Lengend Snippet: Colony formation assay for the assessment of “mCherry-NS3 activated MazF” cytotoxicity toward naïve cells. A day before transfection, 7.5×10 5 HEK293 T-REx cells where seeded per well in 6 wells plate and subsequently transfected with 2 µg of plasmids encoding either mCherry-NS3 activated MazF, mCherry (only the fluorescent protein) or EGFP- MazF (where MazF is not fused to its inhibitory peptide). 48 hours later, transfection efficiency was assessed by fluorescence microscopy and was determined as equal between the plasmids. Transfected cells were than trypsinized, counted and seeded in 3 fold dilutions (starting from 150,000 cells/well) in 6 well plates and were incubated for 10 days in the presence of 1 mg/ml of G418 (to which all three plasmids confer resistance). Surviving colonies were fixed and stained with Giemsa (upper panel). Number of surviving Colonies from wells that were seeded with 5556 cells was determined by manual counting. Each bar represents the mean ± standard deviation (SD) of a set of data from two wells (lower panel).

    Article Snippet: The eukaryotic CMV promoter-based GFP-fusion expression vector pEGFP C2, which was used for expression of mCherry, MazF and MazF-based zymoxins, was from Clontech (USA).

    Techniques: Colony Assay, Transfection, Fluorescence, Microscopy, Incubation, Staining, Standard Deviation

    Schematic representation of the construct “mCherry-NS3 activated MazF” and hypothetical mechanism of activation by NS3 protease. The NS3-activated MazF zymoxin was constructed by fusing 5 elements in the following order (from the N terminus): monomeric red fluorescence protein mCherry, E. coli MazF ribonuclease, HCV P10-P10' NS3 cleavage sequence derived from 2a genotype (strain JFH1) NS5A/B junction, a short inhibitory peptide corresponding to MazE C-terminal 35 amino-acids (which encompass the 23 amino-acids inhibitory peptide (MazEp) that has been described by Li et al. [25] ) and the C-terminal ER membrane anchor of the tyrosine phosphatase PTP1B [28] . After being anchored to the ER membrane, the NS3 cleavage site that is located between the ribonuclease and the inhibitory peptide in the “mCherry-NS3 activated MazF” construct (which is active as a dimer but for convenience is illustrated here in its monomeric form) is cleaved by the HCV- NS3 protease which is also localized to the cytoplasmic side of the ER membrane. The toxic ribonuclease, no longer covalently tethered to its ER-anchored inhibitor, is now free to diffuse to the cytoplasm (which lacks the antidote) and exert its destructive activity.

    Journal: PLoS ONE

    Article Title: Removal of Hepatitis C Virus-Infected Cells by a Zymogenized Bacterial Toxin

    doi: 10.1371/journal.pone.0032320

    Figure Lengend Snippet: Schematic representation of the construct “mCherry-NS3 activated MazF” and hypothetical mechanism of activation by NS3 protease. The NS3-activated MazF zymoxin was constructed by fusing 5 elements in the following order (from the N terminus): monomeric red fluorescence protein mCherry, E. coli MazF ribonuclease, HCV P10-P10' NS3 cleavage sequence derived from 2a genotype (strain JFH1) NS5A/B junction, a short inhibitory peptide corresponding to MazE C-terminal 35 amino-acids (which encompass the 23 amino-acids inhibitory peptide (MazEp) that has been described by Li et al. [25] ) and the C-terminal ER membrane anchor of the tyrosine phosphatase PTP1B [28] . After being anchored to the ER membrane, the NS3 cleavage site that is located between the ribonuclease and the inhibitory peptide in the “mCherry-NS3 activated MazF” construct (which is active as a dimer but for convenience is illustrated here in its monomeric form) is cleaved by the HCV- NS3 protease which is also localized to the cytoplasmic side of the ER membrane. The toxic ribonuclease, no longer covalently tethered to its ER-anchored inhibitor, is now free to diffuse to the cytoplasm (which lacks the antidote) and exert its destructive activity.

    Article Snippet: The eukaryotic CMV promoter-based GFP-fusion expression vector pEGFP C2, which was used for expression of mCherry, MazF and MazF-based zymoxins, was from Clontech (USA).

    Techniques: Construct, Activation Assay, Fluorescence, Sequencing, Derivative Assay, Activity Assay

    Expression of mCherry-NS3 activated MazF results in growth inhibition and morphological changes in NS3-expressing cells. 1×10 5 Tet-NS3/activated MazF or Tet-NS3/uncleavable MazF cells were seeded on poly-L-lysine coated cover-slips in a 24 well-plate. 12 h later, cells were supplemented with 10 ng/ml or 1000 ng/ml of tetracycline, or left untreated. 36 h later, cells were fixed. Following nuclear staining by Hoechst 33258 (Blue), slides were examined by fluorescence microscopy. The bar represents 50 µm.

    Journal: PLoS ONE

    Article Title: Removal of Hepatitis C Virus-Infected Cells by a Zymogenized Bacterial Toxin

    doi: 10.1371/journal.pone.0032320

    Figure Lengend Snippet: Expression of mCherry-NS3 activated MazF results in growth inhibition and morphological changes in NS3-expressing cells. 1×10 5 Tet-NS3/activated MazF or Tet-NS3/uncleavable MazF cells were seeded on poly-L-lysine coated cover-slips in a 24 well-plate. 12 h later, cells were supplemented with 10 ng/ml or 1000 ng/ml of tetracycline, or left untreated. 36 h later, cells were fixed. Following nuclear staining by Hoechst 33258 (Blue), slides were examined by fluorescence microscopy. The bar represents 50 µm.

    Article Snippet: The eukaryotic CMV promoter-based GFP-fusion expression vector pEGFP C2, which was used for expression of mCherry, MazF and MazF-based zymoxins, was from Clontech (USA).

    Techniques: Expressing, Inhibition, Staining, Fluorescence, Microscopy

    Establishment of an SBP-CSN1 expressing cell line. ( A ) Representation of pBMN.SBP-CSN1.i.mCherry, the pBMN.i.mCherry retroviral vector harboring the SBP sequence fused to the N′ terminus of CSN subunit 1. ( B ) Retroviral particles produced from pBMN.SBP-CSN1.i.mCherry were used to infect naive SupT1 cells. The flow cytometry plot shows the analysis of infected cells sorted on the basis of mCherry expression. ( C ) Individual sorted cells were grown in 96-well plates, and the brightest clone was selected to establish the SBP-CSN1 cell line. The fluorescence microscopy images of the cell line obtained shows high expression of mCherry. ( D ) Expression of SBP-CSN1 was confirmed by Western blot analysis. The SBP-Citrine cell line was used as control. The arrows show SBP-CSN1 and endogenous CSN1 (eCSN1) only in the SBP-CSN1 cell line.

    Journal: OMICS : a Journal of Integrative Biology

    Article Title: Purification of the COP9 Signalosome Complex and Binding Partners from Human T Cells

    doi: 10.1089/omi.2011.0158

    Figure Lengend Snippet: Establishment of an SBP-CSN1 expressing cell line. ( A ) Representation of pBMN.SBP-CSN1.i.mCherry, the pBMN.i.mCherry retroviral vector harboring the SBP sequence fused to the N′ terminus of CSN subunit 1. ( B ) Retroviral particles produced from pBMN.SBP-CSN1.i.mCherry were used to infect naive SupT1 cells. The flow cytometry plot shows the analysis of infected cells sorted on the basis of mCherry expression. ( C ) Individual sorted cells were grown in 96-well plates, and the brightest clone was selected to establish the SBP-CSN1 cell line. The fluorescence microscopy images of the cell line obtained shows high expression of mCherry. ( D ) Expression of SBP-CSN1 was confirmed by Western blot analysis. The SBP-Citrine cell line was used as control. The arrows show SBP-CSN1 and endogenous CSN1 (eCSN1) only in the SBP-CSN1 cell line.

    Article Snippet: The retroviral transfer vector pBMN.i.mCherry was constructed by amplifying mCherry from pmCherry-C1 (Clontech, Palo Alto, CA) using the forward primer with extending NcoI site ATCGATGGATCCCCACCATGGTGAGCAAGGGCGAGGAG and reverse primer with extending XhoI site ATGGACGAGCTGTACAAGTAACTCGAGGATCGATC, and inserting it into partially digested pBMN-i-eGFP (Gary Nolan, Stanford University) with NcoI/SalI.

    Techniques: Expressing, Plasmid Preparation, Sequencing, Produced, Flow Cytometry, Cytometry, Infection, Fluorescence, Microscopy, Western Blot