magnetic oligo dt beads  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 78

    Structured Review

    Thermo Fisher magnetic oligo dt beads
    Magnetic Oligo Dt Beads, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 78/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/magnetic oligo dt beads/product/Thermo Fisher
    Average 78 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    magnetic oligo dt beads - by Bioz Stars, 2019-10
    78/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Evaluating the Bioactivity of a Novel Broad-Spectrum Antimicrobial Peptide Brevinin-1GHa from the Frog Skin Secretion of Hylarana guentheri and Its Analogues
    Article Snippet: Then according to the manufacturer, the polyadenylated mRNA was isolated with magnetic oligo-dT beads (Dynal, Merseyside, UK). .. The PCR cycling program ran under the following condition: 90 s at 94 °C for initial denaturation; 35 cycles, 30 s at 94 °C for further denaturation; 30 s at 61 °C for primer annealing and 180 s at 72 °C for the extension.

    Article Title: PSN-PC: A Novel Antimicrobial and Anti-Biofilm Peptide from the Skin Secretion of Phyllomedusa-camba with Cytotoxicity on Human Lung Cancer Cell
    Article Snippet: Paragraph title: 4.2. “Shotgun” Cloning of a Phyllomedusa camba Skin Secretion-Derived cDNA Library ... Then the polyadenylated mRNA was isolated utilizing magnetic oligo-dT beads under the guidance of the manufacturer (Dynal, Merseyside, UK) and the isolated mRNA was subsequently subjected to 5’- and 3’-rapid amplification of cDNA end (RACE) procedures to acquire full-length prepropeptide nucleic acid sequence data by using a SMART-RACE kit (Clontech, Oxford, UK) essentially as outlined by the manufacturer.

    Article Title: Evolutionarily conserved human targets of adenosine to inosine RNA editing
    Article Snippet: For mouse and chicken sequences, poly-A RNA was isolated from brain and liver samples using Trifast (PeqLab, Germany) and poly-A selected using magnetic oligo dT beads (Dynal, Germany). .. For mouse and chicken sequences, poly-A RNA was isolated from brain and liver samples using Trifast (PeqLab, Germany) and poly-A selected using magnetic oligo dT beads (Dynal, Germany).

    Amplification:

    Article Title: Transcriptome analysis provides insights into the regulatory function of alternative splicing in antiviral immunity in grass carp (Ctenopharyngodon idella)
    Article Snippet: Before the construction of library, ribosomal and viral RNA were removed and poly(A)+ mRNA were isolated with magnetic Oligo-dT beads (Invitrogen, USA), and then cDNA libraries were constructed and sequenced by Majorbio Biotech Co., Ltd, Shanghai, China. .. Briefly, 8 μg of total RNA for each group was used for the construction of libraries by using TruseqTM RNA sample prep Kit (Illumina, USA) according to the manufacturer’s protocol.

    Article Title: PSN-PC: A Novel Antimicrobial and Anti-Biofilm Peptide from the Skin Secretion of Phyllomedusa-camba with Cytotoxicity on Human Lung Cancer Cell
    Article Snippet: Five milligrams sample of lyophilised Phyllomedusa camba skin secretion were dissolved in 1 mL of cell lysis/mRNA stabilisation buffer (Dynal, Merseyside, UK). .. Then the polyadenylated mRNA was isolated utilizing magnetic oligo-dT beads under the guidance of the manufacturer (Dynal, Merseyside, UK) and the isolated mRNA was subsequently subjected to 5’- and 3’-rapid amplification of cDNA end (RACE) procedures to acquire full-length prepropeptide nucleic acid sequence data by using a SMART-RACE kit (Clontech, Oxford, UK) essentially as outlined by the manufacturer. .. Briefly, the 3’-RACE reactions employed a nested universal (NUP) primer and degenerate sense primer (S1; 5’-ACTTTCYGAWTTRYAAGMCCAAABATG-3’ (Y = C/T, W = A/T, R = A/G, M = A/C, B = T/C/G) that were designed to highly-conserved segments of the signal peptides of cDNAs cloned previously from other Phyllomedusa frogs within our group [ ].

    Article Title: De novo assembly, characterization and annotation for the transcriptome of Sarcocheilichthys sinensis
    Article Snippet: The Magnetic Oligo (dT) Beads (Invitrogen, USA) was applied to isolate poly (A) mRNA from total RNA. .. After end reparation and single nucleotide A (adenine) addition for the purified cDNA, adapters were connected.

    Article Title: Adaptive chromatin remodeling drives glioblastoma stem cell plasticity and drug tolerance
    Article Snippet: For qRT-PCR, total RNA was reverse-transcribed into cDNA (High Capacitiy cDNA Reverse Transcriptase Kit, Applied Biosystems) and qRT-PCR amplification was performed in triplicate using fast SYBR Green Master Mix (Life Technologies) with specific PCR primers for genes of interest and 18S as an endogenous control. qRT-PCR experiments were performed with two biological replicates. .. For RNA-seq library preparation, Poly(A)+ RNA was enriched using magnetic oligo(dT)-beads (Life Technologies) and then ligated to RNA adaptors for sequencing.

    Article Title: Evolutionarily conserved human targets of adenosine to inosine RNA editing
    Article Snippet: For mouse and chicken sequences, poly-A RNA was isolated from brain and liver samples using Trifast (PeqLab, Germany) and poly-A selected using magnetic oligo dT beads (Dynal, Germany). .. For mouse and chicken sequences, poly-A RNA was isolated from brain and liver samples using Trifast (PeqLab, Germany) and poly-A selected using magnetic oligo dT beads (Dynal, Germany).

    Molecular Cloning:

    Article Title: Evaluating the Bioactivity of a Novel Broad-Spectrum Antimicrobial Peptide Brevinin-1GHa from the Frog Skin Secretion of Hylarana guentheri and Its Analogues
    Article Snippet: Paragraph title: 4.2. Molecular Cloning of an H. guentheri Skin Secretion-Derived cDNA Library ... Then according to the manufacturer, the polyadenylated mRNA was isolated with magnetic oligo-dT beads (Dynal, Merseyside, UK).

    Article Title: The synergistic antimicrobial effects of novel bombinin and bombinin H peptides from the skin secretion of Bombinaorientalis
    Article Snippet: Procedures had been vetted by the IACUC of Queen’s University, Belfast, and approved on 1 March 2011. .. Molecular cloning of novel bombinin and bombinin H precursor encoding cDNA from the skin secretion derived cDNA library A 5-mg lyophilized secretion of B. orientalis was dissolved in 1 ml of mRNA protection buffer, the polyadenylated mRNA was obtained by using magnetic oligo-dT beads following the instructions of the manufacturer (Dynal Biotech, Wirral, U.K.), and subsequently reverse transcribed. .. The cDNA was subjected to 3′-RACE PCR procedure to obtain the full-length prepro-bombinin and prepro-bombinin H nucleotide sequence using a SMART-RACE kit (Clontech, Oxford, U.K.) as described by the manufacturer.

    Construct:

    Article Title: Transcriptome analysis provides insights into the regulatory function of alternative splicing in antiviral immunity in grass carp (Ctenopharyngodon idella)
    Article Snippet: Equal amount of 4 grouped RNA samples were then respectively pooled for cDNA synthesis and RNA-seq. .. Before the construction of library, ribosomal and viral RNA were removed and poly(A)+ mRNA were isolated with magnetic Oligo-dT beads (Invitrogen, USA), and then cDNA libraries were constructed and sequenced by Majorbio Biotech Co., Ltd, Shanghai, China. .. Briefly, 8 μg of total RNA for each group was used for the construction of libraries by using TruseqTM RNA sample prep Kit (Illumina, USA) according to the manufacturer’s protocol.

    Article Title: A Genome-Wide Investigation of Expression Characteristics of Natural Antisense Transcripts in Liver and Muscle Samples of Pigs
    Article Snippet: All libraries were constructed for DGE analyses following the method described in Morrissy et al. (2009) . .. In brief, total RNA was used to isolate mRNA with the magnetic oligo (dT) beads (invitrogen).

    SYBR Green Assay:

    Article Title: Adaptive chromatin remodeling drives glioblastoma stem cell plasticity and drug tolerance
    Article Snippet: For qRT-PCR, total RNA was reverse-transcribed into cDNA (High Capacitiy cDNA Reverse Transcriptase Kit, Applied Biosystems) and qRT-PCR amplification was performed in triplicate using fast SYBR Green Master Mix (Life Technologies) with specific PCR primers for genes of interest and 18S as an endogenous control. qRT-PCR experiments were performed with two biological replicates. .. For RNA-seq library preparation, Poly(A)+ RNA was enriched using magnetic oligo(dT)-beads (Life Technologies) and then ligated to RNA adaptors for sequencing.

    Expressing:

    Article Title: Genetic dissection of blood lipid traits by integrating genome-wide association study and gene expression profiling in a porcine model
    Article Snippet: Digital gene expression (DGE) analyses of genome-wide transcripts were performed on 497 F2 liver samples as described previously [ ]. .. In brief, mRNA was isolated from total RNA with the magnetic oligo (dT) beads (invitrogen, USA).

    Article Title: Increased oxygen exposure alters collagen expression and tissue architecture during ligature-induced periodontitis
    Article Snippet: For analyses of gene expression, periodontal tissues were harvested and flash-frozen in 1 ml of TRIzol (Life Technologies, Rockville, MA) and stored at −80°C. mRNA levels were determined for COL1A1, TGF-β1, ALP, IL-1α, IL-1β, IL-6, and IL-10. .. From the total RNA, poly (A) tailed RNA were selected using magnetic oligo (dT) beads and a magnetic particle concentrator (Dynal A.S., Oslo, Norway) in accordance to the manufacturer’s protocol.

    Genome Wide:

    Article Title: Genetic dissection of blood lipid traits by integrating genome-wide association study and gene expression profiling in a porcine model
    Article Snippet: Digital gene expression (DGE) analyses of genome-wide transcripts were performed on 497 F2 liver samples as described previously [ ]. .. In brief, mRNA was isolated from total RNA with the magnetic oligo (dT) beads (invitrogen, USA).

    Derivative Assay:

    Article Title: The synergistic antimicrobial effects of novel bombinin and bombinin H peptides from the skin secretion of Bombinaorientalis
    Article Snippet: Procedures had been vetted by the IACUC of Queen’s University, Belfast, and approved on 1 March 2011. .. Molecular cloning of novel bombinin and bombinin H precursor encoding cDNA from the skin secretion derived cDNA library A 5-mg lyophilized secretion of B. orientalis was dissolved in 1 ml of mRNA protection buffer, the polyadenylated mRNA was obtained by using magnetic oligo-dT beads following the instructions of the manufacturer (Dynal Biotech, Wirral, U.K.), and subsequently reverse transcribed. .. The cDNA was subjected to 3′-RACE PCR procedure to obtain the full-length prepro-bombinin and prepro-bombinin H nucleotide sequence using a SMART-RACE kit (Clontech, Oxford, U.K.) as described by the manufacturer.

    Hybridization:

    Article Title: The evolutionary conserved FOXJ1 target gene Fam183b is essential for motile cilia in Xenopus but dispensable for ciliary function in mice
    Article Snippet: Paragraph title: Isolation of polyA+ RNA and Northern Blot hybridisation ... Total RNA was isolated from testis using TriReagent (Zymo Research), polyA+ RNA was isolated from adult wild type and Fam183b Δex1/ Δex1 testis using magnetic Oligo dT beads (Dynal, Novagen).

    Ligation:

    Article Title: Whole Blood Transcriptome Sequencing Reveals Gene Expression Differences between Dapulian and Landrace Piglets
    Article Snippet: Poly(A) mRNAs were further purified from the extracted total RNA using magnetic oligo (dT) beads (Invitrogen, Carlsbad, CA, USA). .. AMPure XP Beads (Beckman Coulter Inc., Brea, CA, USA) were used for cDNA purification.

    Biomarker Assay:

    Article Title: CpG Oligodeoxynucleotides Induce Differential Cytokine and Chemokine Gene Expression Profiles in Dapulian and Landrace Pigs
    Article Snippet: Briefly, mRNA was isolated from total RNA using magnetic oligo (dT) beads (Invitrogen, Carlsbad, CA, USA) and was further fragmented into about 200 bp. .. Finally, the suitable cDNA fragments were PCR-amplified to generate a complete cDNA library.

    Synthesized:

    Article Title: De novo assembly, characterization and annotation for the transcriptome of Sarcocheilichthys sinensis
    Article Snippet: The Magnetic Oligo (dT) Beads (Invitrogen, USA) was applied to isolate poly (A) mRNA from total RNA. .. The Magnetic Oligo (dT) Beads (Invitrogen, USA) was applied to isolate poly (A) mRNA from total RNA.

    Northern Blot:

    Article Title: The evolutionary conserved FOXJ1 target gene Fam183b is essential for motile cilia in Xenopus but dispensable for ciliary function in mice
    Article Snippet: Paragraph title: Isolation of polyA+ RNA and Northern Blot hybridisation ... Total RNA was isolated from testis using TriReagent (Zymo Research), polyA+ RNA was isolated from adult wild type and Fam183b Δex1/ Δex1 testis using magnetic Oligo dT beads (Dynal, Novagen).

    Infection:

    Article Title: Transcriptome analysis provides insights into the regulatory function of alternative splicing in antiviral immunity in grass carp (Ctenopharyngodon idella)
    Article Snippet: The 12 moribund fish were susceptible individuals, while the 12 survival fish were resistant individuals against GCRV infection. .. Before the construction of library, ribosomal and viral RNA were removed and poly(A)+ mRNA were isolated with magnetic Oligo-dT beads (Invitrogen, USA), and then cDNA libraries were constructed and sequenced by Majorbio Biotech Co., Ltd, Shanghai, China.

    Generated:

    Article Title: CpG Oligodeoxynucleotides Induce Differential Cytokine and Chemokine Gene Expression Profiles in Dapulian and Landrace Pigs
    Article Snippet: According to the manufacturer's recommendations, the sequencing libraries were generated using a NEBNext® Ultra RNA Library Prep Kit from Illumina (New England Biolabs, Ipswich, MA, USA) by Biomarker Technologies Corporation (Beijing, China). .. Briefly, mRNA was isolated from total RNA using magnetic oligo (dT) beads (Invitrogen, Carlsbad, CA, USA) and was further fragmented into about 200 bp.

    Sequencing:

    Article Title: Comparative transcriptome analyses on terpenoids metabolism in field- and mountain-cultivated ginseng roots
    Article Snippet: Paragraph title: Isolation, library construction and sequencing of RNA ... Briefly, poly (A)+ mRNA was isolated using magnetic Oligo-dT beads (Thermo Fisher Scientific Inc., Waltham, USA) and fragmented randomly into 200 bp in fragmentation buffer.

    Article Title: Transcriptome analysis provides insights into the regulatory function of alternative splicing in antiviral immunity in grass carp (Ctenopharyngodon idella)
    Article Snippet: Paragraph title: RNA isolation, library construction and sequencing ... Before the construction of library, ribosomal and viral RNA were removed and poly(A)+ mRNA were isolated with magnetic Oligo-dT beads (Invitrogen, USA), and then cDNA libraries were constructed and sequenced by Majorbio Biotech Co., Ltd, Shanghai, China.

    Article Title: PSN-PC: A Novel Antimicrobial and Anti-Biofilm Peptide from the Skin Secretion of Phyllomedusa-camba with Cytotoxicity on Human Lung Cancer Cell
    Article Snippet: Five milligrams sample of lyophilised Phyllomedusa camba skin secretion were dissolved in 1 mL of cell lysis/mRNA stabilisation buffer (Dynal, Merseyside, UK). .. Then the polyadenylated mRNA was isolated utilizing magnetic oligo-dT beads under the guidance of the manufacturer (Dynal, Merseyside, UK) and the isolated mRNA was subsequently subjected to 5’- and 3’-rapid amplification of cDNA end (RACE) procedures to acquire full-length prepropeptide nucleic acid sequence data by using a SMART-RACE kit (Clontech, Oxford, UK) essentially as outlined by the manufacturer. .. Briefly, the 3’-RACE reactions employed a nested universal (NUP) primer and degenerate sense primer (S1; 5’-ACTTTCYGAWTTRYAAGMCCAAABATG-3’ (Y = C/T, W = A/T, R = A/G, M = A/C, B = T/C/G) that were designed to highly-conserved segments of the signal peptides of cDNAs cloned previously from other Phyllomedusa frogs within our group [ ].

    Article Title: CpG Oligodeoxynucleotides Induce Differential Cytokine and Chemokine Gene Expression Profiles in Dapulian and Landrace Pigs
    Article Snippet: According to the manufacturer's recommendations, the sequencing libraries were generated using a NEBNext® Ultra RNA Library Prep Kit from Illumina (New England Biolabs, Ipswich, MA, USA) by Biomarker Technologies Corporation (Beijing, China). .. Briefly, mRNA was isolated from total RNA using magnetic oligo (dT) beads (Invitrogen, Carlsbad, CA, USA) and was further fragmented into about 200 bp.

    Article Title: De novo assembly, characterization and annotation for the transcriptome of Sarcocheilichthys sinensis
    Article Snippet: Paragraph title: Library construction and Illumina sequencing ... The Magnetic Oligo (dT) Beads (Invitrogen, USA) was applied to isolate poly (A) mRNA from total RNA.

    Article Title: Transcriptional and Translational Relationship in Environmental Stress: RNAseq and ITRAQ Proteomic Analysis Between Sexually Reproducing and Parthenogenetic Females in Moina micrura
    Article Snippet: Before the construction of library, ribosomal and viral RNA were removed and poly(A)+ mRNA was isolated with magnetic Oligo-dT beads (Invitrogen, United States), and then 10 μg of total RNA for each sample was used for the construction of libraries by using a TruSeqTM RNA sample preparation Kit from Illumina (San Diego, CA, United States), all performed according to the Illumina protocol. .. Before the construction of library, ribosomal and viral RNA were removed and poly(A)+ mRNA was isolated with magnetic Oligo-dT beads (Invitrogen, United States), and then 10 μg of total RNA for each sample was used for the construction of libraries by using a TruSeqTM RNA sample preparation Kit from Illumina (San Diego, CA, United States), all performed according to the Illumina protocol.

    Article Title: Adaptive chromatin remodeling drives glioblastoma stem cell plasticity and drug tolerance
    Article Snippet: Sequences for qRT-PCR primers used are listed in Table S4. .. For RNA-seq library preparation, Poly(A)+ RNA was enriched using magnetic oligo(dT)-beads (Life Technologies) and then ligated to RNA adaptors for sequencing. .. RNA-seq was performed with three biological replicates per GSC line and/or condition.

    Article Title: A Genome-Wide Investigation of Expression Characteristics of Natural Antisense Transcripts in Liver and Muscle Samples of Pigs
    Article Snippet: Paragraph title: Library Construction and Sequencing ... In brief, total RNA was used to isolate mRNA with the magnetic oligo (dT) beads (invitrogen).

    Article Title: Increased oxygen exposure alters collagen expression and tissue architecture during ligature-induced periodontitis
    Article Snippet: From the total RNA, poly (A) tailed RNA were selected using magnetic oligo (dT) beads and a magnetic particle concentrator (Dynal A.S., Oslo, Norway) in accordance to the manufacturer’s protocol. .. Primers and probes for real-time PCR were designed using Primer Express software (Applied Biosystems, Foster City, CA).

    DNA Gel Electrophoresis:

    Article Title: Evaluating the Bioactivity of a Novel Broad-Spectrum Antimicrobial Peptide Brevinin-1GHa from the Frog Skin Secretion of Hylarana guentheri and Its Analogues
    Article Snippet: Then according to the manufacturer, the polyadenylated mRNA was isolated with magnetic oligo-dT beads (Dynal, Merseyside, UK). .. The PCR cycling program ran under the following condition: 90 s at 94 °C for initial denaturation; 35 cycles, 30 s at 94 °C for further denaturation; 30 s at 61 °C for primer annealing and 180 s at 72 °C for the extension.

    Nucleic Acid Electrophoresis:

    Article Title: Comparative transcriptome analyses on terpenoids metabolism in field- and mountain-cultivated ginseng roots
    Article Snippet: Briefly, poly (A)+ mRNA was isolated using magnetic Oligo-dT beads (Thermo Fisher Scientific Inc., Waltham, USA) and fragmented randomly into 200 bp in fragmentation buffer. .. The constructed DNA template was enriched by PCR amplification of 15 cycles.

    Article Title: Transcriptome analysis provides insights into the regulatory function of alternative splicing in antiviral immunity in grass carp (Ctenopharyngodon idella)
    Article Snippet: Before the construction of library, ribosomal and viral RNA were removed and poly(A)+ mRNA were isolated with magnetic Oligo-dT beads (Invitrogen, USA), and then cDNA libraries were constructed and sequenced by Majorbio Biotech Co., Ltd, Shanghai, China. .. The constructed DNA template was enriched by PCR amplification (15 cycles).

    RNA Sequencing Assay:

    Article Title: Comparative transcriptome analyses on terpenoids metabolism in field- and mountain-cultivated ginseng roots
    Article Snippet: Briefly, poly (A)+ mRNA was isolated using magnetic Oligo-dT beads (Thermo Fisher Scientific Inc., Waltham, USA) and fragmented randomly into 200 bp in fragmentation buffer. .. High-throughput sequencing was performed on an Illumina Hiseq4000 sequencer (Illumina Inc., San Diego, USA) using a Truseq SBS Kit v3-HS 200 cycles Kits (Illumina Inc., San Diego, USA).

    Article Title: Transcriptome analysis provides insights into the regulatory function of alternative splicing in antiviral immunity in grass carp (Ctenopharyngodon idella)
    Article Snippet: Equal amount of 4 grouped RNA samples were then respectively pooled for cDNA synthesis and RNA-seq. .. Before the construction of library, ribosomal and viral RNA were removed and poly(A)+ mRNA were isolated with magnetic Oligo-dT beads (Invitrogen, USA), and then cDNA libraries were constructed and sequenced by Majorbio Biotech Co., Ltd, Shanghai, China.

    Article Title: CpG Oligodeoxynucleotides Induce Differential Cytokine and Chemokine Gene Expression Profiles in Dapulian and Landrace Pigs
    Article Snippet: Paragraph title: cDNA library construction and RNA-seq ... Briefly, mRNA was isolated from total RNA using magnetic oligo (dT) beads (Invitrogen, Carlsbad, CA, USA) and was further fragmented into about 200 bp.

    Article Title: Whole Blood Transcriptome Sequencing Reveals Gene Expression Differences between Dapulian and Landrace Piglets
    Article Snippet: Paragraph title: 2.3. cDNA Library Construction and Next-Generation Sequencing (RNA-seq) ... Poly(A) mRNAs were further purified from the extracted total RNA using magnetic oligo (dT) beads (Invitrogen, Carlsbad, CA, USA).

    Article Title: Adaptive chromatin remodeling drives glioblastoma stem cell plasticity and drug tolerance
    Article Snippet: Sequences for qRT-PCR primers used are listed in Table S4. .. For RNA-seq library preparation, Poly(A)+ RNA was enriched using magnetic oligo(dT)-beads (Life Technologies) and then ligated to RNA adaptors for sequencing. .. RNA-seq was performed with three biological replicates per GSC line and/or condition.

    Mutagenesis:

    Article Title: Evolutionarily conserved human targets of adenosine to inosine RNA editing
    Article Snippet: For mouse and chicken sequences, poly-A RNA was isolated from brain and liver samples using Trifast (PeqLab, Germany) and poly-A selected using magnetic oligo dT beads (Dynal, Germany). .. Genomic DNA from the same samples was isolated according to Ausubel et al . ( ).

    Isolation:

    Article Title: Evaluating the Bioactivity of a Novel Broad-Spectrum Antimicrobial Peptide Brevinin-1GHa from the Frog Skin Secretion of Hylarana guentheri and Its Analogues
    Article Snippet: Six milligrams of lyophilized skin secretion were dissolved in 1 mL of cell lysis/binding buffer (Life technologies, Oslo, Norway). .. Then according to the manufacturer, the polyadenylated mRNA was isolated with magnetic oligo-dT beads (Dynal, Merseyside, UK). .. A SMART-RACE kit (Clontech, Palo Alto, CA, USA) was utilized to achieve full-length prepropeptide nucleic acid sequence data.

    Article Title: Comparative transcriptome analyses on terpenoids metabolism in field- and mountain-cultivated ginseng roots
    Article Snippet: Five μg of total RNA for each of the two ginseng root samples was used for construction of libraries using the TruSeq RNA sample preparation Kit. .. Briefly, poly (A)+ mRNA was isolated using magnetic Oligo-dT beads (Thermo Fisher Scientific Inc., Waltham, USA) and fragmented randomly into 200 bp in fragmentation buffer. .. The constructed DNA template was enriched by PCR amplification of 15 cycles.

    Article Title: Transcriptome analysis provides insights into the regulatory function of alternative splicing in antiviral immunity in grass carp (Ctenopharyngodon idella)
    Article Snippet: Equal amount of 4 grouped RNA samples were then respectively pooled for cDNA synthesis and RNA-seq. .. Before the construction of library, ribosomal and viral RNA were removed and poly(A)+ mRNA were isolated with magnetic Oligo-dT beads (Invitrogen, USA), and then cDNA libraries were constructed and sequenced by Majorbio Biotech Co., Ltd, Shanghai, China. .. Briefly, 8 μg of total RNA for each group was used for the construction of libraries by using TruseqTM RNA sample prep Kit (Illumina, USA) according to the manufacturer’s protocol.

    Article Title: PSN-PC: A Novel Antimicrobial and Anti-Biofilm Peptide from the Skin Secretion of Phyllomedusa-camba with Cytotoxicity on Human Lung Cancer Cell
    Article Snippet: Five milligrams sample of lyophilised Phyllomedusa camba skin secretion were dissolved in 1 mL of cell lysis/mRNA stabilisation buffer (Dynal, Merseyside, UK). .. Then the polyadenylated mRNA was isolated utilizing magnetic oligo-dT beads under the guidance of the manufacturer (Dynal, Merseyside, UK) and the isolated mRNA was subsequently subjected to 5’- and 3’-rapid amplification of cDNA end (RACE) procedures to acquire full-length prepropeptide nucleic acid sequence data by using a SMART-RACE kit (Clontech, Oxford, UK) essentially as outlined by the manufacturer. .. Briefly, the 3’-RACE reactions employed a nested universal (NUP) primer and degenerate sense primer (S1; 5’-ACTTTCYGAWTTRYAAGMCCAAABATG-3’ (Y = C/T, W = A/T, R = A/G, M = A/C, B = T/C/G) that were designed to highly-conserved segments of the signal peptides of cDNAs cloned previously from other Phyllomedusa frogs within our group [ ].

    Article Title: CpG Oligodeoxynucleotides Induce Differential Cytokine and Chemokine Gene Expression Profiles in Dapulian and Landrace Pigs
    Article Snippet: According to the manufacturer's recommendations, the sequencing libraries were generated using a NEBNext® Ultra RNA Library Prep Kit from Illumina (New England Biolabs, Ipswich, MA, USA) by Biomarker Technologies Corporation (Beijing, China). .. Briefly, mRNA was isolated from total RNA using magnetic oligo (dT) beads (Invitrogen, Carlsbad, CA, USA) and was further fragmented into about 200 bp. .. The first and the second strands of cDNA were synthesized using theses fragmented mRNAs.

    Article Title: Transcriptomic signature of drought response in pearl millet (Pennisetum glaucum (L.) and development of web-genomic resources
    Article Snippet: Total RNA was isolated from these tissues under control and drought condition using the standard protocol of TRIZOL RNA isolation . .. It was further purified with Magnetic Oligo (dT) beads in accordance to the manufacturer’s instructions (Life Technologies, Grand Island, NY).

    Article Title: The evolutionary conserved FOXJ1 target gene Fam183b is essential for motile cilia in Xenopus but dispensable for ciliary function in mice
    Article Snippet: PCR was performed using the following primer pairs: Fam183b Ex1-F: ATCTTGCGGGAACTCTTTC Fam183b Ex4-B: AGAGTGATGTCGTGGTAGAC 308 bp product (4 exon transcript) 5′HPRT: CACAGGACTAGAACACCTGC 3′HPRT: GCTGGTGAAAAGGACCTCT 248 bp product .. Total RNA was isolated from testis using TriReagent (Zymo Research), polyA+ RNA was isolated from adult wild type and Fam183b Δex1/ Δex1 testis using magnetic Oligo dT beads (Dynal, Novagen). .. Northern blot hybridisation was carried out according to standard procedures.

    Article Title: The evolutionary conserved FOXJ1 target gene Fam183b is essential for motile cilia in Xenopus but dispensable for ciliary function in mice
    Article Snippet: PCR was performed using the following primer pairs: Fam183b Ex1-F: ATCTTGCGGGAACTCTTTC Fam183b Ex4-B: AGAGTGATGTCGTGGTAGAC 308 bp product (4 exon transcript) 5′HPRT: CACAGGACTAGAACACCTGC 3′HPRT: GCTGGTGAAAAGGACCTCT 248 bp product .. Total RNA was isolated from testis using TriReagent (Zymo Research), polyA+ RNA was isolated from adult wild type and Fam183b Δex1/ Δex1 testis using magnetic Oligo dT beads (Dynal, Novagen). .. Northern blot hybridisation was carried out according to standard procedures.

    Article Title: Transcriptional and Translational Relationship in Environmental Stress: RNAseq and ITRAQ Proteomic Analysis Between Sexually Reproducing and Parthenogenetic Females in Moina micrura
    Article Snippet: All samples displayed a 260/280 ratio greater than 2.0 and RNA integrity numbers (RIN) ≥7.5. .. Before the construction of library, ribosomal and viral RNA were removed and poly(A)+ mRNA was isolated with magnetic Oligo-dT beads (Invitrogen, United States), and then 10 μg of total RNA for each sample was used for the construction of libraries by using a TruSeqTM RNA sample preparation Kit from Illumina (San Diego, CA, United States), all performed according to the Illumina protocol. .. Thereafter, libraries were sequenced using Illumina HiSeqTM 2000 system at Majorbio Biotech Co., Ltd. (Shanghai, China).

    Article Title: Genetic dissection of blood lipid traits by integrating genome-wide association study and gene expression profiling in a porcine model
    Article Snippet: Digital gene expression (DGE) analyses of genome-wide transcripts were performed on 497 F2 liver samples as described previously [ ]. .. In brief, mRNA was isolated from total RNA with the magnetic oligo (dT) beads (invitrogen, USA). .. Using the mRNA attached to the bead as a template, double-stranded cDNA was synthesized with oligo-d (T) primers, and then digested with restriction enzymes Nla III and Mme I (New England Biolabs, UK).

    Purification:

    Article Title: Evaluating the Bioactivity of a Novel Broad-Spectrum Antimicrobial Peptide Brevinin-1GHa from the Frog Skin Secretion of Hylarana guentheri and Its Analogues
    Article Snippet: Then according to the manufacturer, the polyadenylated mRNA was isolated with magnetic oligo-dT beads (Dynal, Merseyside, UK). .. The PCR cycling program ran under the following condition: 90 s at 94 °C for initial denaturation; 35 cycles, 30 s at 94 °C for further denaturation; 30 s at 61 °C for primer annealing and 180 s at 72 °C for the extension.

    Article Title: Comparative transcriptome analyses on terpenoids metabolism in field- and mountain-cultivated ginseng roots
    Article Snippet: Briefly, poly (A)+ mRNA was isolated using magnetic Oligo-dT beads (Thermo Fisher Scientific Inc., Waltham, USA) and fragmented randomly into 200 bp in fragmentation buffer. .. The constructed DNA template was enriched by PCR amplification of 15 cycles.

    Article Title: Transcriptome analysis provides insights into the regulatory function of alternative splicing in antiviral immunity in grass carp (Ctenopharyngodon idella)
    Article Snippet: Before the construction of library, ribosomal and viral RNA were removed and poly(A)+ mRNA were isolated with magnetic Oligo-dT beads (Invitrogen, USA), and then cDNA libraries were constructed and sequenced by Majorbio Biotech Co., Ltd, Shanghai, China. .. The constructed DNA template was enriched by PCR amplification (15 cycles).

    Article Title: Transcriptomic signature of drought response in pearl millet (Pennisetum glaucum (L.) and development of web-genomic resources
    Article Snippet: Total RNA was isolated from these tissues under control and drought condition using the standard protocol of TRIZOL RNA isolation . .. It was further purified with Magnetic Oligo (dT) beads in accordance to the manufacturer’s instructions (Life Technologies, Grand Island, NY). .. The single-end Illumina reads were generated using root and leaf RNA of pearl millet genotype J-2454 having approximately 5678956 million and 6463411 million single-ends reads under normal and drought stress condition.

    Article Title: Whole Blood Transcriptome Sequencing Reveals Gene Expression Differences between Dapulian and Landrace Piglets
    Article Snippet: RNA integrity was assessed using a RNA Nano 6000 Assay Kit on an Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA). .. Poly(A) mRNAs were further purified from the extracted total RNA using magnetic oligo (dT) beads (Invitrogen, Carlsbad, CA, USA). .. Sequencing libraries were constructed using the NEBNext® Ultra RNA Library Prep Kit from Illumina (New England Biolabs, Ipswich, MA, USA) with multiplexing primers, following the manufacturer's instructions.

    Article Title: De novo assembly, characterization and annotation for the transcriptome of Sarcocheilichthys sinensis
    Article Snippet: The Magnetic Oligo (dT) Beads (Invitrogen, USA) was applied to isolate poly (A) mRNA from total RNA. .. The Magnetic Oligo (dT) Beads (Invitrogen, USA) was applied to isolate poly (A) mRNA from total RNA.

    Article Title: Genetic dissection of blood lipid traits by integrating genome-wide association study and gene expression profiling in a porcine model
    Article Snippet: In brief, mRNA was isolated from total RNA with the magnetic oligo (dT) beads (invitrogen, USA). .. In brief, mRNA was isolated from total RNA with the magnetic oligo (dT) beads (invitrogen, USA).

    Article Title: Accurate identification of polyadenylation sites from 3′ end deep sequencing using a naïve Bayes classifier
    Article Snippet: Paragraph title: 2.2 RNA purification ... Polyadenylated RNA was selected using magnetic oligo-dT beads (Invitrogen mRNA Direct Kit).

    Article Title: A Genome-Wide Investigation of Expression Characteristics of Natural Antisense Transcripts in Liver and Muscle Samples of Pigs
    Article Snippet: In brief, total RNA was used to isolate mRNA with the magnetic oligo (dT) beads (invitrogen). .. In brief, total RNA was used to isolate mRNA with the magnetic oligo (dT) beads (invitrogen).

    Article Title: Characterization of the human ESC transcriptome by hybrid sequencing
    Article Snippet: The integrity of the RNA was tested by a Bioanalyzer RNA Nano assay (Agilent). .. PolyA RNA was purified from the total RNA ( > 100 µg), using magnetic oligo-dT beads (Dynal) according to the manufacturer’s recommended protocol. .. Two different manufacturer’s kits and accompanying protocols for generating full-length cDNAs were used: Clontech SMARTer PCR and the Invitrogen SuperScript Full-Length cDNA kit.

    Article Title: Evolutionarily conserved human targets of adenosine to inosine RNA editing
    Article Snippet: For mouse and chicken sequences, poly-A RNA was isolated from brain and liver samples using Trifast (PeqLab, Germany) and poly-A selected using magnetic oligo dT beads (Dynal, Germany). .. For mouse and chicken sequences, poly-A RNA was isolated from brain and liver samples using Trifast (PeqLab, Germany) and poly-A selected using magnetic oligo dT beads (Dynal, Germany).

    Polymerase Chain Reaction:

    Article Title: Evaluating the Bioactivity of a Novel Broad-Spectrum Antimicrobial Peptide Brevinin-1GHa from the Frog Skin Secretion of Hylarana guentheri and Its Analogues
    Article Snippet: Then according to the manufacturer, the polyadenylated mRNA was isolated with magnetic oligo-dT beads (Dynal, Merseyside, UK). .. Then according to the manufacturer, the polyadenylated mRNA was isolated with magnetic oligo-dT beads (Dynal, Merseyside, UK).

    Article Title: Transcriptome analysis provides insights into the regulatory function of alternative splicing in antiviral immunity in grass carp (Ctenopharyngodon idella)
    Article Snippet: Before the construction of library, ribosomal and viral RNA were removed and poly(A)+ mRNA were isolated with magnetic Oligo-dT beads (Invitrogen, USA), and then cDNA libraries were constructed and sequenced by Majorbio Biotech Co., Ltd, Shanghai, China. .. Briefly, 8 μg of total RNA for each group was used for the construction of libraries by using TruseqTM RNA sample prep Kit (Illumina, USA) according to the manufacturer’s protocol.

    Article Title: PSN-PC: A Novel Antimicrobial and Anti-Biofilm Peptide from the Skin Secretion of Phyllomedusa-camba with Cytotoxicity on Human Lung Cancer Cell
    Article Snippet: Then the polyadenylated mRNA was isolated utilizing magnetic oligo-dT beads under the guidance of the manufacturer (Dynal, Merseyside, UK) and the isolated mRNA was subsequently subjected to 5’- and 3’-rapid amplification of cDNA end (RACE) procedures to acquire full-length prepropeptide nucleic acid sequence data by using a SMART-RACE kit (Clontech, Oxford, UK) essentially as outlined by the manufacturer. .. Briefly, the 3’-RACE reactions employed a nested universal (NUP) primer and degenerate sense primer (S1; 5’-ACTTTCYGAWTTRYAAGMCCAAABATG-3’ (Y = C/T, W = A/T, R = A/G, M = A/C, B = T/C/G) that were designed to highly-conserved segments of the signal peptides of cDNAs cloned previously from other Phyllomedusa frogs within our group [ ].

    Article Title: CpG Oligodeoxynucleotides Induce Differential Cytokine and Chemokine Gene Expression Profiles in Dapulian and Landrace Pigs
    Article Snippet: Briefly, mRNA was isolated from total RNA using magnetic oligo (dT) beads (Invitrogen, Carlsbad, CA, USA) and was further fragmented into about 200 bp. .. The first and the second strands of cDNA were synthesized using theses fragmented mRNAs.

    Article Title: De novo assembly, characterization and annotation for the transcriptome of Sarcocheilichthys sinensis
    Article Snippet: The Magnetic Oligo (dT) Beads (Invitrogen, USA) was applied to isolate poly (A) mRNA from total RNA. .. After end reparation and single nucleotide A (adenine) addition for the purified cDNA, adapters were connected.

    Article Title: Adaptive chromatin remodeling drives glioblastoma stem cell plasticity and drug tolerance
    Article Snippet: For qRT-PCR, total RNA was reverse-transcribed into cDNA (High Capacitiy cDNA Reverse Transcriptase Kit, Applied Biosystems) and qRT-PCR amplification was performed in triplicate using fast SYBR Green Master Mix (Life Technologies) with specific PCR primers for genes of interest and 18S as an endogenous control. qRT-PCR experiments were performed with two biological replicates. .. For RNA-seq library preparation, Poly(A)+ RNA was enriched using magnetic oligo(dT)-beads (Life Technologies) and then ligated to RNA adaptors for sequencing.

    Article Title: Genetic dissection of blood lipid traits by integrating genome-wide association study and gene expression profiling in a porcine model
    Article Snippet: In brief, mRNA was isolated from total RNA with the magnetic oligo (dT) beads (invitrogen, USA). .. In brief, mRNA was isolated from total RNA with the magnetic oligo (dT) beads (invitrogen, USA).

    Article Title: A Genome-Wide Investigation of Expression Characteristics of Natural Antisense Transcripts in Liver and Muscle Samples of Pigs
    Article Snippet: In brief, total RNA was used to isolate mRNA with the magnetic oligo (dT) beads (invitrogen). .. In brief, total RNA was used to isolate mRNA with the magnetic oligo (dT) beads (invitrogen).

    Article Title: Evolutionarily conserved human targets of adenosine to inosine RNA editing
    Article Snippet: For mouse and chicken sequences, poly-A RNA was isolated from brain and liver samples using Trifast (PeqLab, Germany) and poly-A selected using magnetic oligo dT beads (Dynal, Germany). .. For mouse and chicken sequences, poly-A RNA was isolated from brain and liver samples using Trifast (PeqLab, Germany) and poly-A selected using magnetic oligo dT beads (Dynal, Germany).

    Quantitative RT-PCR:

    Article Title: Adaptive chromatin remodeling drives glioblastoma stem cell plasticity and drug tolerance
    Article Snippet: Paragraph title: Real-Time Quantitative RT-PCR and RNA-seq Library Preparation ... For RNA-seq library preparation, Poly(A)+ RNA was enriched using magnetic oligo(dT)-beads (Life Technologies) and then ligated to RNA adaptors for sequencing.

    Article Title: Increased oxygen exposure alters collagen expression and tissue architecture during ligature-induced periodontitis
    Article Snippet: From the total RNA, poly (A) tailed RNA were selected using magnetic oligo (dT) beads and a magnetic particle concentrator (Dynal A.S., Oslo, Norway) in accordance to the manufacturer’s protocol. .. Primers and probes for real-time PCR were designed using Primer Express software (Applied Biosystems, Foster City, CA).

    cDNA Library Assay:

    Article Title: Evaluating the Bioactivity of a Novel Broad-Spectrum Antimicrobial Peptide Brevinin-1GHa from the Frog Skin Secretion of Hylarana guentheri and Its Analogues
    Article Snippet: Paragraph title: 4.2. Molecular Cloning of an H. guentheri Skin Secretion-Derived cDNA Library ... Then according to the manufacturer, the polyadenylated mRNA was isolated with magnetic oligo-dT beads (Dynal, Merseyside, UK).

    Article Title: The synergistic antimicrobial effects of novel bombinin and bombinin H peptides from the skin secretion of Bombinaorientalis
    Article Snippet: Procedures had been vetted by the IACUC of Queen’s University, Belfast, and approved on 1 March 2011. .. Molecular cloning of novel bombinin and bombinin H precursor encoding cDNA from the skin secretion derived cDNA library A 5-mg lyophilized secretion of B. orientalis was dissolved in 1 ml of mRNA protection buffer, the polyadenylated mRNA was obtained by using magnetic oligo-dT beads following the instructions of the manufacturer (Dynal Biotech, Wirral, U.K.), and subsequently reverse transcribed. .. The cDNA was subjected to 3′-RACE PCR procedure to obtain the full-length prepro-bombinin and prepro-bombinin H nucleotide sequence using a SMART-RACE kit (Clontech, Oxford, U.K.) as described by the manufacturer.

    Article Title: PSN-PC: A Novel Antimicrobial and Anti-Biofilm Peptide from the Skin Secretion of Phyllomedusa-camba with Cytotoxicity on Human Lung Cancer Cell
    Article Snippet: Paragraph title: 4.2. “Shotgun” Cloning of a Phyllomedusa camba Skin Secretion-Derived cDNA Library ... Then the polyadenylated mRNA was isolated utilizing magnetic oligo-dT beads under the guidance of the manufacturer (Dynal, Merseyside, UK) and the isolated mRNA was subsequently subjected to 5’- and 3’-rapid amplification of cDNA end (RACE) procedures to acquire full-length prepropeptide nucleic acid sequence data by using a SMART-RACE kit (Clontech, Oxford, UK) essentially as outlined by the manufacturer.

    Article Title: CpG Oligodeoxynucleotides Induce Differential Cytokine and Chemokine Gene Expression Profiles in Dapulian and Landrace Pigs
    Article Snippet: Paragraph title: cDNA library construction and RNA-seq ... Briefly, mRNA was isolated from total RNA using magnetic oligo (dT) beads (Invitrogen, Carlsbad, CA, USA) and was further fragmented into about 200 bp.

    Article Title: Whole Blood Transcriptome Sequencing Reveals Gene Expression Differences between Dapulian and Landrace Piglets
    Article Snippet: Paragraph title: 2.3. cDNA Library Construction and Next-Generation Sequencing (RNA-seq) ... Poly(A) mRNAs were further purified from the extracted total RNA using magnetic oligo (dT) beads (Invitrogen, Carlsbad, CA, USA).

    Article Title: Transcriptional and Translational Relationship in Environmental Stress: RNAseq and ITRAQ Proteomic Analysis Between Sexually Reproducing and Parthenogenetic Females in Moina micrura
    Article Snippet: Paragraph title: Total RNA Isolation and cDNA Library Construction ... Before the construction of library, ribosomal and viral RNA were removed and poly(A)+ mRNA was isolated with magnetic Oligo-dT beads (Invitrogen, United States), and then 10 μg of total RNA for each sample was used for the construction of libraries by using a TruSeqTM RNA sample preparation Kit from Illumina (San Diego, CA, United States), all performed according to the Illumina protocol.

    Article Title: Genetic dissection of blood lipid traits by integrating genome-wide association study and gene expression profiling in a porcine model
    Article Snippet: In brief, mRNA was isolated from total RNA with the magnetic oligo (dT) beads (invitrogen, USA). .. In brief, mRNA was isolated from total RNA with the magnetic oligo (dT) beads (invitrogen, USA).

    Article Title: A Genome-Wide Investigation of Expression Characteristics of Natural Antisense Transcripts in Liver and Muscle Samples of Pigs
    Article Snippet: In brief, total RNA was used to isolate mRNA with the magnetic oligo (dT) beads (invitrogen). .. In brief, total RNA was used to isolate mRNA with the magnetic oligo (dT) beads (invitrogen).

    Sample Prep:

    Article Title: Comparative transcriptome analyses on terpenoids metabolism in field- and mountain-cultivated ginseng roots
    Article Snippet: Five μg of total RNA for each of the two ginseng root samples was used for construction of libraries using the TruSeq RNA sample preparation Kit. .. Briefly, poly (A)+ mRNA was isolated using magnetic Oligo-dT beads (Thermo Fisher Scientific Inc., Waltham, USA) and fragmented randomly into 200 bp in fragmentation buffer.

    Article Title: Transcriptome analysis provides insights into the regulatory function of alternative splicing in antiviral immunity in grass carp (Ctenopharyngodon idella)
    Article Snippet: According to the recommendation of TruSeq™ RNA sample preparation Guide, all samples displayed a 260/280 ratio greater than 2.0 and RNA integrity numbers (RIN) ≥8.0. .. Before the construction of library, ribosomal and viral RNA were removed and poly(A)+ mRNA were isolated with magnetic Oligo-dT beads (Invitrogen, USA), and then cDNA libraries were constructed and sequenced by Majorbio Biotech Co., Ltd, Shanghai, China.

    Article Title: Transcriptional and Translational Relationship in Environmental Stress: RNAseq and ITRAQ Proteomic Analysis Between Sexually Reproducing and Parthenogenetic Females in Moina micrura
    Article Snippet: All samples displayed a 260/280 ratio greater than 2.0 and RNA integrity numbers (RIN) ≥7.5. .. Before the construction of library, ribosomal and viral RNA were removed and poly(A)+ mRNA was isolated with magnetic Oligo-dT beads (Invitrogen, United States), and then 10 μg of total RNA for each sample was used for the construction of libraries by using a TruSeqTM RNA sample preparation Kit from Illumina (San Diego, CA, United States), all performed according to the Illumina protocol. .. Thereafter, libraries were sequenced using Illumina HiSeqTM 2000 system at Majorbio Biotech Co., Ltd. (Shanghai, China).

    Plasmid Preparation:

    Article Title: Evaluating the Bioactivity of a Novel Broad-Spectrum Antimicrobial Peptide Brevinin-1GHa from the Frog Skin Secretion of Hylarana guentheri and Its Analogues
    Article Snippet: Then according to the manufacturer, the polyadenylated mRNA was isolated with magnetic oligo-dT beads (Dynal, Merseyside, UK). .. The PCR cycling program ran under the following condition: 90 s at 94 °C for initial denaturation; 35 cycles, 30 s at 94 °C for further denaturation; 30 s at 61 °C for primer annealing and 180 s at 72 °C for the extension.

    Article Title: PSN-PC: A Novel Antimicrobial and Anti-Biofilm Peptide from the Skin Secretion of Phyllomedusa-camba with Cytotoxicity on Human Lung Cancer Cell
    Article Snippet: Then the polyadenylated mRNA was isolated utilizing magnetic oligo-dT beads under the guidance of the manufacturer (Dynal, Merseyside, UK) and the isolated mRNA was subsequently subjected to 5’- and 3’-rapid amplification of cDNA end (RACE) procedures to acquire full-length prepropeptide nucleic acid sequence data by using a SMART-RACE kit (Clontech, Oxford, UK) essentially as outlined by the manufacturer. .. The PCR cycling procedure included an initial denaturation at 94 °C for 90 s and 35 cycles for further denaturation at 94 °C lasting for 30 s, after which followed primer annealing for 30 s at 58 °C and extension for 180 s at 72 °C.

    Software:

    Article Title: Increased oxygen exposure alters collagen expression and tissue architecture during ligature-induced periodontitis
    Article Snippet: From the total RNA, poly (A) tailed RNA were selected using magnetic oligo (dT) beads and a magnetic particle concentrator (Dynal A.S., Oslo, Norway) in accordance to the manufacturer’s protocol. .. From the total RNA, poly (A) tailed RNA were selected using magnetic oligo (dT) beads and a magnetic particle concentrator (Dynal A.S., Oslo, Norway) in accordance to the manufacturer’s protocol.

    Real-time Polymerase Chain Reaction:

    Article Title: Increased oxygen exposure alters collagen expression and tissue architecture during ligature-induced periodontitis
    Article Snippet: Paragraph title: Real-Time PCR ... From the total RNA, poly (A) tailed RNA were selected using magnetic oligo (dT) beads and a magnetic particle concentrator (Dynal A.S., Oslo, Norway) in accordance to the manufacturer’s protocol.

    RNA Extraction:

    Article Title: Transcriptomic signature of drought response in pearl millet (Pennisetum glaucum (L.) and development of web-genomic resources
    Article Snippet: Paragraph title: Plant tissue collection and RNA extraction ... It was further purified with Magnetic Oligo (dT) beads in accordance to the manufacturer’s instructions (Life Technologies, Grand Island, NY).

    Agarose Gel Electrophoresis:

    Article Title: Transcriptome analysis provides insights into the regulatory function of alternative splicing in antiviral immunity in grass carp (Ctenopharyngodon idella)
    Article Snippet: Total RNA content of each sample was measured by using NanoDrop 2000c UV-Vis Spectrophotometer (Thermo Fisher Scientific Inc.), and the quality of RNA samples was assessed by agarose gel electrophoresis and Agilent 2100 Bioanalyzer (Agilent technologies). .. Before the construction of library, ribosomal and viral RNA were removed and poly(A)+ mRNA were isolated with magnetic Oligo-dT beads (Invitrogen, USA), and then cDNA libraries were constructed and sequenced by Majorbio Biotech Co., Ltd, Shanghai, China.

    ALP Assay:

    Article Title: Increased oxygen exposure alters collagen expression and tissue architecture during ligature-induced periodontitis
    Article Snippet: For analyses of gene expression, periodontal tissues were harvested and flash-frozen in 1 ml of TRIzol (Life Technologies, Rockville, MA) and stored at −80°C. mRNA levels were determined for COL1A1, TGF-β1, ALP, IL-1α, IL-1β, IL-6, and IL-10. .. From the total RNA, poly (A) tailed RNA were selected using magnetic oligo (dT) beads and a magnetic particle concentrator (Dynal A.S., Oslo, Norway) in accordance to the manufacturer’s protocol.

    Next-Generation Sequencing:

    Article Title: Whole Blood Transcriptome Sequencing Reveals Gene Expression Differences between Dapulian and Landrace Piglets
    Article Snippet: Paragraph title: 2.3. cDNA Library Construction and Next-Generation Sequencing (RNA-seq) ... Poly(A) mRNAs were further purified from the extracted total RNA using magnetic oligo (dT) beads (Invitrogen, Carlsbad, CA, USA).

    Spectrophotometry:

    Article Title: Comparative transcriptome analyses on terpenoids metabolism in field- and mountain-cultivated ginseng roots
    Article Snippet: To avoid interference by proteins and polysaccharides, RNA concentration and quality were evaluated using a ND-2000 spectrophotometer (Thermo Fisher Scientific Inc., Waltham, USA) and a 2100 Bioanalyzer (Agilent Technologies Inc., Santa Clara, USA), respectively. .. Briefly, poly (A)+ mRNA was isolated using magnetic Oligo-dT beads (Thermo Fisher Scientific Inc., Waltham, USA) and fragmented randomly into 200 bp in fragmentation buffer.

    Article Title: Transcriptome analysis provides insights into the regulatory function of alternative splicing in antiviral immunity in grass carp (Ctenopharyngodon idella)
    Article Snippet: Total RNA content of each sample was measured by using NanoDrop 2000c UV-Vis Spectrophotometer (Thermo Fisher Scientific Inc.), and the quality of RNA samples was assessed by agarose gel electrophoresis and Agilent 2100 Bioanalyzer (Agilent technologies). .. Before the construction of library, ribosomal and viral RNA were removed and poly(A)+ mRNA were isolated with magnetic Oligo-dT beads (Invitrogen, USA), and then cDNA libraries were constructed and sequenced by Majorbio Biotech Co., Ltd, Shanghai, China.

    Article Title: CpG Oligodeoxynucleotides Induce Differential Cytokine and Chemokine Gene Expression Profiles in Dapulian and Landrace Pigs
    Article Snippet: RNA concentration and purity were assessed using a NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA). .. Briefly, mRNA was isolated from total RNA using magnetic oligo (dT) beads (Invitrogen, Carlsbad, CA, USA) and was further fragmented into about 200 bp.

    Article Title: Transcriptional and Translational Relationship in Environmental Stress: RNAseq and ITRAQ Proteomic Analysis Between Sexually Reproducing and Parthenogenetic Females in Moina micrura
    Article Snippet: The Nanodrop 2000 spectrophotometer was used to assess sample purity and RNA concentration, and the quality of RNA was analyzed on an Agilent 2100 Bioanalyzer using the RNA 6000 Nano kit (Agilent Technologies, Santa Clara, CA, United States). .. Before the construction of library, ribosomal and viral RNA were removed and poly(A)+ mRNA was isolated with magnetic Oligo-dT beads (Invitrogen, United States), and then 10 μg of total RNA for each sample was used for the construction of libraries by using a TruSeqTM RNA sample preparation Kit from Illumina (San Diego, CA, United States), all performed according to the Illumina protocol.

    Concentration Assay:

    Article Title: Comparative transcriptome analyses on terpenoids metabolism in field- and mountain-cultivated ginseng roots
    Article Snippet: To avoid interference by proteins and polysaccharides, RNA concentration and quality were evaluated using a ND-2000 spectrophotometer (Thermo Fisher Scientific Inc., Waltham, USA) and a 2100 Bioanalyzer (Agilent Technologies Inc., Santa Clara, USA), respectively. .. Briefly, poly (A)+ mRNA was isolated using magnetic Oligo-dT beads (Thermo Fisher Scientific Inc., Waltham, USA) and fragmented randomly into 200 bp in fragmentation buffer.

    Article Title: CpG Oligodeoxynucleotides Induce Differential Cytokine and Chemokine Gene Expression Profiles in Dapulian and Landrace Pigs
    Article Snippet: RNA concentration and purity were assessed using a NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA). .. Briefly, mRNA was isolated from total RNA using magnetic oligo (dT) beads (Invitrogen, Carlsbad, CA, USA) and was further fragmented into about 200 bp.

    Article Title: Transcriptional and Translational Relationship in Environmental Stress: RNAseq and ITRAQ Proteomic Analysis Between Sexually Reproducing and Parthenogenetic Females in Moina micrura
    Article Snippet: The Nanodrop 2000 spectrophotometer was used to assess sample purity and RNA concentration, and the quality of RNA was analyzed on an Agilent 2100 Bioanalyzer using the RNA 6000 Nano kit (Agilent Technologies, Santa Clara, CA, United States). .. Before the construction of library, ribosomal and viral RNA were removed and poly(A)+ mRNA was isolated with magnetic Oligo-dT beads (Invitrogen, United States), and then 10 μg of total RNA for each sample was used for the construction of libraries by using a TruSeqTM RNA sample preparation Kit from Illumina (San Diego, CA, United States), all performed according to the Illumina protocol.

    High Throughput Screening Assay:

    Article Title: Comparative transcriptome analyses on terpenoids metabolism in field- and mountain-cultivated ginseng roots
    Article Snippet: Briefly, poly (A)+ mRNA was isolated using magnetic Oligo-dT beads (Thermo Fisher Scientific Inc., Waltham, USA) and fragmented randomly into 200 bp in fragmentation buffer. .. Amplicons were collected and purified by the Certified Low Range Ultra Agarose (Bio-Rad Inc., Hercules, USA) gel electrophoresis.

    Lysis:

    Article Title: Evaluating the Bioactivity of a Novel Broad-Spectrum Antimicrobial Peptide Brevinin-1GHa from the Frog Skin Secretion of Hylarana guentheri and Its Analogues
    Article Snippet: Six milligrams of lyophilized skin secretion were dissolved in 1 mL of cell lysis/binding buffer (Life technologies, Oslo, Norway). .. Then according to the manufacturer, the polyadenylated mRNA was isolated with magnetic oligo-dT beads (Dynal, Merseyside, UK).

    Article Title: PSN-PC: A Novel Antimicrobial and Anti-Biofilm Peptide from the Skin Secretion of Phyllomedusa-camba with Cytotoxicity on Human Lung Cancer Cell
    Article Snippet: Five milligrams sample of lyophilised Phyllomedusa camba skin secretion were dissolved in 1 mL of cell lysis/mRNA stabilisation buffer (Dynal, Merseyside, UK). .. Then the polyadenylated mRNA was isolated utilizing magnetic oligo-dT beads under the guidance of the manufacturer (Dynal, Merseyside, UK) and the isolated mRNA was subsequently subjected to 5’- and 3’-rapid amplification of cDNA end (RACE) procedures to acquire full-length prepropeptide nucleic acid sequence data by using a SMART-RACE kit (Clontech, Oxford, UK) essentially as outlined by the manufacturer.

    Fluorescence In Situ Hybridization:

    Article Title: Transcriptome analysis provides insights into the regulatory function of alternative splicing in antiviral immunity in grass carp (Ctenopharyngodon idella)
    Article Snippet: According to this allocation, the high-quality RNA samples from each head-kidney and spleen were divided into 4 groups: SS1 (spleen sample of susceptible fish), SR2 (spleen sample of resistant fish), KS3 (head-kidney sample of susceptible fish), KR4 (head-kidney sample of resistant fish). .. Before the construction of library, ribosomal and viral RNA were removed and poly(A)+ mRNA were isolated with magnetic Oligo-dT beads (Invitrogen, USA), and then cDNA libraries were constructed and sequenced by Majorbio Biotech Co., Ltd, Shanghai, China.

    Genomic Sequencing:

    Article Title: Evolutionarily conserved human targets of adenosine to inosine RNA editing
    Article Snippet: For mouse and chicken sequences, poly-A RNA was isolated from brain and liver samples using Trifast (PeqLab, Germany) and poly-A selected using magnetic oligo dT beads (Dynal, Germany). .. For mouse and chicken sequences, poly-A RNA was isolated from brain and liver samples using Trifast (PeqLab, Germany) and poly-A selected using magnetic oligo dT beads (Dynal, Germany).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher sera mag oligo dt magnetic beads
    Outline of the high-throughput RNA-seq (HTR) library preparation . In short, frozen tissue samples are ground in the lysis buffer and <t>mRNA</t> is isolated from this using <t>oligo</t> dT beads (1). The mRNA is used to make first and second strands of cDNA (2) and this double stranded cDNA molecules are subsequently enzymatically fragmented (3). The ends of these molecules are repaired and an A nucleotide is added (4) to facilitate TA ligation of the barcoded adapters (5). The ligated samples are then enriched by amplification using adapter specific primers (6) and purified for sequencing.
    Sera Mag Oligo Dt Magnetic Beads, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 22 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sera mag oligo dt magnetic beads/product/Thermo Fisher
    Average 90 stars, based on 22 article reviews
    Price from $9.99 to $1999.99
    sera mag oligo dt magnetic beads - by Bioz Stars, 2019-10
    90/100 stars
      Buy from Supplier

    Image Search Results


    Outline of the high-throughput RNA-seq (HTR) library preparation . In short, frozen tissue samples are ground in the lysis buffer and mRNA is isolated from this using oligo dT beads (1). The mRNA is used to make first and second strands of cDNA (2) and this double stranded cDNA molecules are subsequently enzymatically fragmented (3). The ends of these molecules are repaired and an A nucleotide is added (4) to facilitate TA ligation of the barcoded adapters (5). The ligated samples are then enriched by amplification using adapter specific primers (6) and purified for sequencing.

    Journal: Frontiers in Plant Science

    Article Title: A High-Throughput Method for Illumina RNA-Seq Library Preparation

    doi: 10.3389/fpls.2012.00202

    Figure Lengend Snippet: Outline of the high-throughput RNA-seq (HTR) library preparation . In short, frozen tissue samples are ground in the lysis buffer and mRNA is isolated from this using oligo dT beads (1). The mRNA is used to make first and second strands of cDNA (2) and this double stranded cDNA molecules are subsequently enzymatically fragmented (3). The ends of these molecules are repaired and an A nucleotide is added (4) to facilitate TA ligation of the barcoded adapters (5). The ligated samples are then enriched by amplification using adapter specific primers (6) and purified for sequencing.

    Article Snippet: For HTR library preparations, mRNA isolation with both Dynabeads (Invitrogen) and Sera-Mag oligo dT magnetic beads (Thermo Scientific, Cat. # 3815-2103-010150) were performed based on the Dynabeads mRNA direct kit (Invitrogen) protocol with minor adjustments (see Methods in Supplementary Material).

    Techniques: High Throughput Screening Assay, RNA Sequencing Assay, Lysis, Isolation, Ligation, Amplification, Purification, Sequencing