m mlv reverse transcriptase  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    M MLV Reverse Transcriptase 200 U µL
    Description:
    M MLV Reverse Transcriptase is a recombinant DNA polymerase that synthesizes a complementary DNA strand from single stranded RNA DNA or an RNA DNA hybrid Compared to AMV RT Moloney Murine Leukemia Virus Reverse Transcriptase M MLV RT lacks DNA endonuclease activity and has a lower RNase H activity Features of this enzyme • Thermostability optimal activity at 37°C• Size of cDNA M MLV can be used to synthesize first strand cDNA up to 7 kb• Applications synthesis of first strand cDNA primer extension sequencing dsDNA cDNA libraries and RT PCRSourcePurified from E coli expressing the pol gene of M MLV on a plasmidPerformance and quality testingSDS PAGE purity endodeoxyribonuclease exodeoxyribonuclease and ribonuclease assays and yield and length of cDNA productUnit definitionOne unit of M MLV RT is the amount of enzyme required to incorporate 1 nmole of deoxyribonucleotide into acid precipitable material in 10 min at 37°C using poly A oligo dT 25 as template primer Unit reaction conditions50 mM Tris HCl pH 8 3 40 mM KCl 6 mM MgCl2 1 mM DTT 0 5 mM 3H dTTP 0 1 mM poly A 0 1 mM oligo dT 25 0 1 mg mL BSA and enzyme in 50 µL for 10 min at 37°C
    Catalog Number:
    28025013
    Price:
    None
    Applications:
    PCR & Real-Time PCR|Reverse Transcription
    Category:
    Proteins Enzymes Peptides
    Buy from Supplier


    Structured Review

    Thermo Fisher m mlv reverse transcriptase
    <t>Gadd45a</t> binds RNA in vitro . A, RNA filter binding assay using the indicated proteins and 32 P-labeled RNA (multiple cloning site transcript, MCS). Co, no protein; BSA, bovine serum albumin; <t>M-MLV</t> RT - Moloney murine leukemia virus reverse transcriptase. B, C, RNA filter binding assays using 32 P-labeled MCS RNA were performed with recombinant Gadd45a in the presence of the indicated unlabeled competitor nucleic acids. Data are shown as percentage of 32 P bound in the absence of the competitor. Each sample was done in triplicate; average and standard deviation was generated; A representative experiment out of three is shown. U, unmethylated; M, methylated; U/U, unmethylated; U/M, hemimethylated; M/M, holomethylated; PolyA, polyC, polyG, polyU, homopolyribonucleotides; total RNA, RNA isolated from HEK293T cells; tRNA, yeast tRNA; MCS RNA, multiple cloning site RNA. Error bars, s.e.m. (n = 3). A representative experiment out of three is shown.
    M MLV Reverse Transcriptase is a recombinant DNA polymerase that synthesizes a complementary DNA strand from single stranded RNA DNA or an RNA DNA hybrid Compared to AMV RT Moloney Murine Leukemia Virus Reverse Transcriptase M MLV RT lacks DNA endonuclease activity and has a lower RNase H activity Features of this enzyme • Thermostability optimal activity at 37°C• Size of cDNA M MLV can be used to synthesize first strand cDNA up to 7 kb• Applications synthesis of first strand cDNA primer extension sequencing dsDNA cDNA libraries and RT PCRSourcePurified from E coli expressing the pol gene of M MLV on a plasmidPerformance and quality testingSDS PAGE purity endodeoxyribonuclease exodeoxyribonuclease and ribonuclease assays and yield and length of cDNA productUnit definitionOne unit of M MLV RT is the amount of enzyme required to incorporate 1 nmole of deoxyribonucleotide into acid precipitable material in 10 min at 37°C using poly A oligo dT 25 as template primer Unit reaction conditions50 mM Tris HCl pH 8 3 40 mM KCl 6 mM MgCl2 1 mM DTT 0 5 mM 3H dTTP 0 1 mM poly A 0 1 mM oligo dT 25 0 1 mg mL BSA and enzyme in 50 µL for 10 min at 37°C
    https://www.bioz.com/result/m mlv reverse transcriptase/product/Thermo Fisher
    Average 99 stars, based on 2749 article reviews
    Price from $9.99 to $1999.99
    m mlv reverse transcriptase - by Bioz Stars, 2020-07
    99/100 stars

    Images

    1) Product Images from "Gadd45a Is an RNA Binding Protein and Is Localized in Nuclear Speckles"

    Article Title: Gadd45a Is an RNA Binding Protein and Is Localized in Nuclear Speckles

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0014500

    Gadd45a binds RNA in vitro . A, RNA filter binding assay using the indicated proteins and 32 P-labeled RNA (multiple cloning site transcript, MCS). Co, no protein; BSA, bovine serum albumin; M-MLV RT - Moloney murine leukemia virus reverse transcriptase. B, C, RNA filter binding assays using 32 P-labeled MCS RNA were performed with recombinant Gadd45a in the presence of the indicated unlabeled competitor nucleic acids. Data are shown as percentage of 32 P bound in the absence of the competitor. Each sample was done in triplicate; average and standard deviation was generated; A representative experiment out of three is shown. U, unmethylated; M, methylated; U/U, unmethylated; U/M, hemimethylated; M/M, holomethylated; PolyA, polyC, polyG, polyU, homopolyribonucleotides; total RNA, RNA isolated from HEK293T cells; tRNA, yeast tRNA; MCS RNA, multiple cloning site RNA. Error bars, s.e.m. (n = 3). A representative experiment out of three is shown.
    Figure Legend Snippet: Gadd45a binds RNA in vitro . A, RNA filter binding assay using the indicated proteins and 32 P-labeled RNA (multiple cloning site transcript, MCS). Co, no protein; BSA, bovine serum albumin; M-MLV RT - Moloney murine leukemia virus reverse transcriptase. B, C, RNA filter binding assays using 32 P-labeled MCS RNA were performed with recombinant Gadd45a in the presence of the indicated unlabeled competitor nucleic acids. Data are shown as percentage of 32 P bound in the absence of the competitor. Each sample was done in triplicate; average and standard deviation was generated; A representative experiment out of three is shown. U, unmethylated; M, methylated; U/U, unmethylated; U/M, hemimethylated; M/M, holomethylated; PolyA, polyC, polyG, polyU, homopolyribonucleotides; total RNA, RNA isolated from HEK293T cells; tRNA, yeast tRNA; MCS RNA, multiple cloning site RNA. Error bars, s.e.m. (n = 3). A representative experiment out of three is shown.

    Techniques Used: In Vitro, Filter-binding Assay, Labeling, Clone Assay, Binding Assay, Recombinant, Standard Deviation, Generated, Methylation, Isolation

    2) Product Images from "The Use of a Dexamethasone-inducible System to Synchronize Xa21 Expression to Study Rice Immunity"

    Article Title: The Use of a Dexamethasone-inducible System to Synchronize Xa21 Expression to Study Rice Immunity

    Journal: Bio-protocol

    doi:

    Expression of Xa21 after dexamethasone application pTA7002::Myc::XA21 rice leaves were harvested at the indicated time points after application of dexamethasone. RNA was extracted using TRIzol with standard protocol; cDNA used for quantitative PCR was transcribed with M-MLV reverse transcriptase; and quantitative PCR was performed with SsoFastEvaGreenSupermix on a PCR machine. The gene expression of Xa21 was normalized using the rice ubiquitin gene (LOC_Os06g46770) as an internal control, and the expression level in the Ubi::Myc::XA21 plants (labeled as XA21) was set as 1.0.
    Figure Legend Snippet: Expression of Xa21 after dexamethasone application pTA7002::Myc::XA21 rice leaves were harvested at the indicated time points after application of dexamethasone. RNA was extracted using TRIzol with standard protocol; cDNA used for quantitative PCR was transcribed with M-MLV reverse transcriptase; and quantitative PCR was performed with SsoFastEvaGreenSupermix on a PCR machine. The gene expression of Xa21 was normalized using the rice ubiquitin gene (LOC_Os06g46770) as an internal control, and the expression level in the Ubi::Myc::XA21 plants (labeled as XA21) was set as 1.0.

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, Labeling

    3) Product Images from "Selective control of primer usage in multiplex one-step reverse transcription PCR"

    Article Title: Selective control of primer usage in multiplex one-step reverse transcription PCR

    Journal: BMC Molecular Biology

    doi: 10.1186/1471-2199-10-113

    Real-time one-step RT-PCR evaluation of cDNA priming strategies and the effect of unbalanced target concentrations . A) Real-time one-step RT-PCR evaluation of the effect of different RT primers on quantification of RNA expression in singleplex and in triplex. Reactions employed either an oligo(dT) 18 RT primer, a random decamer RT primer, or a combination of oligo(dT) 18 and random decamer RT primers for cDNA synthesis. In addition, each one-step RT-PCR protocol employed Taq DNA polymerase, M-MLV RT, 0.8 μg of human thymus total RNA, and CleanAmp™ Precision PCR primers. Reactions were performed in triplicate. B) Real-time one-step RT-PCR evaluation of triplex one-step RT-PCR amplifications using different custom prepared mixes containing three RNA standards in different ratios. The relative abundance for each mixture A through H is represented in the following format: (X:Y:Z), where the copies of the ABCA5 RNA standard is present at 10^X copies, the ABCA6 RNA standard is present at 10^Y copies, and the ABCA7 RNA standard is present at 10^Z copies. The observed copy number for each reaction, which was performed in triplicate, was obtained by extrapolation of the Cq to a standard curve for the ABCA5, ABCA6, and ABCA7 RNA standards. The resultant data for each RNA sample was normalized to ABCA7 and was plotted graphically.
    Figure Legend Snippet: Real-time one-step RT-PCR evaluation of cDNA priming strategies and the effect of unbalanced target concentrations . A) Real-time one-step RT-PCR evaluation of the effect of different RT primers on quantification of RNA expression in singleplex and in triplex. Reactions employed either an oligo(dT) 18 RT primer, a random decamer RT primer, or a combination of oligo(dT) 18 and random decamer RT primers for cDNA synthesis. In addition, each one-step RT-PCR protocol employed Taq DNA polymerase, M-MLV RT, 0.8 μg of human thymus total RNA, and CleanAmp™ Precision PCR primers. Reactions were performed in triplicate. B) Real-time one-step RT-PCR evaluation of triplex one-step RT-PCR amplifications using different custom prepared mixes containing three RNA standards in different ratios. The relative abundance for each mixture A through H is represented in the following format: (X:Y:Z), where the copies of the ABCA5 RNA standard is present at 10^X copies, the ABCA6 RNA standard is present at 10^Y copies, and the ABCA7 RNA standard is present at 10^Z copies. The observed copy number for each reaction, which was performed in triplicate, was obtained by extrapolation of the Cq to a standard curve for the ABCA5, ABCA6, and ABCA7 RNA standards. The resultant data for each RNA sample was normalized to ABCA7 and was plotted graphically.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, RNA Expression, Polymerase Chain Reaction

    One-step RT-PCR evaluation of unmodified and thermolabile CleanAmp™ Precision primers to amplify three different targets of ABCA transporters in singleplex, duplex, and triplex amplifications . For each gene of interest (ABCA5, ABCA6, and ABCA7), the PCR primers were unmodified or contained CleanAmp™ Precision modifications. Reverse transcription utilized an oligo(dT) 18 primer. Reactions contained Taq DNA polymerase, the appropriate reverse transcriptase, and 0.82 μg of human trachea total RNA. A) Reactions employed M-MLV reverse transcriptase and utilized an RT extension temperature of 42°C. B) Reactions employed SuperScript ® III reverse transcriptase (SSIII RT) and utilized an RT extension temperature of 55°C.
    Figure Legend Snippet: One-step RT-PCR evaluation of unmodified and thermolabile CleanAmp™ Precision primers to amplify three different targets of ABCA transporters in singleplex, duplex, and triplex amplifications . For each gene of interest (ABCA5, ABCA6, and ABCA7), the PCR primers were unmodified or contained CleanAmp™ Precision modifications. Reverse transcription utilized an oligo(dT) 18 primer. Reactions contained Taq DNA polymerase, the appropriate reverse transcriptase, and 0.82 μg of human trachea total RNA. A) Reactions employed M-MLV reverse transcriptase and utilized an RT extension temperature of 42°C. B) Reactions employed SuperScript ® III reverse transcriptase (SSIII RT) and utilized an RT extension temperature of 55°C.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction

    Hot Start DNA polymerase evaluation in triplex one-step RT-PCR amplification of ABCA5, ABCA6 and ABCA7 targets . Reactions contained 0.82 μg of human trachea total RNA and an unmodified oligo(dT) 18 RT primer. The PCR primers were either unmodified, or contained CleanAmp™ Precision modifications. These reactions contained one of the following DNA polymerases: Taq , Platinum ® Taq , or AmpliTaq Gold ® and one of the following reverse transcriptases: M-MLV or SSIII. Reactions with M-MLV were incubated at 42°C, while reactions with SSIII were incubated at 55°C.
    Figure Legend Snippet: Hot Start DNA polymerase evaluation in triplex one-step RT-PCR amplification of ABCA5, ABCA6 and ABCA7 targets . Reactions contained 0.82 μg of human trachea total RNA and an unmodified oligo(dT) 18 RT primer. The PCR primers were either unmodified, or contained CleanAmp™ Precision modifications. These reactions contained one of the following DNA polymerases: Taq , Platinum ® Taq , or AmpliTaq Gold ® and one of the following reverse transcriptases: M-MLV or SSIII. Reactions with M-MLV were incubated at 42°C, while reactions with SSIII were incubated at 55°C.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Amplification, Polymerase Chain Reaction, Incubation

    Singleplex and triplex real-time one-step RT-PCR detection of ABCA5, ABCA6, and ABCA7 in three different tissues . Reactions, which were performed in triplicate, contained M-MLV reverse transcriptase, an unmodified oligo(dT) 18 primer, Taq DNA polymerase and CleanAmp™ Precision PCR primers for the ABCA5, ABCA6 and ABCA7 genes. A standard curve for ABCA5, ABCA6, and ABCA7 was determined by employing ~10 1 to ~10 8 copies of the appropriate RNA standard. Each of the three human total RNA tissue samples (brain (0.78 μg), thymus (0.8 μg), and trachea (0.82 μg)) was amplified in singleplex and triplex format for detection of ABCA5, ABCA6, and ABCA7. The number of copies of each target in a given tissue was determined by extrapolating the resultant Cq values to the standard curve and normalizing the resultant values to the micrograms of input total RNA. A) The relative number of copies per microgram and standard deviation for each target in brain, thymus, and trachea total RNA is represented in a bar graph, which displays the results for singleplex and triplex amplifications. B) The corresponding agarose gel analysis of the three tissue samples amplified in singleplex and in triplex.
    Figure Legend Snippet: Singleplex and triplex real-time one-step RT-PCR detection of ABCA5, ABCA6, and ABCA7 in three different tissues . Reactions, which were performed in triplicate, contained M-MLV reverse transcriptase, an unmodified oligo(dT) 18 primer, Taq DNA polymerase and CleanAmp™ Precision PCR primers for the ABCA5, ABCA6 and ABCA7 genes. A standard curve for ABCA5, ABCA6, and ABCA7 was determined by employing ~10 1 to ~10 8 copies of the appropriate RNA standard. Each of the three human total RNA tissue samples (brain (0.78 μg), thymus (0.8 μg), and trachea (0.82 μg)) was amplified in singleplex and triplex format for detection of ABCA5, ABCA6, and ABCA7. The number of copies of each target in a given tissue was determined by extrapolating the resultant Cq values to the standard curve and normalizing the resultant values to the micrograms of input total RNA. A) The relative number of copies per microgram and standard deviation for each target in brain, thymus, and trachea total RNA is represented in a bar graph, which displays the results for singleplex and triplex amplifications. B) The corresponding agarose gel analysis of the three tissue samples amplified in singleplex and in triplex.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Amplification, Standard Deviation, Agarose Gel Electrophoresis

    Evaluation of M-MLV and SSIII reverse transcriptases in multiplex one-step RT-PCR amplification of up to five targets . The amplification of increasing number of targets was evaluated by using either M-MLV RT (42°C) or SSIII RT (55°C). Reactions contained an oligo(dT) 18 primer, 0.82 μg of human trachea total RNA, CleanAmp™ Precision primers, and Taq DNA polymerase.
    Figure Legend Snippet: Evaluation of M-MLV and SSIII reverse transcriptases in multiplex one-step RT-PCR amplification of up to five targets . The amplification of increasing number of targets was evaluated by using either M-MLV RT (42°C) or SSIII RT (55°C). Reactions contained an oligo(dT) 18 primer, 0.82 μg of human trachea total RNA, CleanAmp™ Precision primers, and Taq DNA polymerase.

    Techniques Used: Multiplex Assay, Reverse Transcription Polymerase Chain Reaction, Amplification

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: Transcriptional corepressor SHP recruits SIRT1 histone deacetylase to inhibit LRH-1 transactivation
    Article Snippet: .. Reverse transcriptase PCR and quantitative real-time PCR analysis Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of CYP7A1 and SHP were analyzed by reverse transcriptase PCR (RT–PCR) or quantitative real-time PCR (qPCR) as indicated.

    Article Title: Orphan Nuclear Receptor Err? Induces C-Reactive Protein Gene Expression through Induction of ER-Bound Bzip Transmembrane Transcription Factor CREBH
    Article Snippet: .. Reverse Transcriptase PCR and Quantitative Real-time PCR Analyses Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of ERRγ, CREBH, CRP, and PGC1α were analyzed by reverse transcription PCR (RT–PCR) or quantitative real-time RT-PCR (qPCR) as indicated.

    Article Title: Transcriptional cross talk between orphan nuclear receptor ERR? and transmembrane transcription factor ATF6? coordinates endoplasmic reticulum stress response
    Article Snippet: .. Reverse transcriptase PCR and quantitative real-time PCR analysis Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of ATF6α and PGC1α were analyzed by RT-PCR or quantitative real-time RT-PCR (qPCR) as indicated.

    Article Title: Negative Regulation of the Keap1-Nrf2 Pathway by a p62/Sqstm1 Splicing Variant
    Article Snippet: .. cDNA was synthesized as described in “Reverse transcriptase PCR and quantitative real-time PCR.” Absolute quantification was performed using a QuantStudio 3D digital PCR system (Thermo Fisher Scientific) and analyzed with QuantStudio 3D AnalysisSuite cloud software (Thermo Fisher Scientific). .. The sequences of primers and probes were as follows: p62 full-length Left, CCCACAGGGCTGAAGGAA; p62 full-length Right, CATCTGGGAGAGGGACTCAATC; p62 full-length Probe, CCCACCAGAGGCTGA; p62 variant Left, CGATGACTGGACACATTTGTCTTC; p62 variant Right, TCTGGGAGAGGGACTCAATCA; and p62 full-length Probe, CCATCACAGAGGCTG.

    Synthesized:

    Article Title: Negative Regulation of the Keap1-Nrf2 Pathway by a p62/Sqstm1 Splicing Variant
    Article Snippet: .. cDNA was synthesized as described in “Reverse transcriptase PCR and quantitative real-time PCR.” Absolute quantification was performed using a QuantStudio 3D digital PCR system (Thermo Fisher Scientific) and analyzed with QuantStudio 3D AnalysisSuite cloud software (Thermo Fisher Scientific). .. The sequences of primers and probes were as follows: p62 full-length Left, CCCACAGGGCTGAAGGAA; p62 full-length Right, CATCTGGGAGAGGGACTCAATC; p62 full-length Probe, CCCACCAGAGGCTGA; p62 variant Left, CGATGACTGGACACATTTGTCTTC; p62 variant Right, TCTGGGAGAGGGACTCAATCA; and p62 full-length Probe, CCATCACAGAGGCTG.

    Isolation:

    Article Title: Both U2 snRNA and U12 snRNA are required for accurate splicing of exon 5 of the rat calcitonin/CGRP gene
    Article Snippet: .. Total RNA was isolated using Trizol (Invitrogen) and analyzed for splice products using reverse transcriptase–PCR. cDNAs were transcribed from RNA by Thermoscript reverse transcriptase (Invitrogen) using random hexamers as primers. .. PCR reactions were performed using 30 amplification cycles, the PCR products were extracted, separated by electrophoresis on 1.5% agarose gels, and visualized by ethidium bromide staining and under UV light.

    Article Title: Transcriptional corepressor SHP recruits SIRT1 histone deacetylase to inhibit LRH-1 transactivation
    Article Snippet: .. Reverse transcriptase PCR and quantitative real-time PCR analysis Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of CYP7A1 and SHP were analyzed by reverse transcriptase PCR (RT–PCR) or quantitative real-time PCR (qPCR) as indicated.

    Article Title: Orphan Nuclear Receptor Err? Induces C-Reactive Protein Gene Expression through Induction of ER-Bound Bzip Transmembrane Transcription Factor CREBH
    Article Snippet: .. Reverse Transcriptase PCR and Quantitative Real-time PCR Analyses Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of ERRγ, CREBH, CRP, and PGC1α were analyzed by reverse transcription PCR (RT–PCR) or quantitative real-time RT-PCR (qPCR) as indicated.

    Article Title: Transcriptional cross talk between orphan nuclear receptor ERR? and transmembrane transcription factor ATF6? coordinates endoplasmic reticulum stress response
    Article Snippet: .. Reverse transcriptase PCR and quantitative real-time PCR analysis Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of ATF6α and PGC1α were analyzed by RT-PCR or quantitative real-time RT-PCR (qPCR) as indicated.

    Digital PCR:

    Article Title: Negative Regulation of the Keap1-Nrf2 Pathway by a p62/Sqstm1 Splicing Variant
    Article Snippet: .. cDNA was synthesized as described in “Reverse transcriptase PCR and quantitative real-time PCR.” Absolute quantification was performed using a QuantStudio 3D digital PCR system (Thermo Fisher Scientific) and analyzed with QuantStudio 3D AnalysisSuite cloud software (Thermo Fisher Scientific). .. The sequences of primers and probes were as follows: p62 full-length Left, CCCACAGGGCTGAAGGAA; p62 full-length Right, CATCTGGGAGAGGGACTCAATC; p62 full-length Probe, CCCACCAGAGGCTGA; p62 variant Left, CGATGACTGGACACATTTGTCTTC; p62 variant Right, TCTGGGAGAGGGACTCAATCA; and p62 full-length Probe, CCATCACAGAGGCTG.

    Polymerase Chain Reaction:

    Article Title: Double strand RNA delivery system for plant-sap-feeding insects
    Article Snippet: .. Reverse transcriptase PCR was used to generate cDNA, 200 ng of total RNA was incubated with a 0.5 mM deoxynucleoside triphosphate mixture, 0.65 μM each oligo(dT)16 (Life Technologies), and random hexamers (Life Technologies) at 65°C for 5 min. A cDNA synthesis mixture containing 10 mM dithiothreitol (DTT), 100 units of Superscript Reverse Transcriptase III (Life Technologies), and 2 units of SUPERase™ In RNase inhibitor (Life Technologies) was then added to the total RNA mixture, which was incubated at 25°C for 5 min, 50°C for 50 min. .. The reaction was terminated by incubation at 70°C for 15 min and the resulting cDNA was stored at -20°C.

    Article Title: Transcriptional corepressor SHP recruits SIRT1 histone deacetylase to inhibit LRH-1 transactivation
    Article Snippet: .. Reverse transcriptase PCR and quantitative real-time PCR analysis Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of CYP7A1 and SHP were analyzed by reverse transcriptase PCR (RT–PCR) or quantitative real-time PCR (qPCR) as indicated.

    Article Title: Expression and activity of eIF6 trigger Malignant Pleural Mesothelioma growth in vivo
    Article Snippet: .. Target mRNA quantification by quantitative reverse-transcriptase PCR using ΔΔCt-method using Taqman Universal PCR Master Mix (4304437; Life Technologies) was performed on an ABIPRISM 7900HT Sequence Detection System (Applied Biosystems). .. Cell proliferation, cell cycle and cell death analysis Proliferation rate of MPM cells was analysed by MTT test: briefly, cells were plated in 96 wells plates at different concentrations, and assayed after 24, 48 and 72 hours.

    Article Title: Nucleocytosolic Depletion of the Energy Metabolite Acetyl-Coenzyme A Stimulates Autophagy and Prolongs Lifespan
    Article Snippet: .. Quantitative Reverse-Transcriptase PCR Target mRNA quantification by quantitative reverse-transcriptase PCR using ΔΔCt-method with 18S rRNA as an internal standard was performed on an ABI StepOnePlus using SYBR Select Master Mix (Life Tech, Invitrogen) ΔΔCt-method. .. Drosophila Lifespan Analyses and Brain Immunofluorescence UAS-RNAi lines for acetyl-CoA Synthetase (P{TRiP.HMS02314}attP2) and EGFP (P{VALIUM20-EGFP.shRNA.1}attP2) serving as a background-matched control were obtained from Bloomington Drosophila Stock Center.

    Article Title: Orphan Nuclear Receptor Err? Induces C-Reactive Protein Gene Expression through Induction of ER-Bound Bzip Transmembrane Transcription Factor CREBH
    Article Snippet: .. Reverse Transcriptase PCR and Quantitative Real-time PCR Analyses Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of ERRγ, CREBH, CRP, and PGC1α were analyzed by reverse transcription PCR (RT–PCR) or quantitative real-time RT-PCR (qPCR) as indicated.

    Article Title: Transcriptional cross talk between orphan nuclear receptor ERR? and transmembrane transcription factor ATF6? coordinates endoplasmic reticulum stress response
    Article Snippet: .. Reverse transcriptase PCR and quantitative real-time PCR analysis Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of ATF6α and PGC1α were analyzed by RT-PCR or quantitative real-time RT-PCR (qPCR) as indicated.

    Article Title: Negative Regulation of the Keap1-Nrf2 Pathway by a p62/Sqstm1 Splicing Variant
    Article Snippet: .. cDNA was synthesized as described in “Reverse transcriptase PCR and quantitative real-time PCR.” Absolute quantification was performed using a QuantStudio 3D digital PCR system (Thermo Fisher Scientific) and analyzed with QuantStudio 3D AnalysisSuite cloud software (Thermo Fisher Scientific). .. The sequences of primers and probes were as follows: p62 full-length Left, CCCACAGGGCTGAAGGAA; p62 full-length Right, CATCTGGGAGAGGGACTCAATC; p62 full-length Probe, CCCACCAGAGGCTGA; p62 variant Left, CGATGACTGGACACATTTGTCTTC; p62 variant Right, TCTGGGAGAGGGACTCAATCA; and p62 full-length Probe, CCATCACAGAGGCTG.

    Incubation:

    Article Title: Double strand RNA delivery system for plant-sap-feeding insects
    Article Snippet: .. Reverse transcriptase PCR was used to generate cDNA, 200 ng of total RNA was incubated with a 0.5 mM deoxynucleoside triphosphate mixture, 0.65 μM each oligo(dT)16 (Life Technologies), and random hexamers (Life Technologies) at 65°C for 5 min. A cDNA synthesis mixture containing 10 mM dithiothreitol (DTT), 100 units of Superscript Reverse Transcriptase III (Life Technologies), and 2 units of SUPERase™ In RNase inhibitor (Life Technologies) was then added to the total RNA mixture, which was incubated at 25°C for 5 min, 50°C for 50 min. .. The reaction was terminated by incubation at 70°C for 15 min and the resulting cDNA was stored at -20°C.

    Sequencing:

    Article Title: Expression and activity of eIF6 trigger Malignant Pleural Mesothelioma growth in vivo
    Article Snippet: .. Target mRNA quantification by quantitative reverse-transcriptase PCR using ΔΔCt-method using Taqman Universal PCR Master Mix (4304437; Life Technologies) was performed on an ABIPRISM 7900HT Sequence Detection System (Applied Biosystems). .. Cell proliferation, cell cycle and cell death analysis Proliferation rate of MPM cells was analysed by MTT test: briefly, cells were plated in 96 wells plates at different concentrations, and assayed after 24, 48 and 72 hours.

    Software:

    Article Title: Negative Regulation of the Keap1-Nrf2 Pathway by a p62/Sqstm1 Splicing Variant
    Article Snippet: .. cDNA was synthesized as described in “Reverse transcriptase PCR and quantitative real-time PCR.” Absolute quantification was performed using a QuantStudio 3D digital PCR system (Thermo Fisher Scientific) and analyzed with QuantStudio 3D AnalysisSuite cloud software (Thermo Fisher Scientific). .. The sequences of primers and probes were as follows: p62 full-length Left, CCCACAGGGCTGAAGGAA; p62 full-length Right, CATCTGGGAGAGGGACTCAATC; p62 full-length Probe, CCCACCAGAGGCTGA; p62 variant Left, CGATGACTGGACACATTTGTCTTC; p62 variant Right, TCTGGGAGAGGGACTCAATCA; and p62 full-length Probe, CCATCACAGAGGCTG.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher reverse transcriptase pcr
    The p62 variant negatively regulates the p62-Keap1-Nrf2 axis in mouse hepatocytes. (A) Schematic diagram of the genome structures of wild-type p62 and p62-GFP knock-in alleles. Coding exons, numbered in accordance with the initiation site (exon 1), are depicted by white boxes. <t>E2-cDNA–GFP–pA</t> indicates the p62 cDNA fragment (positions 302 to 1326) fused with GFP cDNA and simian virus 40 (SV40) poly(A). mRNAs and proteins produced from each allele are shown. (B) Immunoblot analysis. Primary hepatocytes prepared from both wild-type and p62-GFP knock-in mice were challenged with 10 μM sodium arsenite [As(III)] for 12 h. After removal of As(III), cells were cultured in regular medium for the indicated times. Cell lysates were prepared and subjected to immunoblot analysis with the indicated antibodies. Data show the results of two independent experiments. Numerical values indicate the results of quantitative densitometric analyses of Nqo1 normalized against the levels in nontreated cells. An asterisk indicates a nonspecific band. (C) Real-time <t>PCR.</t> Relative mRNA levels of Nrf2 targets in hepatocytes prepared as described for panel B are shown. Values were normalized against the corresponding mRNA levels in nontreated wild-type or p62-GFP knock-in hepatocytes. The experiments were performed two times.
    Reverse Transcriptase Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 96 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/reverse transcriptase pcr/product/Thermo Fisher
    Average 99 stars, based on 96 article reviews
    Price from $9.99 to $1999.99
    reverse transcriptase pcr - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    93
    Thermo Fisher moloney murine leukaemia virus reverse transcriptase
    The p62 variant negatively regulates the p62-Keap1-Nrf2 axis in mouse hepatocytes. (A) Schematic diagram of the genome structures of wild-type p62 and p62-GFP knock-in alleles. Coding exons, numbered in accordance with the initiation site (exon 1), are depicted by white boxes. <t>E2-cDNA–GFP–pA</t> indicates the p62 cDNA fragment (positions 302 to 1326) fused with GFP cDNA and simian virus 40 (SV40) poly(A). mRNAs and proteins produced from each allele are shown. (B) Immunoblot analysis. Primary hepatocytes prepared from both wild-type and p62-GFP knock-in mice were challenged with 10 μM sodium arsenite [As(III)] for 12 h. After removal of As(III), cells were cultured in regular medium for the indicated times. Cell lysates were prepared and subjected to immunoblot analysis with the indicated antibodies. Data show the results of two independent experiments. Numerical values indicate the results of quantitative densitometric analyses of Nqo1 normalized against the levels in nontreated cells. An asterisk indicates a nonspecific band. (C) Real-time <t>PCR.</t> Relative mRNA levels of Nrf2 targets in hepatocytes prepared as described for panel B are shown. Values were normalized against the corresponding mRNA levels in nontreated wild-type or p62-GFP knock-in hepatocytes. The experiments were performed two times.
    Moloney Murine Leukaemia Virus Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 33 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/moloney murine leukaemia virus reverse transcriptase/product/Thermo Fisher
    Average 93 stars, based on 33 article reviews
    Price from $9.99 to $1999.99
    moloney murine leukaemia virus reverse transcriptase - by Bioz Stars, 2020-07
    93/100 stars
      Buy from Supplier

    Image Search Results


    The p62 variant negatively regulates the p62-Keap1-Nrf2 axis in mouse hepatocytes. (A) Schematic diagram of the genome structures of wild-type p62 and p62-GFP knock-in alleles. Coding exons, numbered in accordance with the initiation site (exon 1), are depicted by white boxes. E2-cDNA–GFP–pA indicates the p62 cDNA fragment (positions 302 to 1326) fused with GFP cDNA and simian virus 40 (SV40) poly(A). mRNAs and proteins produced from each allele are shown. (B) Immunoblot analysis. Primary hepatocytes prepared from both wild-type and p62-GFP knock-in mice were challenged with 10 μM sodium arsenite [As(III)] for 12 h. After removal of As(III), cells were cultured in regular medium for the indicated times. Cell lysates were prepared and subjected to immunoblot analysis with the indicated antibodies. Data show the results of two independent experiments. Numerical values indicate the results of quantitative densitometric analyses of Nqo1 normalized against the levels in nontreated cells. An asterisk indicates a nonspecific band. (C) Real-time PCR. Relative mRNA levels of Nrf2 targets in hepatocytes prepared as described for panel B are shown. Values were normalized against the corresponding mRNA levels in nontreated wild-type or p62-GFP knock-in hepatocytes. The experiments were performed two times.

    Journal: Molecular and Cellular Biology

    Article Title: Negative Regulation of the Keap1-Nrf2 Pathway by a p62/Sqstm1 Splicing Variant

    doi: 10.1128/MCB.00642-17

    Figure Lengend Snippet: The p62 variant negatively regulates the p62-Keap1-Nrf2 axis in mouse hepatocytes. (A) Schematic diagram of the genome structures of wild-type p62 and p62-GFP knock-in alleles. Coding exons, numbered in accordance with the initiation site (exon 1), are depicted by white boxes. E2-cDNA–GFP–pA indicates the p62 cDNA fragment (positions 302 to 1326) fused with GFP cDNA and simian virus 40 (SV40) poly(A). mRNAs and proteins produced from each allele are shown. (B) Immunoblot analysis. Primary hepatocytes prepared from both wild-type and p62-GFP knock-in mice were challenged with 10 μM sodium arsenite [As(III)] for 12 h. After removal of As(III), cells were cultured in regular medium for the indicated times. Cell lysates were prepared and subjected to immunoblot analysis with the indicated antibodies. Data show the results of two independent experiments. Numerical values indicate the results of quantitative densitometric analyses of Nqo1 normalized against the levels in nontreated cells. An asterisk indicates a nonspecific band. (C) Real-time PCR. Relative mRNA levels of Nrf2 targets in hepatocytes prepared as described for panel B are shown. Values were normalized against the corresponding mRNA levels in nontreated wild-type or p62-GFP knock-in hepatocytes. The experiments were performed two times.

    Article Snippet: cDNA was synthesized as described in “Reverse transcriptase PCR and quantitative real-time PCR.” Absolute quantification was performed using a QuantStudio 3D digital PCR system (Thermo Fisher Scientific) and analyzed with QuantStudio 3D AnalysisSuite cloud software (Thermo Fisher Scientific).

    Techniques: Variant Assay, Knock-In, Produced, Mouse Assay, Cell Culture, Real-time Polymerase Chain Reaction

    A p62 splicing variant lacking the Keap1-interacting region is present in mice. (A) Schematic diagram of genome structures of mouse p62 . Coding exons, numbered in accordance with the initiation site (exon 1), are depicted by white boxes. The full-length mRNA and its splicing variant produced from the p62 allele are shown. wt, wild type. (B) Domain structures of mouse full-length and variant p62 proteins. Phox and Bem1 (PB1) mediates homo-oligomerization or hetero-oligomerization. The LC3-interacting region (LIR) and the C-terminal ubiquitin-associated (UBA) domain promote the sequestration of ubiquitinated substrates into the autophagosome. The Keap1-interacting region (KIR) binds to Keap1. ZZ, zinc finger; TB, TRAF6-binding domain; NLS, nuclear localization signal; NES, nuclear export signal. (C) Alignment of regions containing the LIR, the KIR, and the UBA domain in the full-length and variant p62 proteins of mice. (D) RT-PCR. Analyses of p62 exon 7 splicing in MEFs, Hepa-1 cells, and mouse liver were performed. Diagrams at left indicate cDNAs encoding full-length and variant p62 proteins. The positions of primers used for RT-PCR analysis of p62 cDNA and the expected sizes of the PCR products in the presence and absence of the last half of exon 7 are shown. The right panel shows the results of gel electrophoresis (2% agarose gel) of RT-PCR products from cDNAs of MEFs, Hepa-1 cells, and mouse liver. (E) Digital PCR analysis. RNA copy numbers for full-length p62 and its variant in MEFs, Hepa-1 cells, and mouse liver were determined using a QuantStudio 3D digital PCR system. (F) Immunoblot analysis. Total cell lysates of MEFs and Hepa-1 cells and mouse liver homogenate were prepared and subjected to immunoblot analysis with anti-p62 antibody. Nontagged full-length or variant p62 was expressed in p62 -deficient HeLa cells, and the lysates were used as positive controls. Data are representative of three independent experiments. Quantitative densitometry analysis of immunoblotting data was performed, and the levels of full-length p62 and its variant were normalized against that of actin. (G) Immunoblot analysis. Primary mouse hepatocytes were challenged with 10 μM sodium arsenite [As(III)] for the indicated times. Data are representative of three independent experiments. Quantitative densitometry analysis of immunoblotting data was performed, and the levels of full-length p62 and its variant were normalized against that of actin.

    Journal: Molecular and Cellular Biology

    Article Title: Negative Regulation of the Keap1-Nrf2 Pathway by a p62/Sqstm1 Splicing Variant

    doi: 10.1128/MCB.00642-17

    Figure Lengend Snippet: A p62 splicing variant lacking the Keap1-interacting region is present in mice. (A) Schematic diagram of genome structures of mouse p62 . Coding exons, numbered in accordance with the initiation site (exon 1), are depicted by white boxes. The full-length mRNA and its splicing variant produced from the p62 allele are shown. wt, wild type. (B) Domain structures of mouse full-length and variant p62 proteins. Phox and Bem1 (PB1) mediates homo-oligomerization or hetero-oligomerization. The LC3-interacting region (LIR) and the C-terminal ubiquitin-associated (UBA) domain promote the sequestration of ubiquitinated substrates into the autophagosome. The Keap1-interacting region (KIR) binds to Keap1. ZZ, zinc finger; TB, TRAF6-binding domain; NLS, nuclear localization signal; NES, nuclear export signal. (C) Alignment of regions containing the LIR, the KIR, and the UBA domain in the full-length and variant p62 proteins of mice. (D) RT-PCR. Analyses of p62 exon 7 splicing in MEFs, Hepa-1 cells, and mouse liver were performed. Diagrams at left indicate cDNAs encoding full-length and variant p62 proteins. The positions of primers used for RT-PCR analysis of p62 cDNA and the expected sizes of the PCR products in the presence and absence of the last half of exon 7 are shown. The right panel shows the results of gel electrophoresis (2% agarose gel) of RT-PCR products from cDNAs of MEFs, Hepa-1 cells, and mouse liver. (E) Digital PCR analysis. RNA copy numbers for full-length p62 and its variant in MEFs, Hepa-1 cells, and mouse liver were determined using a QuantStudio 3D digital PCR system. (F) Immunoblot analysis. Total cell lysates of MEFs and Hepa-1 cells and mouse liver homogenate were prepared and subjected to immunoblot analysis with anti-p62 antibody. Nontagged full-length or variant p62 was expressed in p62 -deficient HeLa cells, and the lysates were used as positive controls. Data are representative of three independent experiments. Quantitative densitometry analysis of immunoblotting data was performed, and the levels of full-length p62 and its variant were normalized against that of actin. (G) Immunoblot analysis. Primary mouse hepatocytes were challenged with 10 μM sodium arsenite [As(III)] for the indicated times. Data are representative of three independent experiments. Quantitative densitometry analysis of immunoblotting data was performed, and the levels of full-length p62 and its variant were normalized against that of actin.

    Article Snippet: cDNA was synthesized as described in “Reverse transcriptase PCR and quantitative real-time PCR.” Absolute quantification was performed using a QuantStudio 3D digital PCR system (Thermo Fisher Scientific) and analyzed with QuantStudio 3D AnalysisSuite cloud software (Thermo Fisher Scientific).

    Techniques: Variant Assay, Mouse Assay, Produced, Binding Assay, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Nucleic Acid Electrophoresis, Agarose Gel Electrophoresis, Digital PCR

    Expression of acTLR5 transcript in multiple tissues of A. carolinensis . RT-PCR analysis on total RNA extracted from the indicated tissues of an A. carolinensis lizard after reverse transcription into cDNA (+) or without the reverse transcription step (−). PCR amplified a 216 bp (base pair) fragment of ac tlr5 or (as control) a 374 bp fragment of A. carolinensis glyceraldehyde 3-phosphate dehydrogenase (ac gapdh ).

    Journal: Scientific Reports

    Article Title: Reptile Toll-like receptor 5 unveils adaptive evolution of bacterial flagellin recognition

    doi: 10.1038/srep19046

    Figure Lengend Snippet: Expression of acTLR5 transcript in multiple tissues of A. carolinensis . RT-PCR analysis on total RNA extracted from the indicated tissues of an A. carolinensis lizard after reverse transcription into cDNA (+) or without the reverse transcription step (−). PCR amplified a 216 bp (base pair) fragment of ac tlr5 or (as control) a 374 bp fragment of A. carolinensis glyceraldehyde 3-phosphate dehydrogenase (ac gapdh ).

    Article Snippet: Reverse transcriptase PCR on actlr5 mRNA from various tissues First strand cDNA was created of 1 μg total RNA with oligo (dT)18 primers using the RevertAid First Strand cDNA Synthesis kit (Thermo Scientific).

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Amplification