Structured Review

Addgene inc mcherry
AAV8-EGFP identifies transduced CST neurons. ( A ) Sagittal brain section 4 wk after injection with AAV8-EGFP (arrow). Neuronal somata and dendrites ( Inset ) and descending axons are brightly labeled with EGFP. ( B–D ) AAV8-EGFP and <t>AAV8-EBFP-2A-mCherry</t>
Mcherry, supplied by Addgene inc, used in various techniques. Bioz Stars score: 99/100, based on 39 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mcherry/product/Addgene inc
Average 99 stars, based on 39 article reviews
Price from $9.99 to $1999.99
mcherry - by Bioz Stars, 2022-10
99/100 stars

Images

1) Product Images from "Kr?ppel-like Factor 7 engineered for transcriptional activation promotes axon regeneration in the adult corticospinal tract"

Article Title: Kr?ppel-like Factor 7 engineered for transcriptional activation promotes axon regeneration in the adult corticospinal tract

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi: 10.1073/pnas.1120684109

AAV8-EGFP identifies transduced CST neurons. ( A ) Sagittal brain section 4 wk after injection with AAV8-EGFP (arrow). Neuronal somata and dendrites ( Inset ) and descending axons are brightly labeled with EGFP. ( B–D ) AAV8-EGFP and AAV8-EBFP-2A-mCherry
Figure Legend Snippet: AAV8-EGFP identifies transduced CST neurons. ( A ) Sagittal brain section 4 wk after injection with AAV8-EGFP (arrow). Neuronal somata and dendrites ( Inset ) and descending axons are brightly labeled with EGFP. ( B–D ) AAV8-EGFP and AAV8-EBFP-2A-mCherry

Techniques Used: Injection, Labeling

2) Product Images from "Cellomics approach for high-throughput functional annotation of Caenorhabditis elegans neural network"

Article Title: Cellomics approach for high-throughput functional annotation of Caenorhabditis elegans neural network

Journal: Scientific Reports

doi: 10.1038/s41598-018-28653-x

Identification of HSNs. The whole body was observed with a 10× objective, and the mid-body section with a 40× objective. The 2D images shown are the maximum-intensity projection reconstructed from the z-stacks of the images acquired with a confocal microscope. ( a ) Fluorescence images of an egg-laying individual. The fluorescence of ChR2–GFP is presented in green, and that of mCherry in magenta. The cells that are producing both fluorescent proteins are presented in white. In this particular individual that laid eggs in a light-dependent manner, the expression of ChR2–GFP in HSNR was observed. ( b ) Fluorescence image of a non-egg-laying individual. Light did not induce egg-laying behavior in this individual, and no production of ChR2–GFP was observed in neurons around the vulva. ( c ) Profiles of fluorescence intensity. Fluorescence profiles of dotted lines were quantified by ImageJ.
Figure Legend Snippet: Identification of HSNs. The whole body was observed with a 10× objective, and the mid-body section with a 40× objective. The 2D images shown are the maximum-intensity projection reconstructed from the z-stacks of the images acquired with a confocal microscope. ( a ) Fluorescence images of an egg-laying individual. The fluorescence of ChR2–GFP is presented in green, and that of mCherry in magenta. The cells that are producing both fluorescent proteins are presented in white. In this particular individual that laid eggs in a light-dependent manner, the expression of ChR2–GFP in HSNR was observed. ( b ) Fluorescence image of a non-egg-laying individual. Light did not induce egg-laying behavior in this individual, and no production of ChR2–GFP was observed in neurons around the vulva. ( c ) Profiles of fluorescence intensity. Fluorescence profiles of dotted lines were quantified by ImageJ.

Techniques Used: Microscopy, Fluorescence, Expressing

Stochastic labeling of neurons based on Brainbow technologies. ( a ) One of the constructs (pCre) is designed to produce Cre recombinase in a heat-shock-dependent manner. Another construct (pSTAR) is based on Brainbow technologies, with the lox sequences, mCherry , and the transcription factor QF2 w encoded downstream of the pan-neuronal promoter ( F25B3.3p ). In the initial state, pSTAR and pF25B3.3p_mCherry produces mCherry in all neurons. When an excision occurs between lox2272 sequences, QF2 w is produced, and the production of mCherry continues from pF25B3.3p_mCherry even after Cre recombination. pQUAS_ChR2_GFP expresses the effector ChR2::GFP in a QF2 w -dependent manner. ( b ) Stochastic labeling of neurons with ChR2–GFP. A brief heat shock was applied to the transgenic C. elegans that carries the four constructs as extrachromosomal (Ex) arrays, and each sample was observed using confocal laser scanning microscopy 12 h later. For negative control experiments, the transgenic C. elegans without heat shock, the transgenic lines without pSTAR plasmid or pCre plasmid with heat shock were used. The whole body was observed at a magnification of 10×, and the mid-body section (framed in white in the whole body picture), where neurons can be counted with relative ease, was observed at a magnification of 40×. The 2D images shown are the maximum-intensity projection reconstructed from the z-stacks of the images acquired with the confocal microscope. The fluorescence of ChR2–GFP is presented in green, and that of mCherry in magenta. The cells producing both fluorescent proteins are presented in white and indicated by an arrow. The white-dyed cells differed from one individual to another, indicating the success of stochastic labeling. ( c ) The ratio of GFP positive cells/mCherry positive cells. We established three transgenic lines harboring all plasmids shown in Fig. 2a, and quantified the ratio of GFP positive cells using at least nine individuals from each line. In each individual, we counted 12–26 fluorescent cells. In this experiments, we counted fluorescent cells of the mid-body and tail sections, because cytoplasmic production of mCherry made it difficult to precisely count the number of fluorescent neurons around the head ganglia. The data show mean ± standard deviation, and Tukey’s test was used to test the significance of differences between all of pairs of the result.
Figure Legend Snippet: Stochastic labeling of neurons based on Brainbow technologies. ( a ) One of the constructs (pCre) is designed to produce Cre recombinase in a heat-shock-dependent manner. Another construct (pSTAR) is based on Brainbow technologies, with the lox sequences, mCherry , and the transcription factor QF2 w encoded downstream of the pan-neuronal promoter ( F25B3.3p ). In the initial state, pSTAR and pF25B3.3p_mCherry produces mCherry in all neurons. When an excision occurs between lox2272 sequences, QF2 w is produced, and the production of mCherry continues from pF25B3.3p_mCherry even after Cre recombination. pQUAS_ChR2_GFP expresses the effector ChR2::GFP in a QF2 w -dependent manner. ( b ) Stochastic labeling of neurons with ChR2–GFP. A brief heat shock was applied to the transgenic C. elegans that carries the four constructs as extrachromosomal (Ex) arrays, and each sample was observed using confocal laser scanning microscopy 12 h later. For negative control experiments, the transgenic C. elegans without heat shock, the transgenic lines without pSTAR plasmid or pCre plasmid with heat shock were used. The whole body was observed at a magnification of 10×, and the mid-body section (framed in white in the whole body picture), where neurons can be counted with relative ease, was observed at a magnification of 40×. The 2D images shown are the maximum-intensity projection reconstructed from the z-stacks of the images acquired with the confocal microscope. The fluorescence of ChR2–GFP is presented in green, and that of mCherry in magenta. The cells producing both fluorescent proteins are presented in white and indicated by an arrow. The white-dyed cells differed from one individual to another, indicating the success of stochastic labeling. ( c ) The ratio of GFP positive cells/mCherry positive cells. We established three transgenic lines harboring all plasmids shown in Fig. 2a, and quantified the ratio of GFP positive cells using at least nine individuals from each line. In each individual, we counted 12–26 fluorescent cells. In this experiments, we counted fluorescent cells of the mid-body and tail sections, because cytoplasmic production of mCherry made it difficult to precisely count the number of fluorescent neurons around the head ganglia. The data show mean ± standard deviation, and Tukey’s test was used to test the significance of differences between all of pairs of the result.

Techniques Used: Labeling, Construct, Produced, Transgenic Assay, Confocal Laser Scanning Microscopy, Negative Control, Plasmid Preparation, Microscopy, Fluorescence, Standard Deviation

3) Product Images from "Characterisation and use of a functional Gadd45g bacterial artificial chromosome"

Article Title: Characterisation and use of a functional Gadd45g bacterial artificial chromosome

Journal: Scientific Reports

doi: 10.1038/s41598-018-35458-5

( A ) Position of the mCherry reporter in the Gadd45g open reading frame of E15 BAC; ( B ) Detection of Cherry fluorescence in 11.5 dpc embryonic gonad. Green signal indicates location of PECAM. Blue is DAPI staining. ( C ) Cherry signal is detected in somatic cells of the gonad, which lack PECAM staining shown in ( D ). A few somatic cells (lacking PECAM) also lack Cherry signal (white arrows). ( E ) Lateral view of 10.5 dpc embryo showing Cherry fluorescence in developing neural tissue (forebrain (fb), midbrain (mb), hindbrain (hb)). ( F ) Dorsal view of same embryo reveals signal in neural tube (nt), trigeminal ganglion (tg) and facial ganglion (fg). ( G ) Section of embryo (in plane indicated by dotted line in ( E )) shows neural tube and dorsal root gangion (drg) fluorescence. Scale bar = 50 μm.
Figure Legend Snippet: ( A ) Position of the mCherry reporter in the Gadd45g open reading frame of E15 BAC; ( B ) Detection of Cherry fluorescence in 11.5 dpc embryonic gonad. Green signal indicates location of PECAM. Blue is DAPI staining. ( C ) Cherry signal is detected in somatic cells of the gonad, which lack PECAM staining shown in ( D ). A few somatic cells (lacking PECAM) also lack Cherry signal (white arrows). ( E ) Lateral view of 10.5 dpc embryo showing Cherry fluorescence in developing neural tissue (forebrain (fb), midbrain (mb), hindbrain (hb)). ( F ) Dorsal view of same embryo reveals signal in neural tube (nt), trigeminal ganglion (tg) and facial ganglion (fg). ( G ) Section of embryo (in plane indicated by dotted line in ( E )) shows neural tube and dorsal root gangion (drg) fluorescence. Scale bar = 50 μm.

Techniques Used: BAC Assay, Fluorescence, Staining

4) Product Images from "Proteome‐scale mapping of binding sites in the unstructured regions of the human proteome"

Article Title: Proteome‐scale mapping of binding sites in the unstructured regions of the human proteome

Journal: Molecular Systems Biology

doi: 10.15252/msb.202110584

KPNA4‐binding peptides are functional NLSs Sequence logos of four different NLS classes binding to KPNA4 generated using PepTools. Structure of KPNA2 (PDB:1PJN, minor groove peptide PDB:3ZIP) with ligands bound to the major (purple) and minor groove (blue). Representative cellular localization experiment. HEK293 cells were transiently transfected with the NLS sensor and fixed 36 h after transfection, and imaged using epifluorescence microscopy. The nucleus was stained with DAPI. ( n = 3, independent experiments; the scale bar indicates 10 μm). FP competition experiments using FITC‐Myc 320–328 as a probe for the major groove (blue) or FITC‐NCOR2 1307–1322 as a probe for the minor groove and competing with unlabeled DMTF1 44–59 , KDR 958–973 and TPX2 312–327 peptides. ( n = 3, technical replicates, shown are individual data points. Source data are provided). Sequences of tested NLSs together with the outcome of the affinity measurement through FP and localization of the GFP‐tagged peptides (see Appendix Fig S8 for details). Mutational analysis of identified NLSs in the context of full‐length proteins using mCherry‐tagged HJURP, SPRTN, and HNRNPC. The scale bar indicates 10 μm. Source data are available online for this figure.
Figure Legend Snippet: KPNA4‐binding peptides are functional NLSs Sequence logos of four different NLS classes binding to KPNA4 generated using PepTools. Structure of KPNA2 (PDB:1PJN, minor groove peptide PDB:3ZIP) with ligands bound to the major (purple) and minor groove (blue). Representative cellular localization experiment. HEK293 cells were transiently transfected with the NLS sensor and fixed 36 h after transfection, and imaged using epifluorescence microscopy. The nucleus was stained with DAPI. ( n = 3, independent experiments; the scale bar indicates 10 μm). FP competition experiments using FITC‐Myc 320–328 as a probe for the major groove (blue) or FITC‐NCOR2 1307–1322 as a probe for the minor groove and competing with unlabeled DMTF1 44–59 , KDR 958–973 and TPX2 312–327 peptides. ( n = 3, technical replicates, shown are individual data points. Source data are provided). Sequences of tested NLSs together with the outcome of the affinity measurement through FP and localization of the GFP‐tagged peptides (see Appendix Fig S8 for details). Mutational analysis of identified NLSs in the context of full‐length proteins using mCherry‐tagged HJURP, SPRTN, and HNRNPC. The scale bar indicates 10 μm. Source data are available online for this figure.

Techniques Used: Binding Assay, Functional Assay, Sequencing, Generated, Transfection, Epifluorescence Microscopy, Staining

5) Product Images from "REST and Stress Resistance in Aging and Alzheimer’s Disease"

Article Title: REST and Stress Resistance in Aging and Alzheimer’s Disease

Journal: Nature

doi: 10.1038/nature13163

C. elegans SPR-4 protects against oxidative stress and Aβ toxicity a. Spr-4(by105) worms incubated continuously with paraquat (5 mM) exhibit increased mortality rescued by wild-type SPR-4 or human REST. Shown is a representative experiment replicated three times. b. Quantitative analysis of survival in wild-type worms expressing mCherry or SPR-4 (WT+mCherry and WT+SPR-4), spr-4(by105) mutants, and spr-4(by105) mutants expressing SPR-4 or human REST [ spr4(by105) +SPR4 and spr4(by105) +REST]. Shown is the percent change in mean survival relative to wild-type. Values represent the mean ± S.D., n=3 independent replicates of at least 30 animals per genotype; ** P
Figure Legend Snippet: C. elegans SPR-4 protects against oxidative stress and Aβ toxicity a. Spr-4(by105) worms incubated continuously with paraquat (5 mM) exhibit increased mortality rescued by wild-type SPR-4 or human REST. Shown is a representative experiment replicated three times. b. Quantitative analysis of survival in wild-type worms expressing mCherry or SPR-4 (WT+mCherry and WT+SPR-4), spr-4(by105) mutants, and spr-4(by105) mutants expressing SPR-4 or human REST [ spr4(by105) +SPR4 and spr4(by105) +REST]. Shown is the percent change in mean survival relative to wild-type. Values represent the mean ± S.D., n=3 independent replicates of at least 30 animals per genotype; ** P

Techniques Used: SPR Assay, Incubation, Expressing

6) Product Images from "Electroporation enables the efficient mRNA delivery into the mouse zygotes and facilitates CRISPR/Cas9-based genome editing"

Article Title: Electroporation enables the efficient mRNA delivery into the mouse zygotes and facilitates CRISPR/Cas9-based genome editing

Journal: Scientific Reports

doi: 10.1038/srep11315

Optimal conditions for the electroporation used to deliver mRNA into fertilized eggs. (a) Electroporation set-up used in this study. The right box is the electroporator CUY21 EDIT II (BEX Co. Ltd.), which generates electric pulses, and the left is a stereoscopic microscope for embryo manipulation. Two electrodes were placed on the microscope stage and connected to the electroporator. (b) Higher magnification of the red rectangle in ( a ). (c) Schematic of the electroporation chamber with customized platinum electrodes (BEX Co. Ltd.). Fertilized mouse eggs were placed in the RNA solution in the gap between the electrodes. (d) Microscopic view of the eggs set in the electrode gap. The eggs were manually positioned into a line prior to electroporation. (e) Schematic of the electroporation conditions used to introduce RNAs into mouse eggs: three to eleven repeats of a square pulse of 10–50 V; 3-msec pulses with 97-msec intervals were used. (f) Fluorescence intensity of mCherry (red circles) and rate of electroporated embryo survival to the blastocyst stage (blue squares) were plotted at various voltages (n = 10). The duration of each pulse and number of pulse repeats were fixed at 3 msec and 5 repeats, respectively. (g) The fluorescent intensity of mCherry (red closed circle) and the survival rate of the electroporated embryos to the blastocyst stage (blue squares) were plotted as a function of the number of electroporation repeats (n = 12). The voltage and duration of each pulse were fixed at 30 V and 3 msec, respectively.
Figure Legend Snippet: Optimal conditions for the electroporation used to deliver mRNA into fertilized eggs. (a) Electroporation set-up used in this study. The right box is the electroporator CUY21 EDIT II (BEX Co. Ltd.), which generates electric pulses, and the left is a stereoscopic microscope for embryo manipulation. Two electrodes were placed on the microscope stage and connected to the electroporator. (b) Higher magnification of the red rectangle in ( a ). (c) Schematic of the electroporation chamber with customized platinum electrodes (BEX Co. Ltd.). Fertilized mouse eggs were placed in the RNA solution in the gap between the electrodes. (d) Microscopic view of the eggs set in the electrode gap. The eggs were manually positioned into a line prior to electroporation. (e) Schematic of the electroporation conditions used to introduce RNAs into mouse eggs: three to eleven repeats of a square pulse of 10–50 V; 3-msec pulses with 97-msec intervals were used. (f) Fluorescence intensity of mCherry (red circles) and rate of electroporated embryo survival to the blastocyst stage (blue squares) were plotted at various voltages (n = 10). The duration of each pulse and number of pulse repeats were fixed at 3 msec and 5 repeats, respectively. (g) The fluorescent intensity of mCherry (red closed circle) and the survival rate of the electroporated embryos to the blastocyst stage (blue squares) were plotted as a function of the number of electroporation repeats (n = 12). The voltage and duration of each pulse were fixed at 30 V and 3 msec, respectively.

Techniques Used: Electroporation, Microscopy, Introduce, Fluorescence

The single-stranded oligodeoxynucleotide (ssODN)-induced generation of HDR-mediated insertions. (a) Schematic of the target sequence and the ssODN designed to insert the 37-base loxP sequence (shown in green) and EcoRI recognition site (shown in red). (b) Representative embryo electroporated with Cas9 mRNA, gRNA, and ssODN. The mCherry fluorescence completely disappeared in the electroporated embryos, while control (no electroporation) embryos displayed fluorescent signals. (c) RFLP analysis of the collected embryos. The EcoRI-inserted alleles were digested into two bands (138 bps and 374 bps). The intact allele had 497 bps. The digested bands were observed in embryos # 3, 6, 8, and 9. The unexpected bands in #1 and #7 were the target sequence containing a large deletion.
Figure Legend Snippet: The single-stranded oligodeoxynucleotide (ssODN)-induced generation of HDR-mediated insertions. (a) Schematic of the target sequence and the ssODN designed to insert the 37-base loxP sequence (shown in green) and EcoRI recognition site (shown in red). (b) Representative embryo electroporated with Cas9 mRNA, gRNA, and ssODN. The mCherry fluorescence completely disappeared in the electroporated embryos, while control (no electroporation) embryos displayed fluorescent signals. (c) RFLP analysis of the collected embryos. The EcoRI-inserted alleles were digested into two bands (138 bps and 374 bps). The intact allele had 497 bps. The digested bands were observed in embryos # 3, 6, 8, and 9. The unexpected bands in #1 and #7 were the target sequence containing a large deletion.

Techniques Used: Sequencing, Fluorescence, Electroporation

7) Product Images from "Caenorhabditis elegans ATPase inhibitor factor 1 (IF1) MAI-2 preserves the mitochondrial membrane potential (Δψm) and is important to induce germ cell apoptosis"

Article Title: Caenorhabditis elegans ATPase inhibitor factor 1 (IF1) MAI-2 preserves the mitochondrial membrane potential (Δψm) and is important to induce germ cell apoptosis

Journal: PLoS ONE

doi: 10.1371/journal.pone.0181984

Alleles and translational reporters used to study the function of mitochondria ATPase inhibitors in C . elegans . (A) The mai-1 and mai-2 genes are composed of 2 exons (gray rectangles) and one intron (thin line). (B) We generated two mutant alleles, mai-2(xm18) and mai-2(xm19) , by CRISPR/Cas9 genome editing. Both mutant alleles encode two truncated MAI-2 proteins that conserve the mitochondrial targeting sequence (MTS) but lack the inhibitory domain (ID) and histidine-rich region (HRR), which are essential for MAI-2 function and regulation (3,4). The dotted line (—) in the mai-2(xm19) product represents a randomly formed sequence of amino acids (4). (C) To study protein localization, we generated translational reporters for MAI-1 and MAI-2 (5–7). We inserted, in the carboxyl-terminal, a GFP construct for MAI-2 (5); for MAI-1, we inserted a carboxy-terminal mCherry (6) and an amino-terminal GFP (7).
Figure Legend Snippet: Alleles and translational reporters used to study the function of mitochondria ATPase inhibitors in C . elegans . (A) The mai-1 and mai-2 genes are composed of 2 exons (gray rectangles) and one intron (thin line). (B) We generated two mutant alleles, mai-2(xm18) and mai-2(xm19) , by CRISPR/Cas9 genome editing. Both mutant alleles encode two truncated MAI-2 proteins that conserve the mitochondrial targeting sequence (MTS) but lack the inhibitory domain (ID) and histidine-rich region (HRR), which are essential for MAI-2 function and regulation (3,4). The dotted line (—) in the mai-2(xm19) product represents a randomly formed sequence of amino acids (4). (C) To study protein localization, we generated translational reporters for MAI-1 and MAI-2 (5–7). We inserted, in the carboxyl-terminal, a GFP construct for MAI-2 (5); for MAI-1, we inserted a carboxy-terminal mCherry (6) and an amino-terminal GFP (7).

Techniques Used: Generated, Mutagenesis, CRISPR, Sequencing, Construct

MAI-2::GFP is localized in the mitochondria. We crossed MAI-2::GFP animals with mitochondria expressing transgenic TOMM-20::mCherry animals (A-F). We mounted and observed one-day-old adult animals under a confocal microscopy and observed co-localization in germ cells (A-C) and embryos (D-F). Stained MAI-2::GFP animals with MitoTracker Red CMXRos were mounted and observed under a fluorescence microscope (G-O). We observed the co-localization of signals in tissues such as the hypodermis (J-L) and muscle (M-O), shown in the inset. d: distal, p: proximal.
Figure Legend Snippet: MAI-2::GFP is localized in the mitochondria. We crossed MAI-2::GFP animals with mitochondria expressing transgenic TOMM-20::mCherry animals (A-F). We mounted and observed one-day-old adult animals under a confocal microscopy and observed co-localization in germ cells (A-C) and embryos (D-F). Stained MAI-2::GFP animals with MitoTracker Red CMXRos were mounted and observed under a fluorescence microscope (G-O). We observed the co-localization of signals in tissues such as the hypodermis (J-L) and muscle (M-O), shown in the inset. d: distal, p: proximal.

Techniques Used: Expressing, Transgenic Assay, Confocal Microscopy, Staining, Fluorescence, Microscopy

8) Product Images from "Loss of α-Synuclein Does Not Affect Mitochondrial Bioenergetics in Rodent Neurons"

Article Title: Loss of α-Synuclein Does Not Affect Mitochondrial Bioenergetics in Rodent Neurons

Journal: eNeuro

doi: 10.1523/ENEURO.0216-16.2017

Loss of αsyn does not affect mitochondrial-derived ATP levels at the nerve terminal. A–C , ATP levels of hippocampal neurons were assessed using an ATP YEMK FRET sensor, and synaptic boutons were identified with mCherry-synaptophysin. Basal ATP levels in Tyrodes buffer containing glucose and pyruvate were identical in neurons isolated from control and αsyn KO mice ( A ; n = 14–15 coverslips, not significant (NS) by unpaired two-tailed t test). Electrical field stimulation (10 Hz*60 s, blue lines) in pyruvate buffer without ( B ) and with ( C ) 2-deoxyglucose (2DG, 5 mM) and iodoacetate (IAA, 1 mM) to completely block glycolysis reduced ATP levels similarly in neurons in control and αsyn KO mice (compilation of two experiments, n = 6–7 coverslips/group with 15–20 boutons/coverslip). NS for ATP level of αsyn KO versus control groups at corresponding time points. Note that overall ATP levels (control and αsyn KO) decreased after the first electrical stimulation ( B and C , p
Figure Legend Snippet: Loss of αsyn does not affect mitochondrial-derived ATP levels at the nerve terminal. A–C , ATP levels of hippocampal neurons were assessed using an ATP YEMK FRET sensor, and synaptic boutons were identified with mCherry-synaptophysin. Basal ATP levels in Tyrodes buffer containing glucose and pyruvate were identical in neurons isolated from control and αsyn KO mice ( A ; n = 14–15 coverslips, not significant (NS) by unpaired two-tailed t test). Electrical field stimulation (10 Hz*60 s, blue lines) in pyruvate buffer without ( B ) and with ( C ) 2-deoxyglucose (2DG, 5 mM) and iodoacetate (IAA, 1 mM) to completely block glycolysis reduced ATP levels similarly in neurons in control and αsyn KO mice (compilation of two experiments, n = 6–7 coverslips/group with 15–20 boutons/coverslip). NS for ATP level of αsyn KO versus control groups at corresponding time points. Note that overall ATP levels (control and αsyn KO) decreased after the first electrical stimulation ( B and C , p

Techniques Used: Derivative Assay, Isolation, Mouse Assay, Two Tailed Test, Blocking Assay

Loss of all three (α, β and γ) syn isoforms does not affect mitochondria-derived ATP or activity-dependent ATP consumption at the nerve terminal. ( A ) ATP levels of syn TKO and control hippocampal neurons expressing the ATP FRET sensor were assessed in normal Tyrode’s buffer with either glucose (30 mM) or 2DG (30 mM) without glucose. Neurons were imaged with or without electrical field stimulation (5 Hz) as indicated. Stimulation with 5 Hz for 475 s in 2DG decreased the FRET signal similarly in wt and TKO neurons (2-way ANOVA, interaction p > 0.99) Data are plotted as mean ± SEM by coverslip. n = 4 (wt) and 5 (TKO) coverslips for 5 Hz stimulus/2DG, and 2 coverslips (wt and TKO) for non-stimulated glucose and 2DG controls (50 boutons per coverslip) ( B–D ) Neurons expressing VGLUT1-pHluorin-mCherry were perfused in Tyrodes containing 30 mM glucose (without pyruvate) and stimulated at 30 Hz for 5 s. After continued perfusion for 5 min in either glucose or in 2 μM rotenone without glucose, neurons were stimulated with repeated 5 s 30 Hz bursts every 120 s (blue boxes). ( B ) Sample fluorescence traces from single representative VGLUT1-pHluorin boutons in wild-type (lower) and syn TKO (upper) neurons in rotenone, ( C ) Average fluorescence responses. Data were normalized to the second stimulus response, and points represent mean values by coverslip ± SEM. n = 7 (wt) and 8 (TKO) coverslips (18-50 boutons per coverslip) for pyruvate/rotenone experiments, from two independent experiments. ( D ) Fluorescence traces from individual boutons (as in (A)) were scored with regard to synaptic vesicle cycling response at each stimulus burst. The stimulus burst at which the response
Figure Legend Snippet: Loss of all three (α, β and γ) syn isoforms does not affect mitochondria-derived ATP or activity-dependent ATP consumption at the nerve terminal. ( A ) ATP levels of syn TKO and control hippocampal neurons expressing the ATP FRET sensor were assessed in normal Tyrode’s buffer with either glucose (30 mM) or 2DG (30 mM) without glucose. Neurons were imaged with or without electrical field stimulation (5 Hz) as indicated. Stimulation with 5 Hz for 475 s in 2DG decreased the FRET signal similarly in wt and TKO neurons (2-way ANOVA, interaction p > 0.99) Data are plotted as mean ± SEM by coverslip. n = 4 (wt) and 5 (TKO) coverslips for 5 Hz stimulus/2DG, and 2 coverslips (wt and TKO) for non-stimulated glucose and 2DG controls (50 boutons per coverslip) ( B–D ) Neurons expressing VGLUT1-pHluorin-mCherry were perfused in Tyrodes containing 30 mM glucose (without pyruvate) and stimulated at 30 Hz for 5 s. After continued perfusion for 5 min in either glucose or in 2 μM rotenone without glucose, neurons were stimulated with repeated 5 s 30 Hz bursts every 120 s (blue boxes). ( B ) Sample fluorescence traces from single representative VGLUT1-pHluorin boutons in wild-type (lower) and syn TKO (upper) neurons in rotenone, ( C ) Average fluorescence responses. Data were normalized to the second stimulus response, and points represent mean values by coverslip ± SEM. n = 7 (wt) and 8 (TKO) coverslips (18-50 boutons per coverslip) for pyruvate/rotenone experiments, from two independent experiments. ( D ) Fluorescence traces from individual boutons (as in (A)) were scored with regard to synaptic vesicle cycling response at each stimulus burst. The stimulus burst at which the response "failed" was recorded, and data were plotted as survival curves. Boutons were scored as failed if stim ΔF was

Techniques Used: Derivative Assay, Activity Assay, Expressing, Fluorescence

Loss of αsyn does not affect the distribution of mitochondria in axons of nigrostriatal DA neurons in vivo . A–B , Adeno-associated viruses (AAVs) expressing mitochondria-targeted GFP (mitoGFP; green, to visualize mitochondria) and mCherry-Synaptophysin (red, to visualize synaptic boutons) in DIO constructs ( Sohal et al. 2009 ) that express only in Cre-expressing neurons were coinjected into the substantia nigra pars compacta (SNc) of 3- and 7-month-old DATcre control and αsyn KO-DATcre mice. Mice were sacrificed one month later at 4 and 8 months of age, respectively. Roughly 60% of control and αsyn KO synaptic boutons show mitochondria in the caudate putamen (CPu) ( n = 3–4 mice per group, where each value is the mean of 18–21 fields; NS = not significant by two-way ANOVA and Sidak’s posthoc test). C , Western blot shows that αsyn KO mice have similar levels of βsyn as controls ( n = 3 mice per group; *p
Figure Legend Snippet: Loss of αsyn does not affect the distribution of mitochondria in axons of nigrostriatal DA neurons in vivo . A–B , Adeno-associated viruses (AAVs) expressing mitochondria-targeted GFP (mitoGFP; green, to visualize mitochondria) and mCherry-Synaptophysin (red, to visualize synaptic boutons) in DIO constructs ( Sohal et al. 2009 ) that express only in Cre-expressing neurons were coinjected into the substantia nigra pars compacta (SNc) of 3- and 7-month-old DATcre control and αsyn KO-DATcre mice. Mice were sacrificed one month later at 4 and 8 months of age, respectively. Roughly 60% of control and αsyn KO synaptic boutons show mitochondria in the caudate putamen (CPu) ( n = 3–4 mice per group, where each value is the mean of 18–21 fields; NS = not significant by two-way ANOVA and Sidak’s posthoc test). C , Western blot shows that αsyn KO mice have similar levels of βsyn as controls ( n = 3 mice per group; *p

Techniques Used: In Vivo, Expressing, Construct, Mouse Assay, Western Blot

9) Product Images from "A modular dCas9-based recruitment platform for combinatorial epigenome editing"

Article Title: A modular dCas9-based recruitment platform for combinatorial epigenome editing

Journal: bioRxiv

doi: 10.1101/2022.07.01.498378

Recruitment of DNMT3A, KRAB, and EZH2 to induce targeted transcriptional repression via the SSSavi system. RT-qPCR quantification of target gene transcriptional repression induced by transient transfection of SSSavi plasmids in HSB6G (dCas9-SSSavi and 6x sgRNA) stable cells. (A) Catchers were tested individually or in four-way combinations for each of three effectors: DNMT3A (D3A), EZH2 (E), and/or KRAB (K) fused to either SpyCatcher, SnoopCatcher, α GCN4, or Traptavidin, across four different target genes ( PACC1, B2M, RBM3 , and HINT1 ). Fold change in expression was calculated compared to transfection with α GCN4-mCherry alone (baseline control, black dotted lines). *Independent sample t-tests with Benjamini-Hochberg correction comparing effector to α GCN4-mCherry, where p -values
Figure Legend Snippet: Recruitment of DNMT3A, KRAB, and EZH2 to induce targeted transcriptional repression via the SSSavi system. RT-qPCR quantification of target gene transcriptional repression induced by transient transfection of SSSavi plasmids in HSB6G (dCas9-SSSavi and 6x sgRNA) stable cells. (A) Catchers were tested individually or in four-way combinations for each of three effectors: DNMT3A (D3A), EZH2 (E), and/or KRAB (K) fused to either SpyCatcher, SnoopCatcher, α GCN4, or Traptavidin, across four different target genes ( PACC1, B2M, RBM3 , and HINT1 ). Fold change in expression was calculated compared to transfection with α GCN4-mCherry alone (baseline control, black dotted lines). *Independent sample t-tests with Benjamini-Hochberg correction comparing effector to α GCN4-mCherry, where p -values

Techniques Used: Quantitative RT-PCR, Transfection, Expressing

Downregulation of EPCAM mRNA and protein levels in HepG2 liver cancer cells by the SSSavi system. (A) RT-qPCR quantification of target gene transcriptional repression induced by transient transfection of SSSavi catcher plasmids in the HepSB (HepG2 cells with dCas9-SSSavi and BirA stable) cell line using DNMT3A (D3A), EZH2 (E), and KRAB (K), as well as a 6x sgRNA plasmid. Fold change in expression is calculated compared to transfection with α GCN4-mCherry alone (baseline control, black dotted lines). Bar graphs indicate sample mean with each letter indicating a significant difference as calculated by independent sample t-tests comparing D3A-K-E to α GCN4-mCherry (a: p = 0.003 ( KL ), 0.006 ( RBM3 ), b: p = 0.06 ( B2M )). n = 4, biological replicates, log 2 fold change calculated compared to α GCN4-mCherry control samples, sorted for GFP (catchers) and mCherry (6x sgRNA). (B) A schematic of the different effectors recruited onto the SSSavi docking array, highlighting the different spatial ordering. (C) Flow cytometry analysis of HepSB cells immunostained with EPCAM antibody, comparing percentage of positive cells (vertical black dotted line) across four samples transfected with α GCN4-mCherry alone (grey), Spy-D3A alone (blue), K-E-D3A (green), or D3A-K-E (red) effector combinations. Duplicate experiments were performed.
Figure Legend Snippet: Downregulation of EPCAM mRNA and protein levels in HepG2 liver cancer cells by the SSSavi system. (A) RT-qPCR quantification of target gene transcriptional repression induced by transient transfection of SSSavi catcher plasmids in the HepSB (HepG2 cells with dCas9-SSSavi and BirA stable) cell line using DNMT3A (D3A), EZH2 (E), and KRAB (K), as well as a 6x sgRNA plasmid. Fold change in expression is calculated compared to transfection with α GCN4-mCherry alone (baseline control, black dotted lines). Bar graphs indicate sample mean with each letter indicating a significant difference as calculated by independent sample t-tests comparing D3A-K-E to α GCN4-mCherry (a: p = 0.003 ( KL ), 0.006 ( RBM3 ), b: p = 0.06 ( B2M )). n = 4, biological replicates, log 2 fold change calculated compared to α GCN4-mCherry control samples, sorted for GFP (catchers) and mCherry (6x sgRNA). (B) A schematic of the different effectors recruited onto the SSSavi docking array, highlighting the different spatial ordering. (C) Flow cytometry analysis of HepSB cells immunostained with EPCAM antibody, comparing percentage of positive cells (vertical black dotted line) across four samples transfected with α GCN4-mCherry alone (grey), Spy-D3A alone (blue), K-E-D3A (green), or D3A-K-E (red) effector combinations. Duplicate experiments were performed.

Techniques Used: Quantitative RT-PCR, Transfection, Stable Transfection, Plasmid Preparation, Expressing, Flow Cytometry

Identification of effective sgRNAs to use for activation/repression of KL, EPCAM, PACC1, B2M, RBM3 , and HINT1 target genes. (A) Positional information for up to six sgRNAs relative to the target gene promoter. The best performing sgRNA (red) was selected for stable integration in HEK293T cells based on (B) RT-qPCR quantitation of target gene transcript abundance. HEK293T cells were transiently transfected with dCas9-SSSavi and an individual sgRNA, along with either α GCN4-p65HSF1 for testing activation of the lowly expressed KL, EPCAM , and PACC1 , or α GCN4-KRAB for testing repression of the highly expressed B2M, RBM3 , and HINT1 . Fold change in expression was calculated compared to transfection with α GCN4-mCherry alone (baseline control, n = 2, biological replicates, unsorted cells).
Figure Legend Snippet: Identification of effective sgRNAs to use for activation/repression of KL, EPCAM, PACC1, B2M, RBM3 , and HINT1 target genes. (A) Positional information for up to six sgRNAs relative to the target gene promoter. The best performing sgRNA (red) was selected for stable integration in HEK293T cells based on (B) RT-qPCR quantitation of target gene transcript abundance. HEK293T cells were transiently transfected with dCas9-SSSavi and an individual sgRNA, along with either α GCN4-p65HSF1 for testing activation of the lowly expressed KL, EPCAM , and PACC1 , or α GCN4-KRAB for testing repression of the highly expressed B2M, RBM3 , and HINT1 . Fold change in expression was calculated compared to transfection with α GCN4-mCherry alone (baseline control, n = 2, biological replicates, unsorted cells).

Techniques Used: Activation Assay, Quantitative RT-PCR, Quantitation Assay, Transfection, Expressing

10) Product Images from "α-Synuclein impairs ferritinophagy in the retinal pigment epithelium: Implications for retinal iron dyshomeostasis in Parkinson’s disease"

Article Title: α-Synuclein impairs ferritinophagy in the retinal pigment epithelium: Implications for retinal iron dyshomeostasis in Parkinson’s disease

Journal: Scientific Reports

doi: 10.1038/s41598-017-12862-x

α-Syn impairs lysosomal function in RPE cells: ( A ) When expressed in cells, LC3-GFP-mCherry provides a convenient way to monitor the fusion of LC3 positive autophagosomes with lysosomes. Both GFP and mCherry fluoresce at the neutral pH of autophagosomes, emitting a yellow color. Upon fusion with lysosomes, GFP is quenched due to low pH, while mCherry continues to fluoresce. Efficient fusion of autophagosomes with lysosomes will therefore result in mainly red fluorescence, and the expected degradation of LC3II and ferritin. A block in the fusion of autophagosomes with lysosomes or elevated pH of lysosomes, mimicked pharmacologically by BafA1, will not quench GFP, resulting in yellow fluorescence, and sparing of LC3II and ferritin. ( B ) Representative images of LC3-GFP-mCherry transfected RPE 47 cells stably overexpressing vector or α-syn show a yellow fluorescence in vesicular structures representing autophagosomes, and red fluorescence in lysosomes due to quenching of GFP at low pH. ( C ) Western blot image demonstrating expression of ferritin, LC3, α-syn, and β-actin in RPE cells overexpressing α-syn or vector following treatment with 100 µM BafA1 for 12 h. ( D ) Quantification by densitometry after normalization with β-actin. n = 3. Values represent mean ± SEM of the indicated n (* p
Figure Legend Snippet: α-Syn impairs lysosomal function in RPE cells: ( A ) When expressed in cells, LC3-GFP-mCherry provides a convenient way to monitor the fusion of LC3 positive autophagosomes with lysosomes. Both GFP and mCherry fluoresce at the neutral pH of autophagosomes, emitting a yellow color. Upon fusion with lysosomes, GFP is quenched due to low pH, while mCherry continues to fluoresce. Efficient fusion of autophagosomes with lysosomes will therefore result in mainly red fluorescence, and the expected degradation of LC3II and ferritin. A block in the fusion of autophagosomes with lysosomes or elevated pH of lysosomes, mimicked pharmacologically by BafA1, will not quench GFP, resulting in yellow fluorescence, and sparing of LC3II and ferritin. ( B ) Representative images of LC3-GFP-mCherry transfected RPE 47 cells stably overexpressing vector or α-syn show a yellow fluorescence in vesicular structures representing autophagosomes, and red fluorescence in lysosomes due to quenching of GFP at low pH. ( C ) Western blot image demonstrating expression of ferritin, LC3, α-syn, and β-actin in RPE cells overexpressing α-syn or vector following treatment with 100 µM BafA1 for 12 h. ( D ) Quantification by densitometry after normalization with β-actin. n = 3. Values represent mean ± SEM of the indicated n (* p

Techniques Used: Fluorescence, Blocking Assay, Transfection, Stable Transfection, Plasmid Preparation, Western Blot, Expressing

11) Product Images from "Expression Profiling, Downstream Signaling and Subunit Interactions of GPA2/GPB5 in the Adult Mosquito Aedes aegypti"

Article Title: Expression Profiling, Downstream Signaling and Subunit Interactions of GPA2/GPB5 in the Adult Mosquito Aedes aegypti

Journal: bioRxiv

doi: 10.1101/694653

cAMP-mediated bioluminescence assay determining the effects of tethered GPA2/GPB5 on receptor activation and G protein signalling of LGR1. Secreted protein fractions (a, c) and cell lysates (b, d) derived from cells transiently expressing tethered GPA2/GPB5 (tA2/B5) or red fluorescent protein (mCherry) were tested for their ability to stimulate (Gs signalling) (a, b) or inhibit 1 µM forskolin-induced (Gi/o signalling) (c, d) cAMP-mediated luminescence. (a-d) Luminescence response was recorded and normalized to treatments involving mCherry proteins with LGR1-expressing HEK 293T cells. In all treatments, the relative luminescence response was greater in LGR1-expressing cells (+ LGR1) compared to cells not expressing LGR1 (-LGR1). (a, b) Applications of 1 µM forskolin (FSK) to recombinant cells expressing and not expressing LGR1 significantly increased cAMP-mediated luminescence relative to treatments with tA2/B5 or mCherry. However, incubation of LGR1-expressing cells with tA2/B5 secreted (a) or cell lysate (b) proteins, failed to increase cAMP-mediated luminescence above background levels from incubations with mCherry proteins. (c, d) 1 µM forskolin along with either mCherry proteins, tA2/B5 proteins or assay media (Assay) was added to cells in the presence or absence of LGR1 expression. The ability for each ligand treatment to reduce a forskolin-induced increase in cAMP luminescence was examined. (c) The tA2/B5 secreted protein samples incubated with LGR1-expressing cells did not significantly affect the forskolin-induced cAMP luminescence, compared to control treatments with secreted proteins from mCherry expressing cells. (d) Relative to incubations with mCherry cell lysate proteins, cell lysates containing tA2/B5 protein significantly inhibited forskolin-induced elevations of cAMP-mediated luminescence, and this inhibition was specific to LGR1-expressing cells. Mean ± SEM of three biological replicates. Columns denoted with different letters are significantly different from one another. Multiple comparisons two-way ANOVA test with Tukey’s multiple comparisons (P
Figure Legend Snippet: cAMP-mediated bioluminescence assay determining the effects of tethered GPA2/GPB5 on receptor activation and G protein signalling of LGR1. Secreted protein fractions (a, c) and cell lysates (b, d) derived from cells transiently expressing tethered GPA2/GPB5 (tA2/B5) or red fluorescent protein (mCherry) were tested for their ability to stimulate (Gs signalling) (a, b) or inhibit 1 µM forskolin-induced (Gi/o signalling) (c, d) cAMP-mediated luminescence. (a-d) Luminescence response was recorded and normalized to treatments involving mCherry proteins with LGR1-expressing HEK 293T cells. In all treatments, the relative luminescence response was greater in LGR1-expressing cells (+ LGR1) compared to cells not expressing LGR1 (-LGR1). (a, b) Applications of 1 µM forskolin (FSK) to recombinant cells expressing and not expressing LGR1 significantly increased cAMP-mediated luminescence relative to treatments with tA2/B5 or mCherry. However, incubation of LGR1-expressing cells with tA2/B5 secreted (a) or cell lysate (b) proteins, failed to increase cAMP-mediated luminescence above background levels from incubations with mCherry proteins. (c, d) 1 µM forskolin along with either mCherry proteins, tA2/B5 proteins or assay media (Assay) was added to cells in the presence or absence of LGR1 expression. The ability for each ligand treatment to reduce a forskolin-induced increase in cAMP luminescence was examined. (c) The tA2/B5 secreted protein samples incubated with LGR1-expressing cells did not significantly affect the forskolin-induced cAMP luminescence, compared to control treatments with secreted proteins from mCherry expressing cells. (d) Relative to incubations with mCherry cell lysate proteins, cell lysates containing tA2/B5 protein significantly inhibited forskolin-induced elevations of cAMP-mediated luminescence, and this inhibition was specific to LGR1-expressing cells. Mean ± SEM of three biological replicates. Columns denoted with different letters are significantly different from one another. Multiple comparisons two-way ANOVA test with Tukey’s multiple comparisons (P

Techniques Used: ATP Bioluminescent Assay, Activation Assay, Derivative Assay, Expressing, Recombinant, Incubation, Inhibition

cAMP-mediated bioluminescence assays to determine the effect of GPA2, GPB5 and GPA2/ GPB5 on G-protein signalling of H. sapiens (human) TSHR (a), A. aegypti (mosquito) LGR1 (b, c), or cells expressing a red fluorescent protein, mCherry (d). Secreted protein fractions for each subunit were prepared separately from HEK 293T cells expressing human GPA2 (hA2), human GPB5 (hB5), mosquito GPA2 (A2), mosquito GPB5 (B5), mCherry, or co-expressing mosquito GPA2 and GPB5 in a dual promoter plasmid (A2/B5 coexp). Secreted protein fractions were then tested separately or combined (A2 + B5) and then incubated with cells co-expressing the cAMP biosensor along with either (a) human TSHR, (b, c) mosquito LGR1 or (d) mCherry, the latter of which was used as a negative control in the functional assay and also served to verify transfection efficiency of HEK 293T cells. Luminescent values were recorded and normalized to incubations with protein secretions collected from the media of mCherry-transfected cells. Forskolin (FSK, 250 nM) was used as a positive control for stimulatory G-protein (Gs) pathway (a, b) and inhibitory G-protein (Gi/o) pathway testing (c, d). (a) Unlike treatments with human GPA2 (hA2) or human GPB5 (hB5) applied singly, a significant increase in cAMP-mediated luminescence was observed when TSHR-expressing cells were incubated with culture media containing both human GPA2 and human GPB5 (hA2 + hB5), relative to incubations with mCherry controls. (b) No differences in luminescence were observed when LGR1-expressing cells were incubated with media containing mosquito GPA2/GPB5 subunits, compared to mCherry controls. (c) The addition of GPA2 and GPB5 on LGR1-expressing cells significantly inhibited FSK-induced luminescent response, compared to treatments with mCherry controls; (d) however, this inhibition was also observed when GPA2 and GPB5 proteins were incubated with HEK 293T cells in the absence of LGR1. Mean ± SEM of three (a, b, d) or six (c) biological replicates. Columns denoted with different letters are significantly different from one another. Multiple comparisons one-way ANOVA test with Tukey’s multiple comparisons (P
Figure Legend Snippet: cAMP-mediated bioluminescence assays to determine the effect of GPA2, GPB5 and GPA2/ GPB5 on G-protein signalling of H. sapiens (human) TSHR (a), A. aegypti (mosquito) LGR1 (b, c), or cells expressing a red fluorescent protein, mCherry (d). Secreted protein fractions for each subunit were prepared separately from HEK 293T cells expressing human GPA2 (hA2), human GPB5 (hB5), mosquito GPA2 (A2), mosquito GPB5 (B5), mCherry, or co-expressing mosquito GPA2 and GPB5 in a dual promoter plasmid (A2/B5 coexp). Secreted protein fractions were then tested separately or combined (A2 + B5) and then incubated with cells co-expressing the cAMP biosensor along with either (a) human TSHR, (b, c) mosquito LGR1 or (d) mCherry, the latter of which was used as a negative control in the functional assay and also served to verify transfection efficiency of HEK 293T cells. Luminescent values were recorded and normalized to incubations with protein secretions collected from the media of mCherry-transfected cells. Forskolin (FSK, 250 nM) was used as a positive control for stimulatory G-protein (Gs) pathway (a, b) and inhibitory G-protein (Gi/o) pathway testing (c, d). (a) Unlike treatments with human GPA2 (hA2) or human GPB5 (hB5) applied singly, a significant increase in cAMP-mediated luminescence was observed when TSHR-expressing cells were incubated with culture media containing both human GPA2 and human GPB5 (hA2 + hB5), relative to incubations with mCherry controls. (b) No differences in luminescence were observed when LGR1-expressing cells were incubated with media containing mosquito GPA2/GPB5 subunits, compared to mCherry controls. (c) The addition of GPA2 and GPB5 on LGR1-expressing cells significantly inhibited FSK-induced luminescent response, compared to treatments with mCherry controls; (d) however, this inhibition was also observed when GPA2 and GPB5 proteins were incubated with HEK 293T cells in the absence of LGR1. Mean ± SEM of three (a, b, d) or six (c) biological replicates. Columns denoted with different letters are significantly different from one another. Multiple comparisons one-way ANOVA test with Tukey’s multiple comparisons (P

Techniques Used: Expressing, Plasmid Preparation, Incubation, Negative Control, Functional Assay, Transfection, Positive Control, Inhibition

Western blot analysis and verification of A. aegypti GPA2/GPB5 tethered protein expressed in HEK 293T cells. (a) Western blot analysis of secreted or cell lysate protein fractions of HEK 293T expressing tethered GPA2/GPB5 (tA2/B5) or red fluorescent protein (mCherry) as a control. Tethered GPA2/GPB5 is represented as a strong 32-40 kDa band in cell lysate fractions, and as two less intense 37 kDa and 40 kDa bands in secreted fractions; however, no bands were detected in lanes loaded with proteins from mCherry transfected cells. (b) Upon treatment of tethered GPA2/GPB5 secreted protein fractions with PNGase, the 40 kDa band is eliminated and the 37 kDa band intensifies, indicating removal of N-linked oligosaccharides.
Figure Legend Snippet: Western blot analysis and verification of A. aegypti GPA2/GPB5 tethered protein expressed in HEK 293T cells. (a) Western blot analysis of secreted or cell lysate protein fractions of HEK 293T expressing tethered GPA2/GPB5 (tA2/B5) or red fluorescent protein (mCherry) as a control. Tethered GPA2/GPB5 is represented as a strong 32-40 kDa band in cell lysate fractions, and as two less intense 37 kDa and 40 kDa bands in secreted fractions; however, no bands were detected in lanes loaded with proteins from mCherry transfected cells. (b) Upon treatment of tethered GPA2/GPB5 secreted protein fractions with PNGase, the 40 kDa band is eliminated and the 37 kDa band intensifies, indicating removal of N-linked oligosaccharides.

Techniques Used: Western Blot, Expressing, Transfection

12) Product Images from "SMOC can act as both an antagonist and an expander of BMP signaling"

Article Title: SMOC can act as both an antagonist and an expander of BMP signaling

Journal: eLife

doi: 10.7554/eLife.17935

In vivo assay demonstrating that X SMOC-1 can expand the range of BMP2 signaling. ( A ) Schematic diagram of the host/donor animal cap (AC) transfer assay. ( B–F ) Donor AC grafts expressing mCherry (red) and host/donor immunofluorescent nuclear staining of pSmad 1/5/8 (green). ( B ) Control host + mCherry mRNA (200 pg)-injected donor AC (mCherry AC); endogenous pSmad is not detectable, ( C ) BMP2 mRNA (300 pg)-injected host + mCherry AC; pSmad is detected throughout the host tissue and donor AC, ( D ) BMP2 mRNA (30 pg)-injected host (BMP2-30 pg host) + mCherry AC; pSmad is detected in the host tissue and at the host tissue/AC boundary, ( E ) BMP2-30 pg host + mCherry/ X SMOC-1 mRNA (10 pg)-injected AC; pSmad is detected in the host tissue and 4–5 cell diameters into the AC ( F ) BMP2-30pg host + mCherry/ X SMOC-1 mRNA (300 pg)-injected AC; pSmad is not detected in the AC and is also absent at the host tissue/AC boundary. DOI: http://dx.doi.org/10.7554/eLife.17935.015
Figure Legend Snippet: In vivo assay demonstrating that X SMOC-1 can expand the range of BMP2 signaling. ( A ) Schematic diagram of the host/donor animal cap (AC) transfer assay. ( B–F ) Donor AC grafts expressing mCherry (red) and host/donor immunofluorescent nuclear staining of pSmad 1/5/8 (green). ( B ) Control host + mCherry mRNA (200 pg)-injected donor AC (mCherry AC); endogenous pSmad is not detectable, ( C ) BMP2 mRNA (300 pg)-injected host + mCherry AC; pSmad is detected throughout the host tissue and donor AC, ( D ) BMP2 mRNA (30 pg)-injected host (BMP2-30 pg host) + mCherry AC; pSmad is detected in the host tissue and at the host tissue/AC boundary, ( E ) BMP2-30 pg host + mCherry/ X SMOC-1 mRNA (10 pg)-injected AC; pSmad is detected in the host tissue and 4–5 cell diameters into the AC ( F ) BMP2-30pg host + mCherry/ X SMOC-1 mRNA (300 pg)-injected AC; pSmad is not detected in the AC and is also absent at the host tissue/AC boundary. DOI: http://dx.doi.org/10.7554/eLife.17935.015

Techniques Used: In Vivo, Expressing, Staining, Injection

13) Product Images from "The E3 ligase Thin controls homeostatic plasticity through neurotransmitter release repression"

Article Title: The E3 ligase Thin controls homeostatic plasticity through neurotransmitter release repression

Journal: bioRxiv

doi: 10.1101/2021.06.16.448554

Thin localizes in close proximity to Dysbindin and promotes Dysbindin degradation. A) Confocal maximum intensity projection of a representative NMJ branch (muscle 6-7) after presynaptic co-expression ( elav c155 - Gal4 ) of venus-tagged Dysbindin ( UAS-dysb venus , ‘Dysb’, green) and mCherry-tagged Thin ( UAS-thin mcherry , ‘Thin’, magenta). B) Single plane of the synaptic bouton highlighted by the yellow square in (A) with corresponding line profile ( right ). The yellow line demarks the location of the line profile. C) gSTED image of the synaptic bouton shown in (B) with corresponding line profile ( right ). Note the partial overlap between Thin and Dysbindin at confocal and STED resolution. D) Confocal images (single planes) of Drosophila S2 cells stained with anti-Dysbindin (green) and anti-Thin (magenta) under control conditions ( top row ) and after dysbindin overexpression ( UAS-dysb venus , bottom row ). Note the concomitant redistribution of Dysbindin and Thin upon dysbindin overexpression. E) Representative Western blot of S2 cells transfected with UAS-dysb venus and different levels of UAS-thin . F) Quantification of (E, n=5). Note the decrease in Thin levels upon dysbindin overexpression. Scale bar (A: 5μm), (B, C: 2μm), (D: 5μm).
Figure Legend Snippet: Thin localizes in close proximity to Dysbindin and promotes Dysbindin degradation. A) Confocal maximum intensity projection of a representative NMJ branch (muscle 6-7) after presynaptic co-expression ( elav c155 - Gal4 ) of venus-tagged Dysbindin ( UAS-dysb venus , ‘Dysb’, green) and mCherry-tagged Thin ( UAS-thin mcherry , ‘Thin’, magenta). B) Single plane of the synaptic bouton highlighted by the yellow square in (A) with corresponding line profile ( right ). The yellow line demarks the location of the line profile. C) gSTED image of the synaptic bouton shown in (B) with corresponding line profile ( right ). Note the partial overlap between Thin and Dysbindin at confocal and STED resolution. D) Confocal images (single planes) of Drosophila S2 cells stained with anti-Dysbindin (green) and anti-Thin (magenta) under control conditions ( top row ) and after dysbindin overexpression ( UAS-dysb venus , bottom row ). Note the concomitant redistribution of Dysbindin and Thin upon dysbindin overexpression. E) Representative Western blot of S2 cells transfected with UAS-dysb venus and different levels of UAS-thin . F) Quantification of (E, n=5). Note the decrease in Thin levels upon dysbindin overexpression. Scale bar (A: 5μm), (B, C: 2μm), (D: 5μm).

Techniques Used: Expressing, Staining, Over Expression, Western Blot, Transfection

14) Product Images from "Red fluorescent redox-sensitive biosensor Grx1-roCherry"

Article Title: Red fluorescent redox-sensitive biosensor Grx1-roCherry

Journal: Redox Biology

doi: 10.1016/j.redox.2018.101071

Redox-sensitive biosensor Grx1-roCherry. (A) Diagram of Grx1-roCherry structure. Grx1-roCherry consists of a mutated fluorescent protein mCherry, a human glutaredoxin 1 and a polypeptide linker. The diagram shows the pair of redox-active cysteine residues and other mutations in the biosensor structure. (B) Images of Grx1-roCherry in transiently transfected HeLa Kyoto cells exposed to 150 μM of H 2 O 2 after 40 s of imaging. Numbers indicate timing in seconds. Scale bar, 40 µm. Lookup table indicates intensity of red fluorescence. (C) Timing of H 2 O 2 induced fluorescence change (F 589 ) in HeLa Kyoto cells expressing Grx1-roCherry (red line) or roCherry without Grx1 (black line). Signal values of Grx1-roCherry and roCherry were normalized to the initial value. Signals were averaged from 67 cells for Grx1-roCherry and 101 cells for roCherry in 3 experiments. Error bars indicate standard error of mean. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article).
Figure Legend Snippet: Redox-sensitive biosensor Grx1-roCherry. (A) Diagram of Grx1-roCherry structure. Grx1-roCherry consists of a mutated fluorescent protein mCherry, a human glutaredoxin 1 and a polypeptide linker. The diagram shows the pair of redox-active cysteine residues and other mutations in the biosensor structure. (B) Images of Grx1-roCherry in transiently transfected HeLa Kyoto cells exposed to 150 μM of H 2 O 2 after 40 s of imaging. Numbers indicate timing in seconds. Scale bar, 40 µm. Lookup table indicates intensity of red fluorescence. (C) Timing of H 2 O 2 induced fluorescence change (F 589 ) in HeLa Kyoto cells expressing Grx1-roCherry (red line) or roCherry without Grx1 (black line). Signal values of Grx1-roCherry and roCherry were normalized to the initial value. Signals were averaged from 67 cells for Grx1-roCherry and 101 cells for roCherry in 3 experiments. Error bars indicate standard error of mean. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article).

Techniques Used: Transfection, Imaging, Fluorescence, Expressing

15) Product Images from "Genetically encoded ratiometric biosensor for probing lysosomal pH in mammalian cells and C. elegans"

Article Title: Genetically encoded ratiometric biosensor for probing lysosomal pH in mammalian cells and C. elegans

Journal: bioRxiv

doi: 10.1101/2020.11.04.368654

In vivo functional validation of FIRE-pHLy in C. elegans (A) C. elegans FIRE-pHLy expression cassette driven by intestinal promoter (P vha-6::mtfp1 ::c lmp1::mcherry ) co-injected with selection marker (P myo-2::gfp ) expressed in the pharynx. The human LAMP1 sequence was exchanged for the C. elegans LAMP1 homolog, cLMP1. (B) Merged brightfìeld, mTFP1 and mCherry confocal images of 5 anaesthetized adult (L4) N2 worms expressing the FIRE-pHLy transgene and co-injection marker. Arrows indicate the pharynx and intestines. Dashed white box delineates a representative imaging region. Scale bar = 50 μm. (C) PCR sequencing of transgenic FIRE-pHLy-expressing worms and purified plasmid using forward reverse mTFP1 specific primers. (D) Merged image showing Lyso-647 staining (shown in blue) with P vha-6 driven expression of FIRE-pHLy expression (detected as punctuate structures) in intestinal tissue. White box shows zoomed insert of mTFP1, mCherry and Lyso-647 fluorescent puncta. Arrowheads highlight representative colocalized puncta. Scale bar = 50 μm. (E) Pearson’s correlation coefficients (r) of Lyso-647 and mTFP1 colocalized with mCherry. Data points are presented as mean ± S.D., from n = 20 worms. Statistical analysis was performed using two-tailed, unpaired Student’s t -test. (F) FIRE-pHLy fluorescence ratios (F mTFP1 /F mCherry ) of worm intestinal cells pre-incubated with 50 μM BafA1 and untreated control for 30 min. Box-and-whisker plot shows median, interquartile range (25 th -75 th percentile) and maximum/minimum values of mean ratios; 5 independent replicates; n = 18-20 worms/replicate. Statistical analysis was performed using two-tailed, unpaired Student’s t -test, *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001; ns = not significant.
Figure Legend Snippet: In vivo functional validation of FIRE-pHLy in C. elegans (A) C. elegans FIRE-pHLy expression cassette driven by intestinal promoter (P vha-6::mtfp1 ::c lmp1::mcherry ) co-injected with selection marker (P myo-2::gfp ) expressed in the pharynx. The human LAMP1 sequence was exchanged for the C. elegans LAMP1 homolog, cLMP1. (B) Merged brightfìeld, mTFP1 and mCherry confocal images of 5 anaesthetized adult (L4) N2 worms expressing the FIRE-pHLy transgene and co-injection marker. Arrows indicate the pharynx and intestines. Dashed white box delineates a representative imaging region. Scale bar = 50 μm. (C) PCR sequencing of transgenic FIRE-pHLy-expressing worms and purified plasmid using forward reverse mTFP1 specific primers. (D) Merged image showing Lyso-647 staining (shown in blue) with P vha-6 driven expression of FIRE-pHLy expression (detected as punctuate structures) in intestinal tissue. White box shows zoomed insert of mTFP1, mCherry and Lyso-647 fluorescent puncta. Arrowheads highlight representative colocalized puncta. Scale bar = 50 μm. (E) Pearson’s correlation coefficients (r) of Lyso-647 and mTFP1 colocalized with mCherry. Data points are presented as mean ± S.D., from n = 20 worms. Statistical analysis was performed using two-tailed, unpaired Student’s t -test. (F) FIRE-pHLy fluorescence ratios (F mTFP1 /F mCherry ) of worm intestinal cells pre-incubated with 50 μM BafA1 and untreated control for 30 min. Box-and-whisker plot shows median, interquartile range (25 th -75 th percentile) and maximum/minimum values of mean ratios; 5 independent replicates; n = 18-20 worms/replicate. Statistical analysis was performed using two-tailed, unpaired Student’s t -test, *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001; ns = not significant.

Techniques Used: In Vivo, Functional Assay, Expressing, Injection, Selection, Marker, Sequencing, Imaging, Polymerase Chain Reaction, Transgenic Assay, Purification, Plasmid Preparation, Staining, Two Tailed Test, Fluorescence, Incubation, Whisker Assay

FIRE-pHLy localizes to lysosomal compartments (A-E) Representative images of FIRE-pHLy-expressing HEK293FT cells stained with various markers (shown in light blue). (A) LAMP1 (lysosomal membranes), (B) LAMP2 (lysosomal membranes), (C) LysoTracker Deep Red or Lyso-647 (acidic compartments), (D) EEA1 (early endosomes), (E) MitoTracker Deep Red or Mito-647 (mitochondria). Scale bar = 10 μm. Co-localized marker and mCherry puncta in displayed in white. Nuclei are shown in dark blue. (F-J) Displayed below each image set are Pearson’s correlation coefficients (r) calculated using the ImageJ plugin JACoP (Just Another Colocalization Plugin). Each graph shows a different marker colocalized with mCherry and mTFP1 colocalized with mCherry. Data points represents mean ± S.D. (3 independent replicates; n = 15 cells/replicate. Statistical analysis was performed using two-tailed, unpaired Student’s t -test. *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001; ns = not significant).
Figure Legend Snippet: FIRE-pHLy localizes to lysosomal compartments (A-E) Representative images of FIRE-pHLy-expressing HEK293FT cells stained with various markers (shown in light blue). (A) LAMP1 (lysosomal membranes), (B) LAMP2 (lysosomal membranes), (C) LysoTracker Deep Red or Lyso-647 (acidic compartments), (D) EEA1 (early endosomes), (E) MitoTracker Deep Red or Mito-647 (mitochondria). Scale bar = 10 μm. Co-localized marker and mCherry puncta in displayed in white. Nuclei are shown in dark blue. (F-J) Displayed below each image set are Pearson’s correlation coefficients (r) calculated using the ImageJ plugin JACoP (Just Another Colocalization Plugin). Each graph shows a different marker colocalized with mCherry and mTFP1 colocalized with mCherry. Data points represents mean ± S.D. (3 independent replicates; n = 15 cells/replicate. Statistical analysis was performed using two-tailed, unpaired Student’s t -test. *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001; ns = not significant).

Techniques Used: Expressing, Staining, Marker, Two Tailed Test

pH calibration in live FIRE-pHLy-expressing HEK293FT cells (A) High-throughput workflow for pH calibration protocol. FIRE-pHLy-expressing HEK293FT cells were seeded in 96-well assay plates, incubated with pH buffers (adjusted to 2.0, 3.0, 3.5, 4.0, 4.5, 5.0, 6.0 and 7.0), imaged live using a high-content confocal image analyzer and quantified. (B) Fluorescence ratios (F mTFP1 /F mCherry ) were plotted against pH values to generate a sigmoidal pH calibration curve. Data points are presented as mean ± S.D., from 4 independent replicates; n=10,000 cells per replicate. Curve was fitted using a sigmoidal nonlinear regression model with the x-axis constrained at 0. Tukey’s test for multiple stepwise comparisons indicated significance between all pH groups, except pH 6.0 and pH 7.0. (C) Black and white images of mTFP1, mCherry and nuclei taken from one field of one representative assay well from different pH conditions.
Figure Legend Snippet: pH calibration in live FIRE-pHLy-expressing HEK293FT cells (A) High-throughput workflow for pH calibration protocol. FIRE-pHLy-expressing HEK293FT cells were seeded in 96-well assay plates, incubated with pH buffers (adjusted to 2.0, 3.0, 3.5, 4.0, 4.5, 5.0, 6.0 and 7.0), imaged live using a high-content confocal image analyzer and quantified. (B) Fluorescence ratios (F mTFP1 /F mCherry ) were plotted against pH values to generate a sigmoidal pH calibration curve. Data points are presented as mean ± S.D., from 4 independent replicates; n=10,000 cells per replicate. Curve was fitted using a sigmoidal nonlinear regression model with the x-axis constrained at 0. Tukey’s test for multiple stepwise comparisons indicated significance between all pH groups, except pH 6.0 and pH 7.0. (C) Black and white images of mTFP1, mCherry and nuclei taken from one field of one representative assay well from different pH conditions.

Techniques Used: Expressing, High Throughput Screening Assay, Incubation, Fluorescence

In vitro FIRE-pHLy models and relative pH measurements with bafĩlomycin A1 (A) Representative mTFP1 and mCherry ratiometric images of PFA-fìxed FIRE-pHLy-expressing HEK293FT cells taken on a high-content confocal imaging system. Scale bars =10 μm. (B) pH calibration curve generated from fixed, pH buffer (pH 3.5 - 7.0) treated cells. Data points are presented as mean ± S.D., from 4 independent replicates; n = 10,000 cells per replicate. (C) FIRE-pHLy fluorescence ratios (F mTFP1 /F mCherry ) of FIRE-pHLy-expressing HEK293FT cells treated with bafilomycin (BafA1 30 nM to 1000 nM) and 0.1% DMSO (control) for 6 hours. Data points are presented as mean ± S.D., from 6 independent replicates; n = 10,000 cells per replicate. Tukey’s test for multiple stepwise comparisons indicated significance between all groups including control, except BafA1 300 nM and 1000 nM. (D-G) Ratiometric images (left to right) of FIRE-pHLy stably expressed in human iPSCs, SH-SY5Y, Differentiated SH-SY5Y, and late embryonic rat hippocampal neuronal cells. All cells were fixed prior to image acquisition. Scale bar = 50 μm. (H-K) 100 nM bafilomycin A1 was treated on cells for 6 hours and compared to 0.1% DMSO solvent control. Box-and-whisker plots show median, interquartile range (25 th -75 th percentile) and maximum/minimum values of mean ratios per well. (H) human iPSC; 18 independent replicates; n = 15,000 cells per replicate. (I) SH-SY5Y; 76 independent replicates; n = 1,000 cells per replicate. (J) RA-differentiated SH-SY5Y; 120 independent replicates; n = 3,000 cells per replicate. (K) primary rat hippocampal neurons; 3 independent replicates; n = 10,000 cells per replicate. Statistical analysis was performed using two-tailed, unpaired Student’s t -test. *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001; ns = not significant.
Figure Legend Snippet: In vitro FIRE-pHLy models and relative pH measurements with bafĩlomycin A1 (A) Representative mTFP1 and mCherry ratiometric images of PFA-fìxed FIRE-pHLy-expressing HEK293FT cells taken on a high-content confocal imaging system. Scale bars =10 μm. (B) pH calibration curve generated from fixed, pH buffer (pH 3.5 - 7.0) treated cells. Data points are presented as mean ± S.D., from 4 independent replicates; n = 10,000 cells per replicate. (C) FIRE-pHLy fluorescence ratios (F mTFP1 /F mCherry ) of FIRE-pHLy-expressing HEK293FT cells treated with bafilomycin (BafA1 30 nM to 1000 nM) and 0.1% DMSO (control) for 6 hours. Data points are presented as mean ± S.D., from 6 independent replicates; n = 10,000 cells per replicate. Tukey’s test for multiple stepwise comparisons indicated significance between all groups including control, except BafA1 300 nM and 1000 nM. (D-G) Ratiometric images (left to right) of FIRE-pHLy stably expressed in human iPSCs, SH-SY5Y, Differentiated SH-SY5Y, and late embryonic rat hippocampal neuronal cells. All cells were fixed prior to image acquisition. Scale bar = 50 μm. (H-K) 100 nM bafilomycin A1 was treated on cells for 6 hours and compared to 0.1% DMSO solvent control. Box-and-whisker plots show median, interquartile range (25 th -75 th percentile) and maximum/minimum values of mean ratios per well. (H) human iPSC; 18 independent replicates; n = 15,000 cells per replicate. (I) SH-SY5Y; 76 independent replicates; n = 1,000 cells per replicate. (J) RA-differentiated SH-SY5Y; 120 independent replicates; n = 3,000 cells per replicate. (K) primary rat hippocampal neurons; 3 independent replicates; n = 10,000 cells per replicate. Statistical analysis was performed using two-tailed, unpaired Student’s t -test. *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001; ns = not significant.

Techniques Used: In Vitro, Expressing, Imaging, Generated, Fluorescence, Stable Transfection, Whisker Assay, Two Tailed Test

Design of ratiometric lysosomal pH sensor - FIRE-pHLy (A) Design of FIRE-pHLy expression cassette driven by CMV promoter cloned in the lentiviral pJLM puromycin-resistant plasmid. Chimeric protein (N- to C-terminus) mTFP1-LAMP1-mCherry is targeted to lysosomes via the type-I transmembrane human LAMP1 peptide sequence. Linker regions 1 (GGSGGGSGSGGGSG) and 2 (PAPAPAP) allow proper folding and expression of each protein portion. (B) Representation of FIRE-pHLy expressed on lysosomal membranes and mTFP1 fluorescence levels in acidic (low pH) and alkaline (high pH) conditions. Lysosomal pH-sensitive mTFP1 located within the lumen and lysosomal pH-insensitive mCherry is located on the cytosolic side. (C) Laser excitation (black dashed lines) and detection wavelengths (nm) used to image mTFP1 and mCherry fluorescence. As reported in literature, white dashed lines indicate expected peak excitation (mTFP1 = 462 nm; mCherry = 587 nm) while arrowheads indicate expected peak emission (mTFP1 = 492 nm; mCherry 610 nm). (D) Representative confocal fluorescence images of mTFP1 (green), mCherry (red) and merged (yellow) in stable FIRE-pHLy-expressing HEK293FT cells. Arrowheads highlight representative puncta of overlapping mTFP1 and mCherry signal. Scale bar =10 μm. (E) Lysates from wild-type (WT) and FIRE-pHLy-expressing HEK293FT cells were western blotted with anti-hLAMP1 antibody to detect intact FIRE-pHLy fusion protein expression levels. The expected FIRE-pHLy molecular weight (MW) is between 145-165 kDa, depending on the glycosylation state of LAMP1 (~90-110 kDa). The MW of mTFP1 and mCherry are 26 and 29 kDa, respectively.
Figure Legend Snippet: Design of ratiometric lysosomal pH sensor - FIRE-pHLy (A) Design of FIRE-pHLy expression cassette driven by CMV promoter cloned in the lentiviral pJLM puromycin-resistant plasmid. Chimeric protein (N- to C-terminus) mTFP1-LAMP1-mCherry is targeted to lysosomes via the type-I transmembrane human LAMP1 peptide sequence. Linker regions 1 (GGSGGGSGSGGGSG) and 2 (PAPAPAP) allow proper folding and expression of each protein portion. (B) Representation of FIRE-pHLy expressed on lysosomal membranes and mTFP1 fluorescence levels in acidic (low pH) and alkaline (high pH) conditions. Lysosomal pH-sensitive mTFP1 located within the lumen and lysosomal pH-insensitive mCherry is located on the cytosolic side. (C) Laser excitation (black dashed lines) and detection wavelengths (nm) used to image mTFP1 and mCherry fluorescence. As reported in literature, white dashed lines indicate expected peak excitation (mTFP1 = 462 nm; mCherry = 587 nm) while arrowheads indicate expected peak emission (mTFP1 = 492 nm; mCherry 610 nm). (D) Representative confocal fluorescence images of mTFP1 (green), mCherry (red) and merged (yellow) in stable FIRE-pHLy-expressing HEK293FT cells. Arrowheads highlight representative puncta of overlapping mTFP1 and mCherry signal. Scale bar =10 μm. (E) Lysates from wild-type (WT) and FIRE-pHLy-expressing HEK293FT cells were western blotted with anti-hLAMP1 antibody to detect intact FIRE-pHLy fusion protein expression levels. The expected FIRE-pHLy molecular weight (MW) is between 145-165 kDa, depending on the glycosylation state of LAMP1 (~90-110 kDa). The MW of mTFP1 and mCherry are 26 and 29 kDa, respectively.

Techniques Used: Expressing, Clone Assay, Plasmid Preparation, Sequencing, Fluorescence, Western Blot, Molecular Weight

Ratiometric validation of individual FIRE-pHLy fluorophores (A) F mTFP1 /F mCherry ratio quantified from FIRE-pHLy-expressing HEK293FT cells treated with 1 μM bafilomycin for 6 hours compared to 0.1% DMSO solvent control. (B) mTFP1 mean fluorescence intensity normalized by cell count. (C) mCherry mean fluorescence intensity normalized by cell count. Data points are presented as mean ± S.D., from 6 independent replicates; n= 10,000 cells per replicate. Statistical analysis was performed using two-tailed, unpaired Welch’s t -test for unequal variances. *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001; ns = not significant.
Figure Legend Snippet: Ratiometric validation of individual FIRE-pHLy fluorophores (A) F mTFP1 /F mCherry ratio quantified from FIRE-pHLy-expressing HEK293FT cells treated with 1 μM bafilomycin for 6 hours compared to 0.1% DMSO solvent control. (B) mTFP1 mean fluorescence intensity normalized by cell count. (C) mCherry mean fluorescence intensity normalized by cell count. Data points are presented as mean ± S.D., from 6 independent replicates; n= 10,000 cells per replicate. Statistical analysis was performed using two-tailed, unpaired Welch’s t -test for unequal variances. *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001; ns = not significant.

Techniques Used: Expressing, Fluorescence, Cell Counting, Two Tailed Test

16) Product Images from "Light-regulated allosteric switch enables temporal and subcellular control of enzyme activity"

Article Title: Light-regulated allosteric switch enables temporal and subcellular control of enzyme activity

Journal: eLife

doi: 10.7554/eLife.60647

Local regulation of LightR-Src. ( A ) A diagram showing the centroid shift distance (d) traveled by the centroid of the cell between the onset of local blue light stimulation (1) and the end of stimulation (2). The angle of deviation (θ) represents the extent of divergence of the cell’s centroid movement direction from the location of blue light. Light grey represents the area protruded by the cell in response to local LightR-Src stimulation. ( B ) Local translocation of engineered Src to focal adhesion. Images of a HeLa cell transiently co-expressing FastLightR-Src-mCherry-myc and Vinculin-Venus acquired using a total internal reflection fluorescence microscope (60X objective) after local exposure to blue light (area inside blue circle) for twenty-seven minutes. The merged image represents FastLightR-Src in green and Vinculin in magenta, with colocalization represented in white color and indicated with arrows.
Figure Legend Snippet: Local regulation of LightR-Src. ( A ) A diagram showing the centroid shift distance (d) traveled by the centroid of the cell between the onset of local blue light stimulation (1) and the end of stimulation (2). The angle of deviation (θ) represents the extent of divergence of the cell’s centroid movement direction from the location of blue light. Light grey represents the area protruded by the cell in response to local LightR-Src stimulation. ( B ) Local translocation of engineered Src to focal adhesion. Images of a HeLa cell transiently co-expressing FastLightR-Src-mCherry-myc and Vinculin-Venus acquired using a total internal reflection fluorescence microscope (60X objective) after local exposure to blue light (area inside blue circle) for twenty-seven minutes. The merged image represents FastLightR-Src in green and Vinculin in magenta, with colocalization represented in white color and indicated with arrows.

Techniques Used: Translocation Assay, Expressing, Fluorescence, Microscopy

Analysis of LighR-Cre variants. LinXE cells transiently co-transfected with floxed-stop-mCherry reporter and one of LightR-Cre-miRFP variants were either kept in the dark or illuminated with pulsing blue light (2 s on 10 s off) for 8 hr. The variants differ in their indicated insertion site (N60, D153, D189 or D278) of LightR domain in Cre recombinase, depicted in Figure 6E . Images for all timepoints of each channel were acquired under same settings and adjusted to the same brightness/contrast levels to allow for comparison of protein expression levels between samples. Experiment was done at least three times with similar results.
Figure Legend Snippet: Analysis of LighR-Cre variants. LinXE cells transiently co-transfected with floxed-stop-mCherry reporter and one of LightR-Cre-miRFP variants were either kept in the dark or illuminated with pulsing blue light (2 s on 10 s off) for 8 hr. The variants differ in their indicated insertion site (N60, D153, D189 or D278) of LightR domain in Cre recombinase, depicted in Figure 6E . Images for all timepoints of each channel were acquired under same settings and adjusted to the same brightness/contrast levels to allow for comparison of protein expression levels between samples. Experiment was done at least three times with similar results.

Techniques Used: Transfection, Expressing

Characterization of LightR-Src regulation and expression. ( A ) Blue light setup used for illumination of cells. A grey scale picture of the blue light setup placed inside a tissue culture incubator. Orange arrow points at the cells in a 3 cm dish placed 10 cm above the light panel. ( B ) Regulation of LightR-Src activity level with different intensity of light. LinXE cells transiently expressing LightR-Src-mCherry-myc were exposed to different blue light intensities for fifteen minutes continuously. Cell lysates were probed for phosphorylation of endogenous paxillin on Y118. ( C ) Western blot analysis of total cell lysates collected from control HeLa cells and from HeLa cells stably expressing LightR-Src probed with anti-Src antibody. Endogenous Src band is indicated with an arrow, and LightR-Src-mCherry-myc with an arrowhead.
Figure Legend Snippet: Characterization of LightR-Src regulation and expression. ( A ) Blue light setup used for illumination of cells. A grey scale picture of the blue light setup placed inside a tissue culture incubator. Orange arrow points at the cells in a 3 cm dish placed 10 cm above the light panel. ( B ) Regulation of LightR-Src activity level with different intensity of light. LinXE cells transiently expressing LightR-Src-mCherry-myc were exposed to different blue light intensities for fifteen minutes continuously. Cell lysates were probed for phosphorylation of endogenous paxillin on Y118. ( C ) Western blot analysis of total cell lysates collected from control HeLa cells and from HeLa cells stably expressing LightR-Src probed with anti-Src antibody. Endogenous Src band is indicated with an arrow, and LightR-Src-mCherry-myc with an arrowhead.

Techniques Used: Expressing, Activity Assay, Western Blot, Stable Transfection

Comparison of LightR-Src and FastLightR-Src activity. LinXE cells transiently expressing the indicated constructs bearing tandem mCherry-myc tag at the C-terminus were exposed to continuous blue light for the indicated time. Total cell lysate was probed for phosphorylation of endogenous p130cas on Y249.
Figure Legend Snippet: Comparison of LightR-Src and FastLightR-Src activity. LinXE cells transiently expressing the indicated constructs bearing tandem mCherry-myc tag at the C-terminus were exposed to continuous blue light for the indicated time. Total cell lysate was probed for phosphorylation of endogenous p130cas on Y249.

Techniques Used: Activity Assay, Expressing, Construct

Regulation of cell morphology and LightR-Src localization by light. HeLa cells transiently co-expressing FastLightR-Src-mCherry-myc (N = 10 cells) or catalytically inactive LightR-Src (D388R)-mCherry-myc (N = 9 cells) with stargazin-iRFP670 (plasma membrane marker) were imaged live every minute while illuminated for indicated periods of time (blue rectangles). ( A, B ) Quantification of changes in cell area induced by activation of LightR-Src. Graphs represent mean ±90% confidence intervals. ( C ) Representative images of a HeLa cell showing changes in LightR-Src localization upon illumination with blue light (see Video 1 ). Yellow arrows point to FastLightR-Src localization at structures resembling focal adhesions. Supplementary source data for Figure 4A . Supplementary source data for Figure 4B .
Figure Legend Snippet: Regulation of cell morphology and LightR-Src localization by light. HeLa cells transiently co-expressing FastLightR-Src-mCherry-myc (N = 10 cells) or catalytically inactive LightR-Src (D388R)-mCherry-myc (N = 9 cells) with stargazin-iRFP670 (plasma membrane marker) were imaged live every minute while illuminated for indicated periods of time (blue rectangles). ( A, B ) Quantification of changes in cell area induced by activation of LightR-Src. Graphs represent mean ±90% confidence intervals. ( C ) Representative images of a HeLa cell showing changes in LightR-Src localization upon illumination with blue light (see Video 1 ). Yellow arrows point to FastLightR-Src localization at structures resembling focal adhesions. Supplementary source data for Figure 4A . Supplementary source data for Figure 4B .

Techniques Used: Expressing, Marker, Activation Assay

17) Product Images from "Human XIRP1 is a macrophage podosome protein utilized by Listeria for actin-based motility"

Article Title: Human XIRP1 is a macrophage podosome protein utilized by Listeria for actin-based motility

Journal: bioRxiv

doi: 10.1101/2022.08.28.505595

XIRP1 recruitment to the surface of intracellular Listeria in THP-1 macrophages. (a) Model shows Listeria invasion of the macrophage cytoplasm and actin-based motility. (b) Confocal microscopy of infected THP-1 macrophages (single z-slice, 3 h post-infection). (c) Immunostaining against lysosomal LAMP1 and XIRP1. (d) Immunostaining of infected THP-1 macrophages fixed at indicated time-points post-infection. (e) Immunostaining of THP-1 macrophages infected with wildtype Listeria or mutants deficient in actin-based motility (Δ actA ) or phagosome rupture (Δ hly plcAB ). (f) Super-resolution structured-illumination microscopy of replicating (left panels) and motile (right panels) Listeria in THP-1 macrophages (single channels, top; orthogonal views, bottom). Figure 3—video 1. XIRP1 localizes to the surface of replicating Listeria in THP-1 macrophages Live-cell widefield microscopy of THP-1 macrophages expressing XIRP1B-mCherry ∼2.5 h post-infection with GFP-expressing Listeria. Bar: 10 μm Figure 3—video 2. Listeria escapes the XIRP1 coat after replication in THP-1 macrophages Live-cell widefield microscopy of THP-1 macrophages expressing XIRP1B-mCherry ∼2.5 h post-infection with GFP-expressing Listeria. Bar: 10 μm Figure 3—video 3. XIRP1 localizes to the actin-tails of motile Listeria in THP-1 macrophages Live-cell widefield microscopy of THP-1 macrophages expressing XIRP1B-mCherry ∼2.5 h post-infection with GFP-expressing Listeria. Bar: 10 μm Figure 3—video 4. XIRP1 localizes near the plasma membrane as Listeria escapes THP-1 macrophage cells Live-cell widefield microscopy of THP-1 macrophages expressing XIRP1B-mCherry ∼2.5 h post-infection with GFP-expressing Listeria. Bar: 10 μm
Figure Legend Snippet: XIRP1 recruitment to the surface of intracellular Listeria in THP-1 macrophages. (a) Model shows Listeria invasion of the macrophage cytoplasm and actin-based motility. (b) Confocal microscopy of infected THP-1 macrophages (single z-slice, 3 h post-infection). (c) Immunostaining against lysosomal LAMP1 and XIRP1. (d) Immunostaining of infected THP-1 macrophages fixed at indicated time-points post-infection. (e) Immunostaining of THP-1 macrophages infected with wildtype Listeria or mutants deficient in actin-based motility (Δ actA ) or phagosome rupture (Δ hly plcAB ). (f) Super-resolution structured-illumination microscopy of replicating (left panels) and motile (right panels) Listeria in THP-1 macrophages (single channels, top; orthogonal views, bottom). Figure 3—video 1. XIRP1 localizes to the surface of replicating Listeria in THP-1 macrophages Live-cell widefield microscopy of THP-1 macrophages expressing XIRP1B-mCherry ∼2.5 h post-infection with GFP-expressing Listeria. Bar: 10 μm Figure 3—video 2. Listeria escapes the XIRP1 coat after replication in THP-1 macrophages Live-cell widefield microscopy of THP-1 macrophages expressing XIRP1B-mCherry ∼2.5 h post-infection with GFP-expressing Listeria. Bar: 10 μm Figure 3—video 3. XIRP1 localizes to the actin-tails of motile Listeria in THP-1 macrophages Live-cell widefield microscopy of THP-1 macrophages expressing XIRP1B-mCherry ∼2.5 h post-infection with GFP-expressing Listeria. Bar: 10 μm Figure 3—video 4. XIRP1 localizes near the plasma membrane as Listeria escapes THP-1 macrophage cells Live-cell widefield microscopy of THP-1 macrophages expressing XIRP1B-mCherry ∼2.5 h post-infection with GFP-expressing Listeria. Bar: 10 μm

Techniques Used: Confocal Microscopy, Infection, Immunostaining, Microscopy, Expressing

18) Product Images from "Directly light-regulated binding of RGS-LOV photoreceptors to anionic membrane phospholipids"

Article Title: Directly light-regulated binding of RGS-LOV photoreceptors to anionic membrane phospholipids

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi: 10.1073/pnas.1802832115

Light-activated membrane localization in HEK cells. ( A ) Spinning-disk confocal fluorescence micrographs of BcLOV4 show it is cytosolic in the dark and translocates to the plasma membrane in blue light. Cells were fixed with paraformaldehyde in the dark or under blue light, and stained with Alexa 488-conjugated anti-3×FLAG antibody. (Scale bar: 10 μm.) ( B ) Example single cell for quantitative membrane localization analysis. pm-GFP, isoprenylated GFP marker. Line section for C . (Scale bar: 10 μm.) ( C ) Line section profiles of pm-GFP and BcLOV4-mCherry from cell in B . Association, during 5-s illumination. ( D ) Same as C for dissociation (dissociation, dark after 5-s illumination). ( E ) Population analysis of translocation kinetics. Time constants were statistically determined by correlation analysis between the membrane marker and BcLOV line section profiles, for similarity (τ on = 1.11 s; 95% CI, 1.05–1.18 s). n = 30 cells, * P
Figure Legend Snippet: Light-activated membrane localization in HEK cells. ( A ) Spinning-disk confocal fluorescence micrographs of BcLOV4 show it is cytosolic in the dark and translocates to the plasma membrane in blue light. Cells were fixed with paraformaldehyde in the dark or under blue light, and stained with Alexa 488-conjugated anti-3×FLAG antibody. (Scale bar: 10 μm.) ( B ) Example single cell for quantitative membrane localization analysis. pm-GFP, isoprenylated GFP marker. Line section for C . (Scale bar: 10 μm.) ( C ) Line section profiles of pm-GFP and BcLOV4-mCherry from cell in B . Association, during 5-s illumination. ( D ) Same as C for dissociation (dissociation, dark after 5-s illumination). ( E ) Population analysis of translocation kinetics. Time constants were statistically determined by correlation analysis between the membrane marker and BcLOV line section profiles, for similarity (τ on = 1.11 s; 95% CI, 1.05–1.18 s). n = 30 cells, * P

Techniques Used: Fluorescence, Staining, Marker, Translocation Assay

In vitro binding to anionic membrane lipids. ( A ) Schematic of BcLOV4 in lipid-stabilized w/o emulsions. ( B ) Fluorescence micrographs of wild-type BcLOV4 fused to mCherry. Translocation to the inner leaflet-like interface is observed with increasing anionic PS content, but not with purely zwitterionic PC interfaces. ( C ) Phospholipid interface binding curves, calculated as the membrane interface:dispersed phase ratio (normalized) of BcLOV4 in the light and dark. n = 20–75 droplets; error, SEM. ( D ) Constitutively active BcLOV4 Q355N structurally mimics the photoactivated signaling state, is localized to the interface in the dark, and retains its preference for net anionic phospholipids over zwitterionic ones. The photochemically inactive C292A mutant cannot form a covalent cysteinyl-flavin photoadduct and remains in the aqueous dispersed phase even upon illumination. ( B – D ) Blue light pulses: λ = 440/20 nm, 5 s, 15 mW/cm 2 . mCherry imaging: λ ex = 550/15 nm, λ em = 630/75 nm. (Scale bar: 25 μm.) ( E ) Affinity measures by SPR to 80% PC/20% PS mixed liposomal bilayers. The interaction with constitutively active BcLOV4 is high affinity ( K dQ355N = 130 ± 75 nM) and > 20-fold enhanced over the photochemically inactive mutant ( K dC292A = 3.2 ± 1.2 μM). ( i ) The 0–20 μM range, with fit only for constitutively active mutant for clarity, and ( ii ) 0–2 μM range. n = 2–7; error, SEM. ( F ) SPR measures of constitutively active mutant binding to mixed PC/PS liposomes of varying total anionic charge density. n = 3; error, SD. ( G ) SPR binding assessments of constitutively active mutant to lipids of different headgroup charge density, in liposomes of matching total anionic charge density of 20% ( n = 3; error, SD). ( F and G ) CL, cardiolipin; PC, phosphatidylcholine; PIP2, phosphatidylinositol-(4,5)-biphosphate; PIP3, phosphatidylinositol-(3,4,5)-triphosphate; PS, phosphatidylserine.
Figure Legend Snippet: In vitro binding to anionic membrane lipids. ( A ) Schematic of BcLOV4 in lipid-stabilized w/o emulsions. ( B ) Fluorescence micrographs of wild-type BcLOV4 fused to mCherry. Translocation to the inner leaflet-like interface is observed with increasing anionic PS content, but not with purely zwitterionic PC interfaces. ( C ) Phospholipid interface binding curves, calculated as the membrane interface:dispersed phase ratio (normalized) of BcLOV4 in the light and dark. n = 20–75 droplets; error, SEM. ( D ) Constitutively active BcLOV4 Q355N structurally mimics the photoactivated signaling state, is localized to the interface in the dark, and retains its preference for net anionic phospholipids over zwitterionic ones. The photochemically inactive C292A mutant cannot form a covalent cysteinyl-flavin photoadduct and remains in the aqueous dispersed phase even upon illumination. ( B – D ) Blue light pulses: λ = 440/20 nm, 5 s, 15 mW/cm 2 . mCherry imaging: λ ex = 550/15 nm, λ em = 630/75 nm. (Scale bar: 25 μm.) ( E ) Affinity measures by SPR to 80% PC/20% PS mixed liposomal bilayers. The interaction with constitutively active BcLOV4 is high affinity ( K dQ355N = 130 ± 75 nM) and > 20-fold enhanced over the photochemically inactive mutant ( K dC292A = 3.2 ± 1.2 μM). ( i ) The 0–20 μM range, with fit only for constitutively active mutant for clarity, and ( ii ) 0–2 μM range. n = 2–7; error, SEM. ( F ) SPR measures of constitutively active mutant binding to mixed PC/PS liposomes of varying total anionic charge density. n = 3; error, SD. ( G ) SPR binding assessments of constitutively active mutant to lipids of different headgroup charge density, in liposomes of matching total anionic charge density of 20% ( n = 3; error, SD). ( F and G ) CL, cardiolipin; PC, phosphatidylcholine; PIP2, phosphatidylinositol-(4,5)-biphosphate; PIP3, phosphatidylinositol-(3,4,5)-triphosphate; PS, phosphatidylserine.

Techniques Used: In Vitro, Binding Assay, Fluorescence, Translocation Assay, Mutagenesis, Imaging, SPR Assay

Light-regulated membrane localization in yeast ( S. cerevisiae ). ( A ) Spinning-disk confocal fluorescence micrographs of BcLOV4-mCherry in transformed yeast show reversible membrane localization in response to blue light. Cells were immobilized on agar pads immediately before imaging. (Scale bar: 5 μm.) ( B ) Population analysis of membrane association kinetics. Time constants determined from relative fraction of membrane-bound BcLOV4 from cellular line sections (mean ± SEM; n = 31 cells; τ on = 1.20 s; 95% CI, 1.07–1.38 s). ( C ) Population analysis of membrane dissociation kinetics (τ off = 84.9 s; 95% CI, 83.3–93 s).
Figure Legend Snippet: Light-regulated membrane localization in yeast ( S. cerevisiae ). ( A ) Spinning-disk confocal fluorescence micrographs of BcLOV4-mCherry in transformed yeast show reversible membrane localization in response to blue light. Cells were immobilized on agar pads immediately before imaging. (Scale bar: 5 μm.) ( B ) Population analysis of membrane association kinetics. Time constants determined from relative fraction of membrane-bound BcLOV4 from cellular line sections (mean ± SEM; n = 31 cells; τ on = 1.20 s; 95% CI, 1.07–1.38 s). ( C ) Population analysis of membrane dissociation kinetics (τ off = 84.9 s; 95% CI, 83.3–93 s).

Techniques Used: Fluorescence, Transformation Assay, Imaging

19) Product Images from "A Co-CRISPR Strategy for Efficient Genome Editing in Caenorhabditis elegans"

Article Title: A Co-CRISPR Strategy for Efficient Genome Editing in Caenorhabditis elegans

Journal: Genetics

doi: 10.1534/genetics.114.166389

HR-mediated knock-in to generate fusion genes at endogenous loci. (A) Schematic of the Cas9/sgRNA target site and the donor plasmid for gfp :: pie-1 knock-ins. The donor plasmid contains the gfp coding sequence inserted immediately after the start codon of pie-1 , 1 kb of homology flanking the CRISPR-Cas9 cleavage site, and a silent mutation in the PAM site. (B) Strategy to screen for gfp knock-in lines. We placed three F1 rollers at a time on a 2% agar pad and screened for GFP expression using epifluorescence microscopy. GFP-expressing worms were individually recovered and allowed to make F2 progeny for 1 day before being lysed for PCR and DNA sequence analysis. We confirmed Mendelian inheritance of gfp knock-in alleles among F2 progeny. (C) GFP::PIE-1 expression in the germline of two- to four-cell embryos of gfp :: pie-1 knock-in strains. (D) Immunoblot analysis showing PIE-1 expression levels in wild-type animals, MosSCI-mediated gfp :: pie-1 knock-in animals, and CRISPR-Cas9-mediated gfp knock-in animals. A MosSCI strain of gfp :: pie-1 ; pie-1(zu154) was obtained by crossing gfp :: pie-1 (LGII) with the pie-1(zu154) (LGIII) null mutant. (E) mCherry expression in late embryos of the mCherry :: vet-2 knock-in strain. (F) Schematic of Cas9/sgRNA target sequence, PAM site, and donor plasmid for pie-1 :: flag knock-in. The PAM is located in the last exon of pie-1 . The donor plasmid includes flag coding sequence immediately before the pie-1 stop codon and ∼800-bp homology arms flanking the target site. (G) PCR and restriction analysis of an HR event. PCR products were generated using the primers indicated in F, and the products were digested with Nhe I. The pie-1 :: flag gene conversion introduces an Nhe I RFLP that is observed in F1 heterozygous and F2 homozygous pie-1 :: flag animals.
Figure Legend Snippet: HR-mediated knock-in to generate fusion genes at endogenous loci. (A) Schematic of the Cas9/sgRNA target site and the donor plasmid for gfp :: pie-1 knock-ins. The donor plasmid contains the gfp coding sequence inserted immediately after the start codon of pie-1 , 1 kb of homology flanking the CRISPR-Cas9 cleavage site, and a silent mutation in the PAM site. (B) Strategy to screen for gfp knock-in lines. We placed three F1 rollers at a time on a 2% agar pad and screened for GFP expression using epifluorescence microscopy. GFP-expressing worms were individually recovered and allowed to make F2 progeny for 1 day before being lysed for PCR and DNA sequence analysis. We confirmed Mendelian inheritance of gfp knock-in alleles among F2 progeny. (C) GFP::PIE-1 expression in the germline of two- to four-cell embryos of gfp :: pie-1 knock-in strains. (D) Immunoblot analysis showing PIE-1 expression levels in wild-type animals, MosSCI-mediated gfp :: pie-1 knock-in animals, and CRISPR-Cas9-mediated gfp knock-in animals. A MosSCI strain of gfp :: pie-1 ; pie-1(zu154) was obtained by crossing gfp :: pie-1 (LGII) with the pie-1(zu154) (LGIII) null mutant. (E) mCherry expression in late embryos of the mCherry :: vet-2 knock-in strain. (F) Schematic of Cas9/sgRNA target sequence, PAM site, and donor plasmid for pie-1 :: flag knock-in. The PAM is located in the last exon of pie-1 . The donor plasmid includes flag coding sequence immediately before the pie-1 stop codon and ∼800-bp homology arms flanking the target site. (G) PCR and restriction analysis of an HR event. PCR products were generated using the primers indicated in F, and the products were digested with Nhe I. The pie-1 :: flag gene conversion introduces an Nhe I RFLP that is observed in F1 heterozygous and F2 homozygous pie-1 :: flag animals.

Techniques Used: Knock-In, Plasmid Preparation, Sequencing, CRISPR, Mutagenesis, Expressing, Epifluorescence Microscopy, Polymerase Chain Reaction, Generated

20) Product Images from "Two mechanisms drive pronuclear migration in mouse zygotes"

Article Title: Two mechanisms drive pronuclear migration in mouse zygotes

Journal: Nature Communications

doi: 10.1038/s41467-021-21020-x

Pronuclei migrate by different modes in the periphery and central region of the zygote. a Three-dimensional time-lapse images (upper panel) and iso-surface reconstruction (lower panel) of pronuclei (H2B-mCherry, z-projection of 28 sections, every 3 µm) and the cell surface (MyrGFP, equatorial section) in live zygotes relative to pronuclear formation (0 h). Female (♀) and male (♂) genomes are labelled; as well as the second polar body (PB), which forms around excess maternal DNA in meiosis II. Distinct phases of migration for male and female pronuclei were defined according to migratory behaviour of male (blue) or female (red) pronuclei (for details see text), which were further characterized by typical speeds within certain ranges as follows: fast ( > 0.1 µm/min), medium (0.05–0.1 µm/min) and slow (
Figure Legend Snippet: Pronuclei migrate by different modes in the periphery and central region of the zygote. a Three-dimensional time-lapse images (upper panel) and iso-surface reconstruction (lower panel) of pronuclei (H2B-mCherry, z-projection of 28 sections, every 3 µm) and the cell surface (MyrGFP, equatorial section) in live zygotes relative to pronuclear formation (0 h). Female (♀) and male (♂) genomes are labelled; as well as the second polar body (PB), which forms around excess maternal DNA in meiosis II. Distinct phases of migration for male and female pronuclei were defined according to migratory behaviour of male (blue) or female (red) pronuclei (for details see text), which were further characterized by typical speeds within certain ranges as follows: fast ( > 0.1 µm/min), medium (0.05–0.1 µm/min) and slow (

Techniques Used: Migration

21) Product Images from "Spike-frequency dependent coregulation of multiple ionic conductances in fast-spiking cells forces a metabolic tradeoff"

Article Title: Spike-frequency dependent coregulation of multiple ionic conductances in fast-spiking cells forces a metabolic tradeoff

Journal: bioRxiv

doi: 10.1101/2021.03.08.434486

Expression of mCherry-tagged K Na channels on the plasma membrane of X. laevis oocytes and localization of K Na channels in electrocytes. A. Maximum-intensity-projection (MIP) images of X. laevis oocytes expressing mCherry tagged E. virescens K Na channels rendered with images taken at different focal planes. B: MIP images of a control electrocyte (no expression of mCherry-tagged K Na channels). Broadband tissue autofluorescence (AutoF, green) was excited by a 488-nm laser. C-E: Representative images of electrocytes expressing mCherry-eSlack/Slick plasmids on the anterior region. Images in C1, D1 and E1, acquired using an epifluorescent microscope, show a larger field of view. Other images in C-E were acquired by laser-scanning confocal microscope. Images displayed in C2, D2 and E2 are single optical sections showing the anterior face from cells expressing recombinant K Na channels (red). C3, D3 and E3 are MIP images rendered from the serial optical sections shown in C2, D2 and E2. Merged images of autofluorescence (green) and mCherry (red) in C4, D4 and E4 revealed that recombinant K Na channels are not expressed on the posterior membrane of electrocytes. White dotted lines indicate the boundary of electrocytes.
Figure Legend Snippet: Expression of mCherry-tagged K Na channels on the plasma membrane of X. laevis oocytes and localization of K Na channels in electrocytes. A. Maximum-intensity-projection (MIP) images of X. laevis oocytes expressing mCherry tagged E. virescens K Na channels rendered with images taken at different focal planes. B: MIP images of a control electrocyte (no expression of mCherry-tagged K Na channels). Broadband tissue autofluorescence (AutoF, green) was excited by a 488-nm laser. C-E: Representative images of electrocytes expressing mCherry-eSlack/Slick plasmids on the anterior region. Images in C1, D1 and E1, acquired using an epifluorescent microscope, show a larger field of view. Other images in C-E were acquired by laser-scanning confocal microscope. Images displayed in C2, D2 and E2 are single optical sections showing the anterior face from cells expressing recombinant K Na channels (red). C3, D3 and E3 are MIP images rendered from the serial optical sections shown in C2, D2 and E2. Merged images of autofluorescence (green) and mCherry (red) in C4, D4 and E4 revealed that recombinant K Na channels are not expressed on the posterior membrane of electrocytes. White dotted lines indicate the boundary of electrocytes.

Techniques Used: Expressing, Microscopy, Recombinant

22) Product Images from "FERARI and cargo adaptors coordinate cargo flow through sorting endosomes"

Article Title: FERARI and cargo adaptors coordinate cargo flow through sorting endosomes

Journal: Nature Communications

doi: 10.1038/s41467-022-32377-y

Effects of cargo adaptor SNX6 on Rab5, Rab11, and Rab10 vesicles in worms and HeLa cells. a snx6(RNAi) leads to increased co-localization of GFP-Rab5 vesicles with mCherry-SNX1 networks (see Supplementary Movie 16 ). Mander’s coefficients ( n = 10). Data are presented as mean values +/– SD. Unpaired two-tailed t -test: M1 P = 2.61E-05, M2 P = 2.06E-05. Scale bar: 2 µm. b snx6(RNAi) leads to increased co-localization of GFP-Rab11 vesicles with mCherry-SNX1 networks (see Supplementary Movie 17 ). Mander’s coefficients ( n = 10). Data are presented as mean values +/– SD. Unpaired two-tailed t -test: M1 P = 0.000113, M2 P = 9.501E-05. Scale bar: 2 µm. c snx-6(RNAi) increases GFP-Rab10 compartment co-localization with mCh-SNX1 in C. elegans (Supplementary Movie 18 ). Mander’s coefficients ( n = 10). Data are presented as mean values +/– SD. Unpaired two-tailed t -test: M1 P = 3.96E-06, M2 P = 1.16E-06. Scale bar: 2 µm. d snx6(RNAi) drastically increases the residence times of vesicles. The Rab5 wild-type vesicles are plotted as a dashed line for comparison (see Supplementary Fig. 3c for single-vesicle plots). Please note the elongated x -axis to accommodate vesicles with very long residence times ( n = 62 for Rab5, n = 57 for Rab11). One-way multiple comparison ANOVA test P -values: Rab5 wt vs. Rab5 snx6 P = 7.76E-07, Rab5 wt vs. Rab11 snx6 P = 1.051E-06. e Rab5 vesicles from snx6(RNAi) worms are increased in size ( wt : n = 828, snx-6 : n = 1459) (see Supplementary Fig. 3d for single worms). Unpaired two-tailed t -test P = 1.45E-11. f Rab11 vesicles from snx6(RNAi) worms appear smaller ( wt : n = 774, snx6 : n = 995) (see Supplementary Fig. 3e for single worms). Unpaired two-tailed t -test P = 1E-15. g Co-localization of Rab5 and SNX1 is increased in snx5 + 6 KO cells. HeLa cells were co-transfected with GFP-SNX1 and mApple-Rab5. Representative images from live-cell imaging of ctr and snx5 + 6 KO are shown. Rab5 and SNX1-positive structures are enlarged in snx5 + 6 KO cells ( n = 3 independent experiments, see quantification of volume of Rab5 structures below). Unpaired two-tailed t -test P = 1.615E-249. Scale bars 10 µm. h Knock-down of snx-6 increases RFP-Rab10 compartment co-localization with GFP-EHD1 in C. elegans . Mander’s coefficients ( n = 10). Data are presented as mean values +/– SD. Unpaired two-tailed t -test: M1 P = 0.000275, M2 P = 1.896E-05. Scale bar: 2 µm.
Figure Legend Snippet: Effects of cargo adaptor SNX6 on Rab5, Rab11, and Rab10 vesicles in worms and HeLa cells. a snx6(RNAi) leads to increased co-localization of GFP-Rab5 vesicles with mCherry-SNX1 networks (see Supplementary Movie 16 ). Mander’s coefficients ( n = 10). Data are presented as mean values +/– SD. Unpaired two-tailed t -test: M1 P = 2.61E-05, M2 P = 2.06E-05. Scale bar: 2 µm. b snx6(RNAi) leads to increased co-localization of GFP-Rab11 vesicles with mCherry-SNX1 networks (see Supplementary Movie 17 ). Mander’s coefficients ( n = 10). Data are presented as mean values +/– SD. Unpaired two-tailed t -test: M1 P = 0.000113, M2 P = 9.501E-05. Scale bar: 2 µm. c snx-6(RNAi) increases GFP-Rab10 compartment co-localization with mCh-SNX1 in C. elegans (Supplementary Movie 18 ). Mander’s coefficients ( n = 10). Data are presented as mean values +/– SD. Unpaired two-tailed t -test: M1 P = 3.96E-06, M2 P = 1.16E-06. Scale bar: 2 µm. d snx6(RNAi) drastically increases the residence times of vesicles. The Rab5 wild-type vesicles are plotted as a dashed line for comparison (see Supplementary Fig. 3c for single-vesicle plots). Please note the elongated x -axis to accommodate vesicles with very long residence times ( n = 62 for Rab5, n = 57 for Rab11). One-way multiple comparison ANOVA test P -values: Rab5 wt vs. Rab5 snx6 P = 7.76E-07, Rab5 wt vs. Rab11 snx6 P = 1.051E-06. e Rab5 vesicles from snx6(RNAi) worms are increased in size ( wt : n = 828, snx-6 : n = 1459) (see Supplementary Fig. 3d for single worms). Unpaired two-tailed t -test P = 1.45E-11. f Rab11 vesicles from snx6(RNAi) worms appear smaller ( wt : n = 774, snx6 : n = 995) (see Supplementary Fig. 3e for single worms). Unpaired two-tailed t -test P = 1E-15. g Co-localization of Rab5 and SNX1 is increased in snx5 + 6 KO cells. HeLa cells were co-transfected with GFP-SNX1 and mApple-Rab5. Representative images from live-cell imaging of ctr and snx5 + 6 KO are shown. Rab5 and SNX1-positive structures are enlarged in snx5 + 6 KO cells ( n = 3 independent experiments, see quantification of volume of Rab5 structures below). Unpaired two-tailed t -test P = 1.615E-249. Scale bars 10 µm. h Knock-down of snx-6 increases RFP-Rab10 compartment co-localization with GFP-EHD1 in C. elegans . Mander’s coefficients ( n = 10). Data are presented as mean values +/– SD. Unpaired two-tailed t -test: M1 P = 0.000275, M2 P = 1.896E-05. Scale bar: 2 µm.

Techniques Used: Two Tailed Test, Transfection, Live Cell Imaging

Rab5 and Rab11 vesicles exhibit kiss-and-run behavior dependent on FERARI in both worms and HeLa cells. a Rab11 vesicles perform kiss-and-run dependent on FERARI. Movie stills showing kiss-and-run of endogenously GFP-tagged Rab11 vesicles (arrow) in ctr KO ( n = 41) and vipas39-KO ( n = 25) HeLa cells (see also Supplementary Movie 1 ). Scale bar: 2 µm. b Rab11 vesicles dock on SNX1 networks with residence times in distinct intervals. Groups of vesicles with similar residence times appear as peaks (see also Supplementary Fig. 2b for single-vesicle graph, mock : n = 41, vipas39-KO : n = 25). This pattern is abolished in vipas39 -KO cells (see Supplementary Fig. 2a, b for ehd1-KO and rab11fip5-KO additional data). One-way multiple comparison ANOVA test P -values: mock-vipas39-KO P = 1.98E-09, mock-ehd1-KO P = 1.6E-10, mock-rab11fip5-KO P = 1.58E-09. c List of FERARI genes in C. elegans and H. sapiens . The human nomenclature is used throughout the manuscript. The model organism is indicated by a human or worm icon next to the data. d Movie stills showing kiss-and-run of Rab5 vesicles (arrow) in wild-type worms ( n = 53). Scale bar: 2 µm. e Movie stills showing kiss-and-run of Rab5 vesicles (arrow) in ehd1(RNAi) worms ( n = 33) (see also Supplementary Movie 3 ). Scale bar: 2 µm. f Rab5 vesicles dock on SNX1 networks with residence times in distinct intervals (see also Supplementary Fig. 3a for single-vesicle graph, n = 53). This pattern is abolished in ehd1 ( n = 33) and fip5 ( n = 35) knock-downs (see Supplementary Fig. 3a for single-vesicle plots). One-way multiple comparison ANOVA test P -values: mock-ehd1 P = 4.63E-05, mock-fip5 P = 3.83E-05. g Residence times intervals in Rab5 vesicles docking to mCherry-EHD1 compartments ( wild-type from f as comparison, n = 63) (see Supplementary Fig. 3a ). Unpaired two-tailed t -test: P = 0.8467. h Rab5 exhibits kiss-and-run behavior in HeLa cells stably expressing mApple-Rab5 and transiently expressing GFP-SNX1. Movie stills show representative vesicles for ctr KO ( n = 41) and vipas39- KO ( n = 23) cells (arrow) (see also Supplementary Movie 4 ). Scale bars: 2 µm. i Binning of vesicles from (h) reveals distinct intervals of residence times for Rab5 vesicles ( mock : n = 41, vipas39-KO : n = 23). This pattern is abolished in vipas39-KO cells (see Supplementary Fig. 3b for single-vesicle plots). Unpaired two-tailed t -test: P = 0.000118.
Figure Legend Snippet: Rab5 and Rab11 vesicles exhibit kiss-and-run behavior dependent on FERARI in both worms and HeLa cells. a Rab11 vesicles perform kiss-and-run dependent on FERARI. Movie stills showing kiss-and-run of endogenously GFP-tagged Rab11 vesicles (arrow) in ctr KO ( n = 41) and vipas39-KO ( n = 25) HeLa cells (see also Supplementary Movie 1 ). Scale bar: 2 µm. b Rab11 vesicles dock on SNX1 networks with residence times in distinct intervals. Groups of vesicles with similar residence times appear as peaks (see also Supplementary Fig. 2b for single-vesicle graph, mock : n = 41, vipas39-KO : n = 25). This pattern is abolished in vipas39 -KO cells (see Supplementary Fig. 2a, b for ehd1-KO and rab11fip5-KO additional data). One-way multiple comparison ANOVA test P -values: mock-vipas39-KO P = 1.98E-09, mock-ehd1-KO P = 1.6E-10, mock-rab11fip5-KO P = 1.58E-09. c List of FERARI genes in C. elegans and H. sapiens . The human nomenclature is used throughout the manuscript. The model organism is indicated by a human or worm icon next to the data. d Movie stills showing kiss-and-run of Rab5 vesicles (arrow) in wild-type worms ( n = 53). Scale bar: 2 µm. e Movie stills showing kiss-and-run of Rab5 vesicles (arrow) in ehd1(RNAi) worms ( n = 33) (see also Supplementary Movie 3 ). Scale bar: 2 µm. f Rab5 vesicles dock on SNX1 networks with residence times in distinct intervals (see also Supplementary Fig. 3a for single-vesicle graph, n = 53). This pattern is abolished in ehd1 ( n = 33) and fip5 ( n = 35) knock-downs (see Supplementary Fig. 3a for single-vesicle plots). One-way multiple comparison ANOVA test P -values: mock-ehd1 P = 4.63E-05, mock-fip5 P = 3.83E-05. g Residence times intervals in Rab5 vesicles docking to mCherry-EHD1 compartments ( wild-type from f as comparison, n = 63) (see Supplementary Fig. 3a ). Unpaired two-tailed t -test: P = 0.8467. h Rab5 exhibits kiss-and-run behavior in HeLa cells stably expressing mApple-Rab5 and transiently expressing GFP-SNX1. Movie stills show representative vesicles for ctr KO ( n = 41) and vipas39- KO ( n = 23) cells (arrow) (see also Supplementary Movie 4 ). Scale bars: 2 µm. i Binning of vesicles from (h) reveals distinct intervals of residence times for Rab5 vesicles ( mock : n = 41, vipas39-KO : n = 23). This pattern is abolished in vipas39-KO cells (see Supplementary Fig. 3b for single-vesicle plots). Unpaired two-tailed t -test: P = 0.000118.

Techniques Used: Two Tailed Test, Stable Transfection, Expressing

Rab5 vesicles are fusing and doing kiss-and-run on the way to the sorting endosome, probably while carrying ESCRT-0 cargo adaptors. a Movie stills for GFP-Rab5-positive vesicles (arrows) fusing, then docking on mCherry-SNX1 compartment (kiss-and-run for 18s) and finally fusing with a larger sorting endosome (with GFP-Rab5 and mCherry-SNX1 domains) ( n = 53, kiss-and-run, n = 19 fusing). Scale bar: 2 µm. b Cargo adaptor ESCRT-0 subunit Hrs moves with vesicles that perform kiss-and-run on SNX1 compartments ( n = 67) (movie stills from Supplementary Movie 8 , arrow points to Hrs-positive vesicle). Scale bar: 2 µm. c Kiss-and-run behavior of Hrs vesicles depends on FERARI subunit EHD1 ( n = 30) (movie stills from Supplementary Movie 8 , arrow points to Hrs-positive vesicle). Scale bar: 2 µm. d Hrs vesicles dock on SNX1 networks with residence times in distinct intervals. Groups of vesicles with similar residence times appear as peaks (see also Supplementary Fig. 4f for single-vesicle graph, mock : n = 67, ehd1-KO : n = 30). Unpaired two-tailed t -test: P = 2.03E-06.
Figure Legend Snippet: Rab5 vesicles are fusing and doing kiss-and-run on the way to the sorting endosome, probably while carrying ESCRT-0 cargo adaptors. a Movie stills for GFP-Rab5-positive vesicles (arrows) fusing, then docking on mCherry-SNX1 compartment (kiss-and-run for 18s) and finally fusing with a larger sorting endosome (with GFP-Rab5 and mCherry-SNX1 domains) ( n = 53, kiss-and-run, n = 19 fusing). Scale bar: 2 µm. b Cargo adaptor ESCRT-0 subunit Hrs moves with vesicles that perform kiss-and-run on SNX1 compartments ( n = 67) (movie stills from Supplementary Movie 8 , arrow points to Hrs-positive vesicle). Scale bar: 2 µm. c Kiss-and-run behavior of Hrs vesicles depends on FERARI subunit EHD1 ( n = 30) (movie stills from Supplementary Movie 8 , arrow points to Hrs-positive vesicle). Scale bar: 2 µm. d Hrs vesicles dock on SNX1 networks with residence times in distinct intervals. Groups of vesicles with similar residence times appear as peaks (see also Supplementary Fig. 4f for single-vesicle graph, mock : n = 67, ehd1-KO : n = 30). Unpaired two-tailed t -test: P = 2.03E-06.

Techniques Used: Two Tailed Test

Specific SNAREs are used to dock Rab10 vesicles through FERARI. a Knock-downs of syx16, vamp7, vti1 , and syx3 cause FERARI-like phenotypes as seen in vps45(RNAi) (long RFP-Rab10 tubules indicated by large arrowheads), while syx6 and syx7 do not (short tubules indicated by small arrowheads) ( n = 20 animals per condition). b Tubule length was quantified for n = 10 different tubules in n = 6 animals examined over three independent RNAi experiments (total n = 60). Data are presented as mean values +/– SD. One-way multiple comparison ANOVA test P -values: all indicated differences are smaller than P = 1E-15. Scale bar: 10 µm. c Knock-down of syx3 causes enlargement of Rab11 compartments, similar to previously published FERARI knock-downs 7 ( n = 20 animals per condition). Scale bar: 10 µm. d GFP-SYX3 localizes to mCherry-SNX1, mCherry-EHD1, and RFP-Rab10 structures (Supplementary Movie 14 with 3D projections) ( n = 10 animals). Scale bar: 2 µm. e Mander’s coefficients are shown for n = 10 worms. Data are presented as mean values +/– SD. One-way multiple comparison ANOVA test P -values: M1 SYX3-SNX1 vs. SYX3-EHD1 P = 1.0901E-09, M1 SYX3-SNX1 vs. SYX3-Rab10 P = 0.00116, M1 SYX3-EHD1 vs. SYX3-Rab10 P = 0.00424, M2 SYX3-SNX1 vs. SYX3-EHD1 P = 7.43E-12, M2 SYX3-SNX1 vs. SYX3-Rab10 P = 0.000351, M2 SYX3-EHD1 vs. SYX3-Rab10 P = 0.000149.
Figure Legend Snippet: Specific SNAREs are used to dock Rab10 vesicles through FERARI. a Knock-downs of syx16, vamp7, vti1 , and syx3 cause FERARI-like phenotypes as seen in vps45(RNAi) (long RFP-Rab10 tubules indicated by large arrowheads), while syx6 and syx7 do not (short tubules indicated by small arrowheads) ( n = 20 animals per condition). b Tubule length was quantified for n = 10 different tubules in n = 6 animals examined over three independent RNAi experiments (total n = 60). Data are presented as mean values +/– SD. One-way multiple comparison ANOVA test P -values: all indicated differences are smaller than P = 1E-15. Scale bar: 10 µm. c Knock-down of syx3 causes enlargement of Rab11 compartments, similar to previously published FERARI knock-downs 7 ( n = 20 animals per condition). Scale bar: 10 µm. d GFP-SYX3 localizes to mCherry-SNX1, mCherry-EHD1, and RFP-Rab10 structures (Supplementary Movie 14 with 3D projections) ( n = 10 animals). Scale bar: 2 µm. e Mander’s coefficients are shown for n = 10 worms. Data are presented as mean values +/– SD. One-way multiple comparison ANOVA test P -values: M1 SYX3-SNX1 vs. SYX3-EHD1 P = 1.0901E-09, M1 SYX3-SNX1 vs. SYX3-Rab10 P = 0.00116, M1 SYX3-EHD1 vs. SYX3-Rab10 P = 0.00424, M2 SYX3-SNX1 vs. SYX3-EHD1 P = 7.43E-12, M2 SYX3-SNX1 vs. SYX3-Rab10 P = 0.000351, M2 SYX3-EHD1 vs. SYX3-Rab10 P = 0.000149.

Techniques Used:

Rab10 vesicles undergo kiss-and-run with SNX1 compartments. a GFP-Rab10 compartments docking onto mCherry-SNX1 networks in worm intestine (see also 3D projection, Supplementary Movie 10 ). Regions of co-localization are indicated by arrows. Quantification of co-localization by Mander’s coefficients ( n = 10). Data are presented as mean values +/– SD. M1 denotes the overlap between SNX1 and Rab10, and M2 between Rab10 and SNX1. One-way multiple comparison ANOVA test P -values: M1 SNX1-Rab10 vs. SNX1-DHS-3 P = 1.94E-08, M1 SNX1-Rab10 vs. SNX1-MANS P = 9.62E-09, M2 SNX1-Rab10 vs. SNX1-DHS-3 P = 4.37E-13, M2 SNX1-Rab10 vs. SNX1-MANS P = 4.43E-13. Scale bar: 2 µm. b Genetic interaction between FERARI subunits and Rab10. rab10(ok1494) causes accumulation of SNX1 compartments. RNAi of vps45 and vipas39 but not vps33B (CHEVI) show additional enlargement of SNX1 (arrowheads). n = 20 worms from 3 experiments (for quantification see Supplementary Fig. 5a ). Scale bar: 10 µm. c Western blot of CRISPR–Cas9-mediated KO of Rab10 in HeLa cells ( n = 3 independent experiments). d Size of the endogenous SNX1 structure is enlarged in rab10 KO cells. SNX1 was detected by immunofluorescence. Violin plot showing the enlarged volume of the SNX1 structure in ctr and rab10 KO cells (volume of > 14,700 particles was measured from each group from three independent experiments, median indicated by the red line). Unpaired two-tailed t -test: P = 1.46E-17. Scale bars 10 µm. e Movie stills for Rab10 vesicles (arrow) showing kiss-and-run in ehd1(RNAi) ( n = 40) and wild-type worms ( n = 51) (Supplementary Movie 11 ). “N”: nucleus with high mCh-SNX1 signal. Scale bar: 2 µm. f Rab10 vesicles show residence times with quantal increases ( n = 51). This behavior is abolished in ehd1 ( n = 40) and fip5 ( n = 36) knock-downs (Supplementary Fig. 3a for single-vesicle plots). One-way multiple comparison ANOVA test P -values: mock-ehd1 P = 7.23E-08, mock-fip5 P = 4.29E-10. g Kiss-and-run of Rab10 on sorting compartments is conserved in metazoans. Residence times of Rab10 vesicles exhibit characteristic intervals abolished in vipas39- KO cells (see Supplementary Fig. 5c for single-vesicle plots). Unpaired two-tailed t -test: P = 0.000128. h Movie stills of mCherry-tagged Rab10 vesicles (arrow) showing kiss-and-run on SNX1 (GFP-tagged) compartment in ctr KO and vipas39- KO HeLa cells ( n = 3 independent experiments, mock : n = 53, vipas39-KO : n = 22 vesicles) (see Supplementary Movie 12 ). Scale bar: 2 µm.
Figure Legend Snippet: Rab10 vesicles undergo kiss-and-run with SNX1 compartments. a GFP-Rab10 compartments docking onto mCherry-SNX1 networks in worm intestine (see also 3D projection, Supplementary Movie 10 ). Regions of co-localization are indicated by arrows. Quantification of co-localization by Mander’s coefficients ( n = 10). Data are presented as mean values +/– SD. M1 denotes the overlap between SNX1 and Rab10, and M2 between Rab10 and SNX1. One-way multiple comparison ANOVA test P -values: M1 SNX1-Rab10 vs. SNX1-DHS-3 P = 1.94E-08, M1 SNX1-Rab10 vs. SNX1-MANS P = 9.62E-09, M2 SNX1-Rab10 vs. SNX1-DHS-3 P = 4.37E-13, M2 SNX1-Rab10 vs. SNX1-MANS P = 4.43E-13. Scale bar: 2 µm. b Genetic interaction between FERARI subunits and Rab10. rab10(ok1494) causes accumulation of SNX1 compartments. RNAi of vps45 and vipas39 but not vps33B (CHEVI) show additional enlargement of SNX1 (arrowheads). n = 20 worms from 3 experiments (for quantification see Supplementary Fig. 5a ). Scale bar: 10 µm. c Western blot of CRISPR–Cas9-mediated KO of Rab10 in HeLa cells ( n = 3 independent experiments). d Size of the endogenous SNX1 structure is enlarged in rab10 KO cells. SNX1 was detected by immunofluorescence. Violin plot showing the enlarged volume of the SNX1 structure in ctr and rab10 KO cells (volume of > 14,700 particles was measured from each group from three independent experiments, median indicated by the red line). Unpaired two-tailed t -test: P = 1.46E-17. Scale bars 10 µm. e Movie stills for Rab10 vesicles (arrow) showing kiss-and-run in ehd1(RNAi) ( n = 40) and wild-type worms ( n = 51) (Supplementary Movie 11 ). “N”: nucleus with high mCh-SNX1 signal. Scale bar: 2 µm. f Rab10 vesicles show residence times with quantal increases ( n = 51). This behavior is abolished in ehd1 ( n = 40) and fip5 ( n = 36) knock-downs (Supplementary Fig. 3a for single-vesicle plots). One-way multiple comparison ANOVA test P -values: mock-ehd1 P = 7.23E-08, mock-fip5 P = 4.29E-10. g Kiss-and-run of Rab10 on sorting compartments is conserved in metazoans. Residence times of Rab10 vesicles exhibit characteristic intervals abolished in vipas39- KO cells (see Supplementary Fig. 5c for single-vesicle plots). Unpaired two-tailed t -test: P = 0.000128. h Movie stills of mCherry-tagged Rab10 vesicles (arrow) showing kiss-and-run on SNX1 (GFP-tagged) compartment in ctr KO and vipas39- KO HeLa cells ( n = 3 independent experiments, mock : n = 53, vipas39-KO : n = 22 vesicles) (see Supplementary Movie 12 ). Scale bar: 2 µm.

Techniques Used: Western Blot, CRISPR, Immunofluorescence, Two Tailed Test

23) Product Images from "A genetically targeted sensor reveals spatial and temporal dynamics of acrosomal calcium and sperm acrosome exocytosis"

Article Title: A genetically targeted sensor reveals spatial and temporal dynamics of acrosomal calcium and sperm acrosome exocytosis

Journal: The Journal of Biological Chemistry

doi: 10.1016/j.jbc.2022.101868

Representative images of AcroSensE sperm undergoing different spatial patterns of acrosomal Ca 2+ rise (ACR), membrane fusion (MF), and acrosomal exocytosis (AE) . A , visualization of bottom-to-top spatial progression of ACR and MF following addition of high P4 (+bicarb + CD) to AcroSensE sperm. The initial basal signal of the GCaMP3 is low , while maximal mCherry intensity is detected throughout the apical acrosome. Following stimulation, an increase in the GCaMP3 signal is detected near the bottom of the plasma membrane overlying the acrosome ( arrow 1). The green signal then propagated rostrally ( arrow 2), while a decrease in the red signal was observed near the same point of origin ( arrow a) and then propagated in the same direction ( arrow b). There was complete loss of both red and green signals in this cell, consistent with full MF and AE. B , visualization of t op-to-bottom spatial progression of ACR and bottom-to-top progression of MF in the same sperm cell following addition of High P4 (+bicarb + CD). Before stimulation, the basal signal of the GCaMP3 is low, while maximal mCherry intensity is detected. Following stimulation, an increase in the GCaMP3 signal was detected near the top of the sperm head ( arrow 1). The green signal propagated caudally toward the bottom of the sperm head ( arrow 2), whereas a decrease in the red signal was observed at the bottom of the APM as soon as the green fluorescence intensity increased in that location ( arrow a). The decrease in the red signal propagated rostrally toward the top of the sperm head ( arrow b), resulting in a complete loss of both red and green signals . For both A and B , time is provided in seconds measured after the start of application of the stimulus, next to each frame. AcroSensE, Acrosome-targeted Sensor for Exocytosis; APM, acrosomal plasma membrane; CD, 2-hydroxypropyl β-cyclodextrin.
Figure Legend Snippet: Representative images of AcroSensE sperm undergoing different spatial patterns of acrosomal Ca 2+ rise (ACR), membrane fusion (MF), and acrosomal exocytosis (AE) . A , visualization of bottom-to-top spatial progression of ACR and MF following addition of high P4 (+bicarb + CD) to AcroSensE sperm. The initial basal signal of the GCaMP3 is low , while maximal mCherry intensity is detected throughout the apical acrosome. Following stimulation, an increase in the GCaMP3 signal is detected near the bottom of the plasma membrane overlying the acrosome ( arrow 1). The green signal then propagated rostrally ( arrow 2), while a decrease in the red signal was observed near the same point of origin ( arrow a) and then propagated in the same direction ( arrow b). There was complete loss of both red and green signals in this cell, consistent with full MF and AE. B , visualization of t op-to-bottom spatial progression of ACR and bottom-to-top progression of MF in the same sperm cell following addition of High P4 (+bicarb + CD). Before stimulation, the basal signal of the GCaMP3 is low, while maximal mCherry intensity is detected. Following stimulation, an increase in the GCaMP3 signal was detected near the top of the sperm head ( arrow 1). The green signal propagated caudally toward the bottom of the sperm head ( arrow 2), whereas a decrease in the red signal was observed at the bottom of the APM as soon as the green fluorescence intensity increased in that location ( arrow a). The decrease in the red signal propagated rostrally toward the top of the sperm head ( arrow b), resulting in a complete loss of both red and green signals . For both A and B , time is provided in seconds measured after the start of application of the stimulus, next to each frame. AcroSensE, Acrosome-targeted Sensor for Exocytosis; APM, acrosomal plasma membrane; CD, 2-hydroxypropyl β-cyclodextrin.

Techniques Used: Fluorescence

Representative traces of changes in fluorescence reflecting different Ca 2+ and membrane fusion dynamics under various conditions. Traces are provided as the fluorescence signal (F) after subtracting the fluorescence intensity at time point zero (F 0 ; F-F 0 ). A – D , representative traces of changes in acrosomal Ca 2+ rise (ACR) resulting from increase in GCaMP3 fluorescence ( green ) and membrane fusion (MF), resulting from loss of mCherry fluorescence ( red ) following the addition of ( A ) ionophore A23187 (50 μM puff; estimated final concentration ∼10 μM) where we observed 2 distinct responses: rapid rise ( left panel ) and slow rise ( right panel ); ( B ) G M1 (125 μM puff; final concentration ∼25 μM); ( C ) 2-hydroxypropyl β-cyclodextrin (CD; 20mΜ; final concentration ∼4 mM); ( D ) CD (4 mM) + EGTA (8 mM). Note that this specific trace ( D ) was chosen to demonstrate that the AcroSensE construct was functional, indicated by the loss of the mCherry signal, although no rise in GCaMP3 fluorescence was observed. The majority of cells under this condition did not undergo MF/AE. E – G , representative traces provided for ( E ) Low P4 (15 μM puff; final concentration ∼3 μM); ( F ) High P4 (300 μM puff; final concentration ∼60 μM), and ( G ) High P4 + bicarb + CD (final concentration of P4 ∼60 μM; 10 mM bicarb was only added during the incubation period). AcroSensE, Acrosome-targeted Sensor for Exocytosis.
Figure Legend Snippet: Representative traces of changes in fluorescence reflecting different Ca 2+ and membrane fusion dynamics under various conditions. Traces are provided as the fluorescence signal (F) after subtracting the fluorescence intensity at time point zero (F 0 ; F-F 0 ). A – D , representative traces of changes in acrosomal Ca 2+ rise (ACR) resulting from increase in GCaMP3 fluorescence ( green ) and membrane fusion (MF), resulting from loss of mCherry fluorescence ( red ) following the addition of ( A ) ionophore A23187 (50 μM puff; estimated final concentration ∼10 μM) where we observed 2 distinct responses: rapid rise ( left panel ) and slow rise ( right panel ); ( B ) G M1 (125 μM puff; final concentration ∼25 μM); ( C ) 2-hydroxypropyl β-cyclodextrin (CD; 20mΜ; final concentration ∼4 mM); ( D ) CD (4 mM) + EGTA (8 mM). Note that this specific trace ( D ) was chosen to demonstrate that the AcroSensE construct was functional, indicated by the loss of the mCherry signal, although no rise in GCaMP3 fluorescence was observed. The majority of cells under this condition did not undergo MF/AE. E – G , representative traces provided for ( E ) Low P4 (15 μM puff; final concentration ∼3 μM); ( F ) High P4 (300 μM puff; final concentration ∼60 μM), and ( G ) High P4 + bicarb + CD (final concentration of P4 ∼60 μM; 10 mM bicarb was only added during the incubation period). AcroSensE, Acrosome-targeted Sensor for Exocytosis.

Techniques Used: Fluorescence, Concentration Assay, Construct, Functional Assay, Incubation

Schematic illustration of hypothesized changes in AcroSensE fluorescence, Ca 2+ flux, and membrane fusion (MF) events between the plasma membrane overlying the acrosome (APM) and outer acrosomal membrane (OAM) of the sperm head. Prespike foot (PSF)–like events occur as a result of transitory membrane fusions, either before or leading to more stable—but still small—fusion pores (FPs). These small focal fusion events enable Ca 2+ influx into the acrosome. Full-membrane fusion leading to the loss of mCherry signal and the loss of acrosomal contents occurs as a result of coalescence of FPs. In this model, the dimensions of the FPs initially allow only for influx of small molecules into the acrosome’s lumen, including extracellular Ca 2+ ions that can bind to the GCaMP3, resulting in an increase in the “ green ” fluorescence intensity (ACR). Progression of the FP into full-membrane fusion events results in much larger openings resulting from the loss of hybrid APM/OAM membrane vesicles, allowing the AcroSensE protein to diffuse out of the acrosome lumen into the extracellular space, resulting in a decrease in both the “ red ” and “ green ” fluorescence intensities. ACR, acrosomal Ca 2+ rise; APM, acrosomal plasma membrane; OAM, outer acrosomal membrane.
Figure Legend Snippet: Schematic illustration of hypothesized changes in AcroSensE fluorescence, Ca 2+ flux, and membrane fusion (MF) events between the plasma membrane overlying the acrosome (APM) and outer acrosomal membrane (OAM) of the sperm head. Prespike foot (PSF)–like events occur as a result of transitory membrane fusions, either before or leading to more stable—but still small—fusion pores (FPs). These small focal fusion events enable Ca 2+ influx into the acrosome. Full-membrane fusion leading to the loss of mCherry signal and the loss of acrosomal contents occurs as a result of coalescence of FPs. In this model, the dimensions of the FPs initially allow only for influx of small molecules into the acrosome’s lumen, including extracellular Ca 2+ ions that can bind to the GCaMP3, resulting in an increase in the “ green ” fluorescence intensity (ACR). Progression of the FP into full-membrane fusion events results in much larger openings resulting from the loss of hybrid APM/OAM membrane vesicles, allowing the AcroSensE protein to diffuse out of the acrosome lumen into the extracellular space, resulting in a decrease in both the “ red ” and “ green ” fluorescence intensities. ACR, acrosomal Ca 2+ rise; APM, acrosomal plasma membrane; OAM, outer acrosomal membrane.

Techniques Used: Fluorescence

Using AcroSensE to resolve acrosomal Ca 2+ rise (ACR) and membrane fusion (MF) during acrosome exocytosis. A , illustration of the changes over time in the CGaMP3 ( green wavelength ) and mCherry ( red wavelength ) fluorescence intensity signals. Increase of the GCaMP3 signal is a result of Ca 2+ binding, while the loss of the mCherry signal is attributed to the loss of the AcroSensE protein out of the acrosome to the extracellular space. Note that the x-axis is expanded relative to Figure 2 . B , summary of the percentage of cells demonstrating ACR ( green bars ) and MF (loss of mCherry signal, red bars ) following A23187 (n = 93), G M1 (n= 113), CD (n= 166), CD +EGTA (n= 164), Low P4 (n = 115), High P4 (n = 208), and High P4 + bicarb (n = 73). All concentrations identical to those in Figure 2 . “+” or “-” indicate whether sperm were preincubated with 3 mM CD and/or 10 mM bicarbonate, respectively. Significant differences between conditions as measured by χ 2 ( p
Figure Legend Snippet: Using AcroSensE to resolve acrosomal Ca 2+ rise (ACR) and membrane fusion (MF) during acrosome exocytosis. A , illustration of the changes over time in the CGaMP3 ( green wavelength ) and mCherry ( red wavelength ) fluorescence intensity signals. Increase of the GCaMP3 signal is a result of Ca 2+ binding, while the loss of the mCherry signal is attributed to the loss of the AcroSensE protein out of the acrosome to the extracellular space. Note that the x-axis is expanded relative to Figure 2 . B , summary of the percentage of cells demonstrating ACR ( green bars ) and MF (loss of mCherry signal, red bars ) following A23187 (n = 93), G M1 (n= 113), CD (n= 166), CD +EGTA (n= 164), Low P4 (n = 115), High P4 (n = 208), and High P4 + bicarb (n = 73). All concentrations identical to those in Figure 2 . “+” or “-” indicate whether sperm were preincubated with 3 mM CD and/or 10 mM bicarbonate, respectively. Significant differences between conditions as measured by χ 2 ( p

Techniques Used: Fluorescence, Binding Assay

Design and validation of the mouse line expressing Acr-GCaMP3er-mCherry (Acrosome-targeted Sensor for Exocytosis [AcroSensE]). A , schematic of the construct. B , validation of Acr-GCaMP3-mCherry expression in the model using RT-PCR in various tissues (brain (B), liver (L), heart (H), muscle (M), testis (T), and negative control). Primer sets were designed to amplify 149 base pairs between the proacrosin signal peptide and the GFP portion of the GCaMP3 (f’:catggtcctgctggagttcgtg, r’:ctggtcgagctggacgggcgacg). Actin was used as a positive control. C , immunoblot analysis of protein expression using anti-GFP confirmed high levels of expression of Acr-GCaMP3-mCherry in the testis at the predicted molecular weight of 75 kDa.
Figure Legend Snippet: Design and validation of the mouse line expressing Acr-GCaMP3er-mCherry (Acrosome-targeted Sensor for Exocytosis [AcroSensE]). A , schematic of the construct. B , validation of Acr-GCaMP3-mCherry expression in the model using RT-PCR in various tissues (brain (B), liver (L), heart (H), muscle (M), testis (T), and negative control). Primer sets were designed to amplify 149 base pairs between the proacrosin signal peptide and the GFP portion of the GCaMP3 (f’:catggtcctgctggagttcgtg, r’:ctggtcgagctggacgggcgacg). Actin was used as a positive control. C , immunoblot analysis of protein expression using anti-GFP confirmed high levels of expression of Acr-GCaMP3-mCherry in the testis at the predicted molecular weight of 75 kDa.

Techniques Used: Expressing, Construct, Reverse Transcription Polymerase Chain Reaction, Negative Control, Positive Control, Molecular Weight

24) Product Images from "Optogenetic Rac1 engineered from membrane lipid-binding RGS-LOV for inducible lamellipodia formation"

Article Title: Optogenetic Rac1 engineered from membrane lipid-binding RGS-LOV for inducible lamellipodia formation

Journal: Photochemical & photobiological sciences : Official journal of the European Photochemistry Association and the European Society for Photobiology

doi: 10.1039/c9pp00434c

Population analysis of domain arrangement combinations. (a) Relative expression level vs. BcLOV4-mCherry control with no effector. (b) Ratio of membrane-localized vs. cytosolic protein for the engineered arrangements (normalized vs. BcLOV4-mCherry control) in the dark-adapted and blue light-illuminated state. N = 25 – 35 each. Mean ± standard error.
Figure Legend Snippet: Population analysis of domain arrangement combinations. (a) Relative expression level vs. BcLOV4-mCherry control with no effector. (b) Ratio of membrane-localized vs. cytosolic protein for the engineered arrangements (normalized vs. BcLOV4-mCherry control) in the dark-adapted and blue light-illuminated state. N = 25 – 35 each. Mean ± standard error.

Techniques Used: Expressing

Molecular engineering of opto-Rac1. (a) Domain arrangement combinations of BcLOV4, wildtype human Rac1, and mCherry visualization tag that were tested. Domains were separated by flexible (GGGS) 2 linkers. Candidates were tested for relative expression level and translocation efficiency vs. BcLOV4-mCherry in transfected HEK cells. BcLOV4-Rac1-mCherry was ultimately selected as opto-Rac1 based on its uniform localization profile in the dark-adapted state and similar translocation efficiency to BcLOV4-mCherry. (b) Fluorescence micrographs showing representative expression patterns of the six arrangements in the dark-adapted state. (c) Dynamic membrane localization of opto-Rac1 is reversible under whole-field illumination. Top = Fluorescence micrograph, Scale = 10 μm. Bottom = Line section pixel intensity.
Figure Legend Snippet: Molecular engineering of opto-Rac1. (a) Domain arrangement combinations of BcLOV4, wildtype human Rac1, and mCherry visualization tag that were tested. Domains were separated by flexible (GGGS) 2 linkers. Candidates were tested for relative expression level and translocation efficiency vs. BcLOV4-mCherry in transfected HEK cells. BcLOV4-Rac1-mCherry was ultimately selected as opto-Rac1 based on its uniform localization profile in the dark-adapted state and similar translocation efficiency to BcLOV4-mCherry. (b) Fluorescence micrographs showing representative expression patterns of the six arrangements in the dark-adapted state. (c) Dynamic membrane localization of opto-Rac1 is reversible under whole-field illumination. Top = Fluorescence micrograph, Scale = 10 μm. Bottom = Line section pixel intensity.

Techniques Used: Expressing, Translocation Assay, Transfection, Fluorescence

25) Product Images from "Adenosine Deaminase Acting on RNA 1 Associates with Orf Virus OV20.0 and Enhances Viral Replication"

Article Title: Adenosine Deaminase Acting on RNA 1 Associates with Orf Virus OV20.0 and Enhances Viral Replication

Journal: Journal of Virology

doi: 10.1128/JVI.01912-18

Cellular distribution of ADAR1 in the presence of OV20.0. The expression of endogenous ADAR1 and ADAR1 fused with mCherry was determined by an immunofluorescence assay using an ADAR1 antibody or autofluorescence, respectively. The molecular weight and integrity of mCherry (lane 1) and ADAR1-mCherry (lane 2) were determined by Western blot analysis using an mCherry antibody. (B) Colocalization of ORFV OV20.0 isoforms with ADAR1. HEK 293T cells were cotransfected with one of the eGFP-tagged OV20.0 variants (K20-eGFP, sh20-eGFP, or ΔC-eGFP) and the ADAR1-mCherry constructs. The cellular distribution of ADAR1 and OV20.0 was examined by fluorescence microscopy. White arrows indicate cytoplasmic distribution of ADAR1.
Figure Legend Snippet: Cellular distribution of ADAR1 in the presence of OV20.0. The expression of endogenous ADAR1 and ADAR1 fused with mCherry was determined by an immunofluorescence assay using an ADAR1 antibody or autofluorescence, respectively. The molecular weight and integrity of mCherry (lane 1) and ADAR1-mCherry (lane 2) were determined by Western blot analysis using an mCherry antibody. (B) Colocalization of ORFV OV20.0 isoforms with ADAR1. HEK 293T cells were cotransfected with one of the eGFP-tagged OV20.0 variants (K20-eGFP, sh20-eGFP, or ΔC-eGFP) and the ADAR1-mCherry constructs. The cellular distribution of ADAR1 and OV20.0 was examined by fluorescence microscopy. White arrows indicate cytoplasmic distribution of ADAR1.

Techniques Used: Expressing, Immunofluorescence, Molecular Weight, Western Blot, Construct, Fluorescence, Microscopy

OV20.0 interferes with ADAR1-dependent A-to-I-editing activity. (A) An illustration of the mCherry-based reporter system for monitoring A-to-I-editing activity. The GluR-B amber/W editing site, which contains target sequences for ADAR1-mediated RNA editing, was inserted near the C terminus of the mCherry coding region. The built-in UAG codon insertion leads to the translation of a truncated version of mCherry, while the ADAR1 enzyme likely converts A to I to yield full-length mCherry. (B) The ADAR1 enzyme edits the sequence of the reporter transcript in a dose-dependent manner. HEK 293T cells were transfected with the reporter plasmid, along with increasing amounts of HA-tagged ADAR1 (0, 0.2, 0.4, and 0.8 μg). At 24 h after transfection, A-to-I-editing activity was assessed by Western blot analysis using antibodies against HA and mCherry. (C) The effect of OV20.0 on ADAR1-mediated A-to-I editing. HEK 293T cells were cotransfected with the mCherry reporter plasmid and HA-tagged ADAR1 alone or with FLAG-tagged OV20.0 for 24 h. (D) The effect of OV20.0 on A-to-I-editing activity was measured based on the ratio of edited to the total of unedited plus edited products with increasing amounts of OV20.0 (as labeled) in the presence of ADAR1. The experiment was conducted with three independent repeats. **, P
Figure Legend Snippet: OV20.0 interferes with ADAR1-dependent A-to-I-editing activity. (A) An illustration of the mCherry-based reporter system for monitoring A-to-I-editing activity. The GluR-B amber/W editing site, which contains target sequences for ADAR1-mediated RNA editing, was inserted near the C terminus of the mCherry coding region. The built-in UAG codon insertion leads to the translation of a truncated version of mCherry, while the ADAR1 enzyme likely converts A to I to yield full-length mCherry. (B) The ADAR1 enzyme edits the sequence of the reporter transcript in a dose-dependent manner. HEK 293T cells were transfected with the reporter plasmid, along with increasing amounts of HA-tagged ADAR1 (0, 0.2, 0.4, and 0.8 μg). At 24 h after transfection, A-to-I-editing activity was assessed by Western blot analysis using antibodies against HA and mCherry. (C) The effect of OV20.0 on ADAR1-mediated A-to-I editing. HEK 293T cells were cotransfected with the mCherry reporter plasmid and HA-tagged ADAR1 alone or with FLAG-tagged OV20.0 for 24 h. (D) The effect of OV20.0 on A-to-I-editing activity was measured based on the ratio of edited to the total of unedited plus edited products with increasing amounts of OV20.0 (as labeled) in the presence of ADAR1. The experiment was conducted with three independent repeats. **, P

Techniques Used: Activity Assay, Sequencing, Transfection, Plasmid Preparation, Western Blot, Labeling

26) Product Images from "Pannexin 1 Regulates Dendritic Protrusion Dynamics in Immature Cortical Neurons"

Article Title: Pannexin 1 Regulates Dendritic Protrusion Dynamics in Immature Cortical Neurons

Journal: eNeuro

doi: 10.1523/ENEURO.0079-20.2020

PANX1-EGFP expression rescued the increase in dendritic protrusion density associated with Panx1 KO. A , Representative maximum intensity projections of WT and Panx1 KO cultured cortical neurons transfected with mCherry-CD9-10 and either EGFP ( Ai ) or PANX1-EGFP ( Aii ) as well as cropped images of their respective dendritic segments from a primary neurite. Scale bars: 50 and 5 µm. B , Effect of PANX1 expression on dendritic protrusion density and length in developing cortical neurons transfected with mCherry-CD9-10 and either EGFP or PANX1-EGFP using Cumming estimation plots. Bi , With EGFP expression, dendritic protrusion density was higher with Panx1 KO neurons (WT-EGFP: 12.0 ± 0.3 dendritic protrusions per 10 µm; Panx1 KO-EGFP: 14.4 ± 0.5 dendritic protrusions per 10 µm, p = 0.03517, two-way ANOVA with Bonferroni’s multiple comparison test b1 ). With PANX1-EGFP expression, dendritic protrusion density was decreased in both WT and Panx1 KO neurons (WT-PANX1-EGFP: 8.8 ± 0.5 dendritic protrusions per 10 µm, p = 0.00268; Panx1 KO PANX1-EGFP: 8.3 ± 0.8 dendritic protrusions per 10 µm, p
Figure Legend Snippet: PANX1-EGFP expression rescued the increase in dendritic protrusion density associated with Panx1 KO. A , Representative maximum intensity projections of WT and Panx1 KO cultured cortical neurons transfected with mCherry-CD9-10 and either EGFP ( Ai ) or PANX1-EGFP ( Aii ) as well as cropped images of their respective dendritic segments from a primary neurite. Scale bars: 50 and 5 µm. B , Effect of PANX1 expression on dendritic protrusion density and length in developing cortical neurons transfected with mCherry-CD9-10 and either EGFP or PANX1-EGFP using Cumming estimation plots. Bi , With EGFP expression, dendritic protrusion density was higher with Panx1 KO neurons (WT-EGFP: 12.0 ± 0.3 dendritic protrusions per 10 µm; Panx1 KO-EGFP: 14.4 ± 0.5 dendritic protrusions per 10 µm, p = 0.03517, two-way ANOVA with Bonferroni’s multiple comparison test b1 ). With PANX1-EGFP expression, dendritic protrusion density was decreased in both WT and Panx1 KO neurons (WT-PANX1-EGFP: 8.8 ± 0.5 dendritic protrusions per 10 µm, p = 0.00268; Panx1 KO PANX1-EGFP: 8.3 ± 0.8 dendritic protrusions per 10 µm, p

Techniques Used: Expressing, Cell Culture, Transfection

PANX1 increased dendritic protrusion turnover and overall movement. A , Representative color-coded outlines of WT and Panx1 KO neurons transfected with mCherry-CD9-10 and either EGFP or PANX1-EGFP showing examples of dendritic protrusion movement (arrowheads). These examples are cropped from the full regions of analysis from primary neurites. B , Cumming estimation plots of dendritic protrusion second order metrics: survival fraction, turnover, and overall change in movement (Δmovement). Bi , Transient PANX1 expression in WT and Panx1 KO neurons decreased the survival fraction of dendritic protrusions; however, this was only statistically significant in Panx1 KO neurons (WT-EGFP: 94.5 ± 1.2%; WT-PANX1-EGFP: 91.1 ± 1.9%, p = 0.2034 d1 ; PANX1-EGFP: 97.7 ± 0.5%; Panx1 KO-PANX1-EGFP: 87.3 ± 1.9%, p = 0.00028, Kruskal–Wallis test d1 ). Bii , In the EGFP-control-expressing group, dendritic protrusion turnover was reduced in Panx1 KO neurons (WT-EGFP: 7.5% ± 1.3; PANX1-EGFP: 3.1 ± 0.6%, p = 0.0092, Kruskal–Wallis test d2 ). Transient expression of PANX1 significantly increased dendritic protrusion turnover in Panx1 KO neurons but not in WT neurons (WT-PANX1-EGFP: 14.2 ± 3.3%, p > 0.9999; Panx1 KO-PANX1-EGFP: 15.6 ± 2.34%, p = 0.0027, Kruskal–Wallis test d2 ). Biii , Dendritic protrusion overall movement change (Δmovement) was reduced in Panx1 KO neurons (WT-EGFP: 28 ± 2.8%; KO-EGFP: 10.3 ± 1.5%, p
Figure Legend Snippet: PANX1 increased dendritic protrusion turnover and overall movement. A , Representative color-coded outlines of WT and Panx1 KO neurons transfected with mCherry-CD9-10 and either EGFP or PANX1-EGFP showing examples of dendritic protrusion movement (arrowheads). These examples are cropped from the full regions of analysis from primary neurites. B , Cumming estimation plots of dendritic protrusion second order metrics: survival fraction, turnover, and overall change in movement (Δmovement). Bi , Transient PANX1 expression in WT and Panx1 KO neurons decreased the survival fraction of dendritic protrusions; however, this was only statistically significant in Panx1 KO neurons (WT-EGFP: 94.5 ± 1.2%; WT-PANX1-EGFP: 91.1 ± 1.9%, p = 0.2034 d1 ; PANX1-EGFP: 97.7 ± 0.5%; Panx1 KO-PANX1-EGFP: 87.3 ± 1.9%, p = 0.00028, Kruskal–Wallis test d1 ). Bii , In the EGFP-control-expressing group, dendritic protrusion turnover was reduced in Panx1 KO neurons (WT-EGFP: 7.5% ± 1.3; PANX1-EGFP: 3.1 ± 0.6%, p = 0.0092, Kruskal–Wallis test d2 ). Transient expression of PANX1 significantly increased dendritic protrusion turnover in Panx1 KO neurons but not in WT neurons (WT-PANX1-EGFP: 14.2 ± 3.3%, p > 0.9999; Panx1 KO-PANX1-EGFP: 15.6 ± 2.34%, p = 0.0027, Kruskal–Wallis test d2 ). Biii , Dendritic protrusion overall movement change (Δmovement) was reduced in Panx1 KO neurons (WT-EGFP: 28 ± 2.8%; KO-EGFP: 10.3 ± 1.5%, p

Techniques Used: Transfection, Expressing

Detection of dendritic protrusions in cortical neurons was improved with a membrane-bound fluorescent marker. A , Representative maximum intensity projection of a dendritic segment from a neuron transfected with mCherry-CD9-10 and EGFP at DIV6 and fixed at DIV10. Thin and long dendritic protrusions are more clearly visualized with mCherry-CD9-10 (mid) than the cytoplasmic volume marker EGFP (bottom). Structures not clearly labeled with EGFP are denoted by *, and those missed entirely are denoted with arrowheads. B , Slopegraph showing the quantification of dendritic protrusions detected using the mCherry-CD9-10 signal compared with the EGFP signal. On average, 34% of dendritic protrusions detected with mCherry-CD9-10 were missed in the EGFP channel (EGFP: 72 ± 5.9 dendritic protrusion; mCherry-CD9-10: 110 ± 9.7 dendritic protrusions; p = 0.00384, Student’s t test; N = 12 neurons, 6 WT and 6 Panx1 KO a1 ). C , The interobserver variability was evaluated with Pearson’s correlation and found to be R 2 = 0.95 (95CI 0.84–0.98, p = 5.1e −08 ) a2 . d.p., dendritic protrusion; **
Figure Legend Snippet: Detection of dendritic protrusions in cortical neurons was improved with a membrane-bound fluorescent marker. A , Representative maximum intensity projection of a dendritic segment from a neuron transfected with mCherry-CD9-10 and EGFP at DIV6 and fixed at DIV10. Thin and long dendritic protrusions are more clearly visualized with mCherry-CD9-10 (mid) than the cytoplasmic volume marker EGFP (bottom). Structures not clearly labeled with EGFP are denoted by *, and those missed entirely are denoted with arrowheads. B , Slopegraph showing the quantification of dendritic protrusions detected using the mCherry-CD9-10 signal compared with the EGFP signal. On average, 34% of dendritic protrusions detected with mCherry-CD9-10 were missed in the EGFP channel (EGFP: 72 ± 5.9 dendritic protrusion; mCherry-CD9-10: 110 ± 9.7 dendritic protrusions; p = 0.00384, Student’s t test; N = 12 neurons, 6 WT and 6 Panx1 KO a1 ). C , The interobserver variability was evaluated with Pearson’s correlation and found to be R 2 = 0.95 (95CI 0.84–0.98, p = 5.1e −08 ) a2 . d.p., dendritic protrusion; **

Techniques Used: Marker, Transfection, Labeling

Novel methods for measurement of dendritic protrusion dynamics in living neurons. Ten-minute time lapses were acquired by imaging dendrite segments from cortical neurons every 5 s. Note that this a DIV10 WT cortical neuron transfected with mCherry-CD9-10 and PANX1-EGFP; only mCherry-CD9-10 is shown. The dimensionality of these recordings was reduced by creating maximum z -projections. Images were thresholded to create outlines ( A ; scale bar: 10 µm), which were temporally color coded ( B ; scale bar: 10 µm), allowing the visualization of various events, such as the percentage of dendritic protrusion (relative to time 0) undergoing formation ( de novo appearance), elimination (complete disappearance by the end of the time lapse), lability (appearance and disappearance by the end of the time lapse), and motility (incomplete shrinkage or growth to an existing protrusion) shown in C (scale bar: 2 µm). Note that examples in C (cropped to highlight the event in question with (*) denoting the protrusion events) come from different cultures and different genotypes all at DIV10 transfected with mCherry-CD9-10 and either EGFP or Panx1 -EGFP at DIV6. Note that the example provided here for dendritic protrusion elimination ( † ) in the box in part C comes from the larger neurite depicted in panel B . Also note that the data shown in Figure 4 includes quantification from the examples depicted in this figure. For further details, see Materials and Methods. This figure was modified from the PhD thesis of J.C.S.-A, University of Victoria ( Sanchez-Arias, 2020 ), found at http://hdl.handle.net/1828/11714 .
Figure Legend Snippet: Novel methods for measurement of dendritic protrusion dynamics in living neurons. Ten-minute time lapses were acquired by imaging dendrite segments from cortical neurons every 5 s. Note that this a DIV10 WT cortical neuron transfected with mCherry-CD9-10 and PANX1-EGFP; only mCherry-CD9-10 is shown. The dimensionality of these recordings was reduced by creating maximum z -projections. Images were thresholded to create outlines ( A ; scale bar: 10 µm), which were temporally color coded ( B ; scale bar: 10 µm), allowing the visualization of various events, such as the percentage of dendritic protrusion (relative to time 0) undergoing formation ( de novo appearance), elimination (complete disappearance by the end of the time lapse), lability (appearance and disappearance by the end of the time lapse), and motility (incomplete shrinkage or growth to an existing protrusion) shown in C (scale bar: 2 µm). Note that examples in C (cropped to highlight the event in question with (*) denoting the protrusion events) come from different cultures and different genotypes all at DIV10 transfected with mCherry-CD9-10 and either EGFP or Panx1 -EGFP at DIV6. Note that the example provided here for dendritic protrusion elimination ( † ) in the box in part C comes from the larger neurite depicted in panel B . Also note that the data shown in Figure 4 includes quantification from the examples depicted in this figure. For further details, see Materials and Methods. This figure was modified from the PhD thesis of J.C.S.-A, University of Victoria ( Sanchez-Arias, 2020 ), found at http://hdl.handle.net/1828/11714 .

Techniques Used: Imaging, Transfection, Modification

Metrics of dendritic protrusion dynamics correlated with PANX1 expression levels. A , Representative color-coded outlines of WT and Panx1 KO neurons transfected with mCherry-CD9-10 and either EGFP or Panx1 -EGFP showing examples of dendritic protrusion formation, elimination, lability, and motility events (arrowheads). These examples are cropped from the full regions of analysis from primary neurites. B , Effect of PANX1 expression on dendritic protrusion formation, elimination, lability, and motility in WT and Panx1 KO using Cumming estimation plots. Bi , Dendritic protrusion formation was significantly higher in Panx1 KO neurons transiently expressing PANX1-EGFP compared with those expressing EGFP (KO-EGFP: 0.2 ± 0.1%, KO-PANX1-EGFP: 4.6 ± 1.3%, p = 0.0028, Kruskal–Wallis test c1 ). No significant differences were observed between genotypes in EGFP-expressing neurons (WT-EGFP: 1.7 ± 0.7%; Panx1 KO-EGFP: 0.2 ± 0.1%, p = 0.2267, Kruskal–Wallis test c1 ). Bii , Similarly, only transient expression of PANX1-EGFP in Panx1 KO neurons increased dendritic protrusion elimination (KO-EGFP: 0.3 ± 0.15%; KO-PANX1-EGFP: 4.6 ± 1.28%, p = 0.00024, Kruskal–Wallis test c2 ). No significant differences were found between EGFP and PANX1-EGFP expressing WT cells ( p = 0.62307 c2 ). Biii , Dendritic protrusion lability was higher in Panx1 KO neurons transfected with PANX1-EGFP (KO-EGFP: 2.1 ± 0.5%; KO-PANX1-EGFP: 9.4 ± 1.7%, p = 0.0034, Kruskal–Wallis test c3 ), beyond that observed in WT expressing EGFP control ( p = 0.0291, Kruskal–Wallis test c3 ). Transient expression of PANX1-EGFP in WT neurons had no significant effects ( p > 0.9999 c3 ). Biv , Dendritic protrusion motility was significantly reduced in Panx1 KO neuron expressing EGFP control (WT-EGFP: 20.5 ± 2.3%; KO-EGFP: 7.2 ± 1.3%, p = 0.00016, Kruskal–Wallis test c4 ). Transient PANX1-EGFP expression increased dendritic protrusion motility in Panx1 KO neurons only (KO-PANX1-EGFP: 17.4 ± 2.8%, p = 0.03582, Kruskal–Wallis test c4 ). N = cells, all analyzed cells were obtained from three independent cultures. Effect sizes are reported in the main text and Table 2 . Red arrowheads on the y -axis on the bottom panel of Cumming estimation plots represent WT-EGFP means. d.p., dendritic protrusion; ***
Figure Legend Snippet: Metrics of dendritic protrusion dynamics correlated with PANX1 expression levels. A , Representative color-coded outlines of WT and Panx1 KO neurons transfected with mCherry-CD9-10 and either EGFP or Panx1 -EGFP showing examples of dendritic protrusion formation, elimination, lability, and motility events (arrowheads). These examples are cropped from the full regions of analysis from primary neurites. B , Effect of PANX1 expression on dendritic protrusion formation, elimination, lability, and motility in WT and Panx1 KO using Cumming estimation plots. Bi , Dendritic protrusion formation was significantly higher in Panx1 KO neurons transiently expressing PANX1-EGFP compared with those expressing EGFP (KO-EGFP: 0.2 ± 0.1%, KO-PANX1-EGFP: 4.6 ± 1.3%, p = 0.0028, Kruskal–Wallis test c1 ). No significant differences were observed between genotypes in EGFP-expressing neurons (WT-EGFP: 1.7 ± 0.7%; Panx1 KO-EGFP: 0.2 ± 0.1%, p = 0.2267, Kruskal–Wallis test c1 ). Bii , Similarly, only transient expression of PANX1-EGFP in Panx1 KO neurons increased dendritic protrusion elimination (KO-EGFP: 0.3 ± 0.15%; KO-PANX1-EGFP: 4.6 ± 1.28%, p = 0.00024, Kruskal–Wallis test c2 ). No significant differences were found between EGFP and PANX1-EGFP expressing WT cells ( p = 0.62307 c2 ). Biii , Dendritic protrusion lability was higher in Panx1 KO neurons transfected with PANX1-EGFP (KO-EGFP: 2.1 ± 0.5%; KO-PANX1-EGFP: 9.4 ± 1.7%, p = 0.0034, Kruskal–Wallis test c3 ), beyond that observed in WT expressing EGFP control ( p = 0.0291, Kruskal–Wallis test c3 ). Transient expression of PANX1-EGFP in WT neurons had no significant effects ( p > 0.9999 c3 ). Biv , Dendritic protrusion motility was significantly reduced in Panx1 KO neuron expressing EGFP control (WT-EGFP: 20.5 ± 2.3%; KO-EGFP: 7.2 ± 1.3%, p = 0.00016, Kruskal–Wallis test c4 ). Transient PANX1-EGFP expression increased dendritic protrusion motility in Panx1 KO neurons only (KO-PANX1-EGFP: 17.4 ± 2.8%, p = 0.03582, Kruskal–Wallis test c4 ). N = cells, all analyzed cells were obtained from three independent cultures. Effect sizes are reported in the main text and Table 2 . Red arrowheads on the y -axis on the bottom panel of Cumming estimation plots represent WT-EGFP means. d.p., dendritic protrusion; ***

Techniques Used: Expressing, Transfection

27) Product Images from "Dual single-scission event analysis of constitutive transferrin receptor (TfR) endocytosis and ligand-triggered β2-adrenergic receptor (β2AR) or Mu-opioid receptor (MOR) endocytosis"

Article Title: Dual single-scission event analysis of constitutive transferrin receptor (TfR) endocytosis and ligand-triggered β2-adrenergic receptor (β2AR) or Mu-opioid receptor (MOR) endocytosis

Journal: Molecular Biology of the Cell

doi: 10.1091/mbc.E14-06-1112

Lifetimes analysis of clathrin spots. (A) Example fluorescence traces for Mu2-mCherry (magenta) and phl-β2AR (green) for CCSs that hosted one, two, and seven scission events, respectively (arrows). (B) Histogram of the number of scission events detected per punctate CCS. A significant proportion (∼20%) of punctate CCSs hosted more than one scission event. (C) Histogram of the time between CCS nucleation and the first detected scission event for β2AR (median lifetime, 119.6 s). (D) The time between CCS nucleation and the first, second, or third detected scission event for TfR(+) scission events (black circles), β2AR(+) scission events (open circles), or MOR (gray circles) revealed that CCSs matured more slowly when loaded with β2AR or MOR. (E) Lifetimes histograms of punctate CCSs in cells expressing β2AR before challenge (Ei), during challenge (Eii), and after washout (Eiii) of isoproterenol. Eiii insert shows increase in median lifetime of CCS lifetime on isoproteronol challenge for four cells.
Figure Legend Snippet: Lifetimes analysis of clathrin spots. (A) Example fluorescence traces for Mu2-mCherry (magenta) and phl-β2AR (green) for CCSs that hosted one, two, and seven scission events, respectively (arrows). (B) Histogram of the number of scission events detected per punctate CCS. A significant proportion (∼20%) of punctate CCSs hosted more than one scission event. (C) Histogram of the time between CCS nucleation and the first detected scission event for β2AR (median lifetime, 119.6 s). (D) The time between CCS nucleation and the first, second, or third detected scission event for TfR(+) scission events (black circles), β2AR(+) scission events (open circles), or MOR (gray circles) revealed that CCSs matured more slowly when loaded with β2AR or MOR. (E) Lifetimes histograms of punctate CCSs in cells expressing β2AR before challenge (Ei), during challenge (Eii), and after washout (Eiii) of isoproterenol. Eiii insert shows increase in median lifetime of CCS lifetime on isoproteronol challenge for four cells.

Techniques Used: Fluorescence, Expressing

Discrete, quantized scission events internalized β2AR at clathrin spots and plaques. (A) An example HEK293 cell expressing the CCS marker Mu2-mCherry (magenta) and phl-β2AR (green) before (top) and after (bottom) challenge with isoproterenol. In this particular cell, CCSs appeared as discrete punctae and larger rosette-like plaques. (Bi) After challenge with isoproterenol, phl-β2AR was concentrated at both types of CCS, and discrete scission events were detected at either type of structure. (Bii) A map of detected scission events (red crosses) overlaid on an inverted image of Mu2-mCherry (black). Scission events were detected at both punctate CCSs and larger clathrin plaques. (C) Density scatterplot of Mu2-mCherry object area (ordinate) vs. newly scissioned phl-β2AR object area (abscissa). The fluorescence objects marking scission events are always spots but may colocalize to punctate or plaque-like CCSs. (D) Aligned and average fluorescence traces for Mu2-mCherry fluorescence at terminal punctate (black circles), nonterminal punctate (red circles), or plaque-like CCSs (open circles). All types of CCS show a drop in fluorescence after scission corresponding to CCV uncoating but differ in the persistence of fluorescence signal after scission.
Figure Legend Snippet: Discrete, quantized scission events internalized β2AR at clathrin spots and plaques. (A) An example HEK293 cell expressing the CCS marker Mu2-mCherry (magenta) and phl-β2AR (green) before (top) and after (bottom) challenge with isoproterenol. In this particular cell, CCSs appeared as discrete punctae and larger rosette-like plaques. (Bi) After challenge with isoproterenol, phl-β2AR was concentrated at both types of CCS, and discrete scission events were detected at either type of structure. (Bii) A map of detected scission events (red crosses) overlaid on an inverted image of Mu2-mCherry (black). Scission events were detected at both punctate CCSs and larger clathrin plaques. (C) Density scatterplot of Mu2-mCherry object area (ordinate) vs. newly scissioned phl-β2AR object area (abscissa). The fluorescence objects marking scission events are always spots but may colocalize to punctate or plaque-like CCSs. (D) Aligned and average fluorescence traces for Mu2-mCherry fluorescence at terminal punctate (black circles), nonterminal punctate (red circles), or plaque-like CCSs (open circles). All types of CCS show a drop in fluorescence after scission corresponding to CCV uncoating but differ in the persistence of fluorescence signal after scission.

Techniques Used: Expressing, Marker, Fluorescence

28) Product Images from "The Hob proteins are novel and conserved lipid binding proteins at ER-PM contact sites"

Article Title: The Hob proteins are novel and conserved lipid binding proteins at ER-PM contact sites

Journal: bioRxiv

doi: 10.1101/2021.03.02.433623

The C-terminus of Hobbit is required for localization to ER-PM contact sites. (A) Live-cell imaging of constitutively-active Stim (Stim DDAA -GFP) in control and hobbit mutant salivary gland cells at the onset of metamorphosis (0 h after puparium formation, PF) shows that this protein localizes to puncta at the plasma membrane. Top images show a maximum intensity projection of 20 optical slices from a z-stack comprising 71 total slices (control) or 57 total slices ( hobbit mutant) at a 0.36 µm step size. Bottom images show a transverse section from the z-stacks shown above. Full genotypes-control: UAS-Stim DDAA -GFP/+; Sgs3 > /+ and hobbit mutant: UAS-Stim DDAA -GFP/+; hob 2 , Sgs3 > / hob 3 . (B) Live-cell imaging of constitutively-active Stim (Stim DDAA -GFP, cyan) and full-length Hobbit (Hobbit-mCherry, magenta) in wandering L3 (wL3) salivary glands shows that Hobbit and constitutively-active Stim co-localize at ER-PM contact sites. Top images show a maximum intensity projection of 10 optical slices from a z-stack comprising 31 total slices at a 0.36 µm step size. Bottom images show a transverse section from the z-stacks shown above. Full genotype: UAS-Stim DDAA -GFP/+; Sgs3 > hob-mCherry/+ . (C) Live-cell imaging of constitutively-active Stim (Stim DDAA -GFP, cyan) and C-terminally truncated Hobbit (HobbitΔC82-mCherry, magenta) in wandering L3 (wL3) salivary glands shows that HobbitΔC82 no longer localizes to ER-PM contact sites. Top images show a maximum intensity projection of 10 optical slices from a z-stack comprising 31 total slices at a 0.35 µm step size. Bottom images show a transverse section from the z-stacks shown above. Full genotype: UAS-Stim DDAA -GFP/+; Sgs3 > hobΔC82-mCherry/+ . Scale bars: 5 µm.
Figure Legend Snippet: The C-terminus of Hobbit is required for localization to ER-PM contact sites. (A) Live-cell imaging of constitutively-active Stim (Stim DDAA -GFP) in control and hobbit mutant salivary gland cells at the onset of metamorphosis (0 h after puparium formation, PF) shows that this protein localizes to puncta at the plasma membrane. Top images show a maximum intensity projection of 20 optical slices from a z-stack comprising 71 total slices (control) or 57 total slices ( hobbit mutant) at a 0.36 µm step size. Bottom images show a transverse section from the z-stacks shown above. Full genotypes-control: UAS-Stim DDAA -GFP/+; Sgs3 > /+ and hobbit mutant: UAS-Stim DDAA -GFP/+; hob 2 , Sgs3 > / hob 3 . (B) Live-cell imaging of constitutively-active Stim (Stim DDAA -GFP, cyan) and full-length Hobbit (Hobbit-mCherry, magenta) in wandering L3 (wL3) salivary glands shows that Hobbit and constitutively-active Stim co-localize at ER-PM contact sites. Top images show a maximum intensity projection of 10 optical slices from a z-stack comprising 31 total slices at a 0.36 µm step size. Bottom images show a transverse section from the z-stacks shown above. Full genotype: UAS-Stim DDAA -GFP/+; Sgs3 > hob-mCherry/+ . (C) Live-cell imaging of constitutively-active Stim (Stim DDAA -GFP, cyan) and C-terminally truncated Hobbit (HobbitΔC82-mCherry, magenta) in wandering L3 (wL3) salivary glands shows that HobbitΔC82 no longer localizes to ER-PM contact sites. Top images show a maximum intensity projection of 10 optical slices from a z-stack comprising 31 total slices at a 0.35 µm step size. Bottom images show a transverse section from the z-stacks shown above. Full genotype: UAS-Stim DDAA -GFP/+; Sgs3 > hobΔC82-mCherry/+ . Scale bars: 5 µm.

Techniques Used: Live Cell Imaging, Mutagenesis

Fmp27 localizes to ER-PM contact sites. (A) Live-cell imaging of endogenously tagged Fmp27-GFP (green) shows that Fmp27 is enriched in puncta at the cell cortex that co-localize with RFP-HDEL (magenta), a pan- ER marker. RFP-HDEL is expressed from a plasmid. (B) Live-cell imaging of Fmp27-GFP (green) with the ER-PM tether Tcb3-mCherry (magenta) confirms that Fmp27 is enriched at ER-PM contact sites. (C) Live-cell imaging of endogenously tagged Fmp27-GFP (green) in the Δtether background with RFP-HDEL (magenta) shows that Fmp27 localizes to collapsed ER upon loss of ER-PM tethers. RFP-HDEL is expressed from a plasmid.
Figure Legend Snippet: Fmp27 localizes to ER-PM contact sites. (A) Live-cell imaging of endogenously tagged Fmp27-GFP (green) shows that Fmp27 is enriched in puncta at the cell cortex that co-localize with RFP-HDEL (magenta), a pan- ER marker. RFP-HDEL is expressed from a plasmid. (B) Live-cell imaging of Fmp27-GFP (green) with the ER-PM tether Tcb3-mCherry (magenta) confirms that Fmp27 is enriched at ER-PM contact sites. (C) Live-cell imaging of endogenously tagged Fmp27-GFP (green) in the Δtether background with RFP-HDEL (magenta) shows that Fmp27 localizes to collapsed ER upon loss of ER-PM tethers. RFP-HDEL is expressed from a plasmid.

Techniques Used: Live Cell Imaging, Marker, Plasmid Preparation

ER-PM localization is required for hobbit function. (A) Images of control ( w 1118 ), homozygous hob 3 , and homozygous hob 5 pupae shows that hob 5 mutant animals display the same small body size as hob 3 mutant animals. (B) Live-cell imaging of mucins in control, homozygous hob 5 , and hobΔC82 rescue salivary glands dissected from prepupal animals shows that mucins are secreted in controls but not in hob 5 or hobΔC82 rescue animals. Full genotypes-control: Sgs3-GFP/+. hob 5 : Sgs3-GFP/+; hob 5 /hob 5 . hobΔC82 rescue: Sgs3-GFP/+; hob 2 , UAS-hobΔC82-mCherry; hob 3 , act > . (C) Body size quantification and lethal phase analysis for control ( w 1118 ), hobΔN117-GFP rescue ( hob 2 , UAS-hobΔN117-GFP/hob 3 , act > ), hobΔC82-GFP rescue ( hob 2 , UAS-hobΔC82-GFP/ hob 3 , act > ), hob-mCherry rescue control ( hob 2 /hob 3 , UAS-hob-mCherry ), and hob-mCherry rescue ( hob 2 , act > /hob 3 , UAS-hob-mCherry ) shows that ubiquitous overexpression of neither N-nor C-terminal truncation of Hobbit rescues the small body size or lethality of hobbit mutant animals. In contrast, ubiquitous overexpression of full-length Hobbit-mCherry fully rescues the small body size and lethality of hobbit mutant animals. Body size quantified by pupa volume expressed as a percentage relative to control (100%). Data shown as mean +/- S.E.M. n= 100 animals per genotype. Note that the three pupae on the left were captured in a different image from the two on the right; both were imaged at the same magnification. PP: Prepupa; P/iP: Pupa/incomplete Pupa; PA: Pharate Adult; A: Adult. Scale bar in (B): 10 µm.
Figure Legend Snippet: ER-PM localization is required for hobbit function. (A) Images of control ( w 1118 ), homozygous hob 3 , and homozygous hob 5 pupae shows that hob 5 mutant animals display the same small body size as hob 3 mutant animals. (B) Live-cell imaging of mucins in control, homozygous hob 5 , and hobΔC82 rescue salivary glands dissected from prepupal animals shows that mucins are secreted in controls but not in hob 5 or hobΔC82 rescue animals. Full genotypes-control: Sgs3-GFP/+. hob 5 : Sgs3-GFP/+; hob 5 /hob 5 . hobΔC82 rescue: Sgs3-GFP/+; hob 2 , UAS-hobΔC82-mCherry; hob 3 , act > . (C) Body size quantification and lethal phase analysis for control ( w 1118 ), hobΔN117-GFP rescue ( hob 2 , UAS-hobΔN117-GFP/hob 3 , act > ), hobΔC82-GFP rescue ( hob 2 , UAS-hobΔC82-GFP/ hob 3 , act > ), hob-mCherry rescue control ( hob 2 /hob 3 , UAS-hob-mCherry ), and hob-mCherry rescue ( hob 2 , act > /hob 3 , UAS-hob-mCherry ) shows that ubiquitous overexpression of neither N-nor C-terminal truncation of Hobbit rescues the small body size or lethality of hobbit mutant animals. In contrast, ubiquitous overexpression of full-length Hobbit-mCherry fully rescues the small body size and lethality of hobbit mutant animals. Body size quantified by pupa volume expressed as a percentage relative to control (100%). Data shown as mean +/- S.E.M. n= 100 animals per genotype. Note that the three pupae on the left were captured in a different image from the two on the right; both were imaged at the same magnification. PP: Prepupa; P/iP: Pupa/incomplete Pupa; PA: Pharate Adult; A: Adult. Scale bar in (B): 10 µm.

Techniques Used: Mutagenesis, Live Cell Imaging, Over Expression

29) Product Images from "HLA-C-restricted presentation of a conserved bacterial epitope to an innate NK cell receptor"

Article Title: HLA-C-restricted presentation of a conserved bacterial epitope to an innate NK cell receptor

Journal: bioRxiv

doi: 10.1101/550889

Retroviral transduction of 221–C*05:01 cells with plasmids encoding P2-AV and P2-AW. (A) The plasmid encoding P2-AW includes a signal peptide sequence fused to P2-AW. Arrows indicate translation start site, TAA = stop codon, IRES = internal ribosomal entry sequence. (B) Expression of mCherry in in 221-C*05:01 cells after transduction with P2-AV and P2-AW expressing plasmids.
Figure Legend Snippet: Retroviral transduction of 221–C*05:01 cells with plasmids encoding P2-AV and P2-AW. (A) The plasmid encoding P2-AW includes a signal peptide sequence fused to P2-AW. Arrows indicate translation start site, TAA = stop codon, IRES = internal ribosomal entry sequence. (B) Expression of mCherry in in 221-C*05:01 cells after transduction with P2-AV and P2-AW expressing plasmids.

Techniques Used: Transduction, Plasmid Preparation, Sequencing, Expressing

30) Product Images from "MFF-dependent mitochondrial fission regulates presynaptic release and axon branching by limiting axonal mitochondria size"

Article Title: MFF-dependent mitochondrial fission regulates presynaptic release and axon branching by limiting axonal mitochondria size

Journal: Nature Communications

doi: 10.1038/s41467-018-07416-2

Elongated mitochondria in Mff knockdown axons uptake more Ca 2+ upon evoked neurotransmitter release from presynaptic sites. Presynaptic mitochondrial Ca 2+ was monitored using mitochondria-targeted GCaMP5G (mt-GCaMP5G) with VGLUT1-mCherry and mt-mTAGBFP2 in cortical cultured neurons following EUE at E15.5 and imaged at 17-23DIV. a , b Cropped time-lapse images of mt-GCaMP5G with repetitive stimulation (20AP at 10 Hz) in control and Mff knockdown axons. Mitochondrial Ca 2+ diffuses along elongated mitochondria from a presynaptic site in an Mff knockdown axon (See Supplementary Fig. 6 and Supplementary Movie 4 ) and extrudes faster than small mitochondria. c Integrated intensity of mt-GCaMP5G signals from full-length mitochondria associated with single presynaptic sites is plotted with mean ± sem. d Quantification of [Ca 2+ ] mt (area under the curve) show long mitochondria with a single presynaptic bouton in Mff knockdown axons accumulate significantly more [Ca 2+ ] mt than small mitochondria in control axons. * p
Figure Legend Snippet: Elongated mitochondria in Mff knockdown axons uptake more Ca 2+ upon evoked neurotransmitter release from presynaptic sites. Presynaptic mitochondrial Ca 2+ was monitored using mitochondria-targeted GCaMP5G (mt-GCaMP5G) with VGLUT1-mCherry and mt-mTAGBFP2 in cortical cultured neurons following EUE at E15.5 and imaged at 17-23DIV. a , b Cropped time-lapse images of mt-GCaMP5G with repetitive stimulation (20AP at 10 Hz) in control and Mff knockdown axons. Mitochondrial Ca 2+ diffuses along elongated mitochondria from a presynaptic site in an Mff knockdown axon (See Supplementary Fig. 6 and Supplementary Movie 4 ) and extrudes faster than small mitochondria. c Integrated intensity of mt-GCaMP5G signals from full-length mitochondria associated with single presynaptic sites is plotted with mean ± sem. d Quantification of [Ca 2+ ] mt (area under the curve) show long mitochondria with a single presynaptic bouton in Mff knockdown axons accumulate significantly more [Ca 2+ ] mt than small mitochondria in control axons. * p

Techniques Used: Cell Culture

Presynaptic boutons associated with long mitochondria in MFF-deficient axons show decreased Ca 2+ accumulation and reduced evoked neurotransmitter release. a – e Presynaptic Ca 2+ dynamics in Mff knockdown cortical neurons were monitored using VGLUT1-GCaMP5G with mt-mTAGBFP2 and VGLUT1-mCherry at 17-23DIV. a Representative images show VGLUT1-GCaMP5G peak at 20APs (10 Hz) and mt-mTAGBFP2. VGLUT1-GCaMP5G is displayed by ratio view normalized (Δ F / F max ) by F max values obtained following ionomycin (5 µM) treatment at the end of each imaging session. b – e Presynaptic boutons from MFF-deficient neurons have significantly decreased peak value and total charge transfer (area under the curve), while F max values are not different. All images were recorded using the same capturing condition. All graphs are represented with mean ± sem. n control = 9 dishes, 38 boutons; n MFF shRNA = 11 dishes, 24 boutons. p = 0.001 for peak, p = 0.018 for area, Mann–Whitney test. f – i Presynaptic release properties linked to long mitochondria were monitored using synaptophysin-pHluorin (sypH) and mt-mTagBFP2 in cultured neurons at 20-23DIV. f Representative images of sypH peak normalized by F max obtained during NH 4 Cl (50 mM) incubation. g – i Presynaptic release associated with long mitochondria in Mff knockdown axons is significantly reduced during 20APs (10 Hz) compared to non-knockdown neurons. Quantification of SypH peak normalize values (Δ F /( F max – F 0 )) show significantly reduced neurotransmitter vesicle exocytosis during stimulation of presynaptic release with 20AP at 10 Hz, although total synaptic vesicle pool size ( F max ) is not significantly altered. All images were recorded using the same capturing condition. All graphs are represented with mean ± sem. n control = 16 dishes, 47 boutons; n MFF shRNA = 24 dishes, 33 boutons. p = 0.0037, Unpaired t -test. Scale bars represent the following lengths: 5 µm
Figure Legend Snippet: Presynaptic boutons associated with long mitochondria in MFF-deficient axons show decreased Ca 2+ accumulation and reduced evoked neurotransmitter release. a – e Presynaptic Ca 2+ dynamics in Mff knockdown cortical neurons were monitored using VGLUT1-GCaMP5G with mt-mTAGBFP2 and VGLUT1-mCherry at 17-23DIV. a Representative images show VGLUT1-GCaMP5G peak at 20APs (10 Hz) and mt-mTAGBFP2. VGLUT1-GCaMP5G is displayed by ratio view normalized (Δ F / F max ) by F max values obtained following ionomycin (5 µM) treatment at the end of each imaging session. b – e Presynaptic boutons from MFF-deficient neurons have significantly decreased peak value and total charge transfer (area under the curve), while F max values are not different. All images were recorded using the same capturing condition. All graphs are represented with mean ± sem. n control = 9 dishes, 38 boutons; n MFF shRNA = 11 dishes, 24 boutons. p = 0.001 for peak, p = 0.018 for area, Mann–Whitney test. f – i Presynaptic release properties linked to long mitochondria were monitored using synaptophysin-pHluorin (sypH) and mt-mTagBFP2 in cultured neurons at 20-23DIV. f Representative images of sypH peak normalized by F max obtained during NH 4 Cl (50 mM) incubation. g – i Presynaptic release associated with long mitochondria in Mff knockdown axons is significantly reduced during 20APs (10 Hz) compared to non-knockdown neurons. Quantification of SypH peak normalize values (Δ F /( F max – F 0 )) show significantly reduced neurotransmitter vesicle exocytosis during stimulation of presynaptic release with 20AP at 10 Hz, although total synaptic vesicle pool size ( F max ) is not significantly altered. All images were recorded using the same capturing condition. All graphs are represented with mean ± sem. n control = 16 dishes, 47 boutons; n MFF shRNA = 24 dishes, 33 boutons. p = 0.0037, Unpaired t -test. Scale bars represent the following lengths: 5 µm

Techniques Used: Imaging, shRNA, MANN-WHITNEY, Cell Culture, Incubation

31) Product Images from "miR-1269 Promotes Metastasis and Forms a Positive Feedback Loop with TGF-β"

Article Title: miR-1269 Promotes Metastasis and Forms a Positive Feedback Loop with TGF-β

Journal: Nature communications

doi: 10.1038/ncomms7879

HOXD10 and Smad7 are direct targets of miR-1269a ( a,b ) RT-qPCR of Smad7 (a) and HOXD10 (b) mRNA levels in SW480 and HT29 cells with a control vector (NC) or with an ectopic miR-1269a expression vector (miR-1269a). ( c,d ) Western blot of Smad7 (c) and HOXD10 (d) protein levels in SW480 and HT29 cells with a control vector (NC) or with an ectopic miR-1269a expression vector (miR-1269a). ( e ) Luciferase reporter assays confirming the miR-1269a binding sites in Smad7 and HOXD10 3′UTRs. 3′UTRs of Smad7 (left) and HOXD10 (right) containing wild-type (Wt) or mutated (Mut) putative miR-1269a binding sites were cloned into the 3′UTR of firefly luciferase (Fluc). Ectopic miR-1269a expression in SW480 cells downregulated luciferase in Wt cells, but not in Mut cells. Fluc signals were normalized by a simultaneously delivered Renillar luciferase (Rluc) expression plasmid. ( f ) Transwell migration assay (left) and Matrigel invasion assay (right) of SW480 cells carrying control (NC) or miR-1269a expression (miR-1269a) vectors. Transient expression of HOXD10 abrogated miR-1269a induced migration and invasion. Error bars denote the s.d. between triplicates. ( g,h ) Bright field and fluorescent (mCherry) images of livers isolated from mice orthotopically injected with SW620-NC and SW620-HOXD10 cells (j), and number of liver metastatic nodules (h). Ectopic HOXD10 expression reduced liver metastasis of SW620 cells. Error bars in (h) denote s.d. of each group (8 mice). Scale bar, 8mm. In remaining cases, error bars denote s.d. of triplicates. ***, p
Figure Legend Snippet: HOXD10 and Smad7 are direct targets of miR-1269a ( a,b ) RT-qPCR of Smad7 (a) and HOXD10 (b) mRNA levels in SW480 and HT29 cells with a control vector (NC) or with an ectopic miR-1269a expression vector (miR-1269a). ( c,d ) Western blot of Smad7 (c) and HOXD10 (d) protein levels in SW480 and HT29 cells with a control vector (NC) or with an ectopic miR-1269a expression vector (miR-1269a). ( e ) Luciferase reporter assays confirming the miR-1269a binding sites in Smad7 and HOXD10 3′UTRs. 3′UTRs of Smad7 (left) and HOXD10 (right) containing wild-type (Wt) or mutated (Mut) putative miR-1269a binding sites were cloned into the 3′UTR of firefly luciferase (Fluc). Ectopic miR-1269a expression in SW480 cells downregulated luciferase in Wt cells, but not in Mut cells. Fluc signals were normalized by a simultaneously delivered Renillar luciferase (Rluc) expression plasmid. ( f ) Transwell migration assay (left) and Matrigel invasion assay (right) of SW480 cells carrying control (NC) or miR-1269a expression (miR-1269a) vectors. Transient expression of HOXD10 abrogated miR-1269a induced migration and invasion. Error bars denote the s.d. between triplicates. ( g,h ) Bright field and fluorescent (mCherry) images of livers isolated from mice orthotopically injected with SW620-NC and SW620-HOXD10 cells (j), and number of liver metastatic nodules (h). Ectopic HOXD10 expression reduced liver metastasis of SW620 cells. Error bars in (h) denote s.d. of each group (8 mice). Scale bar, 8mm. In remaining cases, error bars denote s.d. of triplicates. ***, p

Techniques Used: Quantitative RT-PCR, Plasmid Preparation, Expressing, Western Blot, Luciferase, Binding Assay, Clone Assay, Transwell Migration Assay, Invasion Assay, Migration, Isolation, Mouse Assay, Injection

miR-1269a promotes CRC metastasis ( a ) Growth of subcutanous xenograft CRC tumor, as shown by tumor weight (upper panel) and representative tumor images (lower panel), with a control vector (NC) or with ectopic miR-1269a expression (miR-1269a). Error bars denote s.d. of 5 mice in each group. Scale bar, 5mm. ( b,c ) Transwell assay measuring CRC cell migration (b) and invasion (c) with a control vector (NC) or with ectopic miR-1269a expression (miR-1269a). Error bars denote s.d. of triplicates. Scale bar, 50µm. ( d–f ) Analysis of CRC liver metastasis in mice with orthotopic (cecal) injection of SW480-NC and SW480-miR-1269a cells carrying luciferase and mCherry reporter constructs. Representative IVIS luciferase in vivo images (d), bright field and fluorescent (mCherry) images of livers isolated from mice (e), and number of liver metastatic nodules (f) show ectopic miR-1269a expression promoted liver metastasis of SW480 cells. Scale bar, 8mm. ( g–i ) Analysis of CRC liver metastasis in mice with orthotopic (cecal) injection of SW620-Anti-NC and SW620-Anti-miR-1269a cells carrying luciferase and mCherry reporter constructs. Representative IVIS luciferase in vivo images (g), bright field and fluorescent (mCherry) images of livers (h), and number of liver metastatic nodules (i) show knockdown of endogenous miR-1269a by antisense RNA suppressed liver metastasis of SW620 cells. Error bars denote s.d. of 8 mice in each group. Scale bar, 8mm. ( j–k ) H E staining of liver sections isolated from mice orthotopically injected with SW480-NC or SW480-miR-1269a cells (j) or SW6200-Anti-NC or SW620-Anti-miR-1269a cells (k). Error bars denote s.d. of 8 mice in each group. Scale bar, 15 µm. *, p
Figure Legend Snippet: miR-1269a promotes CRC metastasis ( a ) Growth of subcutanous xenograft CRC tumor, as shown by tumor weight (upper panel) and representative tumor images (lower panel), with a control vector (NC) or with ectopic miR-1269a expression (miR-1269a). Error bars denote s.d. of 5 mice in each group. Scale bar, 5mm. ( b,c ) Transwell assay measuring CRC cell migration (b) and invasion (c) with a control vector (NC) or with ectopic miR-1269a expression (miR-1269a). Error bars denote s.d. of triplicates. Scale bar, 50µm. ( d–f ) Analysis of CRC liver metastasis in mice with orthotopic (cecal) injection of SW480-NC and SW480-miR-1269a cells carrying luciferase and mCherry reporter constructs. Representative IVIS luciferase in vivo images (d), bright field and fluorescent (mCherry) images of livers isolated from mice (e), and number of liver metastatic nodules (f) show ectopic miR-1269a expression promoted liver metastasis of SW480 cells. Scale bar, 8mm. ( g–i ) Analysis of CRC liver metastasis in mice with orthotopic (cecal) injection of SW620-Anti-NC and SW620-Anti-miR-1269a cells carrying luciferase and mCherry reporter constructs. Representative IVIS luciferase in vivo images (g), bright field and fluorescent (mCherry) images of livers (h), and number of liver metastatic nodules (i) show knockdown of endogenous miR-1269a by antisense RNA suppressed liver metastasis of SW620 cells. Error bars denote s.d. of 8 mice in each group. Scale bar, 8mm. ( j–k ) H E staining of liver sections isolated from mice orthotopically injected with SW480-NC or SW480-miR-1269a cells (j) or SW6200-Anti-NC or SW620-Anti-miR-1269a cells (k). Error bars denote s.d. of 8 mice in each group. Scale bar, 15 µm. *, p

Techniques Used: Plasmid Preparation, Expressing, Mouse Assay, Transwell Assay, Migration, Injection, Luciferase, Construct, In Vivo, Isolation, Staining

Sox4 activates miR-1269a expression directly ( a ) RT-qPCR showing TGF-β1 treatment induces miR-1269a expression in SW480 cells. ( b ) A schematic diagram illustrating the two putative Sox4 binding sites in the miR-1269a promoter. ( c ) RT-qPCR showing ectopic Sox4 expression upregulates miR-1269a expression in SW480 cells. ( d ) RT-qPCR showing Sox4 knockdown by an shRNA abolishes TGF-β1 induction of miR-1269a. ( e,f ) ChIP assay of SW480 (e) and HT29 (f) cells infected with a control (NC) or a Sox expression (Sox4) vector. Binding of Sox4 to the two sites was confirmed by PCR with primers specific for the two sites. ( g,h ) Luciferase reporter assays confirming Sox4 activation of the miR-1269a promoter through the two Sox4 binding sites in SW480 (g) and HT29 (h) cells. Expression of firefly luciferase (Fluc) was driven by miR-1269a promoter sequences containing either wild-type (Wt) or mutated (Mut1, Mut2) Sox4 binding sites. Ectopic expression of Sox4 upregulates luciferase in Wt cells, but not in Mut1 and Mut2 cells. Fluc signals were normalized by a simultaneously delivered Renillar luciferase (Rluc) expression plasmid. ( i ) ChIP assay of SW480 cells treated with TGF-β1. Sox4 binding to the two sites was confirmed by PCR with primers specific for the two sites. ( j,k ) Bright field and fluorescent (mCherry) images of livers isolated from mice orthotopically injected with SW480-NC and SW480-Sox4 cells (j), and number of liver metastatic nodules. Ectopic Sox4 expression promoted liver metastasis of SW480 cells. Error bars in (k) denote s.d of each group (8 mice). Scale bar, 8mm. In remaining cases, error bars denote s.d. of triplicates. ***, p
Figure Legend Snippet: Sox4 activates miR-1269a expression directly ( a ) RT-qPCR showing TGF-β1 treatment induces miR-1269a expression in SW480 cells. ( b ) A schematic diagram illustrating the two putative Sox4 binding sites in the miR-1269a promoter. ( c ) RT-qPCR showing ectopic Sox4 expression upregulates miR-1269a expression in SW480 cells. ( d ) RT-qPCR showing Sox4 knockdown by an shRNA abolishes TGF-β1 induction of miR-1269a. ( e,f ) ChIP assay of SW480 (e) and HT29 (f) cells infected with a control (NC) or a Sox expression (Sox4) vector. Binding of Sox4 to the two sites was confirmed by PCR with primers specific for the two sites. ( g,h ) Luciferase reporter assays confirming Sox4 activation of the miR-1269a promoter through the two Sox4 binding sites in SW480 (g) and HT29 (h) cells. Expression of firefly luciferase (Fluc) was driven by miR-1269a promoter sequences containing either wild-type (Wt) or mutated (Mut1, Mut2) Sox4 binding sites. Ectopic expression of Sox4 upregulates luciferase in Wt cells, but not in Mut1 and Mut2 cells. Fluc signals were normalized by a simultaneously delivered Renillar luciferase (Rluc) expression plasmid. ( i ) ChIP assay of SW480 cells treated with TGF-β1. Sox4 binding to the two sites was confirmed by PCR with primers specific for the two sites. ( j,k ) Bright field and fluorescent (mCherry) images of livers isolated from mice orthotopically injected with SW480-NC and SW480-Sox4 cells (j), and number of liver metastatic nodules. Ectopic Sox4 expression promoted liver metastasis of SW480 cells. Error bars in (k) denote s.d of each group (8 mice). Scale bar, 8mm. In remaining cases, error bars denote s.d. of triplicates. ***, p

Techniques Used: Expressing, Quantitative RT-PCR, Binding Assay, shRNA, Chromatin Immunoprecipitation, Infection, Plasmid Preparation, Polymerase Chain Reaction, Luciferase, Activation Assay, Isolation, Mouse Assay, Injection

32) Product Images from "Vti1a/b regulate synaptic vesicle and dense core vesicle secretion via protein sorting at the Golgi"

Article Title: Vti1a/b regulate synaptic vesicle and dense core vesicle secretion via protein sorting at the Golgi

Journal: Nature Communications

doi: 10.1038/s41467-018-05699-z

Reduced influx of SNAP25 and DCV cargo into axons in Vti1a/b-deficient neurons. a Representative examples of DIV-5 neurons, in mass cultures, expressing SNAP25-EGFP and the axonal-initial-segment (AIS) marker NaV II/III -mCherry before, after photobleaching and three minutes after photobleaching. Kymographs show SNAP25-EGFP puncta in the AIS photobleached segment. b No differences in SNAP25 puncta velocity in the AIS (DHZ: 1.08 ± 0.10, n = 24; DKO: 0.99 ± 0.04 µm/s, n = 24; Mann–Whitney). c Less SNAP25 puncta enter the AIS in DKO neurons (DHZ: 3.93 ± 0.37, n = 24; DKO: 2.17 ± 0.30 puncta/min, n = 24; t -test). d Representative examples of DIV-5 neurons, in mass cultures, expressing the AIS marker NaV II/III -YFP and NPY-mCherry before, after photobleaching and two minutes after photobleaching. Kymographs show NPY-mCherry puncta in the AIS photobleached segment. e No differences in NPY puncta velocity in the AIS (DHZ: 1.00 ± 0.09, n = 23; DKO: 1.30 ± 0.11, n = 27; DKO + Vti1a: 1.20 ± 0.15, n = 14; DKO + Vti1b: 1.28 ± 0.10 µm/s, n = 15; Wilcoxon). f Less NPY puncta enter the axon in DKO neurons (DHZ: 3.39 ± 0.23, n = 23; DKO: 2.13 ± 0.21, n = 27; DKO + Vti1a: 3.71 ± 0.28, n = 14; DKO + Vti1b: 4.47 ± 0.43 puncta/min, n = 15; Wilcoxon). Bars show mean ± SEM. Bullets and columns represent individual observations and independent litters, respectively. In c and f , some individual observations had the same value and overlapped in the graph. ** p
Figure Legend Snippet: Reduced influx of SNAP25 and DCV cargo into axons in Vti1a/b-deficient neurons. a Representative examples of DIV-5 neurons, in mass cultures, expressing SNAP25-EGFP and the axonal-initial-segment (AIS) marker NaV II/III -mCherry before, after photobleaching and three minutes after photobleaching. Kymographs show SNAP25-EGFP puncta in the AIS photobleached segment. b No differences in SNAP25 puncta velocity in the AIS (DHZ: 1.08 ± 0.10, n = 24; DKO: 0.99 ± 0.04 µm/s, n = 24; Mann–Whitney). c Less SNAP25 puncta enter the AIS in DKO neurons (DHZ: 3.93 ± 0.37, n = 24; DKO: 2.17 ± 0.30 puncta/min, n = 24; t -test). d Representative examples of DIV-5 neurons, in mass cultures, expressing the AIS marker NaV II/III -YFP and NPY-mCherry before, after photobleaching and two minutes after photobleaching. Kymographs show NPY-mCherry puncta in the AIS photobleached segment. e No differences in NPY puncta velocity in the AIS (DHZ: 1.00 ± 0.09, n = 23; DKO: 1.30 ± 0.11, n = 27; DKO + Vti1a: 1.20 ± 0.15, n = 14; DKO + Vti1b: 1.28 ± 0.10 µm/s, n = 15; Wilcoxon). f Less NPY puncta enter the axon in DKO neurons (DHZ: 3.39 ± 0.23, n = 23; DKO: 2.13 ± 0.21, n = 27; DKO + Vti1a: 3.71 ± 0.28, n = 14; DKO + Vti1b: 4.47 ± 0.43 puncta/min, n = 15; Wilcoxon). Bars show mean ± SEM. Bullets and columns represent individual observations and independent litters, respectively. In c and f , some individual observations had the same value and overlapped in the graph. ** p

Techniques Used: Expressing, Marker, MANN-WHITNEY

33) Product Images from "The nuclear structural protein NuMA is a negative regulator of 53BP1 in DNA double-strand break repair"

Article Title: The nuclear structural protein NuMA is a negative regulator of 53BP1 in DNA double-strand break repair

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkz138

NuMA interacts with 53BP1 and regulates 53BP1 kinetics. ( A ) Modeling of GFP-53BP1 diffusion, assuming either a spherical or a rod-shaped structure of the protein. GFP and a fluorescent protein tandem (GFP-mCherry) were used as controls. Time trace simulations are shown with the predicted diffusion times and experimental FCS values (mean ± SEM; n ≥ 15). ( B ) Diffusion of GFP-53BP1 and GFP measured by FCS. U2OS cells were untreated (control), treated with bleomycin (20 mU/ml, 1 h), or exposed to ionizing radiations (IR, 10 Gy and 30 min recovery). n = 50–60 cells from 2 biological replicates; Mann–Whitney test. ( C ) Immunoprecipitation of NuMA from U2OS nuclear extracts (N.E.). Nonspecific immunoglobulins (IgGs) were used as controls. Blots were probed for NuMA and 53BP1. Cells were exposed to IR (10 Gy, and 30 min recovery) or treated with H 2 O 2 (1 mM, 10 min) prior IP. Densitometric quantification of 53BP1 pull down is shown on the graph (mean ± SEM; one sample t-test; n = 4 (IR) or 3 (H 2 O 2 )). In the right panel (H 2 O 2 treatment), all lanes are from the same immunoblot membrane and were taken with the same exposure. Lanes were reassembled for clarity. ( D ) FRET efficacy in U2OS cells expressing NuMA fused to mCherry and either GFP (used as control), GFP-53BP1, or GFP-53BP1 ct (mean ± SD; n = 20–25 cells from at least two experiments; Kruskal–Wallis and Dunn's multiple comparison test). ( E ) Colocalization (arrowheads) between 53BP1 foci and bright NuMA features in immunostaining images of S1 cells treated with bleomycin or untreated (control). Scale bar, 5 μm. Overlap is quantified on the graph (mean ± SEM; n = 10 images from two experiments, corresponding to 300 nuclei per condition; Student's t -test). ( F ) FCS analysis of GFP-53BP1, GFP, and GFP-MeCP2 diffusion. Cells were transfected with nontargeting (NT) or with NuMA-targeting siRNA and were treated with bleomycin as indicated. Statistical analysis with one-way ANOVA and Tukey (GFP-53BP1) or Mann–Whitney tests (GFP and GFP-MeCP2). NuMA silencing was verified by western blot, with lamin B as loading control.
Figure Legend Snippet: NuMA interacts with 53BP1 and regulates 53BP1 kinetics. ( A ) Modeling of GFP-53BP1 diffusion, assuming either a spherical or a rod-shaped structure of the protein. GFP and a fluorescent protein tandem (GFP-mCherry) were used as controls. Time trace simulations are shown with the predicted diffusion times and experimental FCS values (mean ± SEM; n ≥ 15). ( B ) Diffusion of GFP-53BP1 and GFP measured by FCS. U2OS cells were untreated (control), treated with bleomycin (20 mU/ml, 1 h), or exposed to ionizing radiations (IR, 10 Gy and 30 min recovery). n = 50–60 cells from 2 biological replicates; Mann–Whitney test. ( C ) Immunoprecipitation of NuMA from U2OS nuclear extracts (N.E.). Nonspecific immunoglobulins (IgGs) were used as controls. Blots were probed for NuMA and 53BP1. Cells were exposed to IR (10 Gy, and 30 min recovery) or treated with H 2 O 2 (1 mM, 10 min) prior IP. Densitometric quantification of 53BP1 pull down is shown on the graph (mean ± SEM; one sample t-test; n = 4 (IR) or 3 (H 2 O 2 )). In the right panel (H 2 O 2 treatment), all lanes are from the same immunoblot membrane and were taken with the same exposure. Lanes were reassembled for clarity. ( D ) FRET efficacy in U2OS cells expressing NuMA fused to mCherry and either GFP (used as control), GFP-53BP1, or GFP-53BP1 ct (mean ± SD; n = 20–25 cells from at least two experiments; Kruskal–Wallis and Dunn's multiple comparison test). ( E ) Colocalization (arrowheads) between 53BP1 foci and bright NuMA features in immunostaining images of S1 cells treated with bleomycin or untreated (control). Scale bar, 5 μm. Overlap is quantified on the graph (mean ± SEM; n = 10 images from two experiments, corresponding to 300 nuclei per condition; Student's t -test). ( F ) FCS analysis of GFP-53BP1, GFP, and GFP-MeCP2 diffusion. Cells were transfected with nontargeting (NT) or with NuMA-targeting siRNA and were treated with bleomycin as indicated. Statistical analysis with one-way ANOVA and Tukey (GFP-53BP1) or Mann–Whitney tests (GFP and GFP-MeCP2). NuMA silencing was verified by western blot, with lamin B as loading control.

Techniques Used: Diffusion-based Assay, MANN-WHITNEY, Immunoprecipitation, Expressing, Immunostaining, Transfection, Western Blot

NuMA negatively regulates 53BP1 function. ( A ) CSR in CH12F3-2 B cells stably expressing scrambled and 53BP1 shRNA, or nucleofected to express GFP, GFP-NuMA, and GFP-NuMA(S395A) (mean ± SEM; n ≥ 3, ANOVA and Tukey). Representative flow cytometry contour plots are shown for cell nucleofected with GFP and GFP-NuMA constructs. 53BP1 silencing was verified by western blot (right). ( B) Chromosomal aberrations (radials + fusions) in BRCA1-null SUM149 cells transfected with nontargeting or 53BP1-targeting siRNA, GFP, or GFP-NuMA. Cells were treated with olaparib (0.5 μM; 24 h). n = 40–120 cells from ≥3 replicates; statistical analysis with ANOVA and Tukey. Representative images of metaphases are displayed, with arrowheads indicating aberrations. Western blot (right) verified 53BP1 silencing and GFP-NuMA expression (upper band). ( C ) Quantification of NHEJ in U2OS cells with a stably integrated NHEJ-GFP reporter (left; mean ± SEM; Student's t -test). The fraction of cells expressing mCherry or mCherry-NuMA among GFP-positive cells is shown in the cross-ruled graph, whereas cell cycle distribution is shown on the right.
Figure Legend Snippet: NuMA negatively regulates 53BP1 function. ( A ) CSR in CH12F3-2 B cells stably expressing scrambled and 53BP1 shRNA, or nucleofected to express GFP, GFP-NuMA, and GFP-NuMA(S395A) (mean ± SEM; n ≥ 3, ANOVA and Tukey). Representative flow cytometry contour plots are shown for cell nucleofected with GFP and GFP-NuMA constructs. 53BP1 silencing was verified by western blot (right). ( B) Chromosomal aberrations (radials + fusions) in BRCA1-null SUM149 cells transfected with nontargeting or 53BP1-targeting siRNA, GFP, or GFP-NuMA. Cells were treated with olaparib (0.5 μM; 24 h). n = 40–120 cells from ≥3 replicates; statistical analysis with ANOVA and Tukey. Representative images of metaphases are displayed, with arrowheads indicating aberrations. Western blot (right) verified 53BP1 silencing and GFP-NuMA expression (upper band). ( C ) Quantification of NHEJ in U2OS cells with a stably integrated NHEJ-GFP reporter (left; mean ± SEM; Student's t -test). The fraction of cells expressing mCherry or mCherry-NuMA among GFP-positive cells is shown in the cross-ruled graph, whereas cell cycle distribution is shown on the right.

Techniques Used: Stable Transfection, Expressing, shRNA, Flow Cytometry, Construct, Western Blot, Transfection, Non-Homologous End Joining

34) Product Images from "Heterogeneous kinetics of AKT signaling in individual cells are accounted for by variable protein concentration"

Article Title: Heterogeneous kinetics of AKT signaling in individual cells are accounted for by variable protein concentration

Journal: Frontiers in Physiology

doi: 10.3389/fphys.2012.00451

Distribution and quantification of AKT expression levels in Hepa1_6 cell clones. (A) FACS analysis of the distribution of mCherry-AKT expression in stable Hepa1_6 clones is shown in comparison to parental wild type Hepa1_6 cells. For the calculation of the coefficient of variation within the population the distribution in the Hepa1_6-E2 population (passage #12) is depicted on the right and the distribution in the Hepa1_6-D8 population (passage #11) is displayed in the middle. Their dependency on the cell size is shown in the corresponding lower panels. (B + C) Quantification of molecules per cell for mCherry-AKT and endogenous AKT in the stable Hepa1_6 clones D8 (35 μg total cell lysate) and E2 (20 μg of total cell lysate) are shown as determined by (B) quantitative immunoblotting and (C) linear regression from known AKT-calibrator concentrations analyzed on the same gel.
Figure Legend Snippet: Distribution and quantification of AKT expression levels in Hepa1_6 cell clones. (A) FACS analysis of the distribution of mCherry-AKT expression in stable Hepa1_6 clones is shown in comparison to parental wild type Hepa1_6 cells. For the calculation of the coefficient of variation within the population the distribution in the Hepa1_6-E2 population (passage #12) is depicted on the right and the distribution in the Hepa1_6-D8 population (passage #11) is displayed in the middle. Their dependency on the cell size is shown in the corresponding lower panels. (B + C) Quantification of molecules per cell for mCherry-AKT and endogenous AKT in the stable Hepa1_6 clones D8 (35 μg total cell lysate) and E2 (20 μg of total cell lysate) are shown as determined by (B) quantitative immunoblotting and (C) linear regression from known AKT-calibrator concentrations analyzed on the same gel.

Techniques Used: Expressing, FACS, Clone Assay

Extended cMet/PI3K pathway model. (A) Schematic representation of the model structure including mCherry-AKT. (B) Dynamics of the phosphorylation of cMet, endogenous AKT, and mCherry-AKT in the Hepa1_6-D8 and E2 clones stimulated with 40 ng/ml HGF. The means of the indicated number of biological replicates are represented as dots with the standard deviation as error bars. The model trajectories are depicted as lines and the corresponding Chi-square values are given.
Figure Legend Snippet: Extended cMet/PI3K pathway model. (A) Schematic representation of the model structure including mCherry-AKT. (B) Dynamics of the phosphorylation of cMet, endogenous AKT, and mCherry-AKT in the Hepa1_6-D8 and E2 clones stimulated with 40 ng/ml HGF. The means of the indicated number of biological replicates are represented as dots with the standard deviation as error bars. The model trajectories are depicted as lines and the corresponding Chi-square values are given.

Techniques Used: Clone Assay, Standard Deviation

Quantification of the phosphorylation dynamics and total protein levels of endogenous and mCherry-AKT post HGF stimulation in stable Hepa1_6 cell clones. (A) Representative immunoblots for clone Hepa1_6-D8 and E2 detected with phosphor-Ser 473 antibody and reprobing for total AKT are depicted. (B + C) Quantification of AKT phosphorylation dynamics from three-independent experiments are shown. The experimental data indicated by dots represents the mean ( N = 3) and the shaded area indicates the standard deviation for (B) clone Hepa1_6-D8 and (C) clone Hepa1_6-E2.
Figure Legend Snippet: Quantification of the phosphorylation dynamics and total protein levels of endogenous and mCherry-AKT post HGF stimulation in stable Hepa1_6 cell clones. (A) Representative immunoblots for clone Hepa1_6-D8 and E2 detected with phosphor-Ser 473 antibody and reprobing for total AKT are depicted. (B + C) Quantification of AKT phosphorylation dynamics from three-independent experiments are shown. The experimental data indicated by dots represents the mean ( N = 3) and the shaded area indicates the standard deviation for (B) clone Hepa1_6-D8 and (C) clone Hepa1_6-E2.

Techniques Used: Western Blot, Standard Deviation

Representation of experimental and model-derived CVs. The average of the kinetics of mCherry-AKT membrane association in 10 individu al cells for (A) the clone Hepa1_6-D8 and (B) clone Hepa1_6-E2 are shown with the standard error of the mean indicated for each time point. (C + D) The calculated dynamics for 10 simulated cells with extrinsic noise contribution as given by the parameters are shown. For the clones (E) Hepa1_6 D8 and (F) E2 the CV's for the experimental fluctuations in mCherry-pAKT (blue line), theoretical intrinsic fluctuations in mCherry-pAKT (green line), and the corresponding combination of extrinsic and intrinsic fluctuation (red line) are plotted.
Figure Legend Snippet: Representation of experimental and model-derived CVs. The average of the kinetics of mCherry-AKT membrane association in 10 individu al cells for (A) the clone Hepa1_6-D8 and (B) clone Hepa1_6-E2 are shown with the standard error of the mean indicated for each time point. (C + D) The calculated dynamics for 10 simulated cells with extrinsic noise contribution as given by the parameters are shown. For the clones (E) Hepa1_6 D8 and (F) E2 the CV's for the experimental fluctuations in mCherry-pAKT (blue line), theoretical intrinsic fluctuations in mCherry-pAKT (green line), and the corresponding combination of extrinsic and intrinsic fluctuation (red line) are plotted.

Techniques Used: Derivative Assay

Quantification of HGF-induced PI3K/AKT signaling at the single cell level. (A) Confocal image of an individual mCherry-AKT transfected primary mouse hepatocyte is shown as overlay of the Hoechst, WGA-Alexa488, and mCherry-AKT signal with the signals from different channels in artificial-coloring. The graphical representation shows the tracked membrane signal in blue and the rim of the non-membrane cytoplasmic region in yellow with the localization of the two nuclei in the center. (B) Magnification of a subselection showing to the left of the tracked membrane section that is marked in blue the intracellular cytoplasmic space whereas to the right the bright green signal due to background staining of the WGA-Alexa488 visualizes the extracellular space. In the lower panel the quantification areas for mCherry-AKT intensity derived by the membrane tracking are depicted as blue (membrane associated) and yellow regions (intracellular reference area). (C) Signals from 25 individual single cell traces in response to 40 ng/ml HGF stimulation are represented in different colors. (D) Average of single cell traces are depicted for untreated controls ( n = 12) in blue, after stimulation with 40 ng/ml HGF ( n = 50) in red, and for cells pretreated with LY294002 for 30 min prior to HGF stimulation ( n = 15) in green. Error bars represent the standard error of the mean.
Figure Legend Snippet: Quantification of HGF-induced PI3K/AKT signaling at the single cell level. (A) Confocal image of an individual mCherry-AKT transfected primary mouse hepatocyte is shown as overlay of the Hoechst, WGA-Alexa488, and mCherry-AKT signal with the signals from different channels in artificial-coloring. The graphical representation shows the tracked membrane signal in blue and the rim of the non-membrane cytoplasmic region in yellow with the localization of the two nuclei in the center. (B) Magnification of a subselection showing to the left of the tracked membrane section that is marked in blue the intracellular cytoplasmic space whereas to the right the bright green signal due to background staining of the WGA-Alexa488 visualizes the extracellular space. In the lower panel the quantification areas for mCherry-AKT intensity derived by the membrane tracking are depicted as blue (membrane associated) and yellow regions (intracellular reference area). (C) Signals from 25 individual single cell traces in response to 40 ng/ml HGF stimulation are represented in different colors. (D) Average of single cell traces are depicted for untreated controls ( n = 12) in blue, after stimulation with 40 ng/ml HGF ( n = 50) in red, and for cells pretreated with LY294002 for 30 min prior to HGF stimulation ( n = 15) in green. Error bars represent the standard error of the mean.

Techniques Used: Transfection, Whole Genome Amplification, Staining, Derivative Assay

Mathematical modeling of the cMet/PI3K signaling pathway. (A) Schematic representation of the signaling pathway model generated with the Cell Designer Software. Species framed by dashed lines represent phosphorylated or activated forms. (B) Fits of time courses of cMet receptor and AKT phosphorylation in primary mouse hepatocytes stimulated with 40 ng/ml or 100 ng/ml HFG. Depicted as dots with standard deviation as error bar are the means of the indicated number of biological replicates. Model trajectories are depicted as lines and the corresponding Chi-square values are indicated. (C) Depicted in different colors are model simulations of AKT phosphorylation for 10 individual cells resulting from stochastic events. (D) The measured versus computed coefficient of variation (CV) for single cells over time are shown indicating the experimental fluctuations of mCherry-pAKT (blue line), theoretical intrinsic fluctuations of mCherry-pAKT (green line), and the corresponding combination of extrinsic and intrinsic fluctuation (red line).
Figure Legend Snippet: Mathematical modeling of the cMet/PI3K signaling pathway. (A) Schematic representation of the signaling pathway model generated with the Cell Designer Software. Species framed by dashed lines represent phosphorylated or activated forms. (B) Fits of time courses of cMet receptor and AKT phosphorylation in primary mouse hepatocytes stimulated with 40 ng/ml or 100 ng/ml HFG. Depicted as dots with standard deviation as error bar are the means of the indicated number of biological replicates. Model trajectories are depicted as lines and the corresponding Chi-square values are indicated. (C) Depicted in different colors are model simulations of AKT phosphorylation for 10 individual cells resulting from stochastic events. (D) The measured versus computed coefficient of variation (CV) for single cells over time are shown indicating the experimental fluctuations of mCherry-pAKT (blue line), theoretical intrinsic fluctuations of mCherry-pAKT (green line), and the corresponding combination of extrinsic and intrinsic fluctuation (red line).

Techniques Used: Generated, Software, Standard Deviation

Dynamics of cMet receptor phosphorylation and total receptor levels post HGF stimulation in Hepa1_6 cell clones stably expressing mCherry-AKT. (A) Representative immunoblots for phosphorylation and total protein of the cMet receptor immunoprecipitated from lysates of Hepa1_6-D8 and Hepa1_6-E2 clone stimulated with 40 ng/ml HGF. (B) Experimental data indicated as dots show the mean of the kinetics of cMet receptor phosphorylation from three independent experiments and the shaded area indicates the standard deviation individually for both clones and in (C) the total cMet degradation dynamics is displayed.
Figure Legend Snippet: Dynamics of cMet receptor phosphorylation and total receptor levels post HGF stimulation in Hepa1_6 cell clones stably expressing mCherry-AKT. (A) Representative immunoblots for phosphorylation and total protein of the cMet receptor immunoprecipitated from lysates of Hepa1_6-D8 and Hepa1_6-E2 clone stimulated with 40 ng/ml HGF. (B) Experimental data indicated as dots show the mean of the kinetics of cMet receptor phosphorylation from three independent experiments and the shaded area indicates the standard deviation individually for both clones and in (C) the total cMet degradation dynamics is displayed.

Techniques Used: Clone Assay, Stable Transfection, Expressing, Western Blot, Immunoprecipitation, Standard Deviation

35) Product Images from "Ebola virus requires a host scramblase for externalization of phosphatidylserine on the surface of viral particles"

Article Title: Ebola virus requires a host scramblase for externalization of phosphatidylserine on the surface of viral particles

Journal: PLoS Pathogens

doi: 10.1371/journal.ppat.1006848

Distribution of extracellular PS in cells expressing EBOV proteins. Vero-E6 cells grown on 35-mm glass bottom dishes were transfected with the expression plasmids of mCherry-VP40 and wtVP40 at a ratio of 1:5 (a), GP alone (b), mCherry-VP40 and wtVP40 with GP (c), or wtVP40 and GP (d). At 48 h.p.t., the cells were harvested followed by AF-ANX V staining. For detection of GP, the cells were incubated in the medium containing the anti-GP antibody, followed by incubation with Alexa Fluor 647-conjugated secondary antibody. After being washed with medium and ANX V binging buffer, the cells were treated with AF-ANX V. After washing again, the AF-ANX V signal (green) and EBOV proteins were observed by using a confocal microscope. Individual viral proteins are shown in magenta (a, b, and d). In panel (c), mCherry-VP40 and GP are shown in magenta and cyan, respectively. As a control, a backbone plasmid was transfected (e). Panel (f) represents Vero-E6 cells treated with 1 μM STS for 6 h. The nuclei (blue) were counterstained with Hoechst 33342. Insets show the boxed areas. The plots indicate the individual fluorescence intensity along each of the corresponding lines. A.U.; arbitrary unit. Scale bars in the large panels: 10 μm.
Figure Legend Snippet: Distribution of extracellular PS in cells expressing EBOV proteins. Vero-E6 cells grown on 35-mm glass bottom dishes were transfected with the expression plasmids of mCherry-VP40 and wtVP40 at a ratio of 1:5 (a), GP alone (b), mCherry-VP40 and wtVP40 with GP (c), or wtVP40 and GP (d). At 48 h.p.t., the cells were harvested followed by AF-ANX V staining. For detection of GP, the cells were incubated in the medium containing the anti-GP antibody, followed by incubation with Alexa Fluor 647-conjugated secondary antibody. After being washed with medium and ANX V binging buffer, the cells were treated with AF-ANX V. After washing again, the AF-ANX V signal (green) and EBOV proteins were observed by using a confocal microscope. Individual viral proteins are shown in magenta (a, b, and d). In panel (c), mCherry-VP40 and GP are shown in magenta and cyan, respectively. As a control, a backbone plasmid was transfected (e). Panel (f) represents Vero-E6 cells treated with 1 μM STS for 6 h. The nuclei (blue) were counterstained with Hoechst 33342. Insets show the boxed areas. The plots indicate the individual fluorescence intensity along each of the corresponding lines. A.U.; arbitrary unit. Scale bars in the large panels: 10 μm.

Techniques Used: Expressing, Transfection, Staining, Incubation, Microscopy, Plasmid Preparation, Fluorescence

Distribution of Xkr8 in cells expressing EBOV proteins. Vero-E6 cells grown on cover slips were transfected with the expression plasmids of EBOV VP40 (a), GP (b), NP (c), or mCherry-VP40 and wtVP40 (1:5) along with GP (f). At 48 h.p.t. the distribution of the individual EBOV proteins and Xkr8 (magenta) were analyzed by immunofluorescence staining. Viral proteins are shown in green (a–c). In panel (f), mCherry-VP40 and GP are shown in green and cyan, respectively. As a control, a backbone plasmid was transfected (d). Panel (e) represents Vero-E6 cells treated with 1 μM STS for 6 h. Insets show the boxed areas. The plots indicate relative fluorescence intensity detected with individual channels along each of the corresponding lines. A.U.; arbitrary unit. Scale bars in the large panels: 10 μm.
Figure Legend Snippet: Distribution of Xkr8 in cells expressing EBOV proteins. Vero-E6 cells grown on cover slips were transfected with the expression plasmids of EBOV VP40 (a), GP (b), NP (c), or mCherry-VP40 and wtVP40 (1:5) along with GP (f). At 48 h.p.t. the distribution of the individual EBOV proteins and Xkr8 (magenta) were analyzed by immunofluorescence staining. Viral proteins are shown in green (a–c). In panel (f), mCherry-VP40 and GP are shown in green and cyan, respectively. As a control, a backbone plasmid was transfected (d). Panel (e) represents Vero-E6 cells treated with 1 μM STS for 6 h. Insets show the boxed areas. The plots indicate relative fluorescence intensity detected with individual channels along each of the corresponding lines. A.U.; arbitrary unit. Scale bars in the large panels: 10 μm.

Techniques Used: Expressing, Transfection, Immunofluorescence, Staining, Plasmid Preparation, Fluorescence

36) Product Images from "IGLR-2, a Leucine-Rich Repeat Domain Containing Protein, Is Required for the Host Defense in Caenorhabditis elegans"

Article Title: IGLR-2, a Leucine-Rich Repeat Domain Containing Protein, Is Required for the Host Defense in Caenorhabditis elegans

Journal: Frontiers in Immunology

doi: 10.3389/fimmu.2020.561337

iglr-2 is expressed in neurons and intestine. Fluorescence images show iglr-2p :: mCherry or iglr-2p :: mCherry ::H2B reporter strains exhibiting mCherry fluorescent signal in both neuronal and anterior/posterior intestinal cells at the young adult stage. (A–I) Representative images of YQ305 [ iglr-2p::mCherry ] transgenic animals are shown. (A–C) Anterior part of C. elegans YQ305 strain is shown. Arrows indicate the neuronal cells of head and anterior part of intestinal cells in (C) . (D–F) Middle part of C. elegans YQ305. (G–I) Posterior part of C. elegans YQ305 strain is shown. Arrows indicate the posterior part of intestinal cells in (I) . (A, D, G) represent differential interference contrast (DIC) images of the proximal, middle, and distal parts of C. elegans , respectively. (B, E, H) mCherry fluorescence images of iglr-2p :: mCherry animals. (C, F, I) Merged images of iglr-2p :: mCherry animals. (J–R) Representative images of YQ326 [ iglr-2p::mCherry::H2B ] transgenic animals are shown. (J–L) Anterior part of C. elegans YQ326 strain is shown. Arrows indicate the neuronal nuclei of head and anterior part of intestinal nuclei in (L) . (M–O) Middle part of C. elegans YQ326. (P–R) Posterior part of C. elegans YQ326 strain is shown. Arrows indicate the posterior part of intestinal nuclei in (R) . (J, M, P) represent differential interference contrast (DIC) images of the proximal, middle, and distal parts of C. elegans , respectively. (K, N, Q) mCherry fluorescence images of iglr-2p :: mCherry animals. (L, O, R) Merged images of iglr-2p :: mCherry animals. All the scale bars represent 50 µm.
Figure Legend Snippet: iglr-2 is expressed in neurons and intestine. Fluorescence images show iglr-2p :: mCherry or iglr-2p :: mCherry ::H2B reporter strains exhibiting mCherry fluorescent signal in both neuronal and anterior/posterior intestinal cells at the young adult stage. (A–I) Representative images of YQ305 [ iglr-2p::mCherry ] transgenic animals are shown. (A–C) Anterior part of C. elegans YQ305 strain is shown. Arrows indicate the neuronal cells of head and anterior part of intestinal cells in (C) . (D–F) Middle part of C. elegans YQ305. (G–I) Posterior part of C. elegans YQ305 strain is shown. Arrows indicate the posterior part of intestinal cells in (I) . (A, D, G) represent differential interference contrast (DIC) images of the proximal, middle, and distal parts of C. elegans , respectively. (B, E, H) mCherry fluorescence images of iglr-2p :: mCherry animals. (C, F, I) Merged images of iglr-2p :: mCherry animals. (J–R) Representative images of YQ326 [ iglr-2p::mCherry::H2B ] transgenic animals are shown. (J–L) Anterior part of C. elegans YQ326 strain is shown. Arrows indicate the neuronal nuclei of head and anterior part of intestinal nuclei in (L) . (M–O) Middle part of C. elegans YQ326. (P–R) Posterior part of C. elegans YQ326 strain is shown. Arrows indicate the posterior part of intestinal nuclei in (R) . (J, M, P) represent differential interference contrast (DIC) images of the proximal, middle, and distal parts of C. elegans , respectively. (K, N, Q) mCherry fluorescence images of iglr-2p :: mCherry animals. (L, O, R) Merged images of iglr-2p :: mCherry animals. All the scale bars represent 50 µm.

Techniques Used: Fluorescence, Transgenic Assay

37) Product Images from "Using protein-per-mRNA differences among human tissues in codon optimization"

Article Title: Using protein-per-mRNA differences among human tissues in codon optimization

Journal: bioRxiv

doi: 10.1101/2022.03.22.485268

CUSTOM generates fluorescent variants with desired tissue-specific expression, related to Figure 3 . (A) Difference between the standardized Spearman correlation of the proteomics profiles of A549 and HEK293 25 against all tissues in the HPA 20 . (B) Ratios of eGFP and mCherry for each of the four constructs detected by flow cytometry. The number of cells within each group is specified. Center values represent the median. Statistical differences were determined by two-tailed Wilcoxon rank-sum test, and are denoted as follows: *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001.
Figure Legend Snippet: CUSTOM generates fluorescent variants with desired tissue-specific expression, related to Figure 3 . (A) Difference between the standardized Spearman correlation of the proteomics profiles of A549 and HEK293 25 against all tissues in the HPA 20 . (B) Ratios of eGFP and mCherry for each of the four constructs detected by flow cytometry. The number of cells within each group is specified. Center values represent the median. Statistical differences were determined by two-tailed Wilcoxon rank-sum test, and are denoted as follows: *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001.

Techniques Used: Expressing, Construct, Flow Cytometry, Two Tailed Test

CUSTOM generates fluorescent variants with desired tissue-specific expression. (A) Selected eGFP and mCherry sequences optimized to lung and kidney using CUSTOM. The color code corresponds to the optimality ratios of Fig. 2B . (B) Using these sequences, we designed four of constructs by placing a mCherry and an eGFP with opposite tissue-specificity under an inducible bidirectional promoter. (C) Ratios of eGFP and mCherry for each of the four constructs detected by flow cytometry. The number of cells within each group is specified. Center values represent the median. Statistical differences were determined by two-tailed Wilcoxon rank-sum test, and are denoted as follows: *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001. Two additional replicates are shown in ED Figure 5A .
Figure Legend Snippet: CUSTOM generates fluorescent variants with desired tissue-specific expression. (A) Selected eGFP and mCherry sequences optimized to lung and kidney using CUSTOM. The color code corresponds to the optimality ratios of Fig. 2B . (B) Using these sequences, we designed four of constructs by placing a mCherry and an eGFP with opposite tissue-specificity under an inducible bidirectional promoter. (C) Ratios of eGFP and mCherry for each of the four constructs detected by flow cytometry. The number of cells within each group is specified. Center values represent the median. Statistical differences were determined by two-tailed Wilcoxon rank-sum test, and are denoted as follows: *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001. Two additional replicates are shown in ED Figure 5A .

Techniques Used: Expressing, Construct, Flow Cytometry, Two Tailed Test

38) Product Images from "A ubiquitin ligase mediates target-directed microRNA decay independently of tailing and trimming"

Article Title: A ubiquitin ligase mediates target-directed microRNA decay independently of tailing and trimming

Journal: Science (New York, N.Y.)

doi: 10.1126/science.abc9546

ZSWIM8 ubquitin ligase components are essential for TDMD. (A) Flow cytometry analysis of EGFP expression in CYRANO +/+ K562 EGFP miR−7 cells after lentiviral expression of Cas9 and sgRNAs targeting the indicated genes. (B) Northern blot analysis of miRNA expression in CYRANO +/+ and CYRANO −/− K562 cells after expression of sgRNAs targeting ZSWIM8 CRL components. (C) Schematic of reprogrammed mCherry - NREP transcript ( NREP _29a/b) and its predicted base-pairing with miR-29a (upper) and miR-29b (lower). (D) Predicted base-pairing of the mutant NREP transcript with seed binding only ( NREP _seed) with miR-29a and miR-29b. (E) Northern blot analysis of miRNA expression in HCT116 cells expressing NREP transcripts and the indicated sgRNAs. n=3 biological replicates for northern blot and flow cytometry experiments (representative data shown).
Figure Legend Snippet: ZSWIM8 ubquitin ligase components are essential for TDMD. (A) Flow cytometry analysis of EGFP expression in CYRANO +/+ K562 EGFP miR−7 cells after lentiviral expression of Cas9 and sgRNAs targeting the indicated genes. (B) Northern blot analysis of miRNA expression in CYRANO +/+ and CYRANO −/− K562 cells after expression of sgRNAs targeting ZSWIM8 CRL components. (C) Schematic of reprogrammed mCherry - NREP transcript ( NREP _29a/b) and its predicted base-pairing with miR-29a (upper) and miR-29b (lower). (D) Predicted base-pairing of the mutant NREP transcript with seed binding only ( NREP _seed) with miR-29a and miR-29b. (E) Northern blot analysis of miRNA expression in HCT116 cells expressing NREP transcripts and the indicated sgRNAs. n=3 biological replicates for northern blot and flow cytometry experiments (representative data shown).

Techniques Used: Flow Cytometry, Expressing, Northern Blot, Mutagenesis, Binding Assay

39) Product Images from "Distinct regions of the intrinsically disordered protein MUT-16 mediate assembly of a small RNA amplification complex and promote phase separation of Mutator foci"

Article Title: Distinct regions of the intrinsically disordered protein MUT-16 mediate assembly of a small RNA amplification complex and promote phase separation of Mutator foci

Journal: PLoS Genetics

doi: 10.1371/journal.pgen.1007542

The C-terminal region of MUT-16 is necessary for Mutator foci formation. (A) Table indicates whether MUT-16 foci are present or absent in each mut-16 deletion strain. Yes indicates foci present in the majority of animals, No indicates foci absent or severely disrupted, and Weak (for ΔC) indicates an intermediate phenotype where the fluorescence intensity of cytoplasmic MUT-16 appeared reduced relative to the other deletion lines. (B-E) Live imaging of MUT-16::mCherry expression and localization for control strain (B) or when ΔC (C), ΔL (D), or ΔE-I (E) deletions have been introduced into the mut-16 :: mCherry strain. Scale bars, 5μm. (F) MUT-16 western blot to assess protein levels in full-length and mut-16 deletion strains. Expected sizes for MUT-16::mCherry::2xHA are 148 kD (full-length), 139 kD (ΔA), 137 kD (ΔB), 134 kD (ΔC), 138 kD (ΔD), 137 kD (ΔE), 138 kD (ΔF), 141 kD (ΔG), 132 kD (ΔH-I), 135 kD (ΔJ), 141 kD (ΔK), 138 kD (ΔL), 105 kD (ΔE-I), and 85 kD (ΔE-K). Approximately 200 synchronous adult animals were loaded per lane and actin was used as a loading control.
Figure Legend Snippet: The C-terminal region of MUT-16 is necessary for Mutator foci formation. (A) Table indicates whether MUT-16 foci are present or absent in each mut-16 deletion strain. Yes indicates foci present in the majority of animals, No indicates foci absent or severely disrupted, and Weak (for ΔC) indicates an intermediate phenotype where the fluorescence intensity of cytoplasmic MUT-16 appeared reduced relative to the other deletion lines. (B-E) Live imaging of MUT-16::mCherry expression and localization for control strain (B) or when ΔC (C), ΔL (D), or ΔE-I (E) deletions have been introduced into the mut-16 :: mCherry strain. Scale bars, 5μm. (F) MUT-16 western blot to assess protein levels in full-length and mut-16 deletion strains. Expected sizes for MUT-16::mCherry::2xHA are 148 kD (full-length), 139 kD (ΔA), 137 kD (ΔB), 134 kD (ΔC), 138 kD (ΔD), 137 kD (ΔE), 138 kD (ΔF), 141 kD (ΔG), 132 kD (ΔH-I), 135 kD (ΔJ), 141 kD (ΔK), 138 kD (ΔL), 105 kD (ΔE-I), and 85 kD (ΔE-K). Approximately 200 synchronous adult animals were loaded per lane and actin was used as a loading control.

Techniques Used: Fluorescence, Imaging, Expressing, Western Blot

Distinct regions of MUT-16 recruit each of the other Mutator proteins. (A) Table indicates whether mut-16 deletions disrupt MUT-2, RDE-8, NYN-1, MUT-14, RRF-1, and RDE-2 foci. Yes indicates foci present in the majority of animals, No indicates foci absent or severely disrupted, and ND indicates that strain was not constructed or scored. (B-D) MUT-16::mCherry and MUT-2::GFP expression and localization for control strain (B) or when ΔC (C) or ΔK (D) deletions have been introduced into the mut-16 :: mCherry strain. Scale bars, 5μm. (E) Immunoprecipitation and western blot of MUT-16::mCherry::2xHA (expected sizes between 135–141 kD for MUT-16 deletions and 148 kD for MUT-16 full length) and MUT-2::GFP::3xFLAG (83 kD). Left panels are total lysate from strains indicated above, and right panels are following HA immunoprecipitation. (F) Immunoprecipitation and western blot of MUT-16::mCherry::2xHA (expected sizes between 132–142 kD for MUT-16 deletions and 148 kD for MUT-16 full length) and GFP::3xFLAG::RRF-1 (219 kD). Top two panels are total lysate from strains indicated above, and bottom two panels are following HA immunoprecipitation. The equivalent of ~0.5% of starting material for the input fractions and ~20% of starting material for the IP fractions were loaded onto the gels.
Figure Legend Snippet: Distinct regions of MUT-16 recruit each of the other Mutator proteins. (A) Table indicates whether mut-16 deletions disrupt MUT-2, RDE-8, NYN-1, MUT-14, RRF-1, and RDE-2 foci. Yes indicates foci present in the majority of animals, No indicates foci absent or severely disrupted, and ND indicates that strain was not constructed or scored. (B-D) MUT-16::mCherry and MUT-2::GFP expression and localization for control strain (B) or when ΔC (C) or ΔK (D) deletions have been introduced into the mut-16 :: mCherry strain. Scale bars, 5μm. (E) Immunoprecipitation and western blot of MUT-16::mCherry::2xHA (expected sizes between 135–141 kD for MUT-16 deletions and 148 kD for MUT-16 full length) and MUT-2::GFP::3xFLAG (83 kD). Left panels are total lysate from strains indicated above, and right panels are following HA immunoprecipitation. (F) Immunoprecipitation and western blot of MUT-16::mCherry::2xHA (expected sizes between 132–142 kD for MUT-16 deletions and 148 kD for MUT-16 full length) and GFP::3xFLAG::RRF-1 (219 kD). Top two panels are total lysate from strains indicated above, and bottom two panels are following HA immunoprecipitation. The equivalent of ~0.5% of starting material for the input fractions and ~20% of starting material for the IP fractions were loaded onto the gels.

Techniques Used: Construct, Expressing, Immunoprecipitation, Western Blot

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Addgene inc cd81 mcherry neo vector
    HIV and SIV Nef proteins colocalize in the cytoplasm with the EV marker <t>CD81</t> in cells. (A to D) U2OS cells were selected to stably express the EV marker <t>CD81-mCherry</t> and then mock transfected (empty vector). Single-plane images from deconvoluted z-stacks were used to visualize DAPI (A), GFP (B), CD81-mCherry (C), and a composite (D). Size bars = 200 μm. (E to H) Same as panels A to D but for cells transfected with HIV nef -GFP. Single-plane images from deconvoluted z-stacks were used to visualize DAPI (E), GFP (F), CD81-mCherry (G), and a composite (H). (I to L) Same as panels A to D but for cells transfected with SIV nef -GFP. Single-plane images from deconvoluted z-stacks were used to visualize DAPI (I), GFP (J), CD81-mCherry (K), and a composite (L). (M to P) U2OS cells constitutively expressing CD63-GFP and CD81-mCherry were used as a positive control. Single-plane images from deconvoluted z-stacks were used to visualize DAPI (M), CD63-GFP (N), CD81-mCherry (O), and a composite (P). (Q to S) Selected areas from U2OS CD81-mCherry-expressing cells coexpressing HIV Nef-GFP (Q), SIV Nef-GFP (R), and CD63-GFP enlarged to show areas of colocalization events (S).
    Cd81 Mcherry Neo Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cd81 mcherry neo vector/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cd81 mcherry neo vector - by Bioz Stars, 2022-10
    90/100 stars
      Buy from Supplier

    92
    Addgene inc aav2 hsyn dio hm4d gi mcherry
    Chemogenetic suppression of all ventral parafacial neurons increased baseline breathing. ( Ai ) Confocal images of coronal sections and corresponding brainstem schematic show the placement a typical parafacial injection and its diffusion of ~100 µm along the rostral-caudal axis. ( Aii ) Computer-assisted plots show the center of all bilateral <t>AAV2-hSyn-DIO-hM4D-mCherry</t> injections (n = 11 animals). Approximate millimeters behind bregma is indicated by numbers next to each section. ( Aiii ) Left, examples of mCherry and Gad67-immunoreactivity (IR) and summary data to the right confirm both specificity and efficiency of this viral targeting approach. ( B ) Traces of respiratory activity from Slc32a1 Cre mice that received bilateral parafacial injections of AAV2-hSyn-DIO-hM4D-mCherry following systemic (I.P.) injection of clozapine (1 mg/kg) or saline (control). ( C–E ) Summary data shows effects of chemogenetic suppression of parafacial inhibitory neurons with clozapine on respiratory frequency ( C ), tidal volume ( D ) and minute ventilation ( E ) under room air conditions and in 0–7% CO 2 (balance O 2 ). *, different from 0% CO 2 as assessed by Tukey’s post-hoc multiple comparison test. #### , different between genotypes (two-way ANOVA with Tukey’s multiple comparison test, p
    Aav2 Hsyn Dio Hm4d Gi Mcherry, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/aav2 hsyn dio hm4d gi mcherry/product/Addgene inc
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    aav2 hsyn dio hm4d gi mcherry - by Bioz Stars, 2022-10
    92/100 stars
      Buy from Supplier

    90
    addgene inc mcherry tagged protein
    Syph Ct undergoes phase separation among themselves when assisted by additional interactions in living cells. a Schematic diagram of Syph Ct-mCh-CRY2PHR consisting of the N-terminal Syph Ct (blue-gray) fused to <t>mCherry</t> (red) and the CRY2PHR domain (gray indicating inactive state). Blue light activation of Syph Ct-mCh-CRY2PHR leads to rapid clustering (blue indicating active CRY2PHR). b Representative time-lapse fluorescence images of light-activated clustering of Syph Ct-mCh-CRY2PHR and CRY2PHR-mCh stimulated with a 488 nm laser for 2500 ms. Middle: Magnified images of the region enclosed by a red rectangle in the top panel. Scale bars; 20 μm (top and bottom), 2 μm (middle). c Schematic diagram of Syph (Ct) 2 -mCer-MP. Two Syph Cts were linked by a short linker (gray) and fused to mCerulean fluorescent protein and the multimeric protein (MP) of CaMKIIα (pale mint). 12 identical MP subunits are assembled into a circular oligomer, exposing 24 copies of Syph Cts. d Representative fluorescence image of droplets formed by Syph (Ct) 2 -mCer-MP expressed in living cells. e Representative fluorescence image of droplets formed by purified Syph (Ct) 2 -mCer-MP (5 μM) in vitro in the presence of 3% PEG-8000. Scale bars; d = 20 μm, e = 10 μm. f Time-lapse images showed fusion of two Syph (Ct) 2 -mCer-MP droplets in living cells. g Representative fluorescence images of Syph (Ct) 2 -mCer-MP droplets treated with 3% 1,6-Hexanediol (3% 1,6-HD). Droplets disperse reversibly upon 3% 1,6-HD. Scale bars; f = 2 μm, g = 20 μm. h Representative time-lapse images showing fluorescence recovery of Syph (Ct) 2 -mCer-MP droplet after photobleaching. i Plot of the average fluorescence intensities after photobleaching of multiple spots. N = 10 cells from 5 coverslips. Scale bars; 2 μm
    Mcherry Tagged Protein, supplied by addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mcherry tagged protein/product/addgene inc
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mcherry tagged protein - by Bioz Stars, 2022-10
    90/100 stars
      Buy from Supplier

    96
    Addgene inc ptriex mcherry pa rac1 plasmid 22027
    The retrograde movement of Rab10-positive tubules is dependent on microtubules. (A) Epifluorescence microscopy of <t>mCherry-Rab10</t> and EGFP-tubulin in live RAW 264 cells during <t>PA-Rac1</t> ON-OFF cycling. Arrow indicates a Rab10-positive tubule extended from a peripheral premacropinosome. Scale bar=10 μm. (B) Higher-magnification view of extending Rab10-positive tubules (red arrows) along microtubules (green arrows). Scale bar = 2 μm. (C) The extension of EGFP-Rab10 tubules was inhibited in nocodazole-treated RAW264 cells, while many Rab10-positive premacropinosomes (arrows) were formed. Scale bar = 10 μm. The corresponding movies are available in the ( Supplementary Material Movies 4 – 6 ).
    Ptriex Mcherry Pa Rac1 Plasmid 22027, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ptriex mcherry pa rac1 plasmid 22027/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    ptriex mcherry pa rac1 plasmid 22027 - by Bioz Stars, 2022-10
    96/100 stars
      Buy from Supplier

    Image Search Results


    HIV and SIV Nef proteins colocalize in the cytoplasm with the EV marker CD81 in cells. (A to D) U2OS cells were selected to stably express the EV marker CD81-mCherry and then mock transfected (empty vector). Single-plane images from deconvoluted z-stacks were used to visualize DAPI (A), GFP (B), CD81-mCherry (C), and a composite (D). Size bars = 200 μm. (E to H) Same as panels A to D but for cells transfected with HIV nef -GFP. Single-plane images from deconvoluted z-stacks were used to visualize DAPI (E), GFP (F), CD81-mCherry (G), and a composite (H). (I to L) Same as panels A to D but for cells transfected with SIV nef -GFP. Single-plane images from deconvoluted z-stacks were used to visualize DAPI (I), GFP (J), CD81-mCherry (K), and a composite (L). (M to P) U2OS cells constitutively expressing CD63-GFP and CD81-mCherry were used as a positive control. Single-plane images from deconvoluted z-stacks were used to visualize DAPI (M), CD63-GFP (N), CD81-mCherry (O), and a composite (P). (Q to S) Selected areas from U2OS CD81-mCherry-expressing cells coexpressing HIV Nef-GFP (Q), SIV Nef-GFP (R), and CD63-GFP enlarged to show areas of colocalization events (S).

    Journal: mBio

    Article Title: Nef Secretion into Extracellular Vesicles or Exosomes Is Conserved across Human and Simian Immunodeficiency Viruses

    doi: 10.1128/mBio.02344-17

    Figure Lengend Snippet: HIV and SIV Nef proteins colocalize in the cytoplasm with the EV marker CD81 in cells. (A to D) U2OS cells were selected to stably express the EV marker CD81-mCherry and then mock transfected (empty vector). Single-plane images from deconvoluted z-stacks were used to visualize DAPI (A), GFP (B), CD81-mCherry (C), and a composite (D). Size bars = 200 μm. (E to H) Same as panels A to D but for cells transfected with HIV nef -GFP. Single-plane images from deconvoluted z-stacks were used to visualize DAPI (E), GFP (F), CD81-mCherry (G), and a composite (H). (I to L) Same as panels A to D but for cells transfected with SIV nef -GFP. Single-plane images from deconvoluted z-stacks were used to visualize DAPI (I), GFP (J), CD81-mCherry (K), and a composite (L). (M to P) U2OS cells constitutively expressing CD63-GFP and CD81-mCherry were used as a positive control. Single-plane images from deconvoluted z-stacks were used to visualize DAPI (M), CD63-GFP (N), CD81-mCherry (O), and a composite (P). (Q to S) Selected areas from U2OS CD81-mCherry-expressing cells coexpressing HIV Nef-GFP (Q), SIV Nef-GFP (R), and CD63-GFP enlarged to show areas of colocalization events (S).

    Article Snippet: U2OS cells were transfected with CD81-mCherry/Neo vector (Addgene plasmid no. 24162) and selected with 500 μg/ml Geneticin (G418 salt; Gibco).

    Techniques: Marker, Stable Transfection, Transfection, Plasmid Preparation, Expressing, Positive Control

    Chemogenetic suppression of all ventral parafacial neurons increased baseline breathing. ( Ai ) Confocal images of coronal sections and corresponding brainstem schematic show the placement a typical parafacial injection and its diffusion of ~100 µm along the rostral-caudal axis. ( Aii ) Computer-assisted plots show the center of all bilateral AAV2-hSyn-DIO-hM4D-mCherry injections (n = 11 animals). Approximate millimeters behind bregma is indicated by numbers next to each section. ( Aiii ) Left, examples of mCherry and Gad67-immunoreactivity (IR) and summary data to the right confirm both specificity and efficiency of this viral targeting approach. ( B ) Traces of respiratory activity from Slc32a1 Cre mice that received bilateral parafacial injections of AAV2-hSyn-DIO-hM4D-mCherry following systemic (I.P.) injection of clozapine (1 mg/kg) or saline (control). ( C–E ) Summary data shows effects of chemogenetic suppression of parafacial inhibitory neurons with clozapine on respiratory frequency ( C ), tidal volume ( D ) and minute ventilation ( E ) under room air conditions and in 0–7% CO 2 (balance O 2 ). *, different from 0% CO 2 as assessed by Tukey’s post-hoc multiple comparison test. #### , different between genotypes (two-way ANOVA with Tukey’s multiple comparison test, p

    Journal: eLife

    Article Title: Somatostatin-expressing parafacial neurons are CO2/H+ sensitive and regulate baseline breathing

    doi: 10.7554/eLife.60317

    Figure Lengend Snippet: Chemogenetic suppression of all ventral parafacial neurons increased baseline breathing. ( Ai ) Confocal images of coronal sections and corresponding brainstem schematic show the placement a typical parafacial injection and its diffusion of ~100 µm along the rostral-caudal axis. ( Aii ) Computer-assisted plots show the center of all bilateral AAV2-hSyn-DIO-hM4D-mCherry injections (n = 11 animals). Approximate millimeters behind bregma is indicated by numbers next to each section. ( Aiii ) Left, examples of mCherry and Gad67-immunoreactivity (IR) and summary data to the right confirm both specificity and efficiency of this viral targeting approach. ( B ) Traces of respiratory activity from Slc32a1 Cre mice that received bilateral parafacial injections of AAV2-hSyn-DIO-hM4D-mCherry following systemic (I.P.) injection of clozapine (1 mg/kg) or saline (control). ( C–E ) Summary data shows effects of chemogenetic suppression of parafacial inhibitory neurons with clozapine on respiratory frequency ( C ), tidal volume ( D ) and minute ventilation ( E ) under room air conditions and in 0–7% CO 2 (balance O 2 ). *, different from 0% CO 2 as assessed by Tukey’s post-hoc multiple comparison test. #### , different between genotypes (two-way ANOVA with Tukey’s multiple comparison test, p

    Article Snippet: "Specifically, we bilaterally injected AAV2-hSyn-DIO-hM4D(Gi)-mCherry (10 nL/side, Addgene) into the medial portion of the RTN in VGAT-cre mice".

    Techniques: Injection, Diffusion-based Assay, Activity Assay, Mouse Assay

    Syph Ct undergoes phase separation among themselves when assisted by additional interactions in living cells. a Schematic diagram of Syph Ct-mCh-CRY2PHR consisting of the N-terminal Syph Ct (blue-gray) fused to mCherry (red) and the CRY2PHR domain (gray indicating inactive state). Blue light activation of Syph Ct-mCh-CRY2PHR leads to rapid clustering (blue indicating active CRY2PHR). b Representative time-lapse fluorescence images of light-activated clustering of Syph Ct-mCh-CRY2PHR and CRY2PHR-mCh stimulated with a 488 nm laser for 2500 ms. Middle: Magnified images of the region enclosed by a red rectangle in the top panel. Scale bars; 20 μm (top and bottom), 2 μm (middle). c Schematic diagram of Syph (Ct) 2 -mCer-MP. Two Syph Cts were linked by a short linker (gray) and fused to mCerulean fluorescent protein and the multimeric protein (MP) of CaMKIIα (pale mint). 12 identical MP subunits are assembled into a circular oligomer, exposing 24 copies of Syph Cts. d Representative fluorescence image of droplets formed by Syph (Ct) 2 -mCer-MP expressed in living cells. e Representative fluorescence image of droplets formed by purified Syph (Ct) 2 -mCer-MP (5 μM) in vitro in the presence of 3% PEG-8000. Scale bars; d = 20 μm, e = 10 μm. f Time-lapse images showed fusion of two Syph (Ct) 2 -mCer-MP droplets in living cells. g Representative fluorescence images of Syph (Ct) 2 -mCer-MP droplets treated with 3% 1,6-Hexanediol (3% 1,6-HD). Droplets disperse reversibly upon 3% 1,6-HD. Scale bars; f = 2 μm, g = 20 μm. h Representative time-lapse images showing fluorescence recovery of Syph (Ct) 2 -mCer-MP droplet after photobleaching. i Plot of the average fluorescence intensities after photobleaching of multiple spots. N = 10 cells from 5 coverslips. Scale bars; 2 μm

    Journal: Molecular Brain

    Article Title: Multivalent electrostatic pi–cation interaction between synaptophysin and synapsin is responsible for the coacervation

    doi: 10.1186/s13041-021-00846-y

    Figure Lengend Snippet: Syph Ct undergoes phase separation among themselves when assisted by additional interactions in living cells. a Schematic diagram of Syph Ct-mCh-CRY2PHR consisting of the N-terminal Syph Ct (blue-gray) fused to mCherry (red) and the CRY2PHR domain (gray indicating inactive state). Blue light activation of Syph Ct-mCh-CRY2PHR leads to rapid clustering (blue indicating active CRY2PHR). b Representative time-lapse fluorescence images of light-activated clustering of Syph Ct-mCh-CRY2PHR and CRY2PHR-mCh stimulated with a 488 nm laser for 2500 ms. Middle: Magnified images of the region enclosed by a red rectangle in the top panel. Scale bars; 20 μm (top and bottom), 2 μm (middle). c Schematic diagram of Syph (Ct) 2 -mCer-MP. Two Syph Cts were linked by a short linker (gray) and fused to mCerulean fluorescent protein and the multimeric protein (MP) of CaMKIIα (pale mint). 12 identical MP subunits are assembled into a circular oligomer, exposing 24 copies of Syph Cts. d Representative fluorescence image of droplets formed by Syph (Ct) 2 -mCer-MP expressed in living cells. e Representative fluorescence image of droplets formed by purified Syph (Ct) 2 -mCer-MP (5 μM) in vitro in the presence of 3% PEG-8000. Scale bars; d = 20 μm, e = 10 μm. f Time-lapse images showed fusion of two Syph (Ct) 2 -mCer-MP droplets in living cells. g Representative fluorescence images of Syph (Ct) 2 -mCer-MP droplets treated with 3% 1,6-Hexanediol (3% 1,6-HD). Droplets disperse reversibly upon 3% 1,6-HD. Scale bars; f = 2 μm, g = 20 μm. h Representative time-lapse images showing fluorescence recovery of Syph (Ct) 2 -mCer-MP droplet after photobleaching. i Plot of the average fluorescence intensities after photobleaching of multiple spots. N = 10 cells from 5 coverslips. Scale bars; 2 μm

    Article Snippet: In vitro droplets imaging was performed at RT using a 60X oil immersion objective (Plan Apo NA 1.4) on a Nikon spinning disk confocal microscope with 488 nm and 561 nm lasers for mEGFP and mCherry-tagged protein, respectively.

    Techniques: Activation Assay, Fluorescence, Purification, In Vitro

    The retrograde movement of Rab10-positive tubules is dependent on microtubules. (A) Epifluorescence microscopy of mCherry-Rab10 and EGFP-tubulin in live RAW 264 cells during PA-Rac1 ON-OFF cycling. Arrow indicates a Rab10-positive tubule extended from a peripheral premacropinosome. Scale bar=10 μm. (B) Higher-magnification view of extending Rab10-positive tubules (red arrows) along microtubules (green arrows). Scale bar = 2 μm. (C) The extension of EGFP-Rab10 tubules was inhibited in nocodazole-treated RAW264 cells, while many Rab10-positive premacropinosomes (arrows) were formed. Scale bar = 10 μm. The corresponding movies are available in the ( Supplementary Material Movies 4 – 6 ).

    Journal: Frontiers in Immunology

    Article Title: Rab10-Positive Tubular Structures Represent a Novel Endocytic Pathway That Diverges From Canonical Macropinocytosis in RAW264 Macrophages

    doi: 10.3389/fimmu.2021.649600

    Figure Lengend Snippet: The retrograde movement of Rab10-positive tubules is dependent on microtubules. (A) Epifluorescence microscopy of mCherry-Rab10 and EGFP-tubulin in live RAW 264 cells during PA-Rac1 ON-OFF cycling. Arrow indicates a Rab10-positive tubule extended from a peripheral premacropinosome. Scale bar=10 μm. (B) Higher-magnification view of extending Rab10-positive tubules (red arrows) along microtubules (green arrows). Scale bar = 2 μm. (C) The extension of EGFP-Rab10 tubules was inhibited in nocodazole-treated RAW264 cells, while many Rab10-positive premacropinosomes (arrows) were formed. Scale bar = 10 μm. The corresponding movies are available in the ( Supplementary Material Movies 4 – 6 ).

    Article Snippet: The pmCitrine-Rab4, pmCitrine-Rab5, pmCitrine-Rab7, pmCitrine-LAMP1, and pmCitrine-Akt-PH domain were provided by Dr. Joel A. Swanson (University of Michigan). pEGFP-Rab11 was provided by Dr. Marino Zerial (Max Planck Institute). pTriEx/mCherry-PA-Rac1 was obtained from Dr. Klaus Hahn through Addgene (Plasmid #22027, Cambridge, MA). pECFP-PA-Rac1 was created by the insertion of the PA-Rac1 fragment into pECFP-C1.

    Techniques: Epifluorescence Microscopy

    Rab10 dynamics in live RAW264 cells under the optogenetic control of PA-Rac1 activity. (A) The blue boxed area of a cell expressing ECFP-PA-Rac1 was irradiated with a blue laser to photoactivate PA-Rac1. Phase-contrast (left) and mCherry-Rab10 (right) images were acquired at the indicated times after PA-Rac1 activation (ON) and deactivation (OFF). Scale bar =10 μm. (B) Enlarged images of the white boxed area in (A) Following local PA-Rac1 activation, Rab10-positive premacropinosomes were formed in the area. After PA-Rac1 OFF, a few Rab10-positive tubules extended from a premacropinosome (arrowheads). Scale bar = 2 μm. (C) Representative phase-contrast and EGFP-Rab10 fluorescence images of RAW264 cells during PA-Rac1 ON-OFF cycles. (D) Confocal time-lapse microscopy of EGFP-Rab10 in RAW264 cells during PA-Rac1 ON-OFF cycles. Selected frames from the time-lapse movie are presented. Elapsed times are shown in the frame. Scale bar = 10 μm. The corresponding movie is available in the Supplementary Material Movie 2 .

    Journal: Frontiers in Immunology

    Article Title: Rab10-Positive Tubular Structures Represent a Novel Endocytic Pathway That Diverges From Canonical Macropinocytosis in RAW264 Macrophages

    doi: 10.3389/fimmu.2021.649600

    Figure Lengend Snippet: Rab10 dynamics in live RAW264 cells under the optogenetic control of PA-Rac1 activity. (A) The blue boxed area of a cell expressing ECFP-PA-Rac1 was irradiated with a blue laser to photoactivate PA-Rac1. Phase-contrast (left) and mCherry-Rab10 (right) images were acquired at the indicated times after PA-Rac1 activation (ON) and deactivation (OFF). Scale bar =10 μm. (B) Enlarged images of the white boxed area in (A) Following local PA-Rac1 activation, Rab10-positive premacropinosomes were formed in the area. After PA-Rac1 OFF, a few Rab10-positive tubules extended from a premacropinosome (arrowheads). Scale bar = 2 μm. (C) Representative phase-contrast and EGFP-Rab10 fluorescence images of RAW264 cells during PA-Rac1 ON-OFF cycles. (D) Confocal time-lapse microscopy of EGFP-Rab10 in RAW264 cells during PA-Rac1 ON-OFF cycles. Selected frames from the time-lapse movie are presented. Elapsed times are shown in the frame. Scale bar = 10 μm. The corresponding movie is available in the Supplementary Material Movie 2 .

    Article Snippet: The pmCitrine-Rab4, pmCitrine-Rab5, pmCitrine-Rab7, pmCitrine-LAMP1, and pmCitrine-Akt-PH domain were provided by Dr. Joel A. Swanson (University of Michigan). pEGFP-Rab11 was provided by Dr. Marino Zerial (Max Planck Institute). pTriEx/mCherry-PA-Rac1 was obtained from Dr. Klaus Hahn through Addgene (Plasmid #22027, Cambridge, MA). pECFP-PA-Rac1 was created by the insertion of the PA-Rac1 fragment into pECFP-C1.

    Techniques: Activity Assay, Expressing, Irradiation, Activation Assay, Fluorescence, Time-lapse Microscopy