Structured Review

Stratagene mammalian expression vector psg5
LCV 3C proteins universally repress transcription mediated through Jκ. EBV-negative B cells were cotransfected with a CAT reporter gene controlled by 10 copies of a Jκ-binding site plus either empty <t>pSG5</t> expression vector (control) or expression vectors for EBNA-2 alone or in the presence of EBV-3C, BaLCV-3C, or RhLCV-3C. Each data point is the mean from four separate transfections corrected for transfection efficiency. Error bars indicate standard deviations.
Mammalian Expression Vector Psg5, supplied by Stratagene, used in various techniques. Bioz Stars score: 90/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mammalian expression vector psg5/product/Stratagene
Average 90 stars, based on 17 article reviews
Price from $9.99 to $1999.99
mammalian expression vector psg5 - by Bioz Stars, 2020-02
90/100 stars

Images

1) Product Images from "Transcriptional Regulatory Properties of Epstein-Barr Virus Nuclear Antigen 3C Are Conserved in Simian Lymphocryptoviruses"

Article Title: Transcriptional Regulatory Properties of Epstein-Barr Virus Nuclear Antigen 3C Are Conserved in Simian Lymphocryptoviruses

Journal: Journal of Virology

doi: 10.1128/JVI.77.10.5639-5648.2003

LCV 3C proteins universally repress transcription mediated through Jκ. EBV-negative B cells were cotransfected with a CAT reporter gene controlled by 10 copies of a Jκ-binding site plus either empty pSG5 expression vector (control) or expression vectors for EBNA-2 alone or in the presence of EBV-3C, BaLCV-3C, or RhLCV-3C. Each data point is the mean from four separate transfections corrected for transfection efficiency. Error bars indicate standard deviations.
Figure Legend Snippet: LCV 3C proteins universally repress transcription mediated through Jκ. EBV-negative B cells were cotransfected with a CAT reporter gene controlled by 10 copies of a Jκ-binding site plus either empty pSG5 expression vector (control) or expression vectors for EBNA-2 alone or in the presence of EBV-3C, BaLCV-3C, or RhLCV-3C. Each data point is the mean from four separate transfections corrected for transfection efficiency. Error bars indicate standard deviations.

Techniques Used: Binding Assay, Expressing, Plasmid Preparation, Transfection

2) Product Images from "Btk Is Required for an Efficient Response to Erythropoietin and for SCF-controlled Protection against TRAIL in Erythroid Progenitors"

Article Title: Btk Is Required for an Efficient Response to Erythropoietin and for SCF-controlled Protection against TRAIL in Erythroid Progenitors

Journal: The Journal of Experimental Medicine

doi: 10.1084/jem.20031109

Btk coimmunoprecipitates with and is a substrate of Jak2. (A–D and F) COS cells were transfected with pSG5-based expression constructs encoding the indicated proteins. Expression of all proteins was verified in Western blots using specific antibodies (not depicted). After 48 h, cells were stimulated with 5 U/ml Epo (B) or 500 ng/ml SCF (C, lane 4; D and E, lane 4) for 10 min, harvested, and lysed, and Btk (A and C), EpoR (B), Jak2 (D), and c-Kit (F) were immunoprecipitated. (top panels) Immunoblots were stained with antiphosphotyrosine antibodies (PY99). The blots were restained with antibodies recognizing the immunoprecipitated proteins to check for equal loading. Arrows indicate the position of the immunoprecipitated and coimmunoprecipitating proteins. (E) wt erythroid progenitors (2B6) were factor deprived in the absence or presence of the Src kinase family inhibitor PP2 as indicated and stimulated with Epo for 10 min. Epo-induced Jak2 phosphorylation was assayed on immunoblots using PY99 (top). (bottom) Blots were restained with anti-Jak2 to confirm equal loading. (F) c-Kit immunoprecipitates were stained with antiphosphotyrosine antibodies (PY99), and blots were restained with anti–c-Kit and anti-Btk antibodies, whereas total cell lysates (TCLs) were stained with anti–c-Kit and anti-Btk to check expression levels.
Figure Legend Snippet: Btk coimmunoprecipitates with and is a substrate of Jak2. (A–D and F) COS cells were transfected with pSG5-based expression constructs encoding the indicated proteins. Expression of all proteins was verified in Western blots using specific antibodies (not depicted). After 48 h, cells were stimulated with 5 U/ml Epo (B) or 500 ng/ml SCF (C, lane 4; D and E, lane 4) for 10 min, harvested, and lysed, and Btk (A and C), EpoR (B), Jak2 (D), and c-Kit (F) were immunoprecipitated. (top panels) Immunoblots were stained with antiphosphotyrosine antibodies (PY99). The blots were restained with antibodies recognizing the immunoprecipitated proteins to check for equal loading. Arrows indicate the position of the immunoprecipitated and coimmunoprecipitating proteins. (E) wt erythroid progenitors (2B6) were factor deprived in the absence or presence of the Src kinase family inhibitor PP2 as indicated and stimulated with Epo for 10 min. Epo-induced Jak2 phosphorylation was assayed on immunoblots using PY99 (top). (bottom) Blots were restained with anti-Jak2 to confirm equal loading. (F) c-Kit immunoprecipitates were stained with antiphosphotyrosine antibodies (PY99), and blots were restained with anti–c-Kit and anti-Btk antibodies, whereas total cell lysates (TCLs) were stained with anti–c-Kit and anti-Btk to check expression levels.

Techniques Used: Transfection, Expressing, Construct, Western Blot, Immunoprecipitation, Staining

3) Product Images from "Epstein-Barr Virus Nuclear Antigen 3C Activates the Latent Membrane Protein 1 Promoter in the Presence of Epstein-Barr Virus Nuclear Antigen 2 through Sequences Encompassing an Spi-1/Spi-B Binding Site"

Article Title: Epstein-Barr Virus Nuclear Antigen 3C Activates the Latent Membrane Protein 1 Promoter in the Presence of Epstein-Barr Virus Nuclear Antigen 2 through Sequences Encompassing an Spi-1/Spi-B Binding Site

Journal: Journal of Virology

doi:

Jκ DNA-binding sites are not required for EBNA-3C-mediated activation of the LMP-1 promoter. The ability of EBNA-3C to activate the LMP-1 promoter was evaluated using a CAT reporter gene assay following transfection of EBV-negative BL2 cells. The truncated or internally deleted fragments of the LMP-1 promoter controlling expression of the CAT reporter gene are depicted schematically at the left; numbers indicate base pair positions relative to the transcriptional start site. Black circles indicate Jκ binding sites. Specific mutations of the Jκ binding sites are indicated by open circles. A 10-μg quantity of each of the reporters indicated was transfected with either empty pSG5 expression vector (control) or pSG5-EBNA-2 in the presence or absence of pSG5-EBNA-3C. CAT activity was measured 36 h after transfection and is quantified relative to the activity obtained with empty expression vector. Error bars represent standard deviations.
Figure Legend Snippet: Jκ DNA-binding sites are not required for EBNA-3C-mediated activation of the LMP-1 promoter. The ability of EBNA-3C to activate the LMP-1 promoter was evaluated using a CAT reporter gene assay following transfection of EBV-negative BL2 cells. The truncated or internally deleted fragments of the LMP-1 promoter controlling expression of the CAT reporter gene are depicted schematically at the left; numbers indicate base pair positions relative to the transcriptional start site. Black circles indicate Jκ binding sites. Specific mutations of the Jκ binding sites are indicated by open circles. A 10-μg quantity of each of the reporters indicated was transfected with either empty pSG5 expression vector (control) or pSG5-EBNA-2 in the presence or absence of pSG5-EBNA-3C. CAT activity was measured 36 h after transfection and is quantified relative to the activity obtained with empty expression vector. Error bars represent standard deviations.

Techniques Used: Binding Assay, Activation Assay, Reporter Gene Assay, Transfection, Expressing, Plasmid Preparation, Activity Assay

4) Product Images from "ADP-ribosylation factor–like 4C binding to filamin-A modulates filopodium formation and cell migration"

Article Title: ADP-ribosylation factor–like 4C binding to filamin-A modulates filopodium formation and cell migration

Journal: Molecular Biology of the Cell

doi: 10.1091/mbc.E17-01-0059

Arl4C interacts with FLNa. (A) Schematic diagram of FLNa and fragments constructed in this study. FLNa contains 24 IgG repeats and possesses an actin-binding domain (ABD) at the N-terminus. FLNa was identified according to fragments of various lengths using Arl4C-Q72L as bait in a yeast two-hybrid system. (B) Different FLNa fragments were tested for interaction with Arl4C-Q72L in yeast two-hybrid assays. The levels of proteins expressed by the transforming plasmids were confirmed by immunoblotting. Lamin was used as a negative control. After cotransformation with the indicated plasmids, interactions were verified by growth of the yeast on a synthetic His+ plate and a His− selective plate, followed by filter assays for β-galactosidase activity. Total protein (20 µg) was loaded onto a 10-well gel to detect proteins. (C) Different forms of Arl4C were tested for interaction with the FLNa R22′ region in yeast two-hybrid assays. The levels of protein expressed by the transforming plasmids were confirmed by immunoblotting. Empty vector pBTM116 was used as a negative control. (D) Interaction between WT and the GTP-bound form of Arl4C with FLNa was tested by a pull-down assay. Purified GST or FLNa R22′-GST was incubated with lysates of HeLa cells expressing Arl4C-WT, Arl4C-Q72L, and Arl4C-T44N. After binding and washing, bead-bound GST-protein complexes were analyzed by immunoblotting using an anti-Arl4C antibody. SDS–PAGE analysis of the total cell lysate and Arl4C (input) expression by immunoblotting were used to verify the initial expression level. Equal amounts of GST beads were used in each experiment as shown by Coomassie Blue staining. (E) Interaction between Arl4C and FLNa was verified by coimmunoprecipitation. HeLa cells, which possess endogenous FLNa, transiently transfected with the empty vector pSG5 or Arl4C-WT, Arl4C-Q72L, or Arl4C-T44N in pSG5 were lysed and immunoprecipitated with anti-FLNa antibody or irrelevant mouse IgG-conjugated protein G magnetic beads. The bound proteins were separated by SDS–PAGE and subjected to immunoblotting with antibodies against FLNa and Arl4C. To confirm the initial expression level, 2.5% of the total cell lysate (input) was loaded. Equal amounts of FLNa antibody were used in the assays as shown by Coomassie Blue staining of the heavy chain. (F) Wild-type and various mutants of Arl4A, Arl4C, and Arl4D were tested for interaction with FLNa R22′ in yeast two-hybrid assays. Total protein (20 µg) was loaded onto a 10-well gel to detect proteins. (G) The interaction of FLNa R22′ with the Arl4 family was tested by pull-down assays in HeLa cells. SDS–PAGE analysis of total cell lysates and expression of Arl4A/C/D (input) by immunoblotting was used to verify the initial expression level. Equal amounts of GST beads were used in each experiment as shown by Coomassie Blue staining.
Figure Legend Snippet: Arl4C interacts with FLNa. (A) Schematic diagram of FLNa and fragments constructed in this study. FLNa contains 24 IgG repeats and possesses an actin-binding domain (ABD) at the N-terminus. FLNa was identified according to fragments of various lengths using Arl4C-Q72L as bait in a yeast two-hybrid system. (B) Different FLNa fragments were tested for interaction with Arl4C-Q72L in yeast two-hybrid assays. The levels of proteins expressed by the transforming plasmids were confirmed by immunoblotting. Lamin was used as a negative control. After cotransformation with the indicated plasmids, interactions were verified by growth of the yeast on a synthetic His+ plate and a His− selective plate, followed by filter assays for β-galactosidase activity. Total protein (20 µg) was loaded onto a 10-well gel to detect proteins. (C) Different forms of Arl4C were tested for interaction with the FLNa R22′ region in yeast two-hybrid assays. The levels of protein expressed by the transforming plasmids were confirmed by immunoblotting. Empty vector pBTM116 was used as a negative control. (D) Interaction between WT and the GTP-bound form of Arl4C with FLNa was tested by a pull-down assay. Purified GST or FLNa R22′-GST was incubated with lysates of HeLa cells expressing Arl4C-WT, Arl4C-Q72L, and Arl4C-T44N. After binding and washing, bead-bound GST-protein complexes were analyzed by immunoblotting using an anti-Arl4C antibody. SDS–PAGE analysis of the total cell lysate and Arl4C (input) expression by immunoblotting were used to verify the initial expression level. Equal amounts of GST beads were used in each experiment as shown by Coomassie Blue staining. (E) Interaction between Arl4C and FLNa was verified by coimmunoprecipitation. HeLa cells, which possess endogenous FLNa, transiently transfected with the empty vector pSG5 or Arl4C-WT, Arl4C-Q72L, or Arl4C-T44N in pSG5 were lysed and immunoprecipitated with anti-FLNa antibody or irrelevant mouse IgG-conjugated protein G magnetic beads. The bound proteins were separated by SDS–PAGE and subjected to immunoblotting with antibodies against FLNa and Arl4C. To confirm the initial expression level, 2.5% of the total cell lysate (input) was loaded. Equal amounts of FLNa antibody were used in the assays as shown by Coomassie Blue staining of the heavy chain. (F) Wild-type and various mutants of Arl4A, Arl4C, and Arl4D were tested for interaction with FLNa R22′ in yeast two-hybrid assays. Total protein (20 µg) was loaded onto a 10-well gel to detect proteins. (G) The interaction of FLNa R22′ with the Arl4 family was tested by pull-down assays in HeLa cells. SDS–PAGE analysis of total cell lysates and expression of Arl4A/C/D (input) by immunoblotting was used to verify the initial expression level. Equal amounts of GST beads were used in each experiment as shown by Coomassie Blue staining.

Techniques Used: Construct, Binding Assay, Negative Control, Activity Assay, Plasmid Preparation, Pull Down Assay, Purification, Incubation, Expressing, SDS Page, Staining, Transfection, Immunoprecipitation, Magnetic Beads

Arl4C induces filopodium formation in a nucleotide-dependent manner. Immunofluorescence staining of Arl4C or pSG5 vector in HeLa cells transfected with the indicated plasmids. (A) Cells were stained for Arl4C (red), FLNa (green), and DAPI (blue). (B) Cells were stained for Arl4C (red), phalloidin (green), and DAPI (blue). (C) Cells were stained for Arl4C (red), fascin (green), and DAPI (blue). Scale bar = 10 µm. Histograms: The colocalization ratio of Arl4C and FLNa/F-actin/fascin at filopodia of 10 randomly chosen cells from each group were analyzed in each experiment, and statistical analyses were based on data from three independent experiments (total cells from three experiments = 30). Quantification of the number of filopodia per cell was from three independent experiments (total cells = 10). ND: not detected. Scatter plots represent mean ± SD.
Figure Legend Snippet: Arl4C induces filopodium formation in a nucleotide-dependent manner. Immunofluorescence staining of Arl4C or pSG5 vector in HeLa cells transfected with the indicated plasmids. (A) Cells were stained for Arl4C (red), FLNa (green), and DAPI (blue). (B) Cells were stained for Arl4C (red), phalloidin (green), and DAPI (blue). (C) Cells were stained for Arl4C (red), fascin (green), and DAPI (blue). Scale bar = 10 µm. Histograms: The colocalization ratio of Arl4C and FLNa/F-actin/fascin at filopodia of 10 randomly chosen cells from each group were analyzed in each experiment, and statistical analyses were based on data from three independent experiments (total cells from three experiments = 30). Quantification of the number of filopodia per cell was from three independent experiments (total cells = 10). ND: not detected. Scatter plots represent mean ± SD.

Techniques Used: Immunofluorescence, Staining, Plasmid Preparation, Transfection

Arl4C-FLNa interaction promotes Cdc42 activation via FGD6. (A) Pull-down assays with HeLa cells coexpressing the indicated plasmids or siRNAs were used to detect Cdc42 activation. Total cell lysates and equal amounts of GST beads were analyzed by Coomassie Blue staining. The expression of Cdc42, Arl4C, FGD6 (input), and active Cdc42 was analyzed by immunoblotting. The percentage of FGD6 after siRNA treatment is 14.3 ± 0.7% and 17.4 ± 0.4%. (B) HeLa cells were transiently transfected with the empty vector pSG5 or Arl4C as indicated, interaction was verified by coimmunoprecipitation with anti-FLNa–conjugated protein G magnetic beads. To confirm the initial expression level, 2.5% of the total cell lysate (input) was loaded. SDS–PAGE analysis was used to verify Arl4C, FLNa, and FGD6 expression and bound proteins. (C) HeLa cells were transiently transfected with FLNa siRNA, Arl4C, and full-length FLNa-WT, or -A10; interaction was verified by coimmunoprecipitation with anti-FLNa–conjugated protein G magnetic beads. To confirm the initial expression level, 2.5% of the total cell lysate (input) was loaded. SDS–PAGE analysis was used to verify Arl4C, FLNa, and FGD6 expression and bound proteins. (D) Pull-down assays with A549 cells coexpressing the indicated plasmids or siRNA were used to detect Cdc42 activation. Total cell lysates and equal amounts of GST beads were analyzed by Coomassie Blue staining. The expression of Cdc42, FGD6, Arl4C (input), and active Cdc42 was analyzed by immunoblotting. The percentage of Arl4C after siRNA treatment is 28.5 ± 0.6% and 29.7 ± 0.8%. (E) A549 cells were transiently transfected with FGD6 or Arl4C siRNA as indicated. The interaction was verified by coimmunoprecipitation with anti-FLNa–conjugated protein G magnetic beads. The percentage of Arl4C after siRNA treatment is 23.6 ± 1.3%. To confirm the initial expression level, 2.5% of the total cell lysate (input) was loaded. SDS–PAGE analysis was used to verify Arl4C, FLNa, and FGD6 expression and bound proteins. (F) A549 cells were transiently transfected with FLNa siRNA, full-length FLNa-WT, or -A10; interaction was verified by coimmunoprecipitation with anti-FLNa–conjugated protein G magnetic beads. To confirm the initial expression level, 2.5% of the total cell lysate (input) was loaded. SDS–PAGE analysis was used to verify Arl4C, FLNa, and FGD6 expression and bound proteins. Histograms in A and D: Quantification of activity by pull-down assays was based on three biological replicates. Scatter plots represent mean ± SD. *, p
Figure Legend Snippet: Arl4C-FLNa interaction promotes Cdc42 activation via FGD6. (A) Pull-down assays with HeLa cells coexpressing the indicated plasmids or siRNAs were used to detect Cdc42 activation. Total cell lysates and equal amounts of GST beads were analyzed by Coomassie Blue staining. The expression of Cdc42, Arl4C, FGD6 (input), and active Cdc42 was analyzed by immunoblotting. The percentage of FGD6 after siRNA treatment is 14.3 ± 0.7% and 17.4 ± 0.4%. (B) HeLa cells were transiently transfected with the empty vector pSG5 or Arl4C as indicated, interaction was verified by coimmunoprecipitation with anti-FLNa–conjugated protein G magnetic beads. To confirm the initial expression level, 2.5% of the total cell lysate (input) was loaded. SDS–PAGE analysis was used to verify Arl4C, FLNa, and FGD6 expression and bound proteins. (C) HeLa cells were transiently transfected with FLNa siRNA, Arl4C, and full-length FLNa-WT, or -A10; interaction was verified by coimmunoprecipitation with anti-FLNa–conjugated protein G magnetic beads. To confirm the initial expression level, 2.5% of the total cell lysate (input) was loaded. SDS–PAGE analysis was used to verify Arl4C, FLNa, and FGD6 expression and bound proteins. (D) Pull-down assays with A549 cells coexpressing the indicated plasmids or siRNA were used to detect Cdc42 activation. Total cell lysates and equal amounts of GST beads were analyzed by Coomassie Blue staining. The expression of Cdc42, FGD6, Arl4C (input), and active Cdc42 was analyzed by immunoblotting. The percentage of Arl4C after siRNA treatment is 28.5 ± 0.6% and 29.7 ± 0.8%. (E) A549 cells were transiently transfected with FGD6 or Arl4C siRNA as indicated. The interaction was verified by coimmunoprecipitation with anti-FLNa–conjugated protein G magnetic beads. The percentage of Arl4C after siRNA treatment is 23.6 ± 1.3%. To confirm the initial expression level, 2.5% of the total cell lysate (input) was loaded. SDS–PAGE analysis was used to verify Arl4C, FLNa, and FGD6 expression and bound proteins. (F) A549 cells were transiently transfected with FLNa siRNA, full-length FLNa-WT, or -A10; interaction was verified by coimmunoprecipitation with anti-FLNa–conjugated protein G magnetic beads. To confirm the initial expression level, 2.5% of the total cell lysate (input) was loaded. SDS–PAGE analysis was used to verify Arl4C, FLNa, and FGD6 expression and bound proteins. Histograms in A and D: Quantification of activity by pull-down assays was based on three biological replicates. Scatter plots represent mean ± SD. *, p

Techniques Used: Activation Assay, Staining, Expressing, Transfection, Plasmid Preparation, Magnetic Beads, SDS Page, Activity Assay

Related Articles

Clone Assay:

Article Title: Transcriptional Regulatory Properties of Epstein-Barr Virus Nuclear Antigen 3C Are Conserved in Simian Lymphocryptoviruses
Article Snippet: .. The entire BaLCV-3C ORF was isolated as a Kpn I-to- Eco RI subfragment that was cloned into the mammalian expression vector pSG5 (Stratagene) in frame with a c- myc epitope tag. .. Reporter plasmids −2350LMP-CAT (containing an LMP-1 promoter fragment from −2350 to +40 relative to the site of transcription initiation linked to the chloramphenicol acetyltransferase [CAT] reporter gene) and −215/-144 LMP-1BLCAT2 (containing nucleotides −215 to −144 of the LMP-1 promoter, encompassing the Spi site, in the plasmid pBLCAT2 which contains the herpesvirus tk promoter [ ]) have been previously described ( , , ).

Article Title: GTP-Binding-Defective ARL4D Alters Mitochondrial Morphology and Membrane Potential
Article Snippet: .. Expression Plasmids The cDNAs corresponding to ARL4D, ARL4C, ARL4A and their various mutants were cloned into the mammalian expression vector pSG5 (Stratagene, La Jolla, CA, USA), as previously described. .. These constructs were used to express untagged ARL4s .

Article Title: Truncation of the Carboxyl Terminus of the DihydropyridineReceptor β1a Subunit Promotes Ca2+ Dependent Excitation-Contraction Coupling in Skeletal Myotubes
Article Snippet: .. A full-length rabbit α 1C cDNA encoding residues 1-2171 (Genbank accession # , nucleotide coordinates nt 192 to nt 6707) was fused in frame to the first 11 amino acids of the phage T7 gene 10 protein in the mammalian expression vector pSG5 (Stratagene, CA) using Age I and Not I cloning sites. .. The α 1S I-II loop ( α 1S residues 335-432) was amplified by PCR from a cDNA template encoding full-length α 1S (Genbank accession # ), using the forward primer 5′-tca tca gga tcc ggg gaa ttt acc aag gag-3′ that contained a Bam HI restriction site and the reverse primer 5′-atg cca gaa ttc tct cga ctt cac cag gtc -3′with an Eco RI restriction site.

Article Title: The highly related DEAD box RNA helicases p68 and p72 exist as heterodimers in cells
Article Snippet: .. p72-myc . a p72 cDNA was cloned in a derivative of the mammalian expression vector pSG5 (Stratagene) containing the myc epitope at the N-terminus ( ). p82-myc. a p82 cDNA was generated by annealing oligonucleotides comprising the upstream sequence given in Uhlmann-Schiffler et al . ( ) and the myc-tagged version was obtained as for p72. p68-/p72-GST. p68 and p72 cDNAs were cloned in the vector pEBG2T ( ) which allows expression of GST-tagged proteins in mammalian cells. .. Interaction assays, using the Clontech GAL4 Matchmaker yeast two-hybrid system were carried out as described previously ( ).

Article Title: ADP-ribosylation factor–like 4A interacts with Robo1 to promote cell migration by regulating Cdc42 activation
Article Snippet: .. Briefly, Arl4A was cloned into the mammalian expression vector pSG5 (Stratagene, La Jolla, CA) to generate untagged Arl4A. .. The cDNA sequence was subcloned into pET32a (Novagen, Madison, WI) for His-tagged Arl4A expressed in Escherichia coli or pBTM116 for LexA-tagged Arl4A expressed in yeast.

Article Title: Truncation of the Carboxyl Terminus of the DihydropyridineReceptor β1a Subunit Promotes Ca2+ Dependent Excitation-Contraction Coupling in Skeletal Myotubes
Article Snippet: .. All cDNAs were cloned into the mammalian expression vector pSG5 (Stratagene, CA). cDNA transfection was performed during the myoblast fusion stage with the polyamine LT1 (Panvera). .. Cells were exposed for 2–3 h to a transfection solution containing LT1 and cDNA at a 5:1 μ g ratio.

Article Title: ADP-ribosylation factor–like 4C binding to filamin-A modulates filopodium formation and cell migration
Article Snippet: .. Plasmid construction cDNAs corresponding to Arl4A/C/D and their various mutants were cloned into the mammalian expression vector pSG5 (Stratagene, La Jolla, CA), which was also used for expressing untagged Arl4C. .. The cDNAs were also subcloned into the mammalian expression vector pcDNA 3.1 (Invitrogen) or the bacterial expression vector pET15b (Novagen, Madison, WI) and pBTM116 to obtain myc-tagged, His-tagged, or LexA-tagged Arl4 A/C/D and their various mutants. pcDNA 3.1 harboring FLNa-myc was provided by Jeffrey J.Y.

Article Title: Btk Is Required for an Efficient Response to Erythropoietin and for SCF-controlled Protection against TRAIL in Erythroid Progenitors
Article Snippet: .. The complete open reading frame of Btk and Btk kinase dead (K430R, a gift from J. Borst, Netherlands Cancer Institute, Amsterdam, Netherlands), Tec, Jak2, Lyn, c-Kit, and EpoR was cloned into the mammalian expression vector pSG5 (Stratagene). .. Additionally, Btk was cloned into the retroviral vector pBabe-puro.

Transfection:

Article Title: Functional analysis of a frame-shift mutant of the dihydropyridine receptor pore subunit (?1S) expressing two complementary protein fragments
Article Snippet: Primary cultures of mouse myotubes Primary cultures were prepared from hind limbs of day 18 embryos (E18) as described previously [ ]. cDNAs of interest and a separate expression vector encoding the T-cell membrane antigen CD8 were subcloned into the mammalian expression vector pSG5 (Stratagene, CA) and were mixed and cotransfected with the polyamine LT-1 (Panvera, WI). .. Whole-cell recordings and immunostaining were done 3–5 days after transfection.

Article Title: Epstein-Barr Virus Nuclear Antigen 3C Activates the Latent Membrane Protein 1 Promoter in the Presence of Epstein-Barr Virus Nuclear Antigen 2 through Sequences Encompassing an Spi-1/Spi-B Binding Site
Article Snippet: .. The mammalian expression vector pSG5 (Stratagene) was used to express EBNA proteins in transient transfection assays as well as to generate mRNA for in vitro translation. .. The full length Spi-1 cDNA was provided by F. Moreau-Gachelin (Institut Curie, Paris, France).

Article Title: Truncation of the Carboxyl Terminus of the DihydropyridineReceptor β1a Subunit Promotes Ca2+ Dependent Excitation-Contraction Coupling in Skeletal Myotubes
Article Snippet: .. All cDNAs were cloned into the mammalian expression vector pSG5 (Stratagene, CA). cDNA transfection was performed during the myoblast fusion stage with the polyamine LT1 (Panvera). .. Cells were exposed for 2–3 h to a transfection solution containing LT1 and cDNA at a 5:1 μ g ratio.

Article Title: Ca2+ Current and Charge Movements in Skeletal Myotubes Promoted by the β-Subunit of the Dihydropyridine Receptor in the Absence of Ryanodine Receptor Type 1
Article Snippet: Paragraph title: cDNA transfection ... All cDNAs of interest, with the exceptions of RyR1 and CD8- β 2a C3,4S, were subcloned in the mammalian expression vector pSG5 (Stratagene, La Jolla, CA).

Amplification:

Article Title: ADP-ribosylation factor–like 4A interacts with Robo1 to promote cell migration by regulating Cdc42 activation
Article Snippet: Briefly, Arl4A was cloned into the mammalian expression vector pSG5 (Stratagene, La Jolla, CA) to generate untagged Arl4A. .. Full-length Robo1 and srGAP1 cDNA sequences were amplified from a human fetal brain cDNA library (Clontech) using PCR.

Article Title: ADP-ribosylation factor–like 4C binding to filamin-A modulates filopodium formation and cell migration
Article Snippet: Plasmid construction cDNAs corresponding to Arl4A/C/D and their various mutants were cloned into the mammalian expression vector pSG5 (Stratagene, La Jolla, CA), which was also used for expressing untagged Arl4C. .. Partial FLNa DNA fragments were amplified by PCR using syntactic oligonucleotide primers containing restriction enzyme sites.

Article Title: Role of Phosphoinositide 3-Kinase in Activation of Ras and Mitogen-Activated Protein Kinase by Epidermal Growth Factor
Article Snippet: DNA fragments, encoding the carboxy terminus of bovine p110α with an extension corresponding to the farnesylation-palmitylation signal from H-Ras, were amplified by PCR with the sense primer 5′CACACACTCCATCAGTGGCTCAAAGACAAGAAC3′ and the antisense primer 5′CGCGGATCCTCAAGAGAGCACACACTTACAGTTCAAAGCATGCTGC3′. .. The PCR products were digested with Cla I and Bam HI, ligated into the p110 sequence, and subcloned into the mammalian expression vector pSG5 (Stratagene) to generate p110-CAAX.

In Vitro:

Article Title: Epstein-Barr Virus Nuclear Antigen 3C Activates the Latent Membrane Protein 1 Promoter in the Presence of Epstein-Barr Virus Nuclear Antigen 2 through Sequences Encompassing an Spi-1/Spi-B Binding Site
Article Snippet: .. The mammalian expression vector pSG5 (Stratagene) was used to express EBNA proteins in transient transfection assays as well as to generate mRNA for in vitro translation. .. The full length Spi-1 cDNA was provided by F. Moreau-Gachelin (Institut Curie, Paris, France).

Article Title: Dimeric RFX Proteins Contribute to the Activity and Lineage Specificity of the Interleukin-5 Receptor ? Promoter through Activation and Repression Domains
Article Snippet: Paragraph title: In vitro transcription, translation, and nuclear extract preparation. ... Full-length human RFX1 and RFX3 were subcloned into mammalian expression vector pSG5 (Stratagene, La Jolla, Calif.), and the resulting constructs were named pSG5RFX1 and pSG5RFX3, respectively ( , ).

Positive Control:

Article Title: Truncation of the Carboxyl Terminus of the DihydropyridineReceptor β1a Subunit Promotes Ca2+ Dependent Excitation-Contraction Coupling in Skeletal Myotubes
Article Snippet: .. As a positive control, a rabbit α 1C was transiently overexpressed in β 1 KO myotubes using the mammalian expression vector pSG5. .. In this case, we found a robust immunofluorescence signal indicating that exogenous a1C protein was readily detectable by the technique.

Mutagenesis:

Article Title: Development of an intracellularly acting inhibitory peptide selective for PKN
Article Snippet: .. pSG5/tau vector for the expression of tau was generated by insertion of cDNA encoding the open reading frames of human brain tau (383 residues) into the mammalian expression vector pSG5 (Stratagene) as described previously [ ]. pTB701/ PKN1/AF3 vector expressing a catalytically active form of PKN1 (aPKN) and pTB701/PKN1/AF3(K644E) vector expressing a catalytically inactive mutant of PKN1 (iPKN) have been described previously [ ]. .. HeLa cells were cultured at 37 °C in 5 % CO2 in DMEM (Dulbecco’s modified Eagle’s medium) supplemented with 10 % FBS (fetal bovine serum) and antibiotics (50 units/ml penicillin and 50 μ g/ml streptomycin).

Isolation:

Article Title: Transcriptional Regulatory Properties of Epstein-Barr Virus Nuclear Antigen 3C Are Conserved in Simian Lymphocryptoviruses
Article Snippet: .. The entire BaLCV-3C ORF was isolated as a Kpn I-to- Eco RI subfragment that was cloned into the mammalian expression vector pSG5 (Stratagene) in frame with a c- myc epitope tag. .. Reporter plasmids −2350LMP-CAT (containing an LMP-1 promoter fragment from −2350 to +40 relative to the site of transcription initiation linked to the chloramphenicol acetyltransferase [CAT] reporter gene) and −215/-144 LMP-1BLCAT2 (containing nucleotides −215 to −144 of the LMP-1 promoter, encompassing the Spi site, in the plasmid pBLCAT2 which contains the herpesvirus tk promoter [ ]) have been previously described ( , , ).

Generated:

Article Title: Transcriptional Regulatory Properties of Epstein-Barr Virus Nuclear Antigen 3C Are Conserved in Simian Lymphocryptoviruses
Article Snippet: Smaller fragments of this papio DNA clone were generated by restriction endonuclease digestion and subcloned into pBluescript II KS(+) (Stratagene) for DNA sequence analysis with both T7 and T3 sequencing primers. .. The entire BaLCV-3C ORF was isolated as a Kpn I-to- Eco RI subfragment that was cloned into the mammalian expression vector pSG5 (Stratagene) in frame with a c- myc epitope tag.

Article Title: Development of an intracellularly acting inhibitory peptide selective for PKN
Article Snippet: .. pSG5/tau vector for the expression of tau was generated by insertion of cDNA encoding the open reading frames of human brain tau (383 residues) into the mammalian expression vector pSG5 (Stratagene) as described previously [ ]. pTB701/ PKN1/AF3 vector expressing a catalytically active form of PKN1 (aPKN) and pTB701/PKN1/AF3(K644E) vector expressing a catalytically inactive mutant of PKN1 (iPKN) have been described previously [ ]. .. HeLa cells were cultured at 37 °C in 5 % CO2 in DMEM (Dulbecco’s modified Eagle’s medium) supplemented with 10 % FBS (fetal bovine serum) and antibiotics (50 units/ml penicillin and 50 μ g/ml streptomycin).

Article Title: The highly related DEAD box RNA helicases p68 and p72 exist as heterodimers in cells
Article Snippet: .. p72-myc . a p72 cDNA was cloned in a derivative of the mammalian expression vector pSG5 (Stratagene) containing the myc epitope at the N-terminus ( ). p82-myc. a p82 cDNA was generated by annealing oligonucleotides comprising the upstream sequence given in Uhlmann-Schiffler et al . ( ) and the myc-tagged version was obtained as for p72. p68-/p72-GST. p68 and p72 cDNAs were cloned in the vector pEBG2T ( ) which allows expression of GST-tagged proteins in mammalian cells. .. Interaction assays, using the Clontech GAL4 Matchmaker yeast two-hybrid system were carried out as described previously ( ).

Construct:

Article Title: GTP-Binding-Defective ARL4D Alters Mitochondrial Morphology and Membrane Potential
Article Snippet: Expression Plasmids The cDNAs corresponding to ARL4D, ARL4C, ARL4A and their various mutants were cloned into the mammalian expression vector pSG5 (Stratagene, La Jolla, CA, USA), as previously described. .. These constructs were used to express untagged ARL4s .

Article Title: Development of an intracellularly acting inhibitory peptide selective for PKN
Article Snippet: Paragraph title: Mammalian expression constructs ... pSG5/tau vector for the expression of tau was generated by insertion of cDNA encoding the open reading frames of human brain tau (383 residues) into the mammalian expression vector pSG5 (Stratagene) as described previously [ ]. pTB701/ PKN1/AF3 vector expressing a catalytically active form of PKN1 (aPKN) and pTB701/PKN1/AF3(K644E) vector expressing a catalytically inactive mutant of PKN1 (iPKN) have been described previously [ ].

Article Title: Dimeric RFX Proteins Contribute to the Activity and Lineage Specificity of the Interleukin-5 Receptor ? Promoter through Activation and Repression Domains
Article Snippet: .. Full-length human RFX1 and RFX3 were subcloned into mammalian expression vector pSG5 (Stratagene, La Jolla, Calif.), and the resulting constructs were named pSG5RFX1 and pSG5RFX3, respectively ( , ). .. Full-length human RFX2 ( ) was tagged with a hemagglutinin (HA) epitope on its amino terminus and subcloned into mammalian expression vector pcDNA3 (Invitrogen, San Diego, Calif.) (pcDNA3HARFX2).

Article Title: Ca2+ Current and Charge Movements in Skeletal Myotubes Promoted by the β-Subunit of the Dihydropyridine Receptor in the Absence of Ryanodine Receptor Type 1
Article Snippet: All cDNAs of interest, with the exceptions of RyR1 and CD8- β 2a C3,4S, were subcloned in the mammalian expression vector pSG5 (Stratagene, La Jolla, CA). .. The CD8- β 2a C3,4S construct is described below.

Purification:

Article Title: Transcriptional Regulatory Properties of Epstein-Barr Virus Nuclear Antigen 3C Are Conserved in Simian Lymphocryptoviruses
Article Snippet: Following plaque purification, the pBK-CMV phagemid within the ZAP Express vector containing this genomic fragment was excised according to the manufacturer's protocol. .. The entire BaLCV-3C ORF was isolated as a Kpn I-to- Eco RI subfragment that was cloned into the mammalian expression vector pSG5 (Stratagene) in frame with a c- myc epitope tag.

Sequencing:

Article Title: Transcriptional Regulatory Properties of Epstein-Barr Virus Nuclear Antigen 3C Are Conserved in Simian Lymphocryptoviruses
Article Snippet: Paragraph title: Cloning and sequence analysis of the BaLCV-3C gene. ... The entire BaLCV-3C ORF was isolated as a Kpn I-to- Eco RI subfragment that was cloned into the mammalian expression vector pSG5 (Stratagene) in frame with a c- myc epitope tag.

Article Title: The highly related DEAD box RNA helicases p68 and p72 exist as heterodimers in cells
Article Snippet: .. p72-myc . a p72 cDNA was cloned in a derivative of the mammalian expression vector pSG5 (Stratagene) containing the myc epitope at the N-terminus ( ). p82-myc. a p82 cDNA was generated by annealing oligonucleotides comprising the upstream sequence given in Uhlmann-Schiffler et al . ( ) and the myc-tagged version was obtained as for p72. p68-/p72-GST. p68 and p72 cDNAs were cloned in the vector pEBG2T ( ) which allows expression of GST-tagged proteins in mammalian cells. .. Interaction assays, using the Clontech GAL4 Matchmaker yeast two-hybrid system were carried out as described previously ( ).

Article Title: ADP-ribosylation factor–like 4A interacts with Robo1 to promote cell migration by regulating Cdc42 activation
Article Snippet: Briefly, Arl4A was cloned into the mammalian expression vector pSG5 (Stratagene, La Jolla, CA) to generate untagged Arl4A. .. The cDNA sequence was subcloned into pET32a (Novagen, Madison, WI) for His-tagged Arl4A expressed in Escherichia coli or pBTM116 for LexA-tagged Arl4A expressed in yeast.

Article Title: Role of Phosphoinositide 3-Kinase in Activation of Ras and Mitogen-Activated Protein Kinase by Epidermal Growth Factor
Article Snippet: .. The PCR products were digested with Cla I and Bam HI, ligated into the p110 sequence, and subcloned into the mammalian expression vector pSG5 (Stratagene) to generate p110-CAAX. ..

Marker:

Article Title: Truncation of the Carboxyl Terminus of the DihydropyridineReceptor β1a Subunit Promotes Ca2+ Dependent Excitation-Contraction Coupling in Skeletal Myotubes
Article Snippet: All cDNAs were cloned into the mammalian expression vector pSG5 (Stratagene, CA). cDNA transfection was performed during the myoblast fusion stage with the polyamine LT1 (Panvera). .. In addition to the cDNA of interest, cells were cotransfected with a plasmid encoding the T-cell protein CD8 used here as a transfection marker.

Article Title: Ca2+ Current and Charge Movements in Skeletal Myotubes Promoted by the β-Subunit of the Dihydropyridine Receptor in the Absence of Ryanodine Receptor Type 1
Article Snippet: All cDNAs of interest, with the exceptions of RyR1 and CD8- β 2a C3,4S, were subcloned in the mammalian expression vector pSG5 (Stratagene, La Jolla, CA). .. The expression plasmid was cotransfected with a plasmid encoding the T-cell surface glycoprotein CD8A used as a transfection marker.

Incubation:

Article Title: Functional analysis of a frame-shift mutant of the dihydropyridine receptor pore subunit (?1S) expressing two complementary protein fragments
Article Snippet: Primary cultures of mouse myotubes Primary cultures were prepared from hind limbs of day 18 embryos (E18) as described previously [ ]. cDNAs of interest and a separate expression vector encoding the T-cell membrane antigen CD8 were subcloned into the mammalian expression vector pSG5 (Stratagene, CA) and were mixed and cotransfected with the polyamine LT-1 (Panvera, WI). .. Cotransfected cells were recognized by incubation with CD8 antibody beads (Dynal, Norway).

Binding Assay:

Article Title: Truncation of the Carboxyl Terminus of the DihydropyridineReceptor β1a Subunit Promotes Ca2+ Dependent Excitation-Contraction Coupling in Skeletal Myotubes
Article Snippet: All cDNAs were cloned into the mammalian expression vector pSG5 (Stratagene, CA). cDNA transfection was performed during the myoblast fusion stage with the polyamine LT1 (Panvera). .. Transfected myotubes expressing CD8 were recognized by surface binding of polystyrene beads coated with a monoclonal antibody specific for an external CD8 epitope (Dynal ASA, Norway).

cDNA Library Assay:

Article Title: ADP-ribosylation factor–like 4A interacts with Robo1 to promote cell migration by regulating Cdc42 activation
Article Snippet: Briefly, Arl4A was cloned into the mammalian expression vector pSG5 (Stratagene, La Jolla, CA) to generate untagged Arl4A. .. Full-length Robo1 and srGAP1 cDNA sequences were amplified from a human fetal brain cDNA library (Clontech) using PCR.

Immunostaining:

Article Title: Functional analysis of a frame-shift mutant of the dihydropyridine receptor pore subunit (?1S) expressing two complementary protein fragments
Article Snippet: Primary cultures of mouse myotubes Primary cultures were prepared from hind limbs of day 18 embryos (E18) as described previously [ ]. cDNAs of interest and a separate expression vector encoding the T-cell membrane antigen CD8 were subcloned into the mammalian expression vector pSG5 (Stratagene, CA) and were mixed and cotransfected with the polyamine LT-1 (Panvera, WI). .. Whole-cell recordings and immunostaining were done 3–5 days after transfection.

Expressing:

Article Title: Truncation of the Carboxyl Terminus of the DihydropyridineReceptor β1a Subunit Promotes Ca2+ Dependent Excitation-Contraction Coupling in Skeletal Myotubes
Article Snippet: .. As a positive control, a rabbit α 1C was transiently overexpressed in β 1 KO myotubes using the mammalian expression vector pSG5. .. In this case, we found a robust immunofluorescence signal indicating that exogenous a1C protein was readily detectable by the technique.

Article Title: Transcriptional Regulatory Properties of Epstein-Barr Virus Nuclear Antigen 3C Are Conserved in Simian Lymphocryptoviruses
Article Snippet: .. The entire BaLCV-3C ORF was isolated as a Kpn I-to- Eco RI subfragment that was cloned into the mammalian expression vector pSG5 (Stratagene) in frame with a c- myc epitope tag. .. Reporter plasmids −2350LMP-CAT (containing an LMP-1 promoter fragment from −2350 to +40 relative to the site of transcription initiation linked to the chloramphenicol acetyltransferase [CAT] reporter gene) and −215/-144 LMP-1BLCAT2 (containing nucleotides −215 to −144 of the LMP-1 promoter, encompassing the Spi site, in the plasmid pBLCAT2 which contains the herpesvirus tk promoter [ ]) have been previously described ( , , ).

Article Title: GTP-Binding-Defective ARL4D Alters Mitochondrial Morphology and Membrane Potential
Article Snippet: .. Expression Plasmids The cDNAs corresponding to ARL4D, ARL4C, ARL4A and their various mutants were cloned into the mammalian expression vector pSG5 (Stratagene, La Jolla, CA, USA), as previously described. .. These constructs were used to express untagged ARL4s .

Article Title: Functional analysis of a frame-shift mutant of the dihydropyridine receptor pore subunit (?1S) expressing two complementary protein fragments
Article Snippet: .. Primary cultures of mouse myotubes Primary cultures were prepared from hind limbs of day 18 embryos (E18) as described previously [ ]. cDNAs of interest and a separate expression vector encoding the T-cell membrane antigen CD8 were subcloned into the mammalian expression vector pSG5 (Stratagene, CA) and were mixed and cotransfected with the polyamine LT-1 (Panvera, WI). .. Whole-cell recordings and immunostaining were done 3–5 days after transfection.

Article Title: Truncation of the Carboxyl Terminus of the DihydropyridineReceptor β1a Subunit Promotes Ca2+ Dependent Excitation-Contraction Coupling in Skeletal Myotubes
Article Snippet: .. A full-length rabbit α 1C cDNA encoding residues 1-2171 (Genbank accession # , nucleotide coordinates nt 192 to nt 6707) was fused in frame to the first 11 amino acids of the phage T7 gene 10 protein in the mammalian expression vector pSG5 (Stratagene, CA) using Age I and Not I cloning sites. .. The α 1S I-II loop ( α 1S residues 335-432) was amplified by PCR from a cDNA template encoding full-length α 1S (Genbank accession # ), using the forward primer 5′-tca tca gga tcc ggg gaa ttt acc aag gag-3′ that contained a Bam HI restriction site and the reverse primer 5′-atg cca gaa ttc tct cga ctt cac cag gtc -3′with an Eco RI restriction site.

Article Title: Development of an intracellularly acting inhibitory peptide selective for PKN
Article Snippet: .. pSG5/tau vector for the expression of tau was generated by insertion of cDNA encoding the open reading frames of human brain tau (383 residues) into the mammalian expression vector pSG5 (Stratagene) as described previously [ ]. pTB701/ PKN1/AF3 vector expressing a catalytically active form of PKN1 (aPKN) and pTB701/PKN1/AF3(K644E) vector expressing a catalytically inactive mutant of PKN1 (iPKN) have been described previously [ ]. .. HeLa cells were cultured at 37 °C in 5 % CO2 in DMEM (Dulbecco’s modified Eagle’s medium) supplemented with 10 % FBS (fetal bovine serum) and antibiotics (50 units/ml penicillin and 50 μ g/ml streptomycin).

Article Title: Epstein-Barr Virus Nuclear Antigen 3C Activates the Latent Membrane Protein 1 Promoter in the Presence of Epstein-Barr Virus Nuclear Antigen 2 through Sequences Encompassing an Spi-1/Spi-B Binding Site
Article Snippet: .. The mammalian expression vector pSG5 (Stratagene) was used to express EBNA proteins in transient transfection assays as well as to generate mRNA for in vitro translation. .. The full length Spi-1 cDNA was provided by F. Moreau-Gachelin (Institut Curie, Paris, France).

Article Title: The highly related DEAD box RNA helicases p68 and p72 exist as heterodimers in cells
Article Snippet: .. p72-myc . a p72 cDNA was cloned in a derivative of the mammalian expression vector pSG5 (Stratagene) containing the myc epitope at the N-terminus ( ). p82-myc. a p82 cDNA was generated by annealing oligonucleotides comprising the upstream sequence given in Uhlmann-Schiffler et al . ( ) and the myc-tagged version was obtained as for p72. p68-/p72-GST. p68 and p72 cDNAs were cloned in the vector pEBG2T ( ) which allows expression of GST-tagged proteins in mammalian cells. .. Interaction assays, using the Clontech GAL4 Matchmaker yeast two-hybrid system were carried out as described previously ( ).

Article Title: ADP-ribosylation factor–like 4A interacts with Robo1 to promote cell migration by regulating Cdc42 activation
Article Snippet: .. Briefly, Arl4A was cloned into the mammalian expression vector pSG5 (Stratagene, La Jolla, CA) to generate untagged Arl4A. .. The cDNA sequence was subcloned into pET32a (Novagen, Madison, WI) for His-tagged Arl4A expressed in Escherichia coli or pBTM116 for LexA-tagged Arl4A expressed in yeast.

Article Title: Truncation of the Carboxyl Terminus of the DihydropyridineReceptor β1a Subunit Promotes Ca2+ Dependent Excitation-Contraction Coupling in Skeletal Myotubes
Article Snippet: .. All cDNAs were cloned into the mammalian expression vector pSG5 (Stratagene, CA). cDNA transfection was performed during the myoblast fusion stage with the polyamine LT1 (Panvera). .. Cells were exposed for 2–3 h to a transfection solution containing LT1 and cDNA at a 5:1 μ g ratio.

Article Title: ADP-ribosylation factor–like 4C binding to filamin-A modulates filopodium formation and cell migration
Article Snippet: .. Plasmid construction cDNAs corresponding to Arl4A/C/D and their various mutants were cloned into the mammalian expression vector pSG5 (Stratagene, La Jolla, CA), which was also used for expressing untagged Arl4C. .. The cDNAs were also subcloned into the mammalian expression vector pcDNA 3.1 (Invitrogen) or the bacterial expression vector pET15b (Novagen, Madison, WI) and pBTM116 to obtain myc-tagged, His-tagged, or LexA-tagged Arl4 A/C/D and their various mutants. pcDNA 3.1 harboring FLNa-myc was provided by Jeffrey J.Y.

Article Title: Role of Phosphoinositide 3-Kinase in Activation of Ras and Mitogen-Activated Protein Kinase by Epidermal Growth Factor
Article Snippet: .. The PCR products were digested with Cla I and Bam HI, ligated into the p110 sequence, and subcloned into the mammalian expression vector pSG5 (Stratagene) to generate p110-CAAX. ..

Article Title: Dimeric RFX Proteins Contribute to the Activity and Lineage Specificity of the Interleukin-5 Receptor ? Promoter through Activation and Repression Domains
Article Snippet: .. Full-length human RFX1 and RFX3 were subcloned into mammalian expression vector pSG5 (Stratagene, La Jolla, Calif.), and the resulting constructs were named pSG5RFX1 and pSG5RFX3, respectively ( , ). .. Full-length human RFX2 ( ) was tagged with a hemagglutinin (HA) epitope on its amino terminus and subcloned into mammalian expression vector pcDNA3 (Invitrogen, San Diego, Calif.) (pcDNA3HARFX2).

Article Title: Btk Is Required for an Efficient Response to Erythropoietin and for SCF-controlled Protection against TRAIL in Erythroid Progenitors
Article Snippet: .. The complete open reading frame of Btk and Btk kinase dead (K430R, a gift from J. Borst, Netherlands Cancer Institute, Amsterdam, Netherlands), Tec, Jak2, Lyn, c-Kit, and EpoR was cloned into the mammalian expression vector pSG5 (Stratagene). .. Additionally, Btk was cloned into the retroviral vector pBabe-puro.

Article Title: Ca2+ Current and Charge Movements in Skeletal Myotubes Promoted by the β-Subunit of the Dihydropyridine Receptor in the Absence of Ryanodine Receptor Type 1
Article Snippet: .. All cDNAs of interest, with the exceptions of RyR1 and CD8- β 2a C3,4S, were subcloned in the mammalian expression vector pSG5 (Stratagene, La Jolla, CA). .. The RyR1 cDNA was subcloned in the pCl-neo expression vector (Promega, Madison, WI) as described ( ).

Polymerase Chain Reaction:

Article Title: ADP-ribosylation factor–like 4A interacts with Robo1 to promote cell migration by regulating Cdc42 activation
Article Snippet: Briefly, Arl4A was cloned into the mammalian expression vector pSG5 (Stratagene, La Jolla, CA) to generate untagged Arl4A. .. Full-length Robo1 and srGAP1 cDNA sequences were amplified from a human fetal brain cDNA library (Clontech) using PCR.

Article Title: ADP-ribosylation factor–like 4C binding to filamin-A modulates filopodium formation and cell migration
Article Snippet: Plasmid construction cDNAs corresponding to Arl4A/C/D and their various mutants were cloned into the mammalian expression vector pSG5 (Stratagene, La Jolla, CA), which was also used for expressing untagged Arl4C. .. Partial FLNa DNA fragments were amplified by PCR using syntactic oligonucleotide primers containing restriction enzyme sites.

Article Title: Role of Phosphoinositide 3-Kinase in Activation of Ras and Mitogen-Activated Protein Kinase by Epidermal Growth Factor
Article Snippet: .. The PCR products were digested with Cla I and Bam HI, ligated into the p110 sequence, and subcloned into the mammalian expression vector pSG5 (Stratagene) to generate p110-CAAX. ..

Recombinant:

Article Title: Btk Is Required for an Efficient Response to Erythropoietin and for SCF-controlled Protection against TRAIL in Erythroid Progenitors
Article Snippet: Dexamethasone (Dex) was purchased from Sigma-Aldrich; mouse SCF and recombinant TRAIL was obtained from R & D Systems. .. The complete open reading frame of Btk and Btk kinase dead (K430R, a gift from J. Borst, Netherlands Cancer Institute, Amsterdam, Netherlands), Tec, Jak2, Lyn, c-Kit, and EpoR was cloned into the mammalian expression vector pSG5 (Stratagene).

Plasmid Preparation:

Article Title: Truncation of the Carboxyl Terminus of the DihydropyridineReceptor β1a Subunit Promotes Ca2+ Dependent Excitation-Contraction Coupling in Skeletal Myotubes
Article Snippet: .. As a positive control, a rabbit α 1C was transiently overexpressed in β 1 KO myotubes using the mammalian expression vector pSG5. .. In this case, we found a robust immunofluorescence signal indicating that exogenous a1C protein was readily detectable by the technique.

Article Title: Transcriptional Regulatory Properties of Epstein-Barr Virus Nuclear Antigen 3C Are Conserved in Simian Lymphocryptoviruses
Article Snippet: .. The entire BaLCV-3C ORF was isolated as a Kpn I-to- Eco RI subfragment that was cloned into the mammalian expression vector pSG5 (Stratagene) in frame with a c- myc epitope tag. .. Reporter plasmids −2350LMP-CAT (containing an LMP-1 promoter fragment from −2350 to +40 relative to the site of transcription initiation linked to the chloramphenicol acetyltransferase [CAT] reporter gene) and −215/-144 LMP-1BLCAT2 (containing nucleotides −215 to −144 of the LMP-1 promoter, encompassing the Spi site, in the plasmid pBLCAT2 which contains the herpesvirus tk promoter [ ]) have been previously described ( , , ).

Article Title: GTP-Binding-Defective ARL4D Alters Mitochondrial Morphology and Membrane Potential
Article Snippet: .. Expression Plasmids The cDNAs corresponding to ARL4D, ARL4C, ARL4A and their various mutants were cloned into the mammalian expression vector pSG5 (Stratagene, La Jolla, CA, USA), as previously described. .. These constructs were used to express untagged ARL4s .

Article Title: Functional analysis of a frame-shift mutant of the dihydropyridine receptor pore subunit (?1S) expressing two complementary protein fragments
Article Snippet: .. Primary cultures of mouse myotubes Primary cultures were prepared from hind limbs of day 18 embryos (E18) as described previously [ ]. cDNAs of interest and a separate expression vector encoding the T-cell membrane antigen CD8 were subcloned into the mammalian expression vector pSG5 (Stratagene, CA) and were mixed and cotransfected with the polyamine LT-1 (Panvera, WI). .. Whole-cell recordings and immunostaining were done 3–5 days after transfection.

Article Title: Truncation of the Carboxyl Terminus of the DihydropyridineReceptor β1a Subunit Promotes Ca2+ Dependent Excitation-Contraction Coupling in Skeletal Myotubes
Article Snippet: .. A full-length rabbit α 1C cDNA encoding residues 1-2171 (Genbank accession # , nucleotide coordinates nt 192 to nt 6707) was fused in frame to the first 11 amino acids of the phage T7 gene 10 protein in the mammalian expression vector pSG5 (Stratagene, CA) using Age I and Not I cloning sites. .. The α 1S I-II loop ( α 1S residues 335-432) was amplified by PCR from a cDNA template encoding full-length α 1S (Genbank accession # ), using the forward primer 5′-tca tca gga tcc ggg gaa ttt acc aag gag-3′ that contained a Bam HI restriction site and the reverse primer 5′-atg cca gaa ttc tct cga ctt cac cag gtc -3′with an Eco RI restriction site.

Article Title: Development of an intracellularly acting inhibitory peptide selective for PKN
Article Snippet: .. pSG5/tau vector for the expression of tau was generated by insertion of cDNA encoding the open reading frames of human brain tau (383 residues) into the mammalian expression vector pSG5 (Stratagene) as described previously [ ]. pTB701/ PKN1/AF3 vector expressing a catalytically active form of PKN1 (aPKN) and pTB701/PKN1/AF3(K644E) vector expressing a catalytically inactive mutant of PKN1 (iPKN) have been described previously [ ]. .. HeLa cells were cultured at 37 °C in 5 % CO2 in DMEM (Dulbecco’s modified Eagle’s medium) supplemented with 10 % FBS (fetal bovine serum) and antibiotics (50 units/ml penicillin and 50 μ g/ml streptomycin).

Article Title: Epstein-Barr Virus Nuclear Antigen 3C Activates the Latent Membrane Protein 1 Promoter in the Presence of Epstein-Barr Virus Nuclear Antigen 2 through Sequences Encompassing an Spi-1/Spi-B Binding Site
Article Snippet: .. The mammalian expression vector pSG5 (Stratagene) was used to express EBNA proteins in transient transfection assays as well as to generate mRNA for in vitro translation. .. The full length Spi-1 cDNA was provided by F. Moreau-Gachelin (Institut Curie, Paris, France).

Article Title: The highly related DEAD box RNA helicases p68 and p72 exist as heterodimers in cells
Article Snippet: .. p72-myc . a p72 cDNA was cloned in a derivative of the mammalian expression vector pSG5 (Stratagene) containing the myc epitope at the N-terminus ( ). p82-myc. a p82 cDNA was generated by annealing oligonucleotides comprising the upstream sequence given in Uhlmann-Schiffler et al . ( ) and the myc-tagged version was obtained as for p72. p68-/p72-GST. p68 and p72 cDNAs were cloned in the vector pEBG2T ( ) which allows expression of GST-tagged proteins in mammalian cells. .. Interaction assays, using the Clontech GAL4 Matchmaker yeast two-hybrid system were carried out as described previously ( ).

Article Title: ADP-ribosylation factor–like 4A interacts with Robo1 to promote cell migration by regulating Cdc42 activation
Article Snippet: .. Briefly, Arl4A was cloned into the mammalian expression vector pSG5 (Stratagene, La Jolla, CA) to generate untagged Arl4A. .. The cDNA sequence was subcloned into pET32a (Novagen, Madison, WI) for His-tagged Arl4A expressed in Escherichia coli or pBTM116 for LexA-tagged Arl4A expressed in yeast.

Article Title: Truncation of the Carboxyl Terminus of the DihydropyridineReceptor β1a Subunit Promotes Ca2+ Dependent Excitation-Contraction Coupling in Skeletal Myotubes
Article Snippet: .. All cDNAs were cloned into the mammalian expression vector pSG5 (Stratagene, CA). cDNA transfection was performed during the myoblast fusion stage with the polyamine LT1 (Panvera). .. Cells were exposed for 2–3 h to a transfection solution containing LT1 and cDNA at a 5:1 μ g ratio.

Article Title: ADP-ribosylation factor–like 4C binding to filamin-A modulates filopodium formation and cell migration
Article Snippet: .. Plasmid construction cDNAs corresponding to Arl4A/C/D and their various mutants were cloned into the mammalian expression vector pSG5 (Stratagene, La Jolla, CA), which was also used for expressing untagged Arl4C. .. The cDNAs were also subcloned into the mammalian expression vector pcDNA 3.1 (Invitrogen) or the bacterial expression vector pET15b (Novagen, Madison, WI) and pBTM116 to obtain myc-tagged, His-tagged, or LexA-tagged Arl4 A/C/D and their various mutants. pcDNA 3.1 harboring FLNa-myc was provided by Jeffrey J.Y.

Article Title: Role of Phosphoinositide 3-Kinase in Activation of Ras and Mitogen-Activated Protein Kinase by Epidermal Growth Factor
Article Snippet: .. The PCR products were digested with Cla I and Bam HI, ligated into the p110 sequence, and subcloned into the mammalian expression vector pSG5 (Stratagene) to generate p110-CAAX. ..

Article Title: Dimeric RFX Proteins Contribute to the Activity and Lineage Specificity of the Interleukin-5 Receptor ? Promoter through Activation and Repression Domains
Article Snippet: .. Full-length human RFX1 and RFX3 were subcloned into mammalian expression vector pSG5 (Stratagene, La Jolla, Calif.), and the resulting constructs were named pSG5RFX1 and pSG5RFX3, respectively ( , ). .. Full-length human RFX2 ( ) was tagged with a hemagglutinin (HA) epitope on its amino terminus and subcloned into mammalian expression vector pcDNA3 (Invitrogen, San Diego, Calif.) (pcDNA3HARFX2).

Article Title: Btk Is Required for an Efficient Response to Erythropoietin and for SCF-controlled Protection against TRAIL in Erythroid Progenitors
Article Snippet: .. The complete open reading frame of Btk and Btk kinase dead (K430R, a gift from J. Borst, Netherlands Cancer Institute, Amsterdam, Netherlands), Tec, Jak2, Lyn, c-Kit, and EpoR was cloned into the mammalian expression vector pSG5 (Stratagene). .. Additionally, Btk was cloned into the retroviral vector pBabe-puro.

Article Title: Ca2+ Current and Charge Movements in Skeletal Myotubes Promoted by the β-Subunit of the Dihydropyridine Receptor in the Absence of Ryanodine Receptor Type 1
Article Snippet: .. All cDNAs of interest, with the exceptions of RyR1 and CD8- β 2a C3,4S, were subcloned in the mammalian expression vector pSG5 (Stratagene, La Jolla, CA). .. The RyR1 cDNA was subcloned in the pCl-neo expression vector (Promega, Madison, WI) as described ( ).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Stratagene mammalian expression vector psg5
    LCV 3C proteins universally repress transcription mediated through Jκ. EBV-negative B cells were cotransfected with a CAT reporter gene controlled by 10 copies of a Jκ-binding site plus either empty <t>pSG5</t> expression vector (control) or expression vectors for EBNA-2 alone or in the presence of EBV-3C, BaLCV-3C, or RhLCV-3C. Each data point is the mean from four separate transfections corrected for transfection efficiency. Error bars indicate standard deviations.
    Mammalian Expression Vector Psg5, supplied by Stratagene, used in various techniques. Bioz Stars score: 90/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mammalian expression vector psg5/product/Stratagene
    Average 90 stars, based on 17 article reviews
    Price from $9.99 to $1999.99
    mammalian expression vector psg5 - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    Image Search Results


    LCV 3C proteins universally repress transcription mediated through Jκ. EBV-negative B cells were cotransfected with a CAT reporter gene controlled by 10 copies of a Jκ-binding site plus either empty pSG5 expression vector (control) or expression vectors for EBNA-2 alone or in the presence of EBV-3C, BaLCV-3C, or RhLCV-3C. Each data point is the mean from four separate transfections corrected for transfection efficiency. Error bars indicate standard deviations.

    Journal: Journal of Virology

    Article Title: Transcriptional Regulatory Properties of Epstein-Barr Virus Nuclear Antigen 3C Are Conserved in Simian Lymphocryptoviruses

    doi: 10.1128/JVI.77.10.5639-5648.2003

    Figure Lengend Snippet: LCV 3C proteins universally repress transcription mediated through Jκ. EBV-negative B cells were cotransfected with a CAT reporter gene controlled by 10 copies of a Jκ-binding site plus either empty pSG5 expression vector (control) or expression vectors for EBNA-2 alone or in the presence of EBV-3C, BaLCV-3C, or RhLCV-3C. Each data point is the mean from four separate transfections corrected for transfection efficiency. Error bars indicate standard deviations.

    Article Snippet: The entire BaLCV-3C ORF was isolated as a Kpn I-to- Eco RI subfragment that was cloned into the mammalian expression vector pSG5 (Stratagene) in frame with a c- myc epitope tag.

    Techniques: Binding Assay, Expressing, Plasmid Preparation, Transfection

    Btk coimmunoprecipitates with and is a substrate of Jak2. (A–D and F) COS cells were transfected with pSG5-based expression constructs encoding the indicated proteins. Expression of all proteins was verified in Western blots using specific antibodies (not depicted). After 48 h, cells were stimulated with 5 U/ml Epo (B) or 500 ng/ml SCF (C, lane 4; D and E, lane 4) for 10 min, harvested, and lysed, and Btk (A and C), EpoR (B), Jak2 (D), and c-Kit (F) were immunoprecipitated. (top panels) Immunoblots were stained with antiphosphotyrosine antibodies (PY99). The blots were restained with antibodies recognizing the immunoprecipitated proteins to check for equal loading. Arrows indicate the position of the immunoprecipitated and coimmunoprecipitating proteins. (E) wt erythroid progenitors (2B6) were factor deprived in the absence or presence of the Src kinase family inhibitor PP2 as indicated and stimulated with Epo for 10 min. Epo-induced Jak2 phosphorylation was assayed on immunoblots using PY99 (top). (bottom) Blots were restained with anti-Jak2 to confirm equal loading. (F) c-Kit immunoprecipitates were stained with antiphosphotyrosine antibodies (PY99), and blots were restained with anti–c-Kit and anti-Btk antibodies, whereas total cell lysates (TCLs) were stained with anti–c-Kit and anti-Btk to check expression levels.

    Journal: The Journal of Experimental Medicine

    Article Title: Btk Is Required for an Efficient Response to Erythropoietin and for SCF-controlled Protection against TRAIL in Erythroid Progenitors

    doi: 10.1084/jem.20031109

    Figure Lengend Snippet: Btk coimmunoprecipitates with and is a substrate of Jak2. (A–D and F) COS cells were transfected with pSG5-based expression constructs encoding the indicated proteins. Expression of all proteins was verified in Western blots using specific antibodies (not depicted). After 48 h, cells were stimulated with 5 U/ml Epo (B) or 500 ng/ml SCF (C, lane 4; D and E, lane 4) for 10 min, harvested, and lysed, and Btk (A and C), EpoR (B), Jak2 (D), and c-Kit (F) were immunoprecipitated. (top panels) Immunoblots were stained with antiphosphotyrosine antibodies (PY99). The blots were restained with antibodies recognizing the immunoprecipitated proteins to check for equal loading. Arrows indicate the position of the immunoprecipitated and coimmunoprecipitating proteins. (E) wt erythroid progenitors (2B6) were factor deprived in the absence or presence of the Src kinase family inhibitor PP2 as indicated and stimulated with Epo for 10 min. Epo-induced Jak2 phosphorylation was assayed on immunoblots using PY99 (top). (bottom) Blots were restained with anti-Jak2 to confirm equal loading. (F) c-Kit immunoprecipitates were stained with antiphosphotyrosine antibodies (PY99), and blots were restained with anti–c-Kit and anti-Btk antibodies, whereas total cell lysates (TCLs) were stained with anti–c-Kit and anti-Btk to check expression levels.

    Article Snippet: The complete open reading frame of Btk and Btk kinase dead (K430R, a gift from J. Borst, Netherlands Cancer Institute, Amsterdam, Netherlands), Tec, Jak2, Lyn, c-Kit, and EpoR was cloned into the mammalian expression vector pSG5 (Stratagene).

    Techniques: Transfection, Expressing, Construct, Western Blot, Immunoprecipitation, Staining

    Jκ DNA-binding sites are not required for EBNA-3C-mediated activation of the LMP-1 promoter. The ability of EBNA-3C to activate the LMP-1 promoter was evaluated using a CAT reporter gene assay following transfection of EBV-negative BL2 cells. The truncated or internally deleted fragments of the LMP-1 promoter controlling expression of the CAT reporter gene are depicted schematically at the left; numbers indicate base pair positions relative to the transcriptional start site. Black circles indicate Jκ binding sites. Specific mutations of the Jκ binding sites are indicated by open circles. A 10-μg quantity of each of the reporters indicated was transfected with either empty pSG5 expression vector (control) or pSG5-EBNA-2 in the presence or absence of pSG5-EBNA-3C. CAT activity was measured 36 h after transfection and is quantified relative to the activity obtained with empty expression vector. Error bars represent standard deviations.

    Journal: Journal of Virology

    Article Title: Epstein-Barr Virus Nuclear Antigen 3C Activates the Latent Membrane Protein 1 Promoter in the Presence of Epstein-Barr Virus Nuclear Antigen 2 through Sequences Encompassing an Spi-1/Spi-B Binding Site

    doi:

    Figure Lengend Snippet: Jκ DNA-binding sites are not required for EBNA-3C-mediated activation of the LMP-1 promoter. The ability of EBNA-3C to activate the LMP-1 promoter was evaluated using a CAT reporter gene assay following transfection of EBV-negative BL2 cells. The truncated or internally deleted fragments of the LMP-1 promoter controlling expression of the CAT reporter gene are depicted schematically at the left; numbers indicate base pair positions relative to the transcriptional start site. Black circles indicate Jκ binding sites. Specific mutations of the Jκ binding sites are indicated by open circles. A 10-μg quantity of each of the reporters indicated was transfected with either empty pSG5 expression vector (control) or pSG5-EBNA-2 in the presence or absence of pSG5-EBNA-3C. CAT activity was measured 36 h after transfection and is quantified relative to the activity obtained with empty expression vector. Error bars represent standard deviations.

    Article Snippet: The mammalian expression vector pSG5 (Stratagene) was used to express EBNA proteins in transient transfection assays as well as to generate mRNA for in vitro translation.

    Techniques: Binding Assay, Activation Assay, Reporter Gene Assay, Transfection, Expressing, Plasmid Preparation, Activity Assay

    Arl4C interacts with FLNa. (A) Schematic diagram of FLNa and fragments constructed in this study. FLNa contains 24 IgG repeats and possesses an actin-binding domain (ABD) at the N-terminus. FLNa was identified according to fragments of various lengths using Arl4C-Q72L as bait in a yeast two-hybrid system. (B) Different FLNa fragments were tested for interaction with Arl4C-Q72L in yeast two-hybrid assays. The levels of proteins expressed by the transforming plasmids were confirmed by immunoblotting. Lamin was used as a negative control. After cotransformation with the indicated plasmids, interactions were verified by growth of the yeast on a synthetic His+ plate and a His− selective plate, followed by filter assays for β-galactosidase activity. Total protein (20 µg) was loaded onto a 10-well gel to detect proteins. (C) Different forms of Arl4C were tested for interaction with the FLNa R22′ region in yeast two-hybrid assays. The levels of protein expressed by the transforming plasmids were confirmed by immunoblotting. Empty vector pBTM116 was used as a negative control. (D) Interaction between WT and the GTP-bound form of Arl4C with FLNa was tested by a pull-down assay. Purified GST or FLNa R22′-GST was incubated with lysates of HeLa cells expressing Arl4C-WT, Arl4C-Q72L, and Arl4C-T44N. After binding and washing, bead-bound GST-protein complexes were analyzed by immunoblotting using an anti-Arl4C antibody. SDS–PAGE analysis of the total cell lysate and Arl4C (input) expression by immunoblotting were used to verify the initial expression level. Equal amounts of GST beads were used in each experiment as shown by Coomassie Blue staining. (E) Interaction between Arl4C and FLNa was verified by coimmunoprecipitation. HeLa cells, which possess endogenous FLNa, transiently transfected with the empty vector pSG5 or Arl4C-WT, Arl4C-Q72L, or Arl4C-T44N in pSG5 were lysed and immunoprecipitated with anti-FLNa antibody or irrelevant mouse IgG-conjugated protein G magnetic beads. The bound proteins were separated by SDS–PAGE and subjected to immunoblotting with antibodies against FLNa and Arl4C. To confirm the initial expression level, 2.5% of the total cell lysate (input) was loaded. Equal amounts of FLNa antibody were used in the assays as shown by Coomassie Blue staining of the heavy chain. (F) Wild-type and various mutants of Arl4A, Arl4C, and Arl4D were tested for interaction with FLNa R22′ in yeast two-hybrid assays. Total protein (20 µg) was loaded onto a 10-well gel to detect proteins. (G) The interaction of FLNa R22′ with the Arl4 family was tested by pull-down assays in HeLa cells. SDS–PAGE analysis of total cell lysates and expression of Arl4A/C/D (input) by immunoblotting was used to verify the initial expression level. Equal amounts of GST beads were used in each experiment as shown by Coomassie Blue staining.

    Journal: Molecular Biology of the Cell

    Article Title: ADP-ribosylation factor–like 4C binding to filamin-A modulates filopodium formation and cell migration

    doi: 10.1091/mbc.E17-01-0059

    Figure Lengend Snippet: Arl4C interacts with FLNa. (A) Schematic diagram of FLNa and fragments constructed in this study. FLNa contains 24 IgG repeats and possesses an actin-binding domain (ABD) at the N-terminus. FLNa was identified according to fragments of various lengths using Arl4C-Q72L as bait in a yeast two-hybrid system. (B) Different FLNa fragments were tested for interaction with Arl4C-Q72L in yeast two-hybrid assays. The levels of proteins expressed by the transforming plasmids were confirmed by immunoblotting. Lamin was used as a negative control. After cotransformation with the indicated plasmids, interactions were verified by growth of the yeast on a synthetic His+ plate and a His− selective plate, followed by filter assays for β-galactosidase activity. Total protein (20 µg) was loaded onto a 10-well gel to detect proteins. (C) Different forms of Arl4C were tested for interaction with the FLNa R22′ region in yeast two-hybrid assays. The levels of protein expressed by the transforming plasmids were confirmed by immunoblotting. Empty vector pBTM116 was used as a negative control. (D) Interaction between WT and the GTP-bound form of Arl4C with FLNa was tested by a pull-down assay. Purified GST or FLNa R22′-GST was incubated with lysates of HeLa cells expressing Arl4C-WT, Arl4C-Q72L, and Arl4C-T44N. After binding and washing, bead-bound GST-protein complexes were analyzed by immunoblotting using an anti-Arl4C antibody. SDS–PAGE analysis of the total cell lysate and Arl4C (input) expression by immunoblotting were used to verify the initial expression level. Equal amounts of GST beads were used in each experiment as shown by Coomassie Blue staining. (E) Interaction between Arl4C and FLNa was verified by coimmunoprecipitation. HeLa cells, which possess endogenous FLNa, transiently transfected with the empty vector pSG5 or Arl4C-WT, Arl4C-Q72L, or Arl4C-T44N in pSG5 were lysed and immunoprecipitated with anti-FLNa antibody or irrelevant mouse IgG-conjugated protein G magnetic beads. The bound proteins were separated by SDS–PAGE and subjected to immunoblotting with antibodies against FLNa and Arl4C. To confirm the initial expression level, 2.5% of the total cell lysate (input) was loaded. Equal amounts of FLNa antibody were used in the assays as shown by Coomassie Blue staining of the heavy chain. (F) Wild-type and various mutants of Arl4A, Arl4C, and Arl4D were tested for interaction with FLNa R22′ in yeast two-hybrid assays. Total protein (20 µg) was loaded onto a 10-well gel to detect proteins. (G) The interaction of FLNa R22′ with the Arl4 family was tested by pull-down assays in HeLa cells. SDS–PAGE analysis of total cell lysates and expression of Arl4A/C/D (input) by immunoblotting was used to verify the initial expression level. Equal amounts of GST beads were used in each experiment as shown by Coomassie Blue staining.

    Article Snippet: Plasmid construction cDNAs corresponding to Arl4A/C/D and their various mutants were cloned into the mammalian expression vector pSG5 (Stratagene, La Jolla, CA), which was also used for expressing untagged Arl4C.

    Techniques: Construct, Binding Assay, Negative Control, Activity Assay, Plasmid Preparation, Pull Down Assay, Purification, Incubation, Expressing, SDS Page, Staining, Transfection, Immunoprecipitation, Magnetic Beads

    Arl4C induces filopodium formation in a nucleotide-dependent manner. Immunofluorescence staining of Arl4C or pSG5 vector in HeLa cells transfected with the indicated plasmids. (A) Cells were stained for Arl4C (red), FLNa (green), and DAPI (blue). (B) Cells were stained for Arl4C (red), phalloidin (green), and DAPI (blue). (C) Cells were stained for Arl4C (red), fascin (green), and DAPI (blue). Scale bar = 10 µm. Histograms: The colocalization ratio of Arl4C and FLNa/F-actin/fascin at filopodia of 10 randomly chosen cells from each group were analyzed in each experiment, and statistical analyses were based on data from three independent experiments (total cells from three experiments = 30). Quantification of the number of filopodia per cell was from three independent experiments (total cells = 10). ND: not detected. Scatter plots represent mean ± SD.

    Journal: Molecular Biology of the Cell

    Article Title: ADP-ribosylation factor–like 4C binding to filamin-A modulates filopodium formation and cell migration

    doi: 10.1091/mbc.E17-01-0059

    Figure Lengend Snippet: Arl4C induces filopodium formation in a nucleotide-dependent manner. Immunofluorescence staining of Arl4C or pSG5 vector in HeLa cells transfected with the indicated plasmids. (A) Cells were stained for Arl4C (red), FLNa (green), and DAPI (blue). (B) Cells were stained for Arl4C (red), phalloidin (green), and DAPI (blue). (C) Cells were stained for Arl4C (red), fascin (green), and DAPI (blue). Scale bar = 10 µm. Histograms: The colocalization ratio of Arl4C and FLNa/F-actin/fascin at filopodia of 10 randomly chosen cells from each group were analyzed in each experiment, and statistical analyses were based on data from three independent experiments (total cells from three experiments = 30). Quantification of the number of filopodia per cell was from three independent experiments (total cells = 10). ND: not detected. Scatter plots represent mean ± SD.

    Article Snippet: Plasmid construction cDNAs corresponding to Arl4A/C/D and their various mutants were cloned into the mammalian expression vector pSG5 (Stratagene, La Jolla, CA), which was also used for expressing untagged Arl4C.

    Techniques: Immunofluorescence, Staining, Plasmid Preparation, Transfection

    Arl4C-FLNa interaction promotes Cdc42 activation via FGD6. (A) Pull-down assays with HeLa cells coexpressing the indicated plasmids or siRNAs were used to detect Cdc42 activation. Total cell lysates and equal amounts of GST beads were analyzed by Coomassie Blue staining. The expression of Cdc42, Arl4C, FGD6 (input), and active Cdc42 was analyzed by immunoblotting. The percentage of FGD6 after siRNA treatment is 14.3 ± 0.7% and 17.4 ± 0.4%. (B) HeLa cells were transiently transfected with the empty vector pSG5 or Arl4C as indicated, interaction was verified by coimmunoprecipitation with anti-FLNa–conjugated protein G magnetic beads. To confirm the initial expression level, 2.5% of the total cell lysate (input) was loaded. SDS–PAGE analysis was used to verify Arl4C, FLNa, and FGD6 expression and bound proteins. (C) HeLa cells were transiently transfected with FLNa siRNA, Arl4C, and full-length FLNa-WT, or -A10; interaction was verified by coimmunoprecipitation with anti-FLNa–conjugated protein G magnetic beads. To confirm the initial expression level, 2.5% of the total cell lysate (input) was loaded. SDS–PAGE analysis was used to verify Arl4C, FLNa, and FGD6 expression and bound proteins. (D) Pull-down assays with A549 cells coexpressing the indicated plasmids or siRNA were used to detect Cdc42 activation. Total cell lysates and equal amounts of GST beads were analyzed by Coomassie Blue staining. The expression of Cdc42, FGD6, Arl4C (input), and active Cdc42 was analyzed by immunoblotting. The percentage of Arl4C after siRNA treatment is 28.5 ± 0.6% and 29.7 ± 0.8%. (E) A549 cells were transiently transfected with FGD6 or Arl4C siRNA as indicated. The interaction was verified by coimmunoprecipitation with anti-FLNa–conjugated protein G magnetic beads. The percentage of Arl4C after siRNA treatment is 23.6 ± 1.3%. To confirm the initial expression level, 2.5% of the total cell lysate (input) was loaded. SDS–PAGE analysis was used to verify Arl4C, FLNa, and FGD6 expression and bound proteins. (F) A549 cells were transiently transfected with FLNa siRNA, full-length FLNa-WT, or -A10; interaction was verified by coimmunoprecipitation with anti-FLNa–conjugated protein G magnetic beads. To confirm the initial expression level, 2.5% of the total cell lysate (input) was loaded. SDS–PAGE analysis was used to verify Arl4C, FLNa, and FGD6 expression and bound proteins. Histograms in A and D: Quantification of activity by pull-down assays was based on three biological replicates. Scatter plots represent mean ± SD. *, p

    Journal: Molecular Biology of the Cell

    Article Title: ADP-ribosylation factor–like 4C binding to filamin-A modulates filopodium formation and cell migration

    doi: 10.1091/mbc.E17-01-0059

    Figure Lengend Snippet: Arl4C-FLNa interaction promotes Cdc42 activation via FGD6. (A) Pull-down assays with HeLa cells coexpressing the indicated plasmids or siRNAs were used to detect Cdc42 activation. Total cell lysates and equal amounts of GST beads were analyzed by Coomassie Blue staining. The expression of Cdc42, Arl4C, FGD6 (input), and active Cdc42 was analyzed by immunoblotting. The percentage of FGD6 after siRNA treatment is 14.3 ± 0.7% and 17.4 ± 0.4%. (B) HeLa cells were transiently transfected with the empty vector pSG5 or Arl4C as indicated, interaction was verified by coimmunoprecipitation with anti-FLNa–conjugated protein G magnetic beads. To confirm the initial expression level, 2.5% of the total cell lysate (input) was loaded. SDS–PAGE analysis was used to verify Arl4C, FLNa, and FGD6 expression and bound proteins. (C) HeLa cells were transiently transfected with FLNa siRNA, Arl4C, and full-length FLNa-WT, or -A10; interaction was verified by coimmunoprecipitation with anti-FLNa–conjugated protein G magnetic beads. To confirm the initial expression level, 2.5% of the total cell lysate (input) was loaded. SDS–PAGE analysis was used to verify Arl4C, FLNa, and FGD6 expression and bound proteins. (D) Pull-down assays with A549 cells coexpressing the indicated plasmids or siRNA were used to detect Cdc42 activation. Total cell lysates and equal amounts of GST beads were analyzed by Coomassie Blue staining. The expression of Cdc42, FGD6, Arl4C (input), and active Cdc42 was analyzed by immunoblotting. The percentage of Arl4C after siRNA treatment is 28.5 ± 0.6% and 29.7 ± 0.8%. (E) A549 cells were transiently transfected with FGD6 or Arl4C siRNA as indicated. The interaction was verified by coimmunoprecipitation with anti-FLNa–conjugated protein G magnetic beads. The percentage of Arl4C after siRNA treatment is 23.6 ± 1.3%. To confirm the initial expression level, 2.5% of the total cell lysate (input) was loaded. SDS–PAGE analysis was used to verify Arl4C, FLNa, and FGD6 expression and bound proteins. (F) A549 cells were transiently transfected with FLNa siRNA, full-length FLNa-WT, or -A10; interaction was verified by coimmunoprecipitation with anti-FLNa–conjugated protein G magnetic beads. To confirm the initial expression level, 2.5% of the total cell lysate (input) was loaded. SDS–PAGE analysis was used to verify Arl4C, FLNa, and FGD6 expression and bound proteins. Histograms in A and D: Quantification of activity by pull-down assays was based on three biological replicates. Scatter plots represent mean ± SD. *, p

    Article Snippet: Plasmid construction cDNAs corresponding to Arl4A/C/D and their various mutants were cloned into the mammalian expression vector pSG5 (Stratagene, La Jolla, CA), which was also used for expressing untagged Arl4C.

    Techniques: Activation Assay, Staining, Expressing, Transfection, Plasmid Preparation, Magnetic Beads, SDS Page, Activity Assay