maxima hot start pcr master mix  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher maxima hot start pcr master mix
    Analysis of NDRG2 gene promoter methylation in PA samples. a Methylation frequency (%). b Hormone distribution of PAs in methylated and unmethylated NDRG2 promoter groups. PRL – prolactin, IGF-1 – insulin-like grow factor 1, GH – growth hormone, ACTH – adrenocorticotropic hormone, multiple – PAs secreting more than one hormone, NS – non-secreting PAs. c Representative <t>MS-PCR</t> for NDRG2 in PA samples. M indicates amplification of methylated alleles, U unmethylated alleles. M cont. – positive methylation control (Standard Bisulfite Converted Universal Methylated Human DNA), U cont. – negative methylation control (normal human peripheral lymphocytes), H2O – water control, I-VI designate PA samples
    Maxima Hot Start Pcr Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 52 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/maxima hot start pcr master mix/product/Thermo Fisher
    Average 99 stars, based on 52 article reviews
    Price from $9.99 to $1999.99
    maxima hot start pcr master mix - by Bioz Stars, 2020-03
    99/100 stars

    Images

    1) Product Images from "N-myc downstream-regulated gene 2 (NDRG2) promoter methylation and expression in pituitary adenoma"

    Article Title: N-myc downstream-regulated gene 2 (NDRG2) promoter methylation and expression in pituitary adenoma

    Journal: Diagnostic Pathology

    doi: 10.1186/s13000-017-0622-7

    Analysis of NDRG2 gene promoter methylation in PA samples. a Methylation frequency (%). b Hormone distribution of PAs in methylated and unmethylated NDRG2 promoter groups. PRL – prolactin, IGF-1 – insulin-like grow factor 1, GH – growth hormone, ACTH – adrenocorticotropic hormone, multiple – PAs secreting more than one hormone, NS – non-secreting PAs. c Representative MS-PCR for NDRG2 in PA samples. M indicates amplification of methylated alleles, U unmethylated alleles. M cont. – positive methylation control (Standard Bisulfite Converted Universal Methylated Human DNA), U cont. – negative methylation control (normal human peripheral lymphocytes), H2O – water control, I-VI designate PA samples
    Figure Legend Snippet: Analysis of NDRG2 gene promoter methylation in PA samples. a Methylation frequency (%). b Hormone distribution of PAs in methylated and unmethylated NDRG2 promoter groups. PRL – prolactin, IGF-1 – insulin-like grow factor 1, GH – growth hormone, ACTH – adrenocorticotropic hormone, multiple – PAs secreting more than one hormone, NS – non-secreting PAs. c Representative MS-PCR for NDRG2 in PA samples. M indicates amplification of methylated alleles, U unmethylated alleles. M cont. – positive methylation control (Standard Bisulfite Converted Universal Methylated Human DNA), U cont. – negative methylation control (normal human peripheral lymphocytes), H2O – water control, I-VI designate PA samples

    Techniques Used: Methylation, Mass Spectrometry, Polymerase Chain Reaction, Amplification

    Related Articles

    Amplification:

    Article Title: Co-circulation and simultaneous co-infection of dengue, chikungunya, and zika viruses in patients with febrile syndrome at the Colombian-Venezuelan border
    Article Snippet: Similarly, the Maxima® Hot Start Green PCR Master Mix (2X) enzyme (Thermo Scientific®) was used with 10 μmol of each of the following primers: MD1 (F-5’-TCA ATA TGC TGA AAC GCG AGA GAA ACC G-3′), rTS1 (F-5’-CCC GTA ACA CTT TGA TCG CT-3′), mTS2 (F-5’-CGC CAC AAG GGC CAT GAA CAG TTT-3′), TS3 (F-5′-TAA CAT GAG ACA GAG C-3′), and rTS4 (F-5’-TTC TCC CGT TCA GGA TGT TC-3′) and 2 μl of the cDNA from each of the samples. .. These primers amplify regions present in the gene that encode for the C-prM protein; the sizes expected for each amplified region were 208 bp (DENV-1), 119 bp (DENV-2), 288 bp (DENV-3), and 260 bp (DENV-4).

    Article Title: Assessment of Two Different Drinking Water Treatment Plants for the Removal of Free-living Amoebae, Egypt
    Article Snippet: .. Amplification of DNA was performed using Maxima™ Hot Start Green PCR Master Mix (Thermo Fisher Scientific Inc, Waltham, MA, USA) according to the manufacturer manual. .. PCR reaction mixture used per sample consisted of 25 μL Maxima Hot Start Green PCR Master Mix, 3 μL template DNA, 1 μL of each primer, and 20μL diethylpyrocarbonate (DEPC)-treated water.

    Article Title: Relationship between the Presence of Bartonella Species and Bacterial Loads in Cats and Cat Fleas ( Ctenocephalides felis) under Natural Conditions
    Article Snippet: The qPCRs were carried out with a 20-μl final volume containing 0.15 μl of a 10 μM solution of each primer, 0.6 μl of a 50 μM Syto9 solution (Invitrogen, Carlsbad, CA), 5.1 μl of ultrapure water (Sigma-Aldrich, St. Louis, MO), 10 μl of Maxima Hot-Start PCR Master Mix (2X) (Thermo Scientific, Surrey, United Kingdom), and 4 μl of each flea DNA sample. .. The amplification protocol was the same as for the ITS HRM qPCR assay.

    Article Title: How the initiating ribosome copes with ppGpp to translate mRNAs
    Article Snippet: .. mRNAs DNA templates for mRNAs were amplified by PCR using the Maxima Hot Start Green PCR Master Mix (K1062, ThermoScientific, Waltham, Massachusetts) and corresponding primers ( ). ..

    Article Title: Factors influencing Dipylidium sp. infection in a free-ranging social carnivore, the spotted hyaena (Crocuta crocuta)
    Article Snippet: Polymerase chain reactions (PCRs) were performed with approximately 20–40 ng template DNA in 50 μl reactions containing 6.25 μM of each primer, 1.25 units Maxima Hot Start PCR Mastermix (Fermentas GmbH, St. Leon-Rot, Germany) and nuclease free water. .. After an initial denaturation step for 4 min at 95 °C, amplification was carried out for 35 cycles as follows: denaturation for 30 s at 95 °C, annealing for 45 s at 55 °C and elongation for 1 min at 72 °C.

    Article Title: Presence of Rickettsia Species in a Marginalized Area of Yucatan, Mexico
    Article Snippet: The amplification of the extracted DNA was performed using the primers for the Rickettsia ARN 16S gene (fD1: AGAGTTTGATCCTGGCTCAG and Rc16S.452n: AACGTCATTATCTTCCTTGC primer pairs) and the glt A gene (RpCS.877p: GGGGGCCTGCTCACGGCGG and RpCS.1258n: ATTGCAAAAAGTACAGTGAACA primer pairs) [ ] to amplify 426bp and 381bp gene fragments, respectively. .. Conventional polymerase chain reaction was performed using Thermo Scientific Maxima Hot Start PCR Master Mix (2X) (Thermo Scientific, USA).

    Article Title: Dogs Leaving the ICU Carry a Very Large Multi-Drug Resistant Enterococcal Population with Capacity for Biofilm Formation and Horizontal Gene Transfer
    Article Snippet: .. Seven loci were PCR amplified according to the standard protocol ( http://efaecium.mlst.net/misc/info.asp ) using Maxima Hot Start PCR Master Mix (Fermentas Inc.). .. PCR products were purified using DNA Clean and Concentrator kit (Zymo Research Corp.).

    Article Title: MGMT, GATA6, CD81, DR4, and CASP8 gene promoter methylation in glioblastoma
    Article Snippet: PCR reaction was performed in a total volume of 20 μ L, using 10 μ L Maxima® Hot Start PCR Master Mix with Hot Start Taq DNA polymerase (Thermo Fisher Scientific, USA) and 10 μ M of each primer (Metabion International AG, Germany). .. MSP was performed for 38-40 cycles with start of 95 °C for 1 min, annealing for 1 min at temperature appropriate for an individual gene, and extension at 72 °C for 1 min. Amplification products were loaded on 2% agarose gels with ethidium bromide and after electrophoresis documented under UV.

    Positive Control:

    Article Title: MGMT, GATA6, CD81, DR4, and CASP8 gene promoter methylation in glioblastoma
    Article Snippet: As a positive control, standard Bisulfite Converted Universal Methylated Human DNA Standard (Zymo Research, USA) was used. .. PCR reaction was performed in a total volume of 20 μ L, using 10 μ L Maxima® Hot Start PCR Master Mix with Hot Start Taq DNA polymerase (Thermo Fisher Scientific, USA) and 10 μ M of each primer (Metabion International AG, Germany).

    Article Title: Phylogenetic evidence of the intercontinental circulation of a Canine distemper virus lineage in the Americas
    Article Snippet: PCR and sequencing Next, cDNAs from clinical specimens were screened by PCR of the phosphoprotein (P) gene using the Maxima Hot Start PCR Master Mix (2X) (Thermo Scientific®) reagent kit in accordance with the manufacturer’s instructions. .. PCR was performed on a ProFlex™ PCR Thermal Cycler (Applied Biosystems®) under the following conditions: initial denaturation at 95 °C for 4 min followed by 35 cycles of denaturation at 95 °C for 30 s, annealing at 50.8 °C for 30 s, extension at 72 °C for 1 min, and a final extension at 72 °C for 5 min. Ultrapure water was used as a negative control and cDNA from one of the vaccines as positive control.

    Synthesized:

    Article Title: Lipocalin-2 (24p3/Neutrophil Gelatinase-associated Lipocalin (NGAL)) Receptor Is Expressed in Distal Nephron and Mediates Protein Endocytosis *
    Article Snippet: .. cDNA was synthesized from 2 μg of total RNA, and RT-PCR was carried out with MaximaTM Hot Start Green PCR master mix (Fermentas). ..

    Electrophoresis:

    Article Title: MGMT, GATA6, CD81, DR4, and CASP8 gene promoter methylation in glioblastoma
    Article Snippet: PCR reaction was performed in a total volume of 20 μ L, using 10 μ L Maxima® Hot Start PCR Master Mix with Hot Start Taq DNA polymerase (Thermo Fisher Scientific, USA) and 10 μ M of each primer (Metabion International AG, Germany). .. MSP was performed for 38-40 cycles with start of 95 °C for 1 min, annealing for 1 min at temperature appropriate for an individual gene, and extension at 72 °C for 1 min. Amplification products were loaded on 2% agarose gels with ethidium bromide and after electrophoresis documented under UV.

    Multiplex Assay:

    Article Title: Co-circulation and simultaneous co-infection of dengue, chikungunya, and zika viruses in patients with febrile syndrome at the Colombian-Venezuelan border
    Article Snippet: Paragraph title: Multiplex PCR for serotyping of DENV ... Similarly, the Maxima® Hot Start Green PCR Master Mix (2X) enzyme (Thermo Scientific®) was used with 10 μmol of each of the following primers: MD1 (F-5’-TCA ATA TGC TGA AAC GCG AGA GAA ACC G-3′), rTS1 (F-5’-CCC GTA ACA CTT TGA TCG CT-3′), mTS2 (F-5’-CGC CAC AAG GGC CAT GAA CAG TTT-3′), TS3 (F-5′-TAA CAT GAG ACA GAG C-3′), and rTS4 (F-5’-TTC TCC CGT TCA GGA TGT TC-3′) and 2 μl of the cDNA from each of the samples.

    Article Title: Characterization of Diarrheagenic Enteroaggregative Escherichia coli in Danish Adults—Antibiotic Treatment Does Not Reduce Duration of Diarrhea
    Article Snippet: .. Multiplex (QIAGEN, Copenhagen, Denmark) and singleplex amplifications (Maxima Hot Start PCR master mix, Thermo Scientific Inc.) were performed according to the manufacturer's instructions, with annealing temperatures at 57°C and 1 min annealing. .. The PCR products were separated in 2% agarose gels and run for 1–1.5 h at 100 V.

    Mass Spectrometry:

    Article Title: Testin (TES) as a candidate tumour suppressor and prognostic marker in human astrocytoma
    Article Snippet: .. MS-PCR was performed in a total volume of 15 µl, using 7.5 µl Maxima Hot Start Green PCR Master Mix (2X) with Hot Start Taq DNA Polymerase (Thermo Fisher Scientific, Inc., Waltham, MA, USA) and 10 pmol of each primer (Metabion International AG, Steinkirchen, Germany). .. The cycling conditions were as follows: Initial denaturation at 95°C for 5 min, followed by 36 cycles of 94°C for 15 sec, 62°C for 30 sec and 72°C for 15 sec, and a final step at 72°C for 5 min. For each set of MS-PCR, human blood lymphocyte DNA treated with bisulfite (Zymo Research Corporation) served as an unmethylated DNA control, and as a positive methylation control, Bisulfite-converted Universal Methylated Human DNA Standard (Zymo Research Corporation) was used.

    Modification:

    Article Title: Characterization of Diarrheagenic Enteroaggregative Escherichia coli in Danish Adults—Antibiotic Treatment Does Not Reduce Duration of Diarrhea
    Article Snippet: The digoxigenin-labeled probes had previously been described by Boisen et al. ( ) and the DNA-colony hybridization was modified from Struve et al. ( ). .. Multiplex (QIAGEN, Copenhagen, Denmark) and singleplex amplifications (Maxima Hot Start PCR master mix, Thermo Scientific Inc.) were performed according to the manufacturer's instructions, with annealing temperatures at 57°C and 1 min annealing.

    Hybridization:

    Article Title: Characterization of Diarrheagenic Enteroaggregative Escherichia coli in Danish Adults—Antibiotic Treatment Does Not Reduce Duration of Diarrhea
    Article Snippet: The digoxigenin-labeled probes had previously been described by Boisen et al. ( ) and the DNA-colony hybridization was modified from Struve et al. ( ). .. Multiplex (QIAGEN, Copenhagen, Denmark) and singleplex amplifications (Maxima Hot Start PCR master mix, Thermo Scientific Inc.) were performed according to the manufacturer's instructions, with annealing temperatures at 57°C and 1 min annealing.

    Generated:

    Article Title: Factors influencing Dipylidium sp. infection in a free-ranging social carnivore, the spotted hyaena (Crocuta crocuta)
    Article Snippet: Polymerase chain reactions (PCRs) were performed with approximately 20–40 ng template DNA in 50 μl reactions containing 6.25 μM of each primer, 1.25 units Maxima Hot Start PCR Mastermix (Fermentas GmbH, St. Leon-Rot, Germany) and nuclease free water. .. The PCR program comprised an initial denaturation step of 4 min at 95 °C, 35 cycles at 94 °C for 60 s, 55 °C for 45 s and 55 °C for 45 s, followed by a final extension step at 72 °C for 4 min. We then used the sequence data we generated for this short fragment plus recently published sequence data of the complete mitochondrial gene from D. caninum ( , GenBank Accession No. AB732959.1) to design two new primer pairs (Dca_rrnL1 – 4) to obtain a longer fragment that included the complete mitochondrial 12S rRNA gene plus a large section of the 16S rRNA gene.

    Polymerase Chain Reaction:

    Article Title: Co-circulation and simultaneous co-infection of dengue, chikungunya, and zika viruses in patients with febrile syndrome at the Colombian-Venezuelan border
    Article Snippet: .. Similarly, the Maxima® Hot Start Green PCR Master Mix (2X) enzyme (Thermo Scientific®) was used with 10 μmol of each of the following primers: MD1 (F-5’-TCA ATA TGC TGA AAC GCG AGA GAA ACC G-3′), rTS1 (F-5’-CCC GTA ACA CTT TGA TCG CT-3′), mTS2 (F-5’-CGC CAC AAG GGC CAT GAA CAG TTT-3′), TS3 (F-5′-TAA CAT GAG ACA GAG C-3′), and rTS4 (F-5’-TTC TCC CGT TCA GGA TGT TC-3′) and 2 μl of the cDNA from each of the samples. .. These primers amplify regions present in the gene that encode for the C-prM protein; the sizes expected for each amplified region were 208 bp (DENV-1), 119 bp (DENV-2), 288 bp (DENV-3), and 260 bp (DENV-4).

    Article Title: Characterization of Diarrheagenic Enteroaggregative Escherichia coli in Danish Adults—Antibiotic Treatment Does Not Reduce Duration of Diarrhea
    Article Snippet: Further characterization of the EAEC strains was performed by additional PCR, targeting the genes sat, sepA, pic, sigA, pet, astA, aap, agg3/4C, agg3A, aafA, aggA, agg4A , and agg5A as previously described (Boisen et al., ; Jønsson et al., ) with modifications. .. Multiplex (QIAGEN, Copenhagen, Denmark) and singleplex amplifications (Maxima Hot Start PCR master mix, Thermo Scientific Inc.) were performed according to the manufacturer's instructions, with annealing temperatures at 57°C and 1 min annealing.

    Article Title: Assessment of Two Different Drinking Water Treatment Plants for the Removal of Free-living Amoebae, Egypt
    Article Snippet: .. Amplification of DNA was performed using Maxima™ Hot Start Green PCR Master Mix (Thermo Fisher Scientific Inc, Waltham, MA, USA) according to the manufacturer manual. .. PCR reaction mixture used per sample consisted of 25 μL Maxima Hot Start Green PCR Master Mix, 3 μL template DNA, 1 μL of each primer, and 20μL diethylpyrocarbonate (DEPC)-treated water.

    Article Title: Testin (TES) as a candidate tumour suppressor and prognostic marker in human astrocytoma
    Article Snippet: .. MS-PCR was performed in a total volume of 15 µl, using 7.5 µl Maxima Hot Start Green PCR Master Mix (2X) with Hot Start Taq DNA Polymerase (Thermo Fisher Scientific, Inc., Waltham, MA, USA) and 10 pmol of each primer (Metabion International AG, Steinkirchen, Germany). .. The cycling conditions were as follows: Initial denaturation at 95°C for 5 min, followed by 36 cycles of 94°C for 15 sec, 62°C for 30 sec and 72°C for 15 sec, and a final step at 72°C for 5 min. For each set of MS-PCR, human blood lymphocyte DNA treated with bisulfite (Zymo Research Corporation) served as an unmethylated DNA control, and as a positive methylation control, Bisulfite-converted Universal Methylated Human DNA Standard (Zymo Research Corporation) was used.

    Article Title: Assessment of Two Different Drinking Water Treatment Plants for the Removal of Free-living Amoebae, Egypt
    Article Snippet: .. PCR reaction mixture used per sample consisted of 25 μL Maxima Hot Start Green PCR Master Mix, 3 μL template DNA, 1 μL of each primer, and 20μL diethylpyrocarbonate (DEPC)-treated water. ..

    Article Title: How the initiating ribosome copes with ppGpp to translate mRNAs
    Article Snippet: .. mRNAs DNA templates for mRNAs were amplified by PCR using the Maxima Hot Start Green PCR Master Mix (K1062, ThermoScientific, Waltham, Massachusetts) and corresponding primers ( ). ..

    Article Title: Factors influencing Dipylidium sp. infection in a free-ranging social carnivore, the spotted hyaena (Crocuta crocuta)
    Article Snippet: Polymerase chain reactions (PCRs) were performed with approximately 20–40 ng template DNA in 50 μl reactions containing 6.25 μM of each primer, 1.25 units Maxima Hot Start PCR Mastermix (Fermentas GmbH, St. Leon-Rot, Germany) and nuclease free water. .. The PCR program comprised an initial denaturation step of 4 min at 95 °C, 35 cycles at 94 °C for 60 s, 55 °C for 45 s and 55 °C for 45 s, followed by a final extension step at 72 °C for 4 min. We then used the sequence data we generated for this short fragment plus recently published sequence data of the complete mitochondrial gene from D. caninum ( , GenBank Accession No. AB732959.1) to design two new primer pairs (Dca_rrnL1 – 4) to obtain a longer fragment that included the complete mitochondrial 12S rRNA gene plus a large section of the 16S rRNA gene.

    Article Title: Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants
    Article Snippet: .. Colony PCR and sequencing Positive assemblies were confirmed by colony PCR using KAPA Taq PCR Kits (Kapa Biosystems) or Maxima Hot Start Green PCR Master Mix (Thermo Fisher Scientific) following the manufacturer’s protocols. .. For further verification, plasmids were isolated from positive colonies using GeneElute Plasmid Miniprep Kit (Sigma) or NucleoSpin Plasmid Easy Pure (Macherey-Nagel) and analysed by sequencing.

    Article Title: Presence of Rickettsia Species in a Marginalized Area of Yucatan, Mexico
    Article Snippet: .. Conventional polymerase chain reaction was performed using Thermo Scientific Maxima Hot Start PCR Master Mix (2X) (Thermo Scientific, USA). .. The obtained PCR products were purified using a Zymoclean™ Gel DNA Recovery Kit (Zymo Research, USA) and then direct-sequenced using an ABI PRISM™ 310 Genetic Analyzer (Applied Biosystems, USA).

    Article Title: Dogs Leaving the ICU Carry a Very Large Multi-Drug Resistant Enterococcal Population with Capacity for Biofilm Formation and Horizontal Gene Transfer
    Article Snippet: .. Seven loci were PCR amplified according to the standard protocol ( http://efaecium.mlst.net/misc/info.asp ) using Maxima Hot Start PCR Master Mix (Fermentas Inc.). .. PCR products were purified using DNA Clean and Concentrator kit (Zymo Research Corp.).

    Article Title: MGMT, GATA6, CD81, DR4, and CASP8 gene promoter methylation in glioblastoma
    Article Snippet: .. PCR reaction was performed in a total volume of 20 μ L, using 10 μ L Maxima® Hot Start PCR Master Mix with Hot Start Taq DNA polymerase (Thermo Fisher Scientific, USA) and 10 μ M of each primer (Metabion International AG, Germany). .. MSP was performed for 38-40 cycles with start of 95 °C for 1 min, annealing for 1 min at temperature appropriate for an individual gene, and extension at 72 °C for 1 min. Amplification products were loaded on 2% agarose gels with ethidium bromide and after electrophoresis documented under UV.

    Article Title: Lipocalin-2 (24p3/Neutrophil Gelatinase-associated Lipocalin (NGAL)) Receptor Is Expressed in Distal Nephron and Mediates Protein Endocytosis *
    Article Snippet: .. cDNA was synthesized from 2 μg of total RNA, and RT-PCR was carried out with MaximaTM Hot Start Green PCR master mix (Fermentas). ..

    Article Title: Phylogenetic evidence of the intercontinental circulation of a Canine distemper virus lineage in the Americas
    Article Snippet: .. In all cases, 4 µl cDNA was added to a PCR reaction mix, which consisted of 25 µl Maxima Hot Start PCR Master Mix (2X), 15 µl nuclease-free water and 3 µl (10 µM) of each of the primers (Table ). .. PCR was performed on ProFlex™ PCR Thermal Cycler (Applied Biosystems®) under the following conditions: initial denaturation at 95 °C for 4 min followed by 35 cycles of denaturation at 95 °C for 30 s, annealing for 30 s, extension at 72 °C for 2 min, and a final extension at 72 °C for 10 min.

    Article Title: Phylogenetic evidence of the intercontinental circulation of a Canine distemper virus lineage in the Americas
    Article Snippet: .. PCR and sequencing Next, cDNAs from clinical specimens were screened by PCR of the phosphoprotein (P) gene using the Maxima Hot Start PCR Master Mix (2X) (Thermo Scientific®) reagent kit in accordance with the manufacturer’s instructions. ..

    Sequencing:

    Article Title: Factors influencing Dipylidium sp. infection in a free-ranging social carnivore, the spotted hyaena (Crocuta crocuta)
    Article Snippet: To compare sequence data from Dipylidium sp. obtained from spotted hyaenas in Tanzania to sequence data for the same gene fragment of D. caninum in GenBank we extracted total DNA from proglottids using a NucleoSpin Soil kit (Macherey–Nagel, Düren, Germany) following the manufacturer’s instructions. .. Polymerase chain reactions (PCRs) were performed with approximately 20–40 ng template DNA in 50 μl reactions containing 6.25 μM of each primer, 1.25 units Maxima Hot Start PCR Mastermix (Fermentas GmbH, St. Leon-Rot, Germany) and nuclease free water.

    Article Title: Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants
    Article Snippet: .. Colony PCR and sequencing Positive assemblies were confirmed by colony PCR using KAPA Taq PCR Kits (Kapa Biosystems) or Maxima Hot Start Green PCR Master Mix (Thermo Fisher Scientific) following the manufacturer’s protocols. .. For further verification, plasmids were isolated from positive colonies using GeneElute Plasmid Miniprep Kit (Sigma) or NucleoSpin Plasmid Easy Pure (Macherey-Nagel) and analysed by sequencing.

    Article Title: Presence of Rickettsia Species in a Marginalized Area of Yucatan, Mexico
    Article Snippet: Paragraph title: 2.6. Detection of Rickettsia by PCR and Sequencing ... Conventional polymerase chain reaction was performed using Thermo Scientific Maxima Hot Start PCR Master Mix (2X) (Thermo Scientific, USA).

    Article Title: Dogs Leaving the ICU Carry a Very Large Multi-Drug Resistant Enterococcal Population with Capacity for Biofilm Formation and Horizontal Gene Transfer
    Article Snippet: Paragraph title: Genotyping by multi-locus sequence typing (MLST) ... Seven loci were PCR amplified according to the standard protocol ( http://efaecium.mlst.net/misc/info.asp ) using Maxima Hot Start PCR Master Mix (Fermentas Inc.).

    Article Title: MGMT, GATA6, CD81, DR4, and CASP8 gene promoter methylation in glioblastoma
    Article Snippet: Specific for methylated and unmethylated DNA sequence primers are listed in Table and were obtained from published data (for MGMT [ ], CD81 [ ], GATA6 [ ], DR4 [ ], and CASP8 [ ]). .. PCR reaction was performed in a total volume of 20 μ L, using 10 μ L Maxima® Hot Start PCR Master Mix with Hot Start Taq DNA polymerase (Thermo Fisher Scientific, USA) and 10 μ M of each primer (Metabion International AG, Germany).

    Article Title: Phylogenetic evidence of the intercontinental circulation of a Canine distemper virus lineage in the Americas
    Article Snippet: .. PCR and sequencing Next, cDNAs from clinical specimens were screened by PCR of the phosphoprotein (P) gene using the Maxima Hot Start PCR Master Mix (2X) (Thermo Scientific®) reagent kit in accordance with the manufacturer’s instructions. ..

    DNA Extraction:

    Article Title: Assessment of Two Different Drinking Water Treatment Plants for the Removal of Free-living Amoebae, Egypt
    Article Snippet: Paragraph title: DNA extraction and Polymerase Chain Reaction ... Amplification of DNA was performed using Maxima™ Hot Start Green PCR Master Mix (Thermo Fisher Scientific Inc, Waltham, MA, USA) according to the manufacturer manual.

    Article Title: Relationship between the Presence of Bartonella Species and Bacterial Loads in Cats and Cat Fleas ( Ctenocephalides felis) under Natural Conditions
    Article Snippet: The variability in flea size between the samples, which could potentially affect the DNA extraction yield, was corrected by targeting an internal reference gene of C. felis in a real-time PCR assay (see data analysis section below). .. The qPCRs were carried out with a 20-μl final volume containing 0.15 μl of a 10 μM solution of each primer, 0.6 μl of a 50 μM Syto9 solution (Invitrogen, Carlsbad, CA), 5.1 μl of ultrapure water (Sigma-Aldrich, St. Louis, MO), 10 μl of Maxima Hot-Start PCR Master Mix (2X) (Thermo Scientific, Surrey, United Kingdom), and 4 μl of each flea DNA sample.

    Methylation:

    Article Title: Testin (TES) as a candidate tumour suppressor and prognostic marker in human astrocytoma
    Article Snippet: Primers distinguishing unmethylated from methylated alleles were previously published by Ma et al , and their sequences were as follows: Methylated forward: 5′-TATTGAGTTTGTTTAGTAGGGCGTC-3′ and reverse: 5′-AATAACAACCGAACAACTCCG-3′; and unmethylated forward: 5′-TGAGTTTGTTTAGTAGGGTGTTG-3′ and reverse: 5′-ATAACAACCAAACAACTCCAA-3′. .. MS-PCR was performed in a total volume of 15 µl, using 7.5 µl Maxima Hot Start Green PCR Master Mix (2X) with Hot Start Taq DNA Polymerase (Thermo Fisher Scientific, Inc., Waltham, MA, USA) and 10 pmol of each primer (Metabion International AG, Steinkirchen, Germany).

    Article Title: MGMT, GATA6, CD81, DR4, and CASP8 gene promoter methylation in glioblastoma
    Article Snippet: Paragraph title: Methylation-specific PCR ... PCR reaction was performed in a total volume of 20 μ L, using 10 μ L Maxima® Hot Start PCR Master Mix with Hot Start Taq DNA polymerase (Thermo Fisher Scientific, USA) and 10 μ M of each primer (Metabion International AG, Germany).

    Isolation:

    Article Title: Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants
    Article Snippet: Colony PCR and sequencing Positive assemblies were confirmed by colony PCR using KAPA Taq PCR Kits (Kapa Biosystems) or Maxima Hot Start Green PCR Master Mix (Thermo Fisher Scientific) following the manufacturer’s protocols. .. For further verification, plasmids were isolated from positive colonies using GeneElute Plasmid Miniprep Kit (Sigma) or NucleoSpin Plasmid Easy Pure (Macherey-Nagel) and analysed by sequencing.

    Size-exclusion Chromatography:

    Article Title: Testin (TES) as a candidate tumour suppressor and prognostic marker in human astrocytoma
    Article Snippet: MS-PCR was performed in a total volume of 15 µl, using 7.5 µl Maxima Hot Start Green PCR Master Mix (2X) with Hot Start Taq DNA Polymerase (Thermo Fisher Scientific, Inc., Waltham, MA, USA) and 10 pmol of each primer (Metabion International AG, Steinkirchen, Germany). .. The cycling conditions were as follows: Initial denaturation at 95°C for 5 min, followed by 36 cycles of 94°C for 15 sec, 62°C for 30 sec and 72°C for 15 sec, and a final step at 72°C for 5 min. For each set of MS-PCR, human blood lymphocyte DNA treated with bisulfite (Zymo Research Corporation) served as an unmethylated DNA control, and as a positive methylation control, Bisulfite-converted Universal Methylated Human DNA Standard (Zymo Research Corporation) was used.

    Purification:

    Article Title: How the initiating ribosome copes with ppGpp to translate mRNAs
    Article Snippet: mRNAs DNA templates for mRNAs were amplified by PCR using the Maxima Hot Start Green PCR Master Mix (K1062, ThermoScientific, Waltham, Massachusetts) and corresponding primers ( ). .. PCR products were purified using the GeneJET PCR Purification Kit (K0702, ThermoScientific, Waltham, Massachusetts) ( ). mRNAs were produced by in vitro transcription for 3 hours at 37°C.

    Article Title: Presence of Rickettsia Species in a Marginalized Area of Yucatan, Mexico
    Article Snippet: Conventional polymerase chain reaction was performed using Thermo Scientific Maxima Hot Start PCR Master Mix (2X) (Thermo Scientific, USA). .. The obtained PCR products were purified using a Zymoclean™ Gel DNA Recovery Kit (Zymo Research, USA) and then direct-sequenced using an ABI PRISM™ 310 Genetic Analyzer (Applied Biosystems, USA).

    Article Title: Dogs Leaving the ICU Carry a Very Large Multi-Drug Resistant Enterococcal Population with Capacity for Biofilm Formation and Horizontal Gene Transfer
    Article Snippet: Seven loci were PCR amplified according to the standard protocol ( http://efaecium.mlst.net/misc/info.asp ) using Maxima Hot Start PCR Master Mix (Fermentas Inc.). .. PCR products were purified using DNA Clean and Concentrator kit (Zymo Research Corp.).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Lipocalin-2 (24p3/Neutrophil Gelatinase-associated Lipocalin (NGAL)) Receptor Is Expressed in Distal Nephron and Mediates Protein Endocytosis *
    Article Snippet: .. cDNA was synthesized from 2 μg of total RNA, and RT-PCR was carried out with MaximaTM Hot Start Green PCR master mix (Fermentas). ..

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Co-circulation and simultaneous co-infection of dengue, chikungunya, and zika viruses in patients with febrile syndrome at the Colombian-Venezuelan border
    Article Snippet: .. Similarly, the Maxima® Hot Start Green PCR Master Mix (2X) enzyme (Thermo Scientific®) was used with 10 μmol of each of the following primers: MD1 (F-5’-TCA ATA TGC TGA AAC GCG AGA GAA ACC G-3′), rTS1 (F-5’-CCC GTA ACA CTT TGA TCG CT-3′), mTS2 (F-5’-CGC CAC AAG GGC CAT GAA CAG TTT-3′), TS3 (F-5′-TAA CAT GAG ACA GAG C-3′), and rTS4 (F-5’-TTC TCC CGT TCA GGA TGT TC-3′) and 2 μl of the cDNA from each of the samples. .. These primers amplify regions present in the gene that encode for the C-prM protein; the sizes expected for each amplified region were 208 bp (DENV-1), 119 bp (DENV-2), 288 bp (DENV-3), and 260 bp (DENV-4).

    Hot Start PCR:

    Article Title: Characterization of Diarrheagenic Enteroaggregative Escherichia coli in Danish Adults—Antibiotic Treatment Does Not Reduce Duration of Diarrhea
    Article Snippet: .. Multiplex (QIAGEN, Copenhagen, Denmark) and singleplex amplifications (Maxima Hot Start PCR master mix, Thermo Scientific Inc.) were performed according to the manufacturer's instructions, with annealing temperatures at 57°C and 1 min annealing. .. The PCR products were separated in 2% agarose gels and run for 1–1.5 h at 100 V.

    Article Title: Relationship between the Presence of Bartonella Species and Bacterial Loads in Cats and Cat Fleas ( Ctenocephalides felis) under Natural Conditions
    Article Snippet: .. The qPCRs were carried out with a 20-μl final volume containing 0.15 μl of a 10 μM solution of each primer, 0.6 μl of a 50 μM Syto9 solution (Invitrogen, Carlsbad, CA), 5.1 μl of ultrapure water (Sigma-Aldrich, St. Louis, MO), 10 μl of Maxima Hot-Start PCR Master Mix (2X) (Thermo Scientific, Surrey, United Kingdom), and 4 μl of each flea DNA sample. .. The amplification protocol was the same as for the ITS HRM qPCR assay.

    Article Title: Factors influencing Dipylidium sp. infection in a free-ranging social carnivore, the spotted hyaena (Crocuta crocuta)
    Article Snippet: .. Polymerase chain reactions (PCRs) were performed with approximately 20–40 ng template DNA in 50 μl reactions containing 6.25 μM of each primer, 1.25 units Maxima Hot Start PCR Mastermix (Fermentas GmbH, St. Leon-Rot, Germany) and nuclease free water. .. The PCR program comprised an initial denaturation step of 4 min at 95 °C, 35 cycles at 94 °C for 60 s, 55 °C for 45 s and 55 °C for 45 s, followed by a final extension step at 72 °C for 4 min. We then used the sequence data we generated for this short fragment plus recently published sequence data of the complete mitochondrial gene from D. caninum ( , GenBank Accession No. AB732959.1) to design two new primer pairs (Dca_rrnL1 – 4) to obtain a longer fragment that included the complete mitochondrial 12S rRNA gene plus a large section of the 16S rRNA gene.

    Article Title: Presence of Rickettsia Species in a Marginalized Area of Yucatan, Mexico
    Article Snippet: .. Conventional polymerase chain reaction was performed using Thermo Scientific Maxima Hot Start PCR Master Mix (2X) (Thermo Scientific, USA). .. The obtained PCR products were purified using a Zymoclean™ Gel DNA Recovery Kit (Zymo Research, USA) and then direct-sequenced using an ABI PRISM™ 310 Genetic Analyzer (Applied Biosystems, USA).

    Article Title: Dogs Leaving the ICU Carry a Very Large Multi-Drug Resistant Enterococcal Population with Capacity for Biofilm Formation and Horizontal Gene Transfer
    Article Snippet: .. Seven loci were PCR amplified according to the standard protocol ( http://efaecium.mlst.net/misc/info.asp ) using Maxima Hot Start PCR Master Mix (Fermentas Inc.). .. PCR products were purified using DNA Clean and Concentrator kit (Zymo Research Corp.).

    Article Title: MGMT, GATA6, CD81, DR4, and CASP8 gene promoter methylation in glioblastoma
    Article Snippet: .. PCR reaction was performed in a total volume of 20 μ L, using 10 μ L Maxima® Hot Start PCR Master Mix with Hot Start Taq DNA polymerase (Thermo Fisher Scientific, USA) and 10 μ M of each primer (Metabion International AG, Germany). .. MSP was performed for 38-40 cycles with start of 95 °C for 1 min, annealing for 1 min at temperature appropriate for an individual gene, and extension at 72 °C for 1 min. Amplification products were loaded on 2% agarose gels with ethidium bromide and after electrophoresis documented under UV.

    Article Title: Phylogenetic evidence of the intercontinental circulation of a Canine distemper virus lineage in the Americas
    Article Snippet: .. In all cases, 4 µl cDNA was added to a PCR reaction mix, which consisted of 25 µl Maxima Hot Start PCR Master Mix (2X), 15 µl nuclease-free water and 3 µl (10 µM) of each of the primers (Table ). .. PCR was performed on ProFlex™ PCR Thermal Cycler (Applied Biosystems®) under the following conditions: initial denaturation at 95 °C for 4 min followed by 35 cycles of denaturation at 95 °C for 30 s, annealing for 30 s, extension at 72 °C for 2 min, and a final extension at 72 °C for 10 min.

    Article Title: Phylogenetic evidence of the intercontinental circulation of a Canine distemper virus lineage in the Americas
    Article Snippet: .. PCR and sequencing Next, cDNAs from clinical specimens were screened by PCR of the phosphoprotein (P) gene using the Maxima Hot Start PCR Master Mix (2X) (Thermo Scientific®) reagent kit in accordance with the manufacturer’s instructions. ..

    Plasmid Preparation:

    Article Title: Characterization of Diarrheagenic Enteroaggregative Escherichia coli in Danish Adults—Antibiotic Treatment Does Not Reduce Duration of Diarrhea
    Article Snippet: The characterization involved detection of the SPATEs including sat (secreted autotransporter toxin), sepA (Shigella extracellular protein), pic (serine protease precursor), sigA (IgA protease homolog), pet (plasmid encoded protein), and the astA gene, (EAEC heat-stable toxin). .. Multiplex (QIAGEN, Copenhagen, Denmark) and singleplex amplifications (Maxima Hot Start PCR master mix, Thermo Scientific Inc.) were performed according to the manufacturer's instructions, with annealing temperatures at 57°C and 1 min annealing.

    Article Title: Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants
    Article Snippet: Colony PCR and sequencing Positive assemblies were confirmed by colony PCR using KAPA Taq PCR Kits (Kapa Biosystems) or Maxima Hot Start Green PCR Master Mix (Thermo Fisher Scientific) following the manufacturer’s protocols. .. For further verification, plasmids were isolated from positive colonies using GeneElute Plasmid Miniprep Kit (Sigma) or NucleoSpin Plasmid Easy Pure (Macherey-Nagel) and analysed by sequencing.

    Software:

    Article Title: Relationship between the Presence of Bartonella Species and Bacterial Loads in Cats and Cat Fleas ( Ctenocephalides felis) under Natural Conditions
    Article Snippet: The qPCRs were carried out with a 20-μl final volume containing 0.15 μl of a 10 μM solution of each primer, 0.6 μl of a 50 μM Syto9 solution (Invitrogen, Carlsbad, CA), 5.1 μl of ultrapure water (Sigma-Aldrich, St. Louis, MO), 10 μl of Maxima Hot-Start PCR Master Mix (2X) (Thermo Scientific, Surrey, United Kingdom), and 4 μl of each flea DNA sample. .. Threshold values were adjusted manually and baselines were fixed automatically according the StepOnePlus software version 2.2.2.

    Real-time Polymerase Chain Reaction:

    Article Title: Relationship between the Presence of Bartonella Species and Bacterial Loads in Cats and Cat Fleas ( Ctenocephalides felis) under Natural Conditions
    Article Snippet: Paragraph title: Real-time PCR for C. felis DNA. ... The qPCRs were carried out with a 20-μl final volume containing 0.15 μl of a 10 μM solution of each primer, 0.6 μl of a 50 μM Syto9 solution (Invitrogen, Carlsbad, CA), 5.1 μl of ultrapure water (Sigma-Aldrich, St. Louis, MO), 10 μl of Maxima Hot-Start PCR Master Mix (2X) (Thermo Scientific, Surrey, United Kingdom), and 4 μl of each flea DNA sample.

    Negative Control:

    Article Title: MGMT, GATA6, CD81, DR4, and CASP8 gene promoter methylation in glioblastoma
    Article Snippet: Normal human blood lymphocyte DNA treated with bisulfite served as a negative control. .. PCR reaction was performed in a total volume of 20 μ L, using 10 μ L Maxima® Hot Start PCR Master Mix with Hot Start Taq DNA polymerase (Thermo Fisher Scientific, USA) and 10 μ M of each primer (Metabion International AG, Germany).

    Article Title: Phylogenetic evidence of the intercontinental circulation of a Canine distemper virus lineage in the Americas
    Article Snippet: PCR and sequencing Next, cDNAs from clinical specimens were screened by PCR of the phosphoprotein (P) gene using the Maxima Hot Start PCR Master Mix (2X) (Thermo Scientific®) reagent kit in accordance with the manufacturer’s instructions. .. PCR was performed on a ProFlex™ PCR Thermal Cycler (Applied Biosystems®) under the following conditions: initial denaturation at 95 °C for 4 min followed by 35 cycles of denaturation at 95 °C for 30 s, annealing at 50.8 °C for 30 s, extension at 72 °C for 1 min, and a final extension at 72 °C for 5 min. Ultrapure water was used as a negative control and cDNA from one of the vaccines as positive control.

    Positron Emission Tomography:

    Article Title: Characterization of Diarrheagenic Enteroaggregative Escherichia coli in Danish Adults—Antibiotic Treatment Does Not Reduce Duration of Diarrhea
    Article Snippet: The characterization involved detection of the SPATEs including sat (secreted autotransporter toxin), sepA (Shigella extracellular protein), pic (serine protease precursor), sigA (IgA protease homolog), pet (plasmid encoded protein), and the astA gene, (EAEC heat-stable toxin). .. Multiplex (QIAGEN, Copenhagen, Denmark) and singleplex amplifications (Maxima Hot Start PCR master mix, Thermo Scientific Inc.) were performed according to the manufacturer's instructions, with annealing temperatures at 57°C and 1 min annealing.

    In Vitro:

    Article Title: How the initiating ribosome copes with ppGpp to translate mRNAs
    Article Snippet: mRNAs DNA templates for mRNAs were amplified by PCR using the Maxima Hot Start Green PCR Master Mix (K1062, ThermoScientific, Waltham, Massachusetts) and corresponding primers ( ). .. PCR products were purified using the GeneJET PCR Purification Kit (K0702, ThermoScientific, Waltham, Massachusetts) ( ). mRNAs were produced by in vitro transcription for 3 hours at 37°C.

    Homogenization:

    Article Title: Factors influencing Dipylidium sp. infection in a free-ranging social carnivore, the spotted hyaena (Crocuta crocuta)
    Article Snippet: This procedure included a homogenisation step (Precellys 24, Bertin Technologies, Montigny-le-Bretonneux, France) to break cestode cells. .. Polymerase chain reactions (PCRs) were performed with approximately 20–40 ng template DNA in 50 μl reactions containing 6.25 μM of each primer, 1.25 units Maxima Hot Start PCR Mastermix (Fermentas GmbH, St. Leon-Rot, Germany) and nuclease free water.

    Spectrophotometry:

    Article Title: Factors influencing Dipylidium sp. infection in a free-ranging social carnivore, the spotted hyaena (Crocuta crocuta)
    Article Snippet: DNA concentration and quality were assessed using a NanoDrop ND-1000 spectrophotometer (NanoDrop, Wilmington, DE, USA). .. Polymerase chain reactions (PCRs) were performed with approximately 20–40 ng template DNA in 50 μl reactions containing 6.25 μM of each primer, 1.25 units Maxima Hot Start PCR Mastermix (Fermentas GmbH, St. Leon-Rot, Germany) and nuclease free water.

    Article Title: Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants
    Article Snippet: Colony PCR and sequencing Positive assemblies were confirmed by colony PCR using KAPA Taq PCR Kits (Kapa Biosystems) or Maxima Hot Start Green PCR Master Mix (Thermo Fisher Scientific) following the manufacturer’s protocols. .. DNA concentration and purity were evaluated using NanoDrop ND1000 spectrophotometer (Nanodrop technologies).

    Produced:

    Article Title: How the initiating ribosome copes with ppGpp to translate mRNAs
    Article Snippet: mRNAs DNA templates for mRNAs were amplified by PCR using the Maxima Hot Start Green PCR Master Mix (K1062, ThermoScientific, Waltham, Massachusetts) and corresponding primers ( ). .. PCR products were purified using the GeneJET PCR Purification Kit (K0702, ThermoScientific, Waltham, Massachusetts) ( ). mRNAs were produced by in vitro transcription for 3 hours at 37°C.

    Concentration Assay:

    Article Title: Factors influencing Dipylidium sp. infection in a free-ranging social carnivore, the spotted hyaena (Crocuta crocuta)
    Article Snippet: DNA concentration and quality were assessed using a NanoDrop ND-1000 spectrophotometer (NanoDrop, Wilmington, DE, USA). .. Polymerase chain reactions (PCRs) were performed with approximately 20–40 ng template DNA in 50 μl reactions containing 6.25 μM of each primer, 1.25 units Maxima Hot Start PCR Mastermix (Fermentas GmbH, St. Leon-Rot, Germany) and nuclease free water.

    Article Title: Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants
    Article Snippet: Colony PCR and sequencing Positive assemblies were confirmed by colony PCR using KAPA Taq PCR Kits (Kapa Biosystems) or Maxima Hot Start Green PCR Master Mix (Thermo Fisher Scientific) following the manufacturer’s protocols. .. DNA concentration and purity were evaluated using NanoDrop ND1000 spectrophotometer (Nanodrop technologies).

    CTG Assay:

    Article Title: Factors influencing Dipylidium sp. infection in a free-ranging social carnivore, the spotted hyaena (Crocuta crocuta)
    Article Snippet: Polymerase chain reactions (PCRs) were performed with approximately 20–40 ng template DNA in 50 μl reactions containing 6.25 μM of each primer, 1.25 units Maxima Hot Start PCR Mastermix (Fermentas GmbH, St. Leon-Rot, Germany) and nuclease free water. .. The PCR was performed in a 25 μl volume with 50 pM of each primer (Dca_rrnL1 5′ TGA GTT AAG ACC GGC GTG AG 3′ and Dca_rrnL2 5′ TTG ACA CCT TCC CCT GAA CG 3′; Dca_rrnL3 5′ TGG TAG TGC CTG CTC TAT GTT 3′ and Dca_rrnL4 5′ TAA GAA CCG ACC TGG CTC AC 3′) and 0.75 units Maxima Hot Start PCR Mastermix.

    T-Test:

    Article Title: Assessment of Two Different Drinking Water Treatment Plants for the Removal of Free-living Amoebae, Egypt
    Article Snippet: Amplification of DNA was performed using Maxima™ Hot Start Green PCR Master Mix (Thermo Fisher Scientific Inc, Waltham, MA, USA) according to the manufacturer manual. .. The obtained data were analyzed by one-way ANOVA, two samples t-test and Paired t-test using Minitab statistical program.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher maxima hot start green pcr master mix
    Agarose gel electrophorisis for <t>PCR</t> amplified product of <t>DNA</t> from (A) Acanthamoeba spp. Lane 1: 100 plus DNA ladder; Lane 2: Control Positive; Lane 3: Control negative; lanes 4, 5, 6 and 7: Positive samples ( 1 – 4 ). (B): Naegleria spp. Lane 1: 100 plus DNA ladder; lane 2: Positive sample. (C): Vermamoeba vermiformis . Lane 1: 100 plus DNA ladder; lane 2: Negative control; lane 3: Positive sample
    Maxima Hot Start Green Pcr Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 55 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/maxima hot start green pcr master mix/product/Thermo Fisher
    Average 99 stars, based on 55 article reviews
    Price from $9.99 to $1999.99
    maxima hot start green pcr master mix - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    Image Search Results


    Agarose gel electrophorisis for PCR amplified product of DNA from (A) Acanthamoeba spp. Lane 1: 100 plus DNA ladder; Lane 2: Control Positive; Lane 3: Control negative; lanes 4, 5, 6 and 7: Positive samples ( 1 – 4 ). (B): Naegleria spp. Lane 1: 100 plus DNA ladder; lane 2: Positive sample. (C): Vermamoeba vermiformis . Lane 1: 100 plus DNA ladder; lane 2: Negative control; lane 3: Positive sample

    Journal: Iranian Journal of Parasitology

    Article Title: Assessment of Two Different Drinking Water Treatment Plants for the Removal of Free-living Amoebae, Egypt

    doi:

    Figure Lengend Snippet: Agarose gel electrophorisis for PCR amplified product of DNA from (A) Acanthamoeba spp. Lane 1: 100 plus DNA ladder; Lane 2: Control Positive; Lane 3: Control negative; lanes 4, 5, 6 and 7: Positive samples ( 1 – 4 ). (B): Naegleria spp. Lane 1: 100 plus DNA ladder; lane 2: Positive sample. (C): Vermamoeba vermiformis . Lane 1: 100 plus DNA ladder; lane 2: Negative control; lane 3: Positive sample

    Article Snippet: Amplification of DNA was performed using Maxima™ Hot Start Green PCR Master Mix (Thermo Fisher Scientific Inc, Waltham, MA, USA) according to the manufacturer manual.

    Techniques: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Amplification, Negative Control

    Analysis of NDRG2 gene promoter methylation in PA samples. a Methylation frequency (%). b Hormone distribution of PAs in methylated and unmethylated NDRG2 promoter groups. PRL – prolactin, IGF-1 – insulin-like grow factor 1, GH – growth hormone, ACTH – adrenocorticotropic hormone, multiple – PAs secreting more than one hormone, NS – non-secreting PAs. c Representative MS-PCR for NDRG2 in PA samples. M indicates amplification of methylated alleles, U unmethylated alleles. M cont. – positive methylation control (Standard Bisulfite Converted Universal Methylated Human DNA), U cont. – negative methylation control (normal human peripheral lymphocytes), H2O – water control, I-VI designate PA samples

    Journal: Diagnostic Pathology

    Article Title: N-myc downstream-regulated gene 2 (NDRG2) promoter methylation and expression in pituitary adenoma

    doi: 10.1186/s13000-017-0622-7

    Figure Lengend Snippet: Analysis of NDRG2 gene promoter methylation in PA samples. a Methylation frequency (%). b Hormone distribution of PAs in methylated and unmethylated NDRG2 promoter groups. PRL – prolactin, IGF-1 – insulin-like grow factor 1, GH – growth hormone, ACTH – adrenocorticotropic hormone, multiple – PAs secreting more than one hormone, NS – non-secreting PAs. c Representative MS-PCR for NDRG2 in PA samples. M indicates amplification of methylated alleles, U unmethylated alleles. M cont. – positive methylation control (Standard Bisulfite Converted Universal Methylated Human DNA), U cont. – negative methylation control (normal human peripheral lymphocytes), H2O – water control, I-VI designate PA samples

    Article Snippet: After bisulfite modification, the methylation-specific polymerase chain reactions (MS-PCR) were performed in 15 μl of 7.5 μL Maxima® Hot Start PCR Master Mix (ThermoFisher Scientific) with Hot Start Taq DNA polymerase, 10 pmol of each primer (Metabion International AG) and nuclease-free water.

    Techniques: Methylation, Mass Spectrometry, Polymerase Chain Reaction, Amplification

    Representative methylation specific PCR reaction for MGMT, GATA6, CD81, DR4 and CASP8 genes. U represents amplification of unmethylated allele, and M represents methylated allele. Standard Bisulfite Converted Universal Methylated Human DNA (SMD) and normal human peripheral lymphocytes (NL) served as positive and negative methylation controls, respectively. MW – molecular weight. H 2 O – water control. GBM#1-6 glioblastoma patient tumor samples.

    Journal: BMC Cancer

    Article Title: MGMT, GATA6, CD81, DR4, and CASP8 gene promoter methylation in glioblastoma

    doi: 10.1186/1471-2407-12-218

    Figure Lengend Snippet: Representative methylation specific PCR reaction for MGMT, GATA6, CD81, DR4 and CASP8 genes. U represents amplification of unmethylated allele, and M represents methylated allele. Standard Bisulfite Converted Universal Methylated Human DNA (SMD) and normal human peripheral lymphocytes (NL) served as positive and negative methylation controls, respectively. MW – molecular weight. H 2 O – water control. GBM#1-6 glioblastoma patient tumor samples.

    Article Snippet: PCR reaction was performed in a total volume of 20 μ L, using 10 μ L Maxima® Hot Start PCR Master Mix with Hot Start Taq DNA polymerase (Thermo Fisher Scientific, USA) and 10 μ M of each primer (Metabion International AG, Germany).

    Techniques: Methylation, Polymerase Chain Reaction, Amplification, Molecular Weight