Structured Review

Thermo Fisher m dtt
Variations in the patterns of inhibition of GSH- or <t>DTT-catalyzed</t> T 4 to T 3 conversion by P135S <t>D2</t> using PTU. A, Competitive inhibition of DTT by PTU at a fixed T 4 concentration (3 μ m ). B, Uncompetitive inhibition of T 4 deiodination catalyzed by
M Dtt, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 50 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/m dtt/product/Thermo Fisher
Average 99 stars, based on 50 article reviews
Price from $9.99 to $1999.99
m dtt - by Bioz Stars, 2020-03
99/100 stars

Images

1) Product Images from "Substitution of Serine for Proline in the Active Center of Type 2 Iodothyronine Deiodinase Substantially Alters Its in Vitro Biochemical Properties with Dithiothreitol But Not Its Function in Intact Cells"

Article Title: Substitution of Serine for Proline in the Active Center of Type 2 Iodothyronine Deiodinase Substantially Alters Its in Vitro Biochemical Properties with Dithiothreitol But Not Its Function in Intact Cells

Journal: Endocrinology

doi: 10.1210/en.2009-0980

Variations in the patterns of inhibition of GSH- or DTT-catalyzed T 4 to T 3 conversion by P135S D2 using PTU. A, Competitive inhibition of DTT by PTU at a fixed T 4 concentration (3 μ m ). B, Uncompetitive inhibition of T 4 deiodination catalyzed by
Figure Legend Snippet: Variations in the patterns of inhibition of GSH- or DTT-catalyzed T 4 to T 3 conversion by P135S D2 using PTU. A, Competitive inhibition of DTT by PTU at a fixed T 4 concentration (3 μ m ). B, Uncompetitive inhibition of T 4 deiodination catalyzed by

Techniques Used: Inhibition, Concentration Assay

Lineweaver-Burk plots comparing wt D2 and D2 P135S kinetics with respect to T 4 using DTT or GSH as cofactor. A, Double-reciprocal plot of wt D2 activity using DTT 20 m m as cofactor and varying T 4 concentrations. B, Double-reciprocal plot of wt D2 activity
Figure Legend Snippet: Lineweaver-Burk plots comparing wt D2 and D2 P135S kinetics with respect to T 4 using DTT or GSH as cofactor. A, Double-reciprocal plot of wt D2 activity using DTT 20 m m as cofactor and varying T 4 concentrations. B, Double-reciprocal plot of wt D2 activity

Techniques Used: Activity Assay

2) Product Images from "Polysulfides Link H2S to Protein Thiol Oxidation"

Article Title: Polysulfides Link H2S to Protein Thiol Oxidation

Journal: Antioxidants & Redox Signaling

doi: 10.1089/ars.2012.5041

Polysulfides inhibit PTEN by sulfane sulfur addition. (A) Recombinant PTEN-WT was prereduced with 20 m M DTT for 10 min, followed by buffer exchange into a nonreducing PTEN assay buffer and exposure to 100 μ M H 2 O 2 or NaHS
Figure Legend Snippet: Polysulfides inhibit PTEN by sulfane sulfur addition. (A) Recombinant PTEN-WT was prereduced with 20 m M DTT for 10 min, followed by buffer exchange into a nonreducing PTEN assay buffer and exposure to 100 μ M H 2 O 2 or NaHS

Techniques Used: Recombinant, Buffer Exchange

3) Product Images from "Polysulfides Link H2S to Protein Thiol Oxidation"

Article Title: Polysulfides Link H2S to Protein Thiol Oxidation

Journal: Antioxidants & Redox Signaling

doi: 10.1089/ars.2012.5041

Polysulfides inhibit PTEN by sulfane sulfur addition. (A) Recombinant PTEN-WT was prereduced with 20 m M DTT for 10 min, followed by buffer exchange into a nonreducing PTEN assay buffer and exposure to 100 μ M H 2 O 2 or NaHS
Figure Legend Snippet: Polysulfides inhibit PTEN by sulfane sulfur addition. (A) Recombinant PTEN-WT was prereduced with 20 m M DTT for 10 min, followed by buffer exchange into a nonreducing PTEN assay buffer and exposure to 100 μ M H 2 O 2 or NaHS

Techniques Used: Recombinant, Buffer Exchange

Related Articles

Clone Assay:

Article Title: Gadd45a Is an RNA Binding Protein and Is Localized in Nuclear Speckles
Article Snippet: Recombinant proteins used were bovine serum albumin (Fraction V, Sigma), His-Gadd45a and M-MLV-reverse transcriptase (Invitrogen). .. In reactions without competitor, 2.5 or 1.3 µM recombinant proteins were preincubated for 20 min with 10,000 cpm (approximately 2 ng) of 32 P-labelled multiple cloning site (MCS) RNA of pCS2 and pXT1 plasmids.

Article Title: Characterization of LINE-1 Ribonucleoprotein Particles
Article Snippet: For analysis, 1 µL of LEAP or M-MLV RT products was added to 19 µL of master mix (1X SYBR Green PCR Master Mix (Applied Biosystems), 500 nM L1 3′ end primer, and 500 nM L1 Reverse primer), and amplified in a standard Q-PCR run of 45 cycles. .. A standard curve was generated using dilutions of a L1 LEAP product cloned into a plasmid, and a best fit line (log(molecules) versus average Ct value) for these standards was generated by linear regression.

Centrifugation:

Article Title: Evaluation of neural gene expression in serum treated embryonic stem cells in Alzheimer's patients
Article Snippet: .. Quantitative real-time polymerase chain reaction analysis Cells were collected by centrifugation and total RNA was extracted by RNeasy mini kit (Qiagen) and then treated with DNase I (Fermentas) to avoid any DNA contamination (cDNA) and was synthesized using Moloney Murine Leukemia Virus (MMLV) Reverse Transcriptase according to the manufacture protocol (Fermentas). cDNA synthesis was performed using MMLV Reverse Transcriptase and random hexamer primer according to the manufacturer protocol (Fermentas). .. Real-time PCR was carried out in a thermal cycler Rotor gene 6000 (Corbett).

Amplification:

Article Title: The pp24 phosphoprotein of Mason-Pfizer monkey virus contributes to viral genome packaging
Article Snippet: 5 μl of diluted RNA was used for first-strand cDNA synthesis as per manufacturers suggestions for M-MLV RT (Invitrogen) using 500 ng of oligo (dT)12–18 (Ambion, Austin, TX). .. First-strand cDNA (5 μl) were amplified by PCR using the following oligos 5'-CCGCTCGAGCGGGCCGCCATGCCGGTGGCTGAAACCGTTG and 5'-GCTCTAGAGCGGCGGCCATGGCCAGG to amplify M-PMV CA sequences.

Article Title: Increased Expression of Pregnancy Up-Regulated Non-Ubiquitous Calmodulin Kinase Is Associated with Poor Prognosis in Clear Cell Renal Cell Carcinoma
Article Snippet: The first-strand cDNA, synthesized from 2 µg of total RNA using M-MLV reverse transcriptase (Fermentas; American), was then subjected to real-time quantitative PCR after the DNA contamination being removed by RNase-free DNase. .. The primer pairs used for RT-PCR amplification of the relative mRNA of PNCK and GAPDH (as an internal control) were as follows: PNCK sense strand: 5′-TATGCCACGCCCTTTGAG-3′ , PNCK antisense strand: 5′-CACAGCAGGATGTAGGAGATGA-3′ , GAPDH sense strand: 5′-GCTCTCTGCTCCTCCTGTTC-3′ , GAPDH antisense strand: 5′-GACTCCGACCTTCACCTTCC-3′ .

Article Title: Splicing of constitutive upstream introns is essential for the recognition of intra-exonic suboptimal splice sites in the thrombopoietin gene
Article Snippet: .. Poly(dT) cDNA was synthesized using MMLV reverse transcriptase (Gibco BRL) and was amplified with the above mentioned oligos for 35 cycles (30 s at 94°C, 30 s at 62°C, 1 min at 72°C), using 2 U of Taq DNA polymerase (Roche Diagnostic). .. Both the TPO gene and the TPO cDNA were digested with Kpn I and Not I restriction enzymes and ligated into pcDNA 3 eukaryotic expression vector (Invitrogen) Kpn I/ Not I cut, generating the parental constructs TPO gene and TPO cDNA.

Article Title: Characterization of LINE-1 Ribonucleoprotein Particles
Article Snippet: Quantitative real-time PCR Quantitative PCR was performed on LEAP cDNA samples or M-MLV RT-PCR products using the 7300 Real Time PCR system (Applied Biosystems). .. For analysis, 1 µL of LEAP or M-MLV RT products was added to 19 µL of master mix (1X SYBR Green PCR Master Mix (Applied Biosystems), 500 nM L1 3′ end primer, and 500 nM L1 Reverse primer), and amplified in a standard Q-PCR run of 45 cycles.

Article Title: Characterization of LINE-1 Ribonucleoprotein Particles
Article Snippet: .. For analysis, 1 µL of LEAP or M-MLV RT products was added to 19 µL of master mix (1X SYBR Green PCR Master Mix (Applied Biosystems), 500 nM L1 3′ end primer, and 500 nM L1 Reverse primer), and amplified in a standard Q-PCR run of 45 cycles. ..

Article Title: mir-21 Overexpressing Mesenchymal Stem Cells Accelerate Fracture Healing in a Rat Closed Femur Fracture Model
Article Snippet: RNA Extraction and Quantitative Real-Time PCR Total cellular RNA was isolated with RNA Mini Kit (Invitrogen) and then reverse-transcribed into cDNA using M-MLV Reverse Transcriptase (Invitrogen) according to the manufacturer's instructions. .. Amplification conditions were as follows: first at 95°C for 5 min and then 40 cycles of 95°C for 15 s and 60°C for 60 s. Primer sequences were listed in Supplementary Table 1 in Supplementary Material available online at http://dx.doi.org/10.1155/2015/412327 .

Article Title: Functional Domains of Tat Required for Efficient Human Immunodeficiency Virus Type 1 Reverse Transcription †
Article Snippet: The reverse transcription reactions were amplified by PCR with primer pairs specific for tRNA3 Lys (5′-ATAGCTCAGTCGGTAGAGCAT [sense] and 5′-GCCGAACAGGGACTTGAT [antisense]) and HIV-1 genomic RNA (5′-CAAGTAGTGTGTGCCCGTCTGTT [sense] and 5′-CGAGAGAGCTCCTCTGGTTCTAC [antisense]). .. Total viral RNA was annealed to an oligonucleotide (5′-GACTGCGAATCGTTCTAG-3′, antisense) complementary to sequences in the gag open reading frame at 75°C for 10 min and placed on ice, and cDNA was made by using the supplied buffers, 0.2 mM dNTPs, and M-MLV RT (Life Technologies) at 37°C for 60 min. Each cDNA reaction was assayed by PCR for the internal control (IC) cDNA (reverse transcribed from IC RNA) by using a 32 P-labeled oligonucleotide specific for pGem4z sequences (5′-GGGAGACAAGCTTGCATGCCTG, sense) and an unlabeled HIV-1-specific oligonucleotide (5′-GCAGTGGGTTCCCTAGTTAGC, antisense) for 25 cycles at 93°C for 1 min and 65°C for 2 min.

Synthesized:

Article Title: Inhibition of BRCA2 and Thymidylate Synthase Creates Multidrug Sensitive Tumor Cells via the Induction of Combined "Complementary Lethality"
Article Snippet: A549 cells were transfected with BR-1, SARI 83, and control ASOs (synthesized by Eurogentec, Seraing, Belgium) according to the same protocol outlined for siRNA; however, they were used at 20 nmol/l each (for a total concentration of 40 nmol/l). siRNA-mediated reduction of target mRNAs in A549 cells. .. Twenty-four hours after transfection of siRNA, RNA was isolated from cells using Trizol reagent according to manufacturer's instructions (Ambion—Life Technologies) and reverse-transcribed to generate cDNA using M-MLV RT enzyme (Invitrogen—Life Technologies). cDNA (1 µg) was used in conjunction with BRCA2, TS, and 18S rRNA qPCR probe and primers and Taqman master mix (Applied Biosystems—Life Technologies) to generate fluorescently labeled target cDNA.

Article Title: Increased Expression of Pregnancy Up-Regulated Non-Ubiquitous Calmodulin Kinase Is Associated with Poor Prognosis in Clear Cell Renal Cell Carcinoma
Article Snippet: .. The first-strand cDNA, synthesized from 2 µg of total RNA using M-MLV reverse transcriptase (Fermentas; American), was then subjected to real-time quantitative PCR after the DNA contamination being removed by RNase-free DNase. .. The primer pairs used for RT-PCR amplification of the relative mRNA of PNCK and GAPDH (as an internal control) were as follows: PNCK sense strand: 5′-TATGCCACGCCCTTTGAG-3′ , PNCK antisense strand: 5′-CACAGCAGGATGTAGGAGATGA-3′ , GAPDH sense strand: 5′-GCTCTCTGCTCCTCCTGTTC-3′ , GAPDH antisense strand: 5′-GACTCCGACCTTCACCTTCC-3′ .

Article Title: Splicing of constitutive upstream introns is essential for the recognition of intra-exonic suboptimal splice sites in the thrombopoietin gene
Article Snippet: .. Poly(dT) cDNA was synthesized using MMLV reverse transcriptase (Gibco BRL) and was amplified with the above mentioned oligos for 35 cycles (30 s at 94°C, 30 s at 62°C, 1 min at 72°C), using 2 U of Taq DNA polymerase (Roche Diagnostic). .. Both the TPO gene and the TPO cDNA were digested with Kpn I and Not I restriction enzymes and ligated into pcDNA 3 eukaryotic expression vector (Invitrogen) Kpn I/ Not I cut, generating the parental constructs TPO gene and TPO cDNA.

Article Title: Validation of Housekeeping Genes as Reference for Reverse-Transcription-qPCR Analysis in Busulfan-Injured Microvascular Endothelial Cells
Article Snippet: Complementary DNA (cDNA) Synthesis The intact RNA was reverse transcriptase at once after isolation using Invitrogen reagent M-MLV. .. All cDNA was synthesized from 300ng isolated RNA sample in a total volume of 20μ L and kept at -20°C until ready for use.

Article Title: Evaluation of neural gene expression in serum treated embryonic stem cells in Alzheimer's patients
Article Snippet: .. Quantitative real-time polymerase chain reaction analysis Cells were collected by centrifugation and total RNA was extracted by RNeasy mini kit (Qiagen) and then treated with DNase I (Fermentas) to avoid any DNA contamination (cDNA) and was synthesized using Moloney Murine Leukemia Virus (MMLV) Reverse Transcriptase according to the manufacture protocol (Fermentas). cDNA synthesis was performed using MMLV Reverse Transcriptase and random hexamer primer according to the manufacturer protocol (Fermentas). .. Real-time PCR was carried out in a thermal cycler Rotor gene 6000 (Corbett).

Quantitative RT-PCR:

Article Title: Increased Expression of Pregnancy Up-Regulated Non-Ubiquitous Calmodulin Kinase Is Associated with Poor Prognosis in Clear Cell Renal Cell Carcinoma
Article Snippet: Paragraph title: Real-time RT-PCR ... The first-strand cDNA, synthesized from 2 µg of total RNA using M-MLV reverse transcriptase (Fermentas; American), was then subjected to real-time quantitative PCR after the DNA contamination being removed by RNase-free DNase.

SYBR Green Assay:

Article Title: Increased Expression of Pregnancy Up-Regulated Non-Ubiquitous Calmodulin Kinase Is Associated with Poor Prognosis in Clear Cell Renal Cell Carcinoma
Article Snippet: The first-strand cDNA, synthesized from 2 µg of total RNA using M-MLV reverse transcriptase (Fermentas; American), was then subjected to real-time quantitative PCR after the DNA contamination being removed by RNase-free DNase. .. Applied Biosystems (ABI 7000) real-time PCR machine was used for Gene-specific amplification, with a 20-µl PCR reaction mixture containing 1 µl of cDNA (synthesized as described above), 10-µl SYBR Green master mix (Invitrogen; Carlsbad, CA), and 40 nM of each pair of oligonucleotide primers.

Article Title: Characterization of LINE-1 Ribonucleoprotein Particles
Article Snippet: Quantitative real-time PCR Quantitative PCR was performed on LEAP cDNA samples or M-MLV RT-PCR products using the 7300 Real Time PCR system (Applied Biosystems). .. For analysis, 1 µL of LEAP or M-MLV RT products was added to 19 µL of master mix (1X SYBR Green PCR Master Mix (Applied Biosystems), 500 nM L1 3′ end primer, and 500 nM L1 Reverse primer), and amplified in a standard Q-PCR run of 45 cycles.

Article Title: Evaluation of neural gene expression in serum treated embryonic stem cells in Alzheimer's patients
Article Snippet: Quantitative real-time polymerase chain reaction analysis Cells were collected by centrifugation and total RNA was extracted by RNeasy mini kit (Qiagen) and then treated with DNase I (Fermentas) to avoid any DNA contamination (cDNA) and was synthesized using Moloney Murine Leukemia Virus (MMLV) Reverse Transcriptase according to the manufacture protocol (Fermentas). cDNA synthesis was performed using MMLV Reverse Transcriptase and random hexamer primer according to the manufacturer protocol (Fermentas). .. The PCR mixture contained 10 μl Rotor-Gene SYBR Green PCR Master Mix (TaKaRa), 5 pM of each primer, and 50 ng cDNA for each reaction in final volume of 20 μl.

Article Title: Regulation of host gene expression by HIV-1 TAR microRNAs
Article Snippet: Reverse transcription and quantitative PCR analysis RNA was treated with Turbo™ DNAse (Life Technologies) for 30 minutes at 37°C and reverse transcribed (RT) with random primers and the M-MLV reverse transcriptase enzyme (Invitrogen), according to the manufacturer’s instructions. .. Quantitative PCR (qPCR) using IQ™ SYBR® green supermix (Bio-Rad) and listed primers sets (Additional file ) was performed in a C1000 thermal cycler with a CFX96 Real-Time system (Bio-Rad).

Article Title: Characterization of LINE-1 Ribonucleoprotein Particles
Article Snippet: .. For analysis, 1 µL of LEAP or M-MLV RT products was added to 19 µL of master mix (1X SYBR Green PCR Master Mix (Applied Biosystems), 500 nM L1 3′ end primer, and 500 nM L1 Reverse primer), and amplified in a standard Q-PCR run of 45 cycles. ..

Article Title: mir-21 Overexpressing Mesenchymal Stem Cells Accelerate Fracture Healing in a Rat Closed Femur Fracture Model
Article Snippet: RNA Extraction and Quantitative Real-Time PCR Total cellular RNA was isolated with RNA Mini Kit (Invitrogen) and then reverse-transcribed into cDNA using M-MLV Reverse Transcriptase (Invitrogen) according to the manufacturer's instructions. .. The reaction conditions consisted of 15 μ L reaction volumes with diluted cDNA template 3 μ L, 7.5 μ L SYBR-Green Master Mix (2×), 3.9 μ L PCR-grade water, and 0.3 μ L of each primer (10 μ M).

Incubation:

Article Title: Inhibition of BRCA2 and Thymidylate Synthase Creates Multidrug Sensitive Tumor Cells via the Induction of Combined "Complementary Lethality"
Article Snippet: BRCA2 siRNA (10 nmol/l and 2.5 nmol/l control nontargeting siRNA), TS siRNA (2.5 nmol/l and 10 nmol/l control nontargeting siRNA), for BRCA2 siRNA and TS siRNA (10 nmol/l and 2.5 nmol/l, respectively) were diluted in serum-free AMEM and incubated with diluted Lipofectamine 2000 (LFA2K, Invitrogen—Life Technologies) for 20 min. .. Twenty-four hours after transfection of siRNA, RNA was isolated from cells using Trizol reagent according to manufacturer's instructions (Ambion—Life Technologies) and reverse-transcribed to generate cDNA using M-MLV RT enzyme (Invitrogen—Life Technologies). cDNA (1 µg) was used in conjunction with BRCA2, TS, and 18S rRNA qPCR probe and primers and Taqman master mix (Applied Biosystems—Life Technologies) to generate fluorescently labeled target cDNA.

Article Title: Validation of Housekeeping Genes as Reference for Reverse-Transcription-qPCR Analysis in Busulfan-Injured Microvascular Endothelial Cells
Article Snippet: Complementary DNA (cDNA) Synthesis The intact RNA was reverse transcriptase at once after isolation using Invitrogen reagent M-MLV. .. The transcription mixture of 0.1M DTT, 50,000U M-mlv, and 5x-strand buffer was then incubated at 37°C for 50 minutes, at 70°C for 5 minutes and extended temperature of 4°C.

Expressing:

Article Title: Splicing of constitutive upstream introns is essential for the recognition of intra-exonic suboptimal splice sites in the thrombopoietin gene
Article Snippet: Poly(dT) cDNA was synthesized using MMLV reverse transcriptase (Gibco BRL) and was amplified with the above mentioned oligos for 35 cycles (30 s at 94°C, 30 s at 62°C, 1 min at 72°C), using 2 U of Taq DNA polymerase (Roche Diagnostic). .. Both the TPO gene and the TPO cDNA were digested with Kpn I and Not I restriction enzymes and ligated into pcDNA 3 eukaryotic expression vector (Invitrogen) Kpn I/ Not I cut, generating the parental constructs TPO gene and TPO cDNA.

Article Title: Evaluation of neural gene expression in serum treated embryonic stem cells in Alzheimer's patients
Article Snippet: Quantitative real-time polymerase chain reaction analysis Cells were collected by centrifugation and total RNA was extracted by RNeasy mini kit (Qiagen) and then treated with DNase I (Fermentas) to avoid any DNA contamination (cDNA) and was synthesized using Moloney Murine Leukemia Virus (MMLV) Reverse Transcriptase according to the manufacture protocol (Fermentas). cDNA synthesis was performed using MMLV Reverse Transcriptase and random hexamer primer according to the manufacturer protocol (Fermentas). .. All samples were assessed according to the level of β-tubulin expression, as internal control.

Western Blot:

Article Title: The pp24 phosphoprotein of Mason-Pfizer monkey virus contributes to viral genome packaging
Article Snippet: The amount of viral particles was normalized by quantitation of p27 detected by immunobloting. .. 5 μl of diluted RNA was used for first-strand cDNA synthesis as per manufacturers suggestions for M-MLV RT (Invitrogen) using 500 ng of oligo (dT)12–18 (Ambion, Austin, TX).

RNA Binding Assay:

Article Title: Gadd45a Is an RNA Binding Protein and Is Localized in Nuclear Speckles
Article Snippet: Recombinant proteins used were bovine serum albumin (Fraction V, Sigma), His-Gadd45a and M-MLV-reverse transcriptase (Invitrogen). .. Binding reactions were performed in RNA binding buffer (10 mM Tris-HCl (pH 7.4), 10 mM KCl, 1 mM MgCl2 ).

Countercurrent Chromatography:

Article Title: Gene structure and expression profile of Manduca sexta prophenoloxidase-activating proteinase-3 (PAP-3), an immune protein containing two clip domains
Article Snippet: First-strand cDNA synthesis was performed using 2–4 µg RNA, 10 pmol oligo(dT)17 , and 200 U MMLV reverse transcriptase (Invitrogen Life Technologies) at 37 °C for 1 h. M. sexta ribosomal protein S3 transcripts were used as an internal standard to control the template amount in a preliminary PCR experiment. .. Relative levels of PAP-3 cDNA in the normalized samples were determined by semiquantitative PCR using j699 (5′-CGT GTT GTT ATT AGC TTC GTA TTT CT-3′) and j700 (5′-CAT CCC CCC AGC CTC TAC-3′ for PAP-3′.

Transfection:

Article Title: The pp24 phosphoprotein of Mason-Pfizer monkey virus contributes to viral genome packaging
Article Snippet: RNA extraction and RT-PCR Medium from transfected COS-1 cells were clarified and virus was pelleted through a 20% sucrose cushion at 207,570 × g in an SW41 rotor for 2 hours at 4°C and resuspended in 30 μl of PBS. .. 5 μl of diluted RNA was used for first-strand cDNA synthesis as per manufacturers suggestions for M-MLV RT (Invitrogen) using 500 ng of oligo (dT)12–18 (Ambion, Austin, TX).

Article Title: Inhibition of BRCA2 and Thymidylate Synthase Creates Multidrug Sensitive Tumor Cells via the Induction of Combined "Complementary Lethality"
Article Snippet: .. Twenty-four hours after transfection of siRNA, RNA was isolated from cells using Trizol reagent according to manufacturer's instructions (Ambion—Life Technologies) and reverse-transcribed to generate cDNA using M-MLV RT enzyme (Invitrogen—Life Technologies). cDNA (1 µg) was used in conjunction with BRCA2, TS, and 18S rRNA qPCR probe and primers and Taqman master mix (Applied Biosystems—Life Technologies) to generate fluorescently labeled target cDNA. .. Quantification of cDNA to infer levels of TS and BRCA2 mRNAs and 18S rRNA was performed using a Perkin Elmer ViiA 7 Real-time PCR System (Life Technologies).

Reverse Transcription Polymerase Chain Reaction:

Article Title: The pp24 phosphoprotein of Mason-Pfizer monkey virus contributes to viral genome packaging
Article Snippet: Paragraph title: RNA extraction and RT-PCR ... 5 μl of diluted RNA was used for first-strand cDNA synthesis as per manufacturers suggestions for M-MLV RT (Invitrogen) using 500 ng of oligo (dT)12–18 (Ambion, Austin, TX).

Article Title: Increased Expression of Pregnancy Up-Regulated Non-Ubiquitous Calmodulin Kinase Is Associated with Poor Prognosis in Clear Cell Renal Cell Carcinoma
Article Snippet: The first-strand cDNA, synthesized from 2 µg of total RNA using M-MLV reverse transcriptase (Fermentas; American), was then subjected to real-time quantitative PCR after the DNA contamination being removed by RNase-free DNase. .. The primer pairs used for RT-PCR amplification of the relative mRNA of PNCK and GAPDH (as an internal control) were as follows: PNCK sense strand: 5′-TATGCCACGCCCTTTGAG-3′ , PNCK antisense strand: 5′-CACAGCAGGATGTAGGAGATGA-3′ , GAPDH sense strand: 5′-GCTCTCTGCTCCTCCTGTTC-3′ , GAPDH antisense strand: 5′-GACTCCGACCTTCACCTTCC-3′ .

Article Title: Splicing of constitutive upstream introns is essential for the recognition of intra-exonic suboptimal splice sites in the thrombopoietin gene
Article Snippet: The human TPO cDNA (1109 bp) was amplified by RT–PCR using as template total RNA extracted from human peripheral blood leukocytes. .. Poly(dT) cDNA was synthesized using MMLV reverse transcriptase (Gibco BRL) and was amplified with the above mentioned oligos for 35 cycles (30 s at 94°C, 30 s at 62°C, 1 min at 72°C), using 2 U of Taq DNA polymerase (Roche Diagnostic).

Article Title: Characterization of LINE-1 Ribonucleoprotein Particles
Article Snippet: .. Quantitative real-time PCR Quantitative PCR was performed on LEAP cDNA samples or M-MLV RT-PCR products using the 7300 Real Time PCR system (Applied Biosystems). .. For analysis, 1 µL of LEAP or M-MLV RT products was added to 19 µL of master mix (1X SYBR Green PCR Master Mix (Applied Biosystems), 500 nM L1 3′ end primer, and 500 nM L1 Reverse primer), and amplified in a standard Q-PCR run of 45 cycles.

Article Title: Selective control of primer usage in multiplex one-step reverse transcription PCR
Article Snippet: Paragraph title: One-step RT-PCR (quantitative real-time) ... M-MLV reverse transcriptase (25 U) (Invitrogen) and Taq DNA polymerase (2.5 U) (Invitrogen) were used in all quantitative real-time experiments.

Article Title: Gene structure and expression profile of Manduca sexta prophenoloxidase-activating proteinase-3 (PAP-3), an immune protein containing two clip domains
Article Snippet: Paragraph title: RNA extraction and RT-PCR analysis ... First-strand cDNA synthesis was performed using 2–4 µg RNA, 10 pmol oligo(dT)17 , and 200 U MMLV reverse transcriptase (Invitrogen Life Technologies) at 37 °C for 1 h. M. sexta ribosomal protein S3 transcripts were used as an internal standard to control the template amount in a preliminary PCR experiment.

Article Title: Characterization of LINE-1 Ribonucleoprotein Particles
Article Snippet: Quantitative real-time PCR Quantitative PCR was performed on LEAP cDNA samples or M-MLV RT-PCR products using the 7300 Real Time PCR system (Applied Biosystems). .. For analysis, 1 µL of LEAP or M-MLV RT products was added to 19 µL of master mix (1X SYBR Green PCR Master Mix (Applied Biosystems), 500 nM L1 3′ end primer, and 500 nM L1 Reverse primer), and amplified in a standard Q-PCR run of 45 cycles.

Article Title: Functional Domains of Tat Required for Efficient Human Immunodeficiency Virus Type 1 Reverse Transcription †
Article Snippet: Paragraph title: PCR and RT-PCR analysis. ... Total viral RNA was annealed to an oligonucleotide (5′-GACTGCGAATCGTTCTAG-3′, antisense) complementary to sequences in the gag open reading frame at 75°C for 10 min and placed on ice, and cDNA was made by using the supplied buffers, 0.2 mM dNTPs, and M-MLV RT (Life Technologies) at 37°C for 60 min. Each cDNA reaction was assayed by PCR for the internal control (IC) cDNA (reverse transcribed from IC RNA) by using a 32 P-labeled oligonucleotide specific for pGem4z sequences (5′-GGGAGACAAGCTTGCATGCCTG, sense) and an unlabeled HIV-1-specific oligonucleotide (5′-GCAGTGGGTTCCCTAGTTAGC, antisense) for 25 cycles at 93°C for 1 min and 65°C for 2 min.

Generated:

Article Title: Characterization of LINE-1 Ribonucleoprotein Particles
Article Snippet: For analysis, 1 µL of LEAP or M-MLV RT products was added to 19 µL of master mix (1X SYBR Green PCR Master Mix (Applied Biosystems), 500 nM L1 3′ end primer, and 500 nM L1 Reverse primer), and amplified in a standard Q-PCR run of 45 cycles. .. A standard curve was generated using dilutions of a L1 LEAP product cloned into a plasmid, and a best fit line (log(molecules) versus average Ct value) for these standards was generated by linear regression.

Polymerase Chain Reaction:

Article Title: The pp24 phosphoprotein of Mason-Pfizer monkey virus contributes to viral genome packaging
Article Snippet: 5 μl of diluted RNA was used for first-strand cDNA synthesis as per manufacturers suggestions for M-MLV RT (Invitrogen) using 500 ng of oligo (dT)12–18 (Ambion, Austin, TX). .. First-strand cDNA (5 μl) were amplified by PCR using the following oligos 5'-CCGCTCGAGCGGGCCGCCATGCCGGTGGCTGAAACCGTTG and 5'-GCTCTAGAGCGGCGGCCATGGCCAGG to amplify M-PMV CA sequences.

Article Title: Increased Expression of Pregnancy Up-Regulated Non-Ubiquitous Calmodulin Kinase Is Associated with Poor Prognosis in Clear Cell Renal Cell Carcinoma
Article Snippet: The first-strand cDNA, synthesized from 2 µg of total RNA using M-MLV reverse transcriptase (Fermentas; American), was then subjected to real-time quantitative PCR after the DNA contamination being removed by RNase-free DNase. .. Applied Biosystems (ABI 7000) real-time PCR machine was used for Gene-specific amplification, with a 20-µl PCR reaction mixture containing 1 µl of cDNA (synthesized as described above), 10-µl SYBR Green master mix (Invitrogen; Carlsbad, CA), and 40 nM of each pair of oligonucleotide primers.

Article Title: Characterization of LINE-1 Ribonucleoprotein Particles
Article Snippet: Quantitative real-time PCR Quantitative PCR was performed on LEAP cDNA samples or M-MLV RT-PCR products using the 7300 Real Time PCR system (Applied Biosystems). .. For analysis, 1 µL of LEAP or M-MLV RT products was added to 19 µL of master mix (1X SYBR Green PCR Master Mix (Applied Biosystems), 500 nM L1 3′ end primer, and 500 nM L1 Reverse primer), and amplified in a standard Q-PCR run of 45 cycles.

Article Title: Validation of Housekeeping Genes as Reference for Reverse-Transcription-qPCR Analysis in Busulfan-Injured Microvascular Endothelial Cells
Article Snippet: Complementary DNA (cDNA) Synthesis The intact RNA was reverse transcriptase at once after isolation using Invitrogen reagent M-MLV. .. Firstly, the RNA was transcribed into first cDNA, using 10μ m oligonucleotide dT primer; 10mM dNTP and DEPC-treated water were combined together and preserved at 65°C for 10 minutes with extended temperature of 4°C in the conventional PCR.

Article Title: Evaluation of neural gene expression in serum treated embryonic stem cells in Alzheimer's patients
Article Snippet: Quantitative real-time polymerase chain reaction analysis Cells were collected by centrifugation and total RNA was extracted by RNeasy mini kit (Qiagen) and then treated with DNase I (Fermentas) to avoid any DNA contamination (cDNA) and was synthesized using Moloney Murine Leukemia Virus (MMLV) Reverse Transcriptase according to the manufacture protocol (Fermentas). cDNA synthesis was performed using MMLV Reverse Transcriptase and random hexamer primer according to the manufacturer protocol (Fermentas). .. The PCR mixture contained 10 μl Rotor-Gene SYBR Green PCR Master Mix (TaKaRa), 5 pM of each primer, and 50 ng cDNA for each reaction in final volume of 20 μl.

Article Title: Gene structure and expression profile of Manduca sexta prophenoloxidase-activating proteinase-3 (PAP-3), an immune protein containing two clip domains
Article Snippet: .. First-strand cDNA synthesis was performed using 2–4 µg RNA, 10 pmol oligo(dT)17 , and 200 U MMLV reverse transcriptase (Invitrogen Life Technologies) at 37 °C for 1 h. M. sexta ribosomal protein S3 transcripts were used as an internal standard to control the template amount in a preliminary PCR experiment. .. Relative levels of PAP-3 cDNA in the normalized samples were determined by semiquantitative PCR using j699 (5′-CGT GTT GTT ATT AGC TTC GTA TTT CT-3′) and j700 (5′-CAT CCC CCC AGC CTC TAC-3′ for PAP-3′.

Article Title: Characterization of LINE-1 Ribonucleoprotein Particles
Article Snippet: .. For analysis, 1 µL of LEAP or M-MLV RT products was added to 19 µL of master mix (1X SYBR Green PCR Master Mix (Applied Biosystems), 500 nM L1 3′ end primer, and 500 nM L1 Reverse primer), and amplified in a standard Q-PCR run of 45 cycles. ..

Article Title: mir-21 Overexpressing Mesenchymal Stem Cells Accelerate Fracture Healing in a Rat Closed Femur Fracture Model
Article Snippet: RNA Extraction and Quantitative Real-Time PCR Total cellular RNA was isolated with RNA Mini Kit (Invitrogen) and then reverse-transcribed into cDNA using M-MLV Reverse Transcriptase (Invitrogen) according to the manufacturer's instructions. .. The reaction conditions consisted of 15 μ L reaction volumes with diluted cDNA template 3 μ L, 7.5 μ L SYBR-Green Master Mix (2×), 3.9 μ L PCR-grade water, and 0.3 μ L of each primer (10 μ M).

Article Title: Functional Domains of Tat Required for Efficient Human Immunodeficiency Virus Type 1 Reverse Transcription †
Article Snippet: .. Total viral RNA was annealed to an oligonucleotide (5′-GACTGCGAATCGTTCTAG-3′, antisense) complementary to sequences in the gag open reading frame at 75°C for 10 min and placed on ice, and cDNA was made by using the supplied buffers, 0.2 mM dNTPs, and M-MLV RT (Life Technologies) at 37°C for 60 min. Each cDNA reaction was assayed by PCR for the internal control (IC) cDNA (reverse transcribed from IC RNA) by using a 32 P-labeled oligonucleotide specific for pGem4z sequences (5′-GGGAGACAAGCTTGCATGCCTG, sense) and an unlabeled HIV-1-specific oligonucleotide (5′-GCAGTGGGTTCCCTAGTTAGC, antisense) for 25 cycles at 93°C for 1 min and 65°C for 2 min. ..

Quantitation Assay:

Article Title: The pp24 phosphoprotein of Mason-Pfizer monkey virus contributes to viral genome packaging
Article Snippet: The amount of viral particles was normalized by quantitation of p27 detected by immunobloting. .. 5 μl of diluted RNA was used for first-strand cDNA synthesis as per manufacturers suggestions for M-MLV RT (Invitrogen) using 500 ng of oligo (dT)12–18 (Ambion, Austin, TX).

Article Title: Characterization of LINE-1 Ribonucleoprotein Particles
Article Snippet: Quantitative real-time PCR Quantitative PCR was performed on LEAP cDNA samples or M-MLV RT-PCR products using the 7300 Real Time PCR system (Applied Biosystems). .. The ‘absolute quantitation by standard curve’ method was used to determine the number of cDNA molecules in each LEAP RNP or RNA sample.

Recombinant:

Article Title: Gadd45a Is an RNA Binding Protein and Is Localized in Nuclear Speckles
Article Snippet: .. Recombinant proteins used were bovine serum albumin (Fraction V, Sigma), His-Gadd45a and M-MLV-reverse transcriptase (Invitrogen). .. Binding reactions were performed in RNA binding buffer (10 mM Tris-HCl (pH 7.4), 10 mM KCl, 1 mM MgCl2 ).

Isolation:

Article Title: Inhibition of BRCA2 and Thymidylate Synthase Creates Multidrug Sensitive Tumor Cells via the Induction of Combined "Complementary Lethality"
Article Snippet: .. Twenty-four hours after transfection of siRNA, RNA was isolated from cells using Trizol reagent according to manufacturer's instructions (Ambion—Life Technologies) and reverse-transcribed to generate cDNA using M-MLV RT enzyme (Invitrogen—Life Technologies). cDNA (1 µg) was used in conjunction with BRCA2, TS, and 18S rRNA qPCR probe and primers and Taqman master mix (Applied Biosystems—Life Technologies) to generate fluorescently labeled target cDNA. .. Quantification of cDNA to infer levels of TS and BRCA2 mRNAs and 18S rRNA was performed using a Perkin Elmer ViiA 7 Real-time PCR System (Life Technologies).

Article Title: Increased Expression of Pregnancy Up-Regulated Non-Ubiquitous Calmodulin Kinase Is Associated with Poor Prognosis in Clear Cell Renal Cell Carcinoma
Article Snippet: Real-time RT-PCR Total RNA was isolated using the TRIzol solution (Invitrogen; Carlsbad, CA) according to the manufacturer’s instructions. .. The first-strand cDNA, synthesized from 2 µg of total RNA using M-MLV reverse transcriptase (Fermentas; American), was then subjected to real-time quantitative PCR after the DNA contamination being removed by RNase-free DNase.

Article Title: Validation of Housekeeping Genes as Reference for Reverse-Transcription-qPCR Analysis in Busulfan-Injured Microvascular Endothelial Cells
Article Snippet: .. Complementary DNA (cDNA) Synthesis The intact RNA was reverse transcriptase at once after isolation using Invitrogen reagent M-MLV. .. Firstly, the RNA was transcribed into first cDNA, using 10μ m oligonucleotide dT primer; 10mM dNTP and DEPC-treated water were combined together and preserved at 65°C for 10 minutes with extended temperature of 4°C in the conventional PCR.

Article Title: Gene structure and expression profile of Manduca sexta prophenoloxidase-activating proteinase-3 (PAP-3), an immune protein containing two clip domains
Article Snippet: Similarly, fat body and haemocyte RNA samples were isolated from naive and bacteria-challenged M. sexta larvae. .. First-strand cDNA synthesis was performed using 2–4 µg RNA, 10 pmol oligo(dT)17 , and 200 U MMLV reverse transcriptase (Invitrogen Life Technologies) at 37 °C for 1 h. M. sexta ribosomal protein S3 transcripts were used as an internal standard to control the template amount in a preliminary PCR experiment.

Article Title: mir-21 Overexpressing Mesenchymal Stem Cells Accelerate Fracture Healing in a Rat Closed Femur Fracture Model
Article Snippet: .. RNA Extraction and Quantitative Real-Time PCR Total cellular RNA was isolated with RNA Mini Kit (Invitrogen) and then reverse-transcribed into cDNA using M-MLV Reverse Transcriptase (Invitrogen) according to the manufacturer's instructions. .. Real-time PCR was performed using the Step One Plus Real-Time PCR System (Applied Biosystems, USA) according to the manufacturer's instructions.

Article Title: Functional Domains of Tat Required for Efficient Human Immunodeficiency Virus Type 1 Reverse Transcription †
Article Snippet: Supernatant containing 60 ng of p24 Ag was treated with TriPure reagent (Roche Diagnostics), 0.5 pg of in vitro-synthesized HIV-1 RNA was added, and total virion RNA was isolated according to the manufacturer’s recommendations. .. Total viral RNA was annealed to an oligonucleotide (5′-GACTGCGAATCGTTCTAG-3′, antisense) complementary to sequences in the gag open reading frame at 75°C for 10 min and placed on ice, and cDNA was made by using the supplied buffers, 0.2 mM dNTPs, and M-MLV RT (Life Technologies) at 37°C for 60 min. Each cDNA reaction was assayed by PCR for the internal control (IC) cDNA (reverse transcribed from IC RNA) by using a 32 P-labeled oligonucleotide specific for pGem4z sequences (5′-GGGAGACAAGCTTGCATGCCTG, sense) and an unlabeled HIV-1-specific oligonucleotide (5′-GCAGTGGGTTCCCTAGTTAGC, antisense) for 25 cycles at 93°C for 1 min and 65°C for 2 min.

Labeling:

Article Title: Inhibition of BRCA2 and Thymidylate Synthase Creates Multidrug Sensitive Tumor Cells via the Induction of Combined "Complementary Lethality"
Article Snippet: .. Twenty-four hours after transfection of siRNA, RNA was isolated from cells using Trizol reagent according to manufacturer's instructions (Ambion—Life Technologies) and reverse-transcribed to generate cDNA using M-MLV RT enzyme (Invitrogen—Life Technologies). cDNA (1 µg) was used in conjunction with BRCA2, TS, and 18S rRNA qPCR probe and primers and Taqman master mix (Applied Biosystems—Life Technologies) to generate fluorescently labeled target cDNA. .. Quantification of cDNA to infer levels of TS and BRCA2 mRNAs and 18S rRNA was performed using a Perkin Elmer ViiA 7 Real-time PCR System (Life Technologies).

Article Title: Gadd45a Is an RNA Binding Protein and Is Localized in Nuclear Speckles
Article Snippet: Recombinant proteins used were bovine serum albumin (Fraction V, Sigma), His-Gadd45a and M-MLV-reverse transcriptase (Invitrogen). .. In competition assays, unlabeled competitor nucleic acids were preincubated for 10 min with recombinant proteins before addition of labeled RNA.

Purification:

Article Title: The pp24 phosphoprotein of Mason-Pfizer monkey virus contributes to viral genome packaging
Article Snippet: Purified RNA was treated with 1 U of Rnase-free Dnase I (New England Biolabs, Inc., Berverly, MA) for 30 min at 37°C, followed by inactivation at 70°C for 30 min. Purified RNA from equivalent amounts of virus was diluted 1:1,000 followed by 2-fold serial dilutions. .. 5 μl of diluted RNA was used for first-strand cDNA synthesis as per manufacturers suggestions for M-MLV RT (Invitrogen) using 500 ng of oligo (dT)12–18 (Ambion, Austin, TX).

Article Title: Gene structure and expression profile of Manduca sexta prophenoloxidase-activating proteinase-3 (PAP-3), an immune protein containing two clip domains
Article Snippet: RNA samples were extracted from various tissues of M. sexta at different developmental stages (see legend for details), using Micro-to-Midi Total RNA purification system (Invitrogen Life Technologies, Carlsbad, CA). .. First-strand cDNA synthesis was performed using 2–4 µg RNA, 10 pmol oligo(dT)17 , and 200 U MMLV reverse transcriptase (Invitrogen Life Technologies) at 37 °C for 1 h. M. sexta ribosomal protein S3 transcripts were used as an internal standard to control the template amount in a preliminary PCR experiment.

Sequencing:

Article Title: Splicing of constitutive upstream introns is essential for the recognition of intra-exonic suboptimal splice sites in the thrombopoietin gene
Article Snippet: Poly(dT) cDNA was synthesized using MMLV reverse transcriptase (Gibco BRL) and was amplified with the above mentioned oligos for 35 cycles (30 s at 94°C, 30 s at 62°C, 1 min at 72°C), using 2 U of Taq DNA polymerase (Roche Diagnostic). .. To study the strength of splice sites on the splicing efficiency of the 116 nt sequence, we used an overlap extension system ( ) to mutagenize the 5′-splice site towards consensus with primer 5′C-for, tccgaggacaggtaagtatcctgat and 5′C-rev, atcaggatacttacctgtcctcgga and the 3′ splice site, which was improved partially with primers 3′I-for, acgagctcccttgtttaaacaggacttct and 3′I-rev, tccgaggacaggtaagtatcctgat or fully with primers 3′C-for, agtcctcacactgaacgttttttttttcaggacttct and 3′C-rev, agaagtcctgaaaaaaaaaacgttcagtgtgaggact, respectively.

Filter-binding Assay:

Article Title: Gadd45a Is an RNA Binding Protein and Is Localized in Nuclear Speckles
Article Snippet: Paragraph title: Filter binding assay ... Recombinant proteins used were bovine serum albumin (Fraction V, Sigma), His-Gadd45a and M-MLV-reverse transcriptase (Invitrogen).

Construct:

Article Title: Splicing of constitutive upstream introns is essential for the recognition of intra-exonic suboptimal splice sites in the thrombopoietin gene
Article Snippet: Paragraph title: Constructs ... Poly(dT) cDNA was synthesized using MMLV reverse transcriptase (Gibco BRL) and was amplified with the above mentioned oligos for 35 cycles (30 s at 94°C, 30 s at 62°C, 1 min at 72°C), using 2 U of Taq DNA polymerase (Roche Diagnostic).

Plasmid Preparation:

Article Title: Splicing of constitutive upstream introns is essential for the recognition of intra-exonic suboptimal splice sites in the thrombopoietin gene
Article Snippet: Poly(dT) cDNA was synthesized using MMLV reverse transcriptase (Gibco BRL) and was amplified with the above mentioned oligos for 35 cycles (30 s at 94°C, 30 s at 62°C, 1 min at 72°C), using 2 U of Taq DNA polymerase (Roche Diagnostic). .. Both the TPO gene and the TPO cDNA were digested with Kpn I and Not I restriction enzymes and ligated into pcDNA 3 eukaryotic expression vector (Invitrogen) Kpn I/ Not I cut, generating the parental constructs TPO gene and TPO cDNA.

Article Title: Characterization of LINE-1 Ribonucleoprotein Particles
Article Snippet: For analysis, 1 µL of LEAP or M-MLV RT products was added to 19 µL of master mix (1X SYBR Green PCR Master Mix (Applied Biosystems), 500 nM L1 3′ end primer, and 500 nM L1 Reverse primer), and amplified in a standard Q-PCR run of 45 cycles. .. A standard curve was generated using dilutions of a L1 LEAP product cloned into a plasmid, and a best fit line (log(molecules) versus average Ct value) for these standards was generated by linear regression.

Software:

Article Title: Increased Expression of Pregnancy Up-Regulated Non-Ubiquitous Calmodulin Kinase Is Associated with Poor Prognosis in Clear Cell Renal Cell Carcinoma
Article Snippet: The first-strand cDNA, synthesized from 2 µg of total RNA using M-MLV reverse transcriptase (Fermentas; American), was then subjected to real-time quantitative PCR after the DNA contamination being removed by RNase-free DNase. .. Regression curves were calculated for each sample, and the relative amount of mRNA was calculated from the threshold cycles by using the software provided with the instrument (Version 17.0 SPSS Inc.).

Article Title: Regulation of host gene expression by HIV-1 TAR microRNAs
Article Snippet: Reverse transcription and quantitative PCR analysis RNA was treated with Turbo™ DNAse (Life Technologies) for 30 minutes at 37°C and reverse transcribed (RT) with random primers and the M-MLV reverse transcriptase enzyme (Invitrogen), according to the manufacturer’s instructions. .. Data were collected using the Bio-Rad CFX manager software v. 1.6 (Bio-Rad).

Article Title: Gene structure and expression profile of Manduca sexta prophenoloxidase-activating proteinase-3 (PAP-3), an immune protein containing two clip domains
Article Snippet: First-strand cDNA synthesis was performed using 2–4 µg RNA, 10 pmol oligo(dT)17 , and 200 U MMLV reverse transcriptase (Invitrogen Life Technologies) at 37 °C for 1 h. M. sexta ribosomal protein S3 transcripts were used as an internal standard to control the template amount in a preliminary PCR experiment. .. After electrophoretic separation on a 1.3% agarose gel, intensities of the PCR products were quantified and compared using Digital Science 1D Gel Analysis Software (Kodak, Rochester, NY).

Real-time Polymerase Chain Reaction:

Article Title: Inhibition of BRCA2 and Thymidylate Synthase Creates Multidrug Sensitive Tumor Cells via the Induction of Combined "Complementary Lethality"
Article Snippet: .. Twenty-four hours after transfection of siRNA, RNA was isolated from cells using Trizol reagent according to manufacturer's instructions (Ambion—Life Technologies) and reverse-transcribed to generate cDNA using M-MLV RT enzyme (Invitrogen—Life Technologies). cDNA (1 µg) was used in conjunction with BRCA2, TS, and 18S rRNA qPCR probe and primers and Taqman master mix (Applied Biosystems—Life Technologies) to generate fluorescently labeled target cDNA. .. Quantification of cDNA to infer levels of TS and BRCA2 mRNAs and 18S rRNA was performed using a Perkin Elmer ViiA 7 Real-time PCR System (Life Technologies).

Article Title: Increased Expression of Pregnancy Up-Regulated Non-Ubiquitous Calmodulin Kinase Is Associated with Poor Prognosis in Clear Cell Renal Cell Carcinoma
Article Snippet: .. The first-strand cDNA, synthesized from 2 µg of total RNA using M-MLV reverse transcriptase (Fermentas; American), was then subjected to real-time quantitative PCR after the DNA contamination being removed by RNase-free DNase. .. The primer pairs used for RT-PCR amplification of the relative mRNA of PNCK and GAPDH (as an internal control) were as follows: PNCK sense strand: 5′-TATGCCACGCCCTTTGAG-3′ , PNCK antisense strand: 5′-CACAGCAGGATGTAGGAGATGA-3′ , GAPDH sense strand: 5′-GCTCTCTGCTCCTCCTGTTC-3′ , GAPDH antisense strand: 5′-GACTCCGACCTTCACCTTCC-3′ .

Article Title: Characterization of LINE-1 Ribonucleoprotein Particles
Article Snippet: .. Quantitative real-time PCR Quantitative PCR was performed on LEAP cDNA samples or M-MLV RT-PCR products using the 7300 Real Time PCR system (Applied Biosystems). .. For analysis, 1 µL of LEAP or M-MLV RT products was added to 19 µL of master mix (1X SYBR Green PCR Master Mix (Applied Biosystems), 500 nM L1 3′ end primer, and 500 nM L1 Reverse primer), and amplified in a standard Q-PCR run of 45 cycles.

Article Title: Evaluation of neural gene expression in serum treated embryonic stem cells in Alzheimer's patients
Article Snippet: .. Quantitative real-time polymerase chain reaction analysis Cells were collected by centrifugation and total RNA was extracted by RNeasy mini kit (Qiagen) and then treated with DNase I (Fermentas) to avoid any DNA contamination (cDNA) and was synthesized using Moloney Murine Leukemia Virus (MMLV) Reverse Transcriptase according to the manufacture protocol (Fermentas). cDNA synthesis was performed using MMLV Reverse Transcriptase and random hexamer primer according to the manufacturer protocol (Fermentas). .. Real-time PCR was carried out in a thermal cycler Rotor gene 6000 (Corbett).

Article Title: Regulation of host gene expression by HIV-1 TAR microRNAs
Article Snippet: .. Reverse transcription and quantitative PCR analysis RNA was treated with Turbo™ DNAse (Life Technologies) for 30 minutes at 37°C and reverse transcribed (RT) with random primers and the M-MLV reverse transcriptase enzyme (Invitrogen), according to the manufacturer’s instructions. .. Quantitative PCR (qPCR) using IQ™ SYBR® green supermix (Bio-Rad) and listed primers sets (Additional file ) was performed in a C1000 thermal cycler with a CFX96 Real-Time system (Bio-Rad).

Article Title: Characterization of LINE-1 Ribonucleoprotein Particles
Article Snippet: Paragraph title: Quantitative real-time PCR ... For analysis, 1 µL of LEAP or M-MLV RT products was added to 19 µL of master mix (1X SYBR Green PCR Master Mix (Applied Biosystems), 500 nM L1 3′ end primer, and 500 nM L1 Reverse primer), and amplified in a standard Q-PCR run of 45 cycles.

Article Title: mir-21 Overexpressing Mesenchymal Stem Cells Accelerate Fracture Healing in a Rat Closed Femur Fracture Model
Article Snippet: .. RNA Extraction and Quantitative Real-Time PCR Total cellular RNA was isolated with RNA Mini Kit (Invitrogen) and then reverse-transcribed into cDNA using M-MLV Reverse Transcriptase (Invitrogen) according to the manufacturer's instructions. .. Real-time PCR was performed using the Step One Plus Real-Time PCR System (Applied Biosystems, USA) according to the manufacturer's instructions.

RNA Extraction:

Article Title: The pp24 phosphoprotein of Mason-Pfizer monkey virus contributes to viral genome packaging
Article Snippet: Paragraph title: RNA extraction and RT-PCR ... 5 μl of diluted RNA was used for first-strand cDNA synthesis as per manufacturers suggestions for M-MLV RT (Invitrogen) using 500 ng of oligo (dT)12–18 (Ambion, Austin, TX).

Article Title: Gene structure and expression profile of Manduca sexta prophenoloxidase-activating proteinase-3 (PAP-3), an immune protein containing two clip domains
Article Snippet: Paragraph title: RNA extraction and RT-PCR analysis ... First-strand cDNA synthesis was performed using 2–4 µg RNA, 10 pmol oligo(dT)17 , and 200 U MMLV reverse transcriptase (Invitrogen Life Technologies) at 37 °C for 1 h. M. sexta ribosomal protein S3 transcripts were used as an internal standard to control the template amount in a preliminary PCR experiment.

Article Title: mir-21 Overexpressing Mesenchymal Stem Cells Accelerate Fracture Healing in a Rat Closed Femur Fracture Model
Article Snippet: .. RNA Extraction and Quantitative Real-Time PCR Total cellular RNA was isolated with RNA Mini Kit (Invitrogen) and then reverse-transcribed into cDNA using M-MLV Reverse Transcriptase (Invitrogen) according to the manufacturer's instructions. .. Real-time PCR was performed using the Step One Plus Real-Time PCR System (Applied Biosystems, USA) according to the manufacturer's instructions.

Agarose Gel Electrophoresis:

Article Title: Gene structure and expression profile of Manduca sexta prophenoloxidase-activating proteinase-3 (PAP-3), an immune protein containing two clip domains
Article Snippet: First-strand cDNA synthesis was performed using 2–4 µg RNA, 10 pmol oligo(dT)17 , and 200 U MMLV reverse transcriptase (Invitrogen Life Technologies) at 37 °C for 1 h. M. sexta ribosomal protein S3 transcripts were used as an internal standard to control the template amount in a preliminary PCR experiment. .. After electrophoretic separation on a 1.3% agarose gel, intensities of the PCR products were quantified and compared using Digital Science 1D Gel Analysis Software (Kodak, Rochester, NY).

Transgenic Assay:

Article Title: The Use of a Dexamethasone-inducible System to Synchronize Xa21 Expression to Study Rice Immunity
Article Snippet: .. Kitaake) Transgenic rice seeds containing pTA7002::Myc::Xa21 ( ) Transgenic rice seeds containing Ubi::Myc::Xa21 ( ) Xanthomonas oryzae pv. oryzae ( Xoo ; Philippines race 6, strain PXO99Az) Dexamethasone (Sigma-Aldrich, catalog number: D1756) Dimethyl sulfoxide (DMSO) (Thermo Fisher Scientific, catalog number: D128-1) Tween-20 (Bio-Rad Laboratories, catalog number: 170-6531) Sterile H2 O (Milli-Q) TRIzol (Life Technologies, Invitrogen™ , catalog number: 15596-026) M-MLV reverse transcriptase (Life Technologies, Invitrogen™ , catalog number: 28025-013) SsoFastEvaGreenSupermix (Bio-Rad Laboratories, catalog number: 172-5203) Peptone sucrose agar (PSA) solid media containing 20 μg/ml cephalexin (MP Biomedicals, catalog number: 02150585) (see Recipes) Dexamethasone (see Recipes) Greenhouse rice growing conditions (see Recipes) Walk-in growth chamber rice growing conditions (see Recipes) .. Spray bottle (550 ml) (any supplier) for dexamethasone foliar spray 1.5 ml Eppendorf tube (any supplier) Surgical scissors (sharp/sharp, straight, 5 ½ inch or similar) for Xoo clipping inoculation 5 ½ inch square disposable pots Supertub (24 inch x 36 inch x 8 inch) (Mac Court Products, model: ST3608 or similar) Scale suitable for measurements down to 0.0001 g (any manufacturer) Spectrophotometer suitable for taking optical density measurements at 600 nm (any manufacturer) Growth chamber (14 h light and 10 h dark photoperiod with 28 °C temperature) (any manufacturer) for rice seed germination Incubation chamber (28 °C) (any manufacturer) for Xoo preparation Greenhouse capable of temperature and humidity control for growing rice plants Walk-in growth chamber (conviron or equivalent) for Xoo inoculation and dexamethasone treatment qPCR machine (Bio-Rad Laboratories, model: CFX96 Real-Time PCR)

Random Hexamer Labeling:

Article Title: Evaluation of neural gene expression in serum treated embryonic stem cells in Alzheimer's patients
Article Snippet: .. Quantitative real-time polymerase chain reaction analysis Cells were collected by centrifugation and total RNA was extracted by RNeasy mini kit (Qiagen) and then treated with DNase I (Fermentas) to avoid any DNA contamination (cDNA) and was synthesized using Moloney Murine Leukemia Virus (MMLV) Reverse Transcriptase according to the manufacture protocol (Fermentas). cDNA synthesis was performed using MMLV Reverse Transcriptase and random hexamer primer according to the manufacturer protocol (Fermentas). .. Real-time PCR was carried out in a thermal cycler Rotor gene 6000 (Corbett).

Concentration Assay:

Article Title: Inhibition of BRCA2 and Thymidylate Synthase Creates Multidrug Sensitive Tumor Cells via the Induction of Combined "Complementary Lethality"
Article Snippet: A549 cells were transfected with BR-1, SARI 83, and control ASOs (synthesized by Eurogentec, Seraing, Belgium) according to the same protocol outlined for siRNA; however, they were used at 20 nmol/l each (for a total concentration of 40 nmol/l). siRNA-mediated reduction of target mRNAs in A549 cells. .. Twenty-four hours after transfection of siRNA, RNA was isolated from cells using Trizol reagent according to manufacturer's instructions (Ambion—Life Technologies) and reverse-transcribed to generate cDNA using M-MLV RT enzyme (Invitrogen—Life Technologies). cDNA (1 µg) was used in conjunction with BRCA2, TS, and 18S rRNA qPCR probe and primers and Taqman master mix (Applied Biosystems—Life Technologies) to generate fluorescently labeled target cDNA.

Article Title: Selective control of primer usage in multiplex one-step reverse transcription PCR
Article Snippet: M-MLV reverse transcriptase (25 U) (Invitrogen) and Taq DNA polymerase (2.5 U) (Invitrogen) were used in all quantitative real-time experiments. .. The copies of each gene of interest were quantitated by extrapolation to standard curves containing from ~101 to ~108 copies of the appropriate RNA standard (prepared as described above) in 100-fold dilutions, where each concentration of RNA standard was performed in triplicate as a singleplex reaction.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Thermo Fisher m dithiothreitol
    Redox potential of the MetAP2 disulfide bond. A , the labeling of fully reduced MetAP2 by the biotin-linked maleimide, MPB, was used to calculate the ratio of reduced to oxidized enzyme as a function of the ratio of reduced (DTT red ) to oxidized (DTT ox ) <t>dithiothreitol.</t> Biotin incorporation was measured by SDS-PAGE and blotting with streptavidin-peroxidase. B , plot of the ratio of reduced to oxidized MetAP2 as a function of the ratio of reduced to oxidized DTT. The solid line . The calculated equilibrium constant is 0.028 (95% confidence interval: 0.012–0.044). From the Nernst equation, the standard redox potential of the Cys 228 -Cys 448 disulfide is −261 mV. Data points and error bars , mean ± S.E. of three independent experiments. C , the initial rate of hydrolysis of Met-Gly-Pro-AMC by fully oxidized or reduced MetAP2 was used to calculate the ratio of reduced to oxidized enzyme as a function of the ratio of reduced (Trx red ) to oxidized (Trx ox ) thioredoxin. The solid line . The calculated equilibrium constant is 0.740 (95% confidence interval: 0.600–0.688), which equates to a standard redox potential of −266 mV for the Cys 228 -Cys 448 disulfide bond. Data points and error bars , mean ± S.E. of three independent experiments.
    M Dithiothreitol, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/m dithiothreitol/product/Thermo Fisher
    Average 95 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    m dithiothreitol - by Bioz Stars, 2020-03
    95/100 stars
      Buy from Supplier

    99
    Thermo Fisher m dtt
    Polysulfides inhibit PTEN by sulfane sulfur addition. (A) Recombinant PTEN-WT was <t>prereduced</t> with 20 m M <t>DTT</t> for 10 min, followed by buffer exchange into a nonreducing PTEN assay buffer and exposure to 100 μ M H 2 O 2 or NaHS
    M Dtt, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 50 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/m dtt/product/Thermo Fisher
    Average 99 stars, based on 50 article reviews
    Price from $9.99 to $1999.99
    m dtt - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    Image Search Results


    Redox potential of the MetAP2 disulfide bond. A , the labeling of fully reduced MetAP2 by the biotin-linked maleimide, MPB, was used to calculate the ratio of reduced to oxidized enzyme as a function of the ratio of reduced (DTT red ) to oxidized (DTT ox ) dithiothreitol. Biotin incorporation was measured by SDS-PAGE and blotting with streptavidin-peroxidase. B , plot of the ratio of reduced to oxidized MetAP2 as a function of the ratio of reduced to oxidized DTT. The solid line . The calculated equilibrium constant is 0.028 (95% confidence interval: 0.012–0.044). From the Nernst equation, the standard redox potential of the Cys 228 -Cys 448 disulfide is −261 mV. Data points and error bars , mean ± S.E. of three independent experiments. C , the initial rate of hydrolysis of Met-Gly-Pro-AMC by fully oxidized or reduced MetAP2 was used to calculate the ratio of reduced to oxidized enzyme as a function of the ratio of reduced (Trx red ) to oxidized (Trx ox ) thioredoxin. The solid line . The calculated equilibrium constant is 0.740 (95% confidence interval: 0.600–0.688), which equates to a standard redox potential of −266 mV for the Cys 228 -Cys 448 disulfide bond. Data points and error bars , mean ± S.E. of three independent experiments.

    Journal: The Journal of Biological Chemistry

    Article Title: Redox Regulation of Methionine Aminopeptidase 2 Activity *

    doi: 10.1074/jbc.M114.554253

    Figure Lengend Snippet: Redox potential of the MetAP2 disulfide bond. A , the labeling of fully reduced MetAP2 by the biotin-linked maleimide, MPB, was used to calculate the ratio of reduced to oxidized enzyme as a function of the ratio of reduced (DTT red ) to oxidized (DTT ox ) dithiothreitol. Biotin incorporation was measured by SDS-PAGE and blotting with streptavidin-peroxidase. B , plot of the ratio of reduced to oxidized MetAP2 as a function of the ratio of reduced to oxidized DTT. The solid line . The calculated equilibrium constant is 0.028 (95% confidence interval: 0.012–0.044). From the Nernst equation, the standard redox potential of the Cys 228 -Cys 448 disulfide is −261 mV. Data points and error bars , mean ± S.E. of three independent experiments. C , the initial rate of hydrolysis of Met-Gly-Pro-AMC by fully oxidized or reduced MetAP2 was used to calculate the ratio of reduced to oxidized enzyme as a function of the ratio of reduced (Trx red ) to oxidized (Trx ox ) thioredoxin. The solid line . The calculated equilibrium constant is 0.740 (95% confidence interval: 0.600–0.688), which equates to a standard redox potential of −266 mV for the Cys 228 -Cys 448 disulfide bond. Data points and error bars , mean ± S.E. of three independent experiments.

    Article Snippet: Just before use, the active site disulfide bond of the oxidoreductase was reduced with 50 m m dithiothreitol and 50 m m tris-(2-carboxyethyl)phosphine (TCEP) for 1 h at 25 °C, and the reducing agents were removed by two passes through Zeba spin desalting columns equilibrated with phosphate-buffered saline (Thermo Scientific).

    Techniques: Labeling, SDS Page

    Polysulfides inhibit PTEN by sulfane sulfur addition. (A) Recombinant PTEN-WT was prereduced with 20 m M DTT for 10 min, followed by buffer exchange into a nonreducing PTEN assay buffer and exposure to 100 μ M H 2 O 2 or NaHS

    Journal: Antioxidants & Redox Signaling

    Article Title: Polysulfides Link H2S to Protein Thiol Oxidation

    doi: 10.1089/ars.2012.5041

    Figure Lengend Snippet: Polysulfides inhibit PTEN by sulfane sulfur addition. (A) Recombinant PTEN-WT was prereduced with 20 m M DTT for 10 min, followed by buffer exchange into a nonreducing PTEN assay buffer and exposure to 100 μ M H 2 O 2 or NaHS

    Article Snippet: Typically, roGFP2-His was prereduced with 20 m M DTT for 10 min before the experiment, and passed through gel filtration columns (Thermo Scientific) pre-equilibrated with the roGFP2 assay buffer to remove DTT immediately before the start of the assay.

    Techniques: Recombinant, Buffer Exchange