magnesium sulfate heptahydrate  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    Magnesium sulfate heptahydrate
    Description:
    Magnesium sulfate heptahydrate is hydroscopic and is vulnerable to warm temperatures
    Catalog Number:
    m5921
    Price:
    None
    Applications:
    Magnesium sulfate heptahydrate has been used:. as a component in Kreb′s Ringer buffer. as a component in minimal medium to culture Ralstonia solanacearum. in the preparation of maceration solution for Lamb′s lettuce cell isolation and isotonic glucose buffer
    Buy from Supplier


    Structured Review

    Millipore magnesium sulfate heptahydrate
    Magnesium sulfate heptahydrate
    Magnesium sulfate heptahydrate is hydroscopic and is vulnerable to warm temperatures
    https://www.bioz.com/result/magnesium sulfate heptahydrate/product/Millipore
    Average 95 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    magnesium sulfate heptahydrate - by Bioz Stars, 2020-02
    95/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Characterization of a Factor H Mutation That Perturbs the Alternative Pathway of Complement in a Family with Membranoproliferative GN
    Article Snippet: Clones of Pichia pastoris strain KM71H producing WT (fH1–4WT ) and mutant (fH1–4R83S ) fH in the setting of CCPs 1–4 were generated as described previously. .. A starter culture was transferred into 1 L basal fermentor salts (0.095% [wt/vol] calcium sulfate, 1.82% [wt/vol] potassium sulfate, 1.5% [wt/vol] magnesium sulfate heptahydrate, 0.42% [wt/vol] potassium hydroxide, 2.7% [vol/vol] phosphoric acid, and 2.5% [vol/vol] glycerol) enriched with 1% (wt/vol) casein aa, 0.5% (wt/vol) PTM1 salts, and 0.5% (vol/vol) antifoam A (Sigma-Aldrich).

    Positive Control:

    Article Title: Ecotoxicological Assessment of Thermally- and Hydrogen-Reduced Graphene Oxide/TiO2 Photocatalytic Nanocomposites Using the Zebrafish Embryo Model
    Article Snippet: This nanoparticle was used as positive control (PC) in our acutoxicity assays because it is known to cause mortality and teratogenic effects in zebrafish embryos [ , , ]. .. E3 media (used to cultivate zebrafish embryos) constituents including 5.0 mM sodium chloride (NaCl), 0.17 mM potassium chloride (KCl), 0.33 mM magnesium sulfate heptahydrate (MgSO4 ·7H2 O) and 0.33 mM calcium chloride dihydrate (CaCl2 ·2H2 O), all purchased from Sigma.

    Enzyme-linked Immunosorbent Assay:

    Article Title: Synergy Between Gαz Deficiency and GLP-1 Analog Treatment in Preserving Functional β-Cell Mass in Experimental Diabetes
    Article Snippet: Sodium chloride (S9888), potassium chloride (P3911), magnesium sulfate heptahydrate (M9397), potassium phosphate monobasic (P0662), sodium bicarbonate (S6014), HEPES (H3375), calcium chloride dehydrate (C3881), and RIA-grade bovine serum albumin (A7888), STZ (S0130), and Ex4 (E7144) were purchased from Sigma-Aldrich. .. Antiinsulin ELISA antibodies (insulin + proinsulin antibody, 10R-I136a; insulin + proinsulin antibody, biotinylated, 61E-I136bBT) were from Fitzgerald Industries.

    Incubation:

    Article Title: Autophagy mediates phosphatidylserine exposure and phagosome degradation during apoptosis through specific functions of GABARAP/LGG-1 and LC3/LGG-2
    Article Snippet: Nematode strains were grown on nematode growth media (NGM) plates (50 mM NaCl [Sigma-Aldrich, 60,142], 0.25% bactopeptone [Becton-Dickinson, 211677], 5 µg/ml cholesterol [Sigma-Aldrich, C8667], 2% bacto agar [Becton-Dickinson, 214010] autoclaved and supplemented with 1 mM CaCl2 [Sigma-Aldrich, C3306], 1 mM MgSO4 [Sigma-Aldrich, M5921], 20 mM KH2 PO4 [Sigma-Aldrich, P5655] 1 M, 3.3 mM K2 HPO4 [Sigma-Aldrich, 60356]) and fed with Escherichia coli strain OP50 (Caenorhabditis Genetic Center) [ ]. .. To score ACs labelled with ANXV::GFP or GFP::LACTC1C2, embryos were grown at 20°C and then incubated at 33°C for 45 min followed by a recovery at 20°C for 2 h. The quantification is the ratio between the number of DIC corpses and the fluorescent rings regardless of cell morphology.

    Article Title: Effects of Ionic Strength on Bacteriophage MS2 Behavior and Their Implications for the Assessment of Virus Retention by Ultrafiltration Membranes ▿
    Article Snippet: Briefly, 1 ml of MS2 stock was mixed with 1 ml of E. coli suspension in 10 ml tryptone-yeast extract medium containing 14 g/liter tryptone (Oxoid, Ltd., Basingstoke, Hampshire, United Kingdom), 7 g/liter yeast extract (AES Chemunex, Bruz, France), 7 g/liter NaCl (Sigma-Aldrich Co., St. Louis, MO) and 2.5 g/liter magnesium sulfate heptahydrate (Sigma-Aldrich Co., St. Louis, MO). .. Then, 0.8 ml of this preparation was distributed into inclined tubes containing tryptic soy agar (bioMérieux, Craponne, France) and incubated for 22 h at 37°C.

    Expressing:

    Article Title: Characterization of a Factor H Mutation That Perturbs the Alternative Pathway of Complement in a Family with Membranoproliferative GN
    Article Snippet: Protein expression was carried out in a 3-L BioFlo 115 Biofermenter (New Brunswick). .. A starter culture was transferred into 1 L basal fermentor salts (0.095% [wt/vol] calcium sulfate, 1.82% [wt/vol] potassium sulfate, 1.5% [wt/vol] magnesium sulfate heptahydrate, 0.42% [wt/vol] potassium hydroxide, 2.7% [vol/vol] phosphoric acid, and 2.5% [vol/vol] glycerol) enriched with 1% (wt/vol) casein aa, 0.5% (wt/vol) PTM1 salts, and 0.5% (vol/vol) antifoam A (Sigma-Aldrich).

    Modification:

    Article Title: Increased Levels of Modified Advanced Oxidation Protein Products Are Associated with Central and Peripheral Blood Pressure in Peritoneal Dialysis Patients
    Article Snippet: .. As the HDL-cholesterol precipitating reagent (Thermo Electron Corporation, Vantaa, Finland) is no longer available, we modified the procedure and instead used, as precipitating reagent, 10 mg of dextran sulphate (molecular weight 500 KDa, Sigma-Aldrich, St Louis, MO, USA, product number D6001) and 246 mg magnesium sulphate X7H2 0 (molecular weight 246 KDa, Sigma-Aldrich, M5921) prepared in 1 mL distilled water. .. One part (20 uL) of this reagent was mixed with 10 parts (200 uL) of ethylenediaminetetraacetic acid (EDTA) plasma in an Eppendorf (Sarstedt, Nümbrecht, Germany) tube, vortexed, allowed to stand for 10 minutes, centrifuged at 1,500 × g for 30 minutes in a cold centrifuge (+4 °C), upon which the supernatant was carefully pipetted for further analysis.

    Transformation Assay:

    Article Title: Characterization of a Factor H Mutation That Perturbs the Alternative Pathway of Complement in a Family with Membranoproliferative GN
    Article Snippet: KM71H cells were transformed using electroporation, selected by zeocin, and screened for protein expression. .. A starter culture was transferred into 1 L basal fermentor salts (0.095% [wt/vol] calcium sulfate, 1.82% [wt/vol] potassium sulfate, 1.5% [wt/vol] magnesium sulfate heptahydrate, 0.42% [wt/vol] potassium hydroxide, 2.7% [vol/vol] phosphoric acid, and 2.5% [vol/vol] glycerol) enriched with 1% (wt/vol) casein aa, 0.5% (wt/vol) PTM1 salts, and 0.5% (vol/vol) antifoam A (Sigma-Aldrich).

    High Performance Liquid Chromatography:

    Article Title: Analytical assessment of the intense heat load of whipping cream, coffee cream, and condensed milk at retail in Austria and Germany
    Article Snippet: Chemical references All solvents used for chromatographic analysis were of HPLC grade, and all chemicals used for sample preparation were of analytical grade. .. Acetonitrile (ACN, 100%), disodium hydrogen phosphate (99%), heptanesulfonic acid ( > 98%), hydrogen peroxide (30%), magnesium sulfate heptahydrate (98%), sodium acetate trihydrate (99.5%), sodium dihydrogen phosphate, octanol (98%), and trifluoroacetic acid (TFA, 99%) were purchased from Sigma-Aldrich (St. Louis, MO, USA).

    Electroporation:

    Article Title: Characterization of a Factor H Mutation That Perturbs the Alternative Pathway of Complement in a Family with Membranoproliferative GN
    Article Snippet: KM71H cells were transformed using electroporation, selected by zeocin, and screened for protein expression. .. A starter culture was transferred into 1 L basal fermentor salts (0.095% [wt/vol] calcium sulfate, 1.82% [wt/vol] potassium sulfate, 1.5% [wt/vol] magnesium sulfate heptahydrate, 0.42% [wt/vol] potassium hydroxide, 2.7% [vol/vol] phosphoric acid, and 2.5% [vol/vol] glycerol) enriched with 1% (wt/vol) casein aa, 0.5% (wt/vol) PTM1 salts, and 0.5% (vol/vol) antifoam A (Sigma-Aldrich).

    Introduce:

    Article Title: Surface thiolation of silicon for antifouling application
    Article Snippet: Calcium chloride dihydrate (≥ 99.0%), magnesium sulfate heptahydrate (≥ 98%), potassium phosphate dibasic (≥ 98%), potassium phosphate monobasic (≥ 99.0%), and Luria–Bertani (LB) broth were purchased from Sigma-Aldrich (United States). .. The system used for cultivating B. braunii is equipped with a Tetra Whisper aquarium air pump (United States) to introduce air bubbles.

    Generated:

    Article Title: Characterization of a Factor H Mutation That Perturbs the Alternative Pathway of Complement in a Family with Membranoproliferative GN
    Article Snippet: In brief, the R83S point mutation was generated in a pPICZαB (Invitrogen) vector containing residues 19–263 of fH, with a C-terminal 6× His tag and an N-terminal myc tag (EQKLISEEDL), using the QuikChange site-directed mutagenesis kit (Stratagene) with the following primers: (f) gggttgctcttaatccattaaggaaatgtcagaaaag T ccctgtggacatcctggagatactcc; (r)ggagtatctccaggatgtccacaggg A cttttctgacatttccttaatggattaagagcaaccc. .. A starter culture was transferred into 1 L basal fermentor salts (0.095% [wt/vol] calcium sulfate, 1.82% [wt/vol] potassium sulfate, 1.5% [wt/vol] magnesium sulfate heptahydrate, 0.42% [wt/vol] potassium hydroxide, 2.7% [vol/vol] phosphoric acid, and 2.5% [vol/vol] glycerol) enriched with 1% (wt/vol) casein aa, 0.5% (wt/vol) PTM1 salts, and 0.5% (vol/vol) antifoam A (Sigma-Aldrich).

    other:

    Article Title: Endothelium-dependent vasodilation effects of Panax notoginseng and its main components are mediated by nitric oxide and cyclooxygenase pathways
    Article Snippet: Norepinephrine (NE), acetylcholine chloride (ACh), dimethyl sulfoxide (DMSO), L-NAME, INDO, sodium chloride (NaCl), ODQ, potassium chloride (KCl), potassium dihydrogen phosphate (KH2 PO4 ), magnesium sulfate heptahydrate (MgSO4 .7H2 O), sodium bicarbonate (NaHCO3 ), glucose and calcium chloride (CaCl2 ) were purchased from Sigma-Aldrich (Merck Millipore, Darmstadt, Germany).

    Article Title: Artificial Fusion of mCherry Enhances Trehalose Transferase Solubility and Stability
    Article Snippet: The following chemicals were used: uridine 5′-diphosphate disodium salt (98%; Carbosynth), d -glucose (99.5%; Sigma-Aldrich), HEPES ( > 99.5%; Sigma-Aldrich), MgCl2 hexahydrate ( > 99.5%; VWR), CaCl2 dihydrate ( > 99.0%; Sigma-Aldrich), NiCl2 hexahydrate (99.9%), guanidine hydrochloride ( > 99.5%; Sigma-Aldrich), sodium deoxycholate ( > 98%; Sigma-Aldrich), sodium sulfate ( > 99.0%; Sigma-Aldrich), zinc chloride ( > 98%; Sigma-Aldrich), magnesium sulfate heptahydrate (99%; Sigma-Aldrich), cobalt chloride hexahydrate ( > 98%; Sigma-Aldrich), glycerol (99.5%; Sigma-Aldrich), rubidium chloride ( > 99%; Sigma-Aldrich), potassium acetate ( > 99%; Acros), sulfuric acid (98%; Acros), agarose ( > 99%; Sigma-Aldrich), ampicillin (Sigma-Aldrich), Tris(hydroxymethyl)aminomethane (Tris, 99%; Sigma-Aldrich), glycine ( > 99%; Sigma-Aldrich), pyridine ( > 99%; Sigma-Aldrich), sodium chloride ( > 99.5%; J.T.

    Article Title: Botryococcus braunii as a bioreactor for the production of nanoparticles with antimicrobial potentialities
    Article Snippet: Silver nitrate, ampicillin, Luria–Bertani (LB) broth, yeast extract–peptone–dextrose (YPD), LB broth agar, sodium nitrate, calcium nitrate, magnesium sulfate heptahydrate, potassium sulfate, and a 20 nm AgNP solution were all purchased from Sigma-Aldrich (Toluca, Mexico).

    Article Title: Recovery of Hydrogen Peroxide-Sensitive Culturable Cells of Vibrio vulnificus Gives the Appearance of Resuscitation from a Viable but Nonculturable State
    Article Snippet: Acridine orange, neutral red, sodium pyruvate, 3% hydrogen peroxide, sodium chloride, potassium chloride, calcium chloride dihydrate, magnesium chloride hexahydrate, magnesium sulfate heptahydrate, and sodium bicarbonate were obtained from Sigma Chemical Co. (St. Louis, Mo.).

    Polymerase Chain Reaction:

    Article Title: An Intracellular Iron Chelator Pleiotropically Suppresses Enzymatic and Growth Defects of Superoxide Dismutase-DeficientEscherichia coli
    Article Snippet: Magnesium sulfate heptahydrate, ferrous sulfate heptahydrate, sodium nitrite, and manganese chloride were obtained from Aldrich. β-Mercaptoethanol and sodium citrate dihydrate were obtained from Fisher Scientific. .. Ready-to-go PCR beads were obtained from Pharmacia Biotech.

    Recombinant:

    Article Title: Characterization of a Factor H Mutation That Perturbs the Alternative Pathway of Complement in a Family with Membranoproliferative GN
    Article Snippet: A starter culture was transferred into 1 L basal fermentor salts (0.095% [wt/vol] calcium sulfate, 1.82% [wt/vol] potassium sulfate, 1.5% [wt/vol] magnesium sulfate heptahydrate, 0.42% [wt/vol] potassium hydroxide, 2.7% [vol/vol] phosphoric acid, and 2.5% [vol/vol] glycerol) enriched with 1% (wt/vol) casein aa, 0.5% (wt/vol) PTM1 salts, and 0.5% (vol/vol) antifoam A (Sigma-Aldrich). .. The cells were allowed to starve for 4 hours before recombinant expression was induced with 0.75% methanol containing 0.5% (wt/vol) PTM1 salts.

    Molecular Weight:

    Article Title: Increased Levels of Modified Advanced Oxidation Protein Products Are Associated with Central and Peripheral Blood Pressure in Peritoneal Dialysis Patients
    Article Snippet: .. As the HDL-cholesterol precipitating reagent (Thermo Electron Corporation, Vantaa, Finland) is no longer available, we modified the procedure and instead used, as precipitating reagent, 10 mg of dextran sulphate (molecular weight 500 KDa, Sigma-Aldrich, St Louis, MO, USA, product number D6001) and 246 mg magnesium sulphate X7H2 0 (molecular weight 246 KDa, Sigma-Aldrich, M5921) prepared in 1 mL distilled water. .. One part (20 uL) of this reagent was mixed with 10 parts (200 uL) of ethylenediaminetetraacetic acid (EDTA) plasma in an Eppendorf (Sarstedt, Nümbrecht, Germany) tube, vortexed, allowed to stand for 10 minutes, centrifuged at 1,500 × g for 30 minutes in a cold centrifuge (+4 °C), upon which the supernatant was carefully pipetted for further analysis.

    Mutagenesis:

    Article Title: Characterization of a Factor H Mutation That Perturbs the Alternative Pathway of Complement in a Family with Membranoproliferative GN
    Article Snippet: In brief, the R83S point mutation was generated in a pPICZαB (Invitrogen) vector containing residues 19–263 of fH, with a C-terminal 6× His tag and an N-terminal myc tag (EQKLISEEDL), using the QuikChange site-directed mutagenesis kit (Stratagene) with the following primers: (f) gggttgctcttaatccattaaggaaatgtcagaaaag T ccctgtggacatcctggagatactcc; (r)ggagtatctccaggatgtccacaggg A cttttctgacatttccttaatggattaagagcaaccc. .. A starter culture was transferred into 1 L basal fermentor salts (0.095% [wt/vol] calcium sulfate, 1.82% [wt/vol] potassium sulfate, 1.5% [wt/vol] magnesium sulfate heptahydrate, 0.42% [wt/vol] potassium hydroxide, 2.7% [vol/vol] phosphoric acid, and 2.5% [vol/vol] glycerol) enriched with 1% (wt/vol) casein aa, 0.5% (wt/vol) PTM1 salts, and 0.5% (vol/vol) antifoam A (Sigma-Aldrich).

    Size-exclusion Chromatography:

    Article Title: Characterization of a Factor H Mutation That Perturbs the Alternative Pathway of Complement in a Family with Membranoproliferative GN
    Article Snippet: A starter culture was transferred into 1 L basal fermentor salts (0.095% [wt/vol] calcium sulfate, 1.82% [wt/vol] potassium sulfate, 1.5% [wt/vol] magnesium sulfate heptahydrate, 0.42% [wt/vol] potassium hydroxide, 2.7% [vol/vol] phosphoric acid, and 2.5% [vol/vol] glycerol) enriched with 1% (wt/vol) casein aa, 0.5% (wt/vol) PTM1 salts, and 0.5% (vol/vol) antifoam A (Sigma-Aldrich). .. It was applied to a 5-ml His trap column (GE Healthcare) at 4°C, and the protein was eluted with 500 mM imidazole followed by size exclusion chromatography on Superdex 200 (GE Healthcare).

    Microscopy:

    Article Title: Ecotoxicological Assessment of Thermally- and Hydrogen-Reduced Graphene Oxide/TiO2 Photocatalytic Nanocomposites Using the Zebrafish Embryo Model
    Article Snippet: In addition, it is used to inhibit pigment formation in the developing zebrafish embryos to facilitate their visualization under the microscope. .. E3 media (used to cultivate zebrafish embryos) constituents including 5.0 mM sodium chloride (NaCl), 0.17 mM potassium chloride (KCl), 0.33 mM magnesium sulfate heptahydrate (MgSO4 ·7H2 O) and 0.33 mM calcium chloride dihydrate (CaCl2 ·2H2 O), all purchased from Sigma.

    Mouse Assay:

    Article Title: Differential Regulation of Syngap1 Translation by FMRP Modulates eEF2 Mediated Response on NMDAR Activity
    Article Snippet: Mice were brought from the animal house and sacrificed by cervical dislocation, and the brain was dissected out. .. The brain was kept in ice-cold sucrose based artificial cerebrospinal fluid (aCSF; cutting solution) comprising of: 189 mM Sucrose (S9378, Sigma Aldrich), 10 mM D-Glucose (G8270, Sigma Aldrich), 26 mM NaHCO3 (5761, Sigma Aldrich), 3 mM KCl (P5405, Sigma Aldrich), 10 mM MgSO4 .7H2 O (M2773, Sigma Aldrich), 1.25 mM NaH2 PO4 (8282, Sigma Aldrich) and 0.1 mM CaCl2 (21115, Sigma Aldrich).

    Sequencing:

    Article Title: Characterization of a Factor H Mutation That Perturbs the Alternative Pathway of Complement in a Family with Membranoproliferative GN
    Article Snippet: Fidelity was confirmed by bidirectional Sanger sequencing. .. A starter culture was transferred into 1 L basal fermentor salts (0.095% [wt/vol] calcium sulfate, 1.82% [wt/vol] potassium sulfate, 1.5% [wt/vol] magnesium sulfate heptahydrate, 0.42% [wt/vol] potassium hydroxide, 2.7% [vol/vol] phosphoric acid, and 2.5% [vol/vol] glycerol) enriched with 1% (wt/vol) casein aa, 0.5% (wt/vol) PTM1 salts, and 0.5% (vol/vol) antifoam A (Sigma-Aldrich).

    Purification:

    Article Title: Ecotoxicological Assessment of Thermally- and Hydrogen-Reduced Graphene Oxide/TiO2 Photocatalytic Nanocomposites Using the Zebrafish Embryo Model
    Article Snippet: E3 media (used to cultivate zebrafish embryos) constituents including 5.0 mM sodium chloride (NaCl), 0.17 mM potassium chloride (KCl), 0.33 mM magnesium sulfate heptahydrate (MgSO4 ·7H2 O) and 0.33 mM calcium chloride dihydrate (CaCl2 ·2H2 O), all purchased from Sigma. .. Water was purified using a MilliQ water purification system (Millipore, Guyancourt, France).

    Article Title: Characterization of a Factor H Mutation That Perturbs the Alternative Pathway of Complement in a Family with Membranoproliferative GN
    Article Snippet: Paragraph title: Production and Purification of Proteins ... A starter culture was transferred into 1 L basal fermentor salts (0.095% [wt/vol] calcium sulfate, 1.82% [wt/vol] potassium sulfate, 1.5% [wt/vol] magnesium sulfate heptahydrate, 0.42% [wt/vol] potassium hydroxide, 2.7% [vol/vol] phosphoric acid, and 2.5% [vol/vol] glycerol) enriched with 1% (wt/vol) casein aa, 0.5% (wt/vol) PTM1 salts, and 0.5% (vol/vol) antifoam A (Sigma-Aldrich).

    Plasmid Preparation:

    Article Title: Characterization of a Factor H Mutation That Perturbs the Alternative Pathway of Complement in a Family with Membranoproliferative GN
    Article Snippet: In brief, the R83S point mutation was generated in a pPICZαB (Invitrogen) vector containing residues 19–263 of fH, with a C-terminal 6× His tag and an N-terminal myc tag (EQKLISEEDL), using the QuikChange site-directed mutagenesis kit (Stratagene) with the following primers: (f) gggttgctcttaatccattaaggaaatgtcagaaaag T ccctgtggacatcctggagatactcc; (r)ggagtatctccaggatgtccacaggg A cttttctgacatttccttaatggattaagagcaaccc. .. A starter culture was transferred into 1 L basal fermentor salts (0.095% [wt/vol] calcium sulfate, 1.82% [wt/vol] potassium sulfate, 1.5% [wt/vol] magnesium sulfate heptahydrate, 0.42% [wt/vol] potassium hydroxide, 2.7% [vol/vol] phosphoric acid, and 2.5% [vol/vol] glycerol) enriched with 1% (wt/vol) casein aa, 0.5% (wt/vol) PTM1 salts, and 0.5% (vol/vol) antifoam A (Sigma-Aldrich).

    Sample Prep:

    Article Title: Analytical assessment of the intense heat load of whipping cream, coffee cream, and condensed milk at retail in Austria and Germany
    Article Snippet: Chemical references All solvents used for chromatographic analysis were of HPLC grade, and all chemicals used for sample preparation were of analytical grade. .. Acetonitrile (ACN, 100%), disodium hydrogen phosphate (99%), heptanesulfonic acid ( > 98%), hydrogen peroxide (30%), magnesium sulfate heptahydrate (98%), sodium acetate trihydrate (99.5%), sodium dihydrogen phosphate, octanol (98%), and trifluoroacetic acid (TFA, 99%) were purchased from Sigma-Aldrich (St. Louis, MO, USA).

    Article Title: Increased Levels of Modified Advanced Oxidation Protein Products Are Associated with Central and Peripheral Blood Pressure in Peritoneal Dialysis Patients
    Article Snippet: The mAOPP assay included, in addition to the AOPP methodology , a sample preparation procedure to precipitate very low- and low-density lipoproteins in the plasma. .. As the HDL-cholesterol precipitating reagent (Thermo Electron Corporation, Vantaa, Finland) is no longer available, we modified the procedure and instead used, as precipitating reagent, 10 mg of dextran sulphate (molecular weight 500 KDa, Sigma-Aldrich, St Louis, MO, USA, product number D6001) and 246 mg magnesium sulphate X7H2 0 (molecular weight 246 KDa, Sigma-Aldrich, M5921) prepared in 1 mL distilled water.

    In Vitro:

    Article Title: Ecotoxicological Assessment of Thermally- and Hydrogen-Reduced Graphene Oxide/TiO2 Photocatalytic Nanocomposites Using the Zebrafish Embryo Model
    Article Snippet: N-phenylthiourea (PTU) (Sigma, Steinheim, Germany) in egg water (E3 media) was used as a media to raise zebrafish embryos in vitro. .. E3 media (used to cultivate zebrafish embryos) constituents including 5.0 mM sodium chloride (NaCl), 0.17 mM potassium chloride (KCl), 0.33 mM magnesium sulfate heptahydrate (MgSO4 ·7H2 O) and 0.33 mM calcium chloride dihydrate (CaCl2 ·2H2 O), all purchased from Sigma.

    Spectrophotometry:

    Article Title: Increased Levels of Modified Advanced Oxidation Protein Products Are Associated with Central and Peripheral Blood Pressure in Peritoneal Dialysis Patients
    Article Snippet: As the HDL-cholesterol precipitating reagent (Thermo Electron Corporation, Vantaa, Finland) is no longer available, we modified the procedure and instead used, as precipitating reagent, 10 mg of dextran sulphate (molecular weight 500 KDa, Sigma-Aldrich, St Louis, MO, USA, product number D6001) and 246 mg magnesium sulphate X7H2 0 (molecular weight 246 KDa, Sigma-Aldrich, M5921) prepared in 1 mL distilled water. .. Then, mAOPP was immediately measured in the supernatant at 340 nm on a microplate spectrophotometer (SPECTRAmax 250, Molecular Devices Corporation, Sunnyvale, CA, USA) under acidic conditions and expressed as chloramine-T equivalents ( ).

    Clear Native PAGE:

    Article Title: Analytical assessment of the intense heat load of whipping cream, coffee cream, and condensed milk at retail in Austria and Germany
    Article Snippet: Acetonitrile (ACN, 100%), disodium hydrogen phosphate (99%), heptanesulfonic acid ( > 98%), hydrogen peroxide (30%), magnesium sulfate heptahydrate (98%), sodium acetate trihydrate (99.5%), sodium dihydrogen phosphate, octanol (98%), and trifluoroacetic acid (TFA, 99%) were purchased from Sigma-Aldrich (St. Louis, MO, USA). .. For native PAGE, ammoniumpersulfate ( > 99%) and tetramethylethylendiamine were purchased from Serva (Heidelberg, Germany), and bromophenol blue as well as glycine were purchased from Merck (Darmstadt, Germany).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Millipore alcian blue staining
    Meclozine promotes chondrocyte proliferation and ameliorates loss of extracellular matrix in FGF2-treated <t>RCS</t> cells. (A, B) RCS cells were treated with 5 ng/ml FGF2 and the indicated concentrations of meclozine for 48 hours. Cell growth was quantified using the MTS assay (A) or by counting cells (B). Data are normalized to that without meclozine and indicated by the mean and SD ( n = 8 for A and 6 for B). Meclozine rescued the FGF2-mediated growth arrest of RCS cells. (C) Meclozine (10 µM) ameliorated FGF2-mediated alteration of cellular shape and loss of extracellular matrix. RCS cells were treated with 5 ng/ml FGF2 with and without 0.2 µM CNP or 20 µM meclozine for 72 hours, and cartilage-like sulfated proteoglycan matrix was stained by <t>Alcian</t> blue. Growing RCS cells were round-shaped and produced abundant cartilage-like sulfated proteoglycan matrix in the absence of FGF2. FGF2 treatment transformed some cells to fibroblast-like shapes and prominently suppressed expression of sulfated proteoglycan matrix. In the RCS cells treated with CNP or meclozine, the cellular shape remained round and the intensity of Alcian blue staining approximated that of FGF2-negative cells. Representative images of triplicated experiments are shown. Magnified images of the middle panels are shown in the rightmost column. Bars in the left, middle, and right panels are 750, 150, and 30 µm, respectively. (D) Meclozine (20 µM) inhibited mRNA expression of matrix metalloproteinases in FGF2-treated RCS cells. Cells were treated with FGF2 and either CNP or meclozine for four hours and mRNAs were quantified by real-time RT-PCR. Expression levels of Mmp10 , Mmp13 , and Adamts1 are presented as the mean and SD normalized to that of FGF2-negative cells ( n = 3). FGF2-mediated increases of Mmp10 , Mmp13 , and Adamts1 mRNA were antagonized by CNP and meclozine. Statistical significance is estimated by Student's t-test.
    Alcian Blue Staining, supplied by Millipore, used in various techniques. Bioz Stars score: 95/100, based on 122 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/alcian blue staining/product/Millipore
    Average 95 stars, based on 122 article reviews
    Price from $9.99 to $1999.99
    alcian blue staining - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    95
    Millipore anhydrous magnesium sulfate
    Meclozine promotes chondrocyte proliferation and ameliorates loss of extracellular matrix in FGF2-treated <t>RCS</t> cells. (A, B) RCS cells were treated with 5 ng/ml FGF2 and the indicated concentrations of meclozine for 48 hours. Cell growth was quantified using the MTS assay (A) or by counting cells (B). Data are normalized to that without meclozine and indicated by the mean and SD ( n = 8 for A and 6 for B). Meclozine rescued the FGF2-mediated growth arrest of RCS cells. (C) Meclozine (10 µM) ameliorated FGF2-mediated alteration of cellular shape and loss of extracellular matrix. RCS cells were treated with 5 ng/ml FGF2 with and without 0.2 µM CNP or 20 µM meclozine for 72 hours, and cartilage-like sulfated proteoglycan matrix was stained by <t>Alcian</t> blue. Growing RCS cells were round-shaped and produced abundant cartilage-like sulfated proteoglycan matrix in the absence of FGF2. FGF2 treatment transformed some cells to fibroblast-like shapes and prominently suppressed expression of sulfated proteoglycan matrix. In the RCS cells treated with CNP or meclozine, the cellular shape remained round and the intensity of Alcian blue staining approximated that of FGF2-negative cells. Representative images of triplicated experiments are shown. Magnified images of the middle panels are shown in the rightmost column. Bars in the left, middle, and right panels are 750, 150, and 30 µm, respectively. (D) Meclozine (20 µM) inhibited mRNA expression of matrix metalloproteinases in FGF2-treated RCS cells. Cells were treated with FGF2 and either CNP or meclozine for four hours and mRNAs were quantified by real-time RT-PCR. Expression levels of Mmp10 , Mmp13 , and Adamts1 are presented as the mean and SD normalized to that of FGF2-negative cells ( n = 3). FGF2-mediated increases of Mmp10 , Mmp13 , and Adamts1 mRNA were antagonized by CNP and meclozine. Statistical significance is estimated by Student's t-test.
    Anhydrous Magnesium Sulfate, supplied by Millipore, used in various techniques. Bioz Stars score: 95/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anhydrous magnesium sulfate/product/Millipore
    Average 95 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    anhydrous magnesium sulfate - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier


    Image Search Results


    Meclozine promotes chondrocyte proliferation and ameliorates loss of extracellular matrix in FGF2-treated RCS cells. (A, B) RCS cells were treated with 5 ng/ml FGF2 and the indicated concentrations of meclozine for 48 hours. Cell growth was quantified using the MTS assay (A) or by counting cells (B). Data are normalized to that without meclozine and indicated by the mean and SD ( n = 8 for A and 6 for B). Meclozine rescued the FGF2-mediated growth arrest of RCS cells. (C) Meclozine (10 µM) ameliorated FGF2-mediated alteration of cellular shape and loss of extracellular matrix. RCS cells were treated with 5 ng/ml FGF2 with and without 0.2 µM CNP or 20 µM meclozine for 72 hours, and cartilage-like sulfated proteoglycan matrix was stained by Alcian blue. Growing RCS cells were round-shaped and produced abundant cartilage-like sulfated proteoglycan matrix in the absence of FGF2. FGF2 treatment transformed some cells to fibroblast-like shapes and prominently suppressed expression of sulfated proteoglycan matrix. In the RCS cells treated with CNP or meclozine, the cellular shape remained round and the intensity of Alcian blue staining approximated that of FGF2-negative cells. Representative images of triplicated experiments are shown. Magnified images of the middle panels are shown in the rightmost column. Bars in the left, middle, and right panels are 750, 150, and 30 µm, respectively. (D) Meclozine (20 µM) inhibited mRNA expression of matrix metalloproteinases in FGF2-treated RCS cells. Cells were treated with FGF2 and either CNP or meclozine for four hours and mRNAs were quantified by real-time RT-PCR. Expression levels of Mmp10 , Mmp13 , and Adamts1 are presented as the mean and SD normalized to that of FGF2-negative cells ( n = 3). FGF2-mediated increases of Mmp10 , Mmp13 , and Adamts1 mRNA were antagonized by CNP and meclozine. Statistical significance is estimated by Student's t-test.

    Journal: PLoS ONE

    Article Title: Meclozine Facilitates Proliferation and Differentiation of Chondrocytes by Attenuating Abnormally Activated FGFR3 Signaling in Achondroplasia

    doi: 10.1371/journal.pone.0081569

    Figure Lengend Snippet: Meclozine promotes chondrocyte proliferation and ameliorates loss of extracellular matrix in FGF2-treated RCS cells. (A, B) RCS cells were treated with 5 ng/ml FGF2 and the indicated concentrations of meclozine for 48 hours. Cell growth was quantified using the MTS assay (A) or by counting cells (B). Data are normalized to that without meclozine and indicated by the mean and SD ( n = 8 for A and 6 for B). Meclozine rescued the FGF2-mediated growth arrest of RCS cells. (C) Meclozine (10 µM) ameliorated FGF2-mediated alteration of cellular shape and loss of extracellular matrix. RCS cells were treated with 5 ng/ml FGF2 with and without 0.2 µM CNP or 20 µM meclozine for 72 hours, and cartilage-like sulfated proteoglycan matrix was stained by Alcian blue. Growing RCS cells were round-shaped and produced abundant cartilage-like sulfated proteoglycan matrix in the absence of FGF2. FGF2 treatment transformed some cells to fibroblast-like shapes and prominently suppressed expression of sulfated proteoglycan matrix. In the RCS cells treated with CNP or meclozine, the cellular shape remained round and the intensity of Alcian blue staining approximated that of FGF2-negative cells. Representative images of triplicated experiments are shown. Magnified images of the middle panels are shown in the rightmost column. Bars in the left, middle, and right panels are 750, 150, and 30 µm, respectively. (D) Meclozine (20 µM) inhibited mRNA expression of matrix metalloproteinases in FGF2-treated RCS cells. Cells were treated with FGF2 and either CNP or meclozine for four hours and mRNAs were quantified by real-time RT-PCR. Expression levels of Mmp10 , Mmp13 , and Adamts1 are presented as the mean and SD normalized to that of FGF2-negative cells ( n = 3). FGF2-mediated increases of Mmp10 , Mmp13 , and Adamts1 mRNA were antagonized by CNP and meclozine. Statistical significance is estimated by Student's t-test.

    Article Snippet: Alcian blue staining For Alcian blue staining, ∼1×105 RCS cells in a 12-well plate were added with 5 ng/ml FGF2 and also with either 10 µM meclozine or 0.2 µM CNP (Calbiochem).

    Techniques: MTS Assay, Staining, Produced, Transformation Assay, Expressing, Quantitative RT-PCR

    In vitro differentiation potential of NCSCs. (A–B) Immunostaining for Schwann cell markers S100β (A) and GFAP (B). (C–D) Immunostaining for peripheral neuron markers peripherin (C) and Tuj1 (D). (E–F) Immunostaining for SMC lineage markers CNN1 (E) and SMA (F). (G–H) Adipogenic differentiation shown by phase contrast imaging (G) and Oil red staining (H). (I–J) Osteogenic differentiation shown by Alizarin red staining for calcified matrix (G) and immunostaining of alkaline phosphatase (ALP) (H). (K–L) Chondrogenic differentiation shown by Alcian blue staining for glycosaminoglycans (E) and immunofluorescent staining of Col-II (F). In all immunofluorescence images, nuclei were stained by DAPI in blue. Scale bar = 100 µm.

    Journal: PLoS ONE

    Article Title: Uniaxial Mechanical Strain Modulates the Differentiation of Neural Crest Stem Cells into Smooth Muscle Lineage on Micropatterned Surfaces

    doi: 10.1371/journal.pone.0026029

    Figure Lengend Snippet: In vitro differentiation potential of NCSCs. (A–B) Immunostaining for Schwann cell markers S100β (A) and GFAP (B). (C–D) Immunostaining for peripheral neuron markers peripherin (C) and Tuj1 (D). (E–F) Immunostaining for SMC lineage markers CNN1 (E) and SMA (F). (G–H) Adipogenic differentiation shown by phase contrast imaging (G) and Oil red staining (H). (I–J) Osteogenic differentiation shown by Alizarin red staining for calcified matrix (G) and immunostaining of alkaline phosphatase (ALP) (H). (K–L) Chondrogenic differentiation shown by Alcian blue staining for glycosaminoglycans (E) and immunofluorescent staining of Col-II (F). In all immunofluorescence images, nuclei were stained by DAPI in blue. Scale bar = 100 µm.

    Article Snippet: The cell pellets were cryosectioned, and stained for glycosaminoglycans (GAGs) by using Alcian blue staining or immunostained for Collagen type II (Col-II; MAB8887, Millipore Corp.).

    Techniques: In Vitro, Immunostaining, Imaging, Staining, ALP Assay, Immunofluorescence