luria bertani medium  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Millipore luria bertani medium
    Subcellular localization of SrrA and SrrB. (A) rSrrA and rSrrB* were produced by independently cloning the full-length srrA gene and the putative extracellular portion of the srrB gene into the pET28b expression vector. E. coli strains BL21(pJMY22) and BL21(pJMY21) containing the pET28b-SrrA and pET28b-SrrB* constructs, respectively, were grown in <t>Luria-Bertani</t> medium, induced to express recombinant protein, and harvested by centrifugation. Recombinant protein was obtained as described in Materials and Methods. The recombinant histidine-tagged proteins were purified by column chromatography. The histidine tag was removed from SrrA by thrombin cleavage, and both proteins were purified by HPLC. rSrrA was present as an approximately 34-kDa protein on an SDS-polyacrylamide gel, while rSrrB* was present as an approximately 18-kDa protein. (B) S. aureus strains DU5875 and DU5875(pJMY11) were grown to the postexponential phase, lysed, and separated into membrane and cytoplasmic fractions as described in the text. Fractions were electrophoresed by SDS-PAGE and blotted for Western analysis. Cytoplasmic fractions are on the left and membrane fractions are on the right of each blot. (Left panel) Western blot with anti-SrrA (α-SrrA). SrrA was present as an approximately 34-kDa protein that was in the cytoplasmic fraction of strain DU5875(pJMY11). (Center panel) Western blot with anti-SrrB* (α-SrrB*). SrrB was present as an approximately 60-kDa protein that was in both the DU5875 and DU5875(pJMY11) membrane fractions. (Right panel) Western blot with normal serum. Numbers on the left are molecular masses, in kilodaltons.
    Luria Bertani Medium, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 56 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/luria bertani medium/product/Millipore
    Average 99 stars, based on 56 article reviews
    Price from $9.99 to $1999.99
    luria bertani medium - by Bioz Stars, 2020-08
    99/100 stars

    Images

    1) Product Images from "Characterization of Virulence Factor Regulation by SrrAB, a Two-Component System in Staphylococcus aureus"

    Article Title: Characterization of Virulence Factor Regulation by SrrAB, a Two-Component System in Staphylococcus aureus

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.186.8.2430-2438.2004

    Subcellular localization of SrrA and SrrB. (A) rSrrA and rSrrB* were produced by independently cloning the full-length srrA gene and the putative extracellular portion of the srrB gene into the pET28b expression vector. E. coli strains BL21(pJMY22) and BL21(pJMY21) containing the pET28b-SrrA and pET28b-SrrB* constructs, respectively, were grown in Luria-Bertani medium, induced to express recombinant protein, and harvested by centrifugation. Recombinant protein was obtained as described in Materials and Methods. The recombinant histidine-tagged proteins were purified by column chromatography. The histidine tag was removed from SrrA by thrombin cleavage, and both proteins were purified by HPLC. rSrrA was present as an approximately 34-kDa protein on an SDS-polyacrylamide gel, while rSrrB* was present as an approximately 18-kDa protein. (B) S. aureus strains DU5875 and DU5875(pJMY11) were grown to the postexponential phase, lysed, and separated into membrane and cytoplasmic fractions as described in the text. Fractions were electrophoresed by SDS-PAGE and blotted for Western analysis. Cytoplasmic fractions are on the left and membrane fractions are on the right of each blot. (Left panel) Western blot with anti-SrrA (α-SrrA). SrrA was present as an approximately 34-kDa protein that was in the cytoplasmic fraction of strain DU5875(pJMY11). (Center panel) Western blot with anti-SrrB* (α-SrrB*). SrrB was present as an approximately 60-kDa protein that was in both the DU5875 and DU5875(pJMY11) membrane fractions. (Right panel) Western blot with normal serum. Numbers on the left are molecular masses, in kilodaltons.
    Figure Legend Snippet: Subcellular localization of SrrA and SrrB. (A) rSrrA and rSrrB* were produced by independently cloning the full-length srrA gene and the putative extracellular portion of the srrB gene into the pET28b expression vector. E. coli strains BL21(pJMY22) and BL21(pJMY21) containing the pET28b-SrrA and pET28b-SrrB* constructs, respectively, were grown in Luria-Bertani medium, induced to express recombinant protein, and harvested by centrifugation. Recombinant protein was obtained as described in Materials and Methods. The recombinant histidine-tagged proteins were purified by column chromatography. The histidine tag was removed from SrrA by thrombin cleavage, and both proteins were purified by HPLC. rSrrA was present as an approximately 34-kDa protein on an SDS-polyacrylamide gel, while rSrrB* was present as an approximately 18-kDa protein. (B) S. aureus strains DU5875 and DU5875(pJMY11) were grown to the postexponential phase, lysed, and separated into membrane and cytoplasmic fractions as described in the text. Fractions were electrophoresed by SDS-PAGE and blotted for Western analysis. Cytoplasmic fractions are on the left and membrane fractions are on the right of each blot. (Left panel) Western blot with anti-SrrA (α-SrrA). SrrA was present as an approximately 34-kDa protein that was in the cytoplasmic fraction of strain DU5875(pJMY11). (Center panel) Western blot with anti-SrrB* (α-SrrB*). SrrB was present as an approximately 60-kDa protein that was in both the DU5875 and DU5875(pJMY11) membrane fractions. (Right panel) Western blot with normal serum. Numbers on the left are molecular masses, in kilodaltons.

    Techniques Used: Produced, Clone Assay, Expressing, Plasmid Preparation, Construct, Recombinant, Centrifugation, Purification, Column Chromatography, High Performance Liquid Chromatography, SDS Page, Western Blot

    2) Product Images from "Intracellular Viral Processing, Not Single-Stranded DNA Accumulation, Is Crucial for Recombinant Adeno-Associated Virus Transduction"

    Article Title: Intracellular Viral Processing, Not Single-Stranded DNA Accumulation, Is Crucial for Recombinant Adeno-Associated Virus Transduction

    Journal: Journal of Virology

    doi: 10.1128/JVI.78.24.13678-13686.2004

    Detection of BrdU-labeled viral ss DNA by immunofluorescence staining. HeLa cells were infected with BrdU-labeled AAV2 vector at an MOI of 10,000, and the incorporated BrdU in the viral genome was detected at (A) 10 min, (B) 6 h, (C) 12 h, (D) 24 h, and (E) 48 h postinfection by using a BrdU antibody. Under nondenaturing (Non D) conditions, no signal is detectable. Under denaturing (Denatured) conditions, BrdU signal (red) can be detected in the nucleus, which is stained with Hoechst 33342 (blue) at 6 h postinfection or later on. The strongest signal is detected 24 h postinfection, which is reduced following that time point. As a negative (neg) control, the same time course experiment was performed by using a nonlabeled AAV2-CMV-GFP vector which is shown at 12 h postinfection (F). (G, H, and I) SS plasmid DNA was prepared from bacteria that were grown in Luria-Bertani medium supplemented with BrdU. HeLa cells were transfected with 10 ng (G) or 100 pg (H) of labeled ss DNA or 200 ng of unlabeled ss DNA (I). Cells were fixed at 6 h posttransfection and stained with BrdU antibody (red) under nondenaturing conditions. The nucleus was stained with Hoechst 33342 (blue). The scale bar is 20 μm for all panels.
    Figure Legend Snippet: Detection of BrdU-labeled viral ss DNA by immunofluorescence staining. HeLa cells were infected with BrdU-labeled AAV2 vector at an MOI of 10,000, and the incorporated BrdU in the viral genome was detected at (A) 10 min, (B) 6 h, (C) 12 h, (D) 24 h, and (E) 48 h postinfection by using a BrdU antibody. Under nondenaturing (Non D) conditions, no signal is detectable. Under denaturing (Denatured) conditions, BrdU signal (red) can be detected in the nucleus, which is stained with Hoechst 33342 (blue) at 6 h postinfection or later on. The strongest signal is detected 24 h postinfection, which is reduced following that time point. As a negative (neg) control, the same time course experiment was performed by using a nonlabeled AAV2-CMV-GFP vector which is shown at 12 h postinfection (F). (G, H, and I) SS plasmid DNA was prepared from bacteria that were grown in Luria-Bertani medium supplemented with BrdU. HeLa cells were transfected with 10 ng (G) or 100 pg (H) of labeled ss DNA or 200 ng of unlabeled ss DNA (I). Cells were fixed at 6 h posttransfection and stained with BrdU antibody (red) under nondenaturing conditions. The nucleus was stained with Hoechst 33342 (blue). The scale bar is 20 μm for all panels.

    Techniques Used: Labeling, Immunofluorescence, Staining, Infection, Plasmid Preparation, Transfection

    Related Articles

    Clone Assay:

    Article Title: Gain-of-function mutations indicate that Escherichia coli Kch forms a functional K+ conduit in vivo
    Article Snippet: .. The empty pB11d plasmid (ampicillin resistance) was created by substituting the multiple cloning site-containing Pst I– Xba I fragment of pB10b ( ) with that of pET21d (Novagen, USA). .. To create pGEM-WT (Figure A), a Bam HI-tagged 5′ primer (5′-CG GGATCC GATTTACTGGCTCAACCGTTATTGC-3′) and a Pst I-tagged 3′ primer (5′-AA CTGCAG TCCTTTTGAAAGCGCATTGTTAT GAG-3′) were used for PCR to clone the kch coding and flanking region from wild-type FRAG1 genomic DNA, and the resulting Bam HI– Pst I fragment was inserted in pGEM-3Zf(+) vector (Promega, USA).

    Article Title: Complex stability and dynamic subunit interchange modulates the disparate activities of the yeast moonlighting proteins Hal3 and Vhs3
    Article Snippet: .. The PDs were also cloned into the ampicillin resistant co-expression vector pETDuet-1 (Novagen), which allows for the simultaneous expression of two proteins: the first with an N-terminal 6 × His fusion tag, and the second as an untagged protein. .. Cab3PD was subcloned from pET28a-Cab3PD into the second multiple cloning site (MCS) of the vector using the NdeI/XhoI restriction sites.

    Positron Emission Tomography:

    Article Title: An Escherichia coli strain for expression of the connexin45 carboxyl terminus attached to the 4th transmembrane domain
    Article Snippet: .. Table provides the amino acid sequence and species used for each TM4-CT domain to clone and ligate into the pET-14b expression vector (N-terminal 6× His-tag, ampicillin resistance; Novagen). .. Each construct includes 10 residues prior to their predicted TM4 domain (e.g., TM4-Cx45CT, Figure ).

    Infection:

    Article Title: Fosmidomycin, an inhibitor of isoprenoid synthesis, induces persistence in Chlamydia by inhibiting peptidoglycan assembly
    Article Snippet: .. Chlamydia -infected HeLa cells treated with 1 μg/mL ampicillin (AMP) (Sigma-Aldrich, MO, USA) were harvested at 22 hpci. .. Pelleted bacterial samples were suspended for 1 h at room temperature in a solution of 2% formaldehyde (freshly prepared from paraformaldehyde crystals) and 2% EM grade glutaraldehyde (Electron Microscopy Sciences, Hatfield, PA) prepared in 0.1 M cacodylate buffer, pH 7.2.

    Expressing:

    Article Title: An Escherichia coli strain for expression of the connexin45 carboxyl terminus attached to the 4th transmembrane domain
    Article Snippet: .. Table provides the amino acid sequence and species used for each TM4-CT domain to clone and ligate into the pET-14b expression vector (N-terminal 6× His-tag, ampicillin resistance; Novagen). .. Each construct includes 10 residues prior to their predicted TM4 domain (e.g., TM4-Cx45CT, Figure ).

    Article Title: Complex stability and dynamic subunit interchange modulates the disparate activities of the yeast moonlighting proteins Hal3 and Vhs3
    Article Snippet: .. The PDs were also cloned into the ampicillin resistant co-expression vector pETDuet-1 (Novagen), which allows for the simultaneous expression of two proteins: the first with an N-terminal 6 × His fusion tag, and the second as an untagged protein. .. Cab3PD was subcloned from pET28a-Cab3PD into the second multiple cloning site (MCS) of the vector using the NdeI/XhoI restriction sites.

    Sequencing:

    Article Title: An Escherichia coli strain for expression of the connexin45 carboxyl terminus attached to the 4th transmembrane domain
    Article Snippet: .. Table provides the amino acid sequence and species used for each TM4-CT domain to clone and ligate into the pET-14b expression vector (N-terminal 6× His-tag, ampicillin resistance; Novagen). .. Each construct includes 10 residues prior to their predicted TM4 domain (e.g., TM4-Cx45CT, Figure ).

    Chick Chorioallantoic Membrane Assay:

    Article Title: Inhibitory Effects of Lactoferrin on Growth and Biofilm Formation of Porphyromonas gingivalis and Prevotella intermedia ▿
    Article Snippet: .. Ampicillin (ABPC), ciprofloxacin (CPFX), clarithromycin (CAM), and minocycline hydrochloride (MINO) were obtained from Sigma-Aldrich (Tokyo, Japan). ..

    Plasmid Preparation:

    Article Title: An Escherichia coli strain for expression of the connexin45 carboxyl terminus attached to the 4th transmembrane domain
    Article Snippet: .. Table provides the amino acid sequence and species used for each TM4-CT domain to clone and ligate into the pET-14b expression vector (N-terminal 6× His-tag, ampicillin resistance; Novagen). .. Each construct includes 10 residues prior to their predicted TM4 domain (e.g., TM4-Cx45CT, Figure ).

    Article Title: Gain-of-function mutations indicate that Escherichia coli Kch forms a functional K+ conduit in vivo
    Article Snippet: .. The empty pB11d plasmid (ampicillin resistance) was created by substituting the multiple cloning site-containing Pst I– Xba I fragment of pB10b ( ) with that of pET21d (Novagen, USA). .. To create pGEM-WT (Figure A), a Bam HI-tagged 5′ primer (5′-CG GGATCC GATTTACTGGCTCAACCGTTATTGC-3′) and a Pst I-tagged 3′ primer (5′-AA CTGCAG TCCTTTTGAAAGCGCATTGTTAT GAG-3′) were used for PCR to clone the kch coding and flanking region from wild-type FRAG1 genomic DNA, and the resulting Bam HI– Pst I fragment was inserted in pGEM-3Zf(+) vector (Promega, USA).

    Article Title: Cas13b is a Type VI-B CRISPR-associated RNA-Guided RNase differentially regulated by accessory proteins Csx27 and Csx28
    Article Snippet: .. To determine interference, 25 ng of the ampicillin resistant target plasmid and 25 ng of the chloramphenicol resistant bzcas13b or empty vector (pACYC) were added to 5 uL of NovaBlue GigaSingle cells (Novagen). .. Then, 95 uL of SOC was added to cells and they were incubated with shaking at 37°C for 90 minutes, before plating the entire outgrowth (100 uL) on plates containing both chloramphenicol and ampicillin.

    Article Title: Complex stability and dynamic subunit interchange modulates the disparate activities of the yeast moonlighting proteins Hal3 and Vhs3
    Article Snippet: .. The PDs were also cloned into the ampicillin resistant co-expression vector pETDuet-1 (Novagen), which allows for the simultaneous expression of two proteins: the first with an N-terminal 6 × His fusion tag, and the second as an untagged protein. .. Cab3PD was subcloned from pET28a-Cab3PD into the second multiple cloning site (MCS) of the vector using the NdeI/XhoI restriction sites.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Millipore luria bertani lb medium
    High-density fermentation of recombinant strains with high stoichiometric yields and bioconversion by strain R04. a High-density fermentation of strains R04, R12, R14, and R15. Cells were initially cultured in <t>Luria–Bertani</t> medium at 37 °C. Then, this seed culture was inoculated into 500 mL inorganic salts medium with glycerol and glucose as a mixed carbon source in a 1-L fermenter. b Comparison of bioconversion by strain R04 cultured in shaken flasks (1) and high-density fermentation (2). Cells were suspended in a mixture with 50 mM glucose for 10 h at 37 °C and 220 rpm
    Luria Bertani Lb Medium, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 157 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/luria bertani lb medium/product/Millipore
    Average 99 stars, based on 157 article reviews
    Price from $9.99 to $1999.99
    luria bertani lb medium - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    99
    Millipore lb broth miller
    High-density fermentation of recombinant strains with high stoichiometric yields and bioconversion by strain R04. a High-density fermentation of strains R04, R12, R14, and R15. Cells were initially cultured in <t>Luria–Bertani</t> medium at 37 °C. Then, this seed culture was inoculated into 500 mL inorganic salts medium with glycerol and glucose as a mixed carbon source in a 1-L fermenter. b Comparison of bioconversion by strain R04 cultured in shaken flasks (1) and high-density fermentation (2). Cells were suspended in a mixture with 50 mM glucose for 10 h at 37 °C and 220 rpm
    Lb Broth Miller, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lb broth miller/product/Millipore
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    lb broth miller - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    Image Search Results


    High-density fermentation of recombinant strains with high stoichiometric yields and bioconversion by strain R04. a High-density fermentation of strains R04, R12, R14, and R15. Cells were initially cultured in Luria–Bertani medium at 37 °C. Then, this seed culture was inoculated into 500 mL inorganic salts medium with glycerol and glucose as a mixed carbon source in a 1-L fermenter. b Comparison of bioconversion by strain R04 cultured in shaken flasks (1) and high-density fermentation (2). Cells were suspended in a mixture with 50 mM glucose for 10 h at 37 °C and 220 rpm

    Journal: Microbial Cell Factories

    Article Title: Efficient production of myo-inositol in Escherichia coli through metabolic engineering

    doi: 10.1186/s12934-020-01366-5

    Figure Lengend Snippet: High-density fermentation of recombinant strains with high stoichiometric yields and bioconversion by strain R04. a High-density fermentation of strains R04, R12, R14, and R15. Cells were initially cultured in Luria–Bertani medium at 37 °C. Then, this seed culture was inoculated into 500 mL inorganic salts medium with glycerol and glucose as a mixed carbon source in a 1-L fermenter. b Comparison of bioconversion by strain R04 cultured in shaken flasks (1) and high-density fermentation (2). Cells were suspended in a mixture with 50 mM glucose for 10 h at 37 °C and 220 rpm

    Article Snippet: All E. coli strains were grown in Luria–Bertani (LB) medium containing 10 g/L tryptone, 10 g/L NaCl, and 5 g/L yeast extract.

    Techniques: Recombinant, Cell Culture