lr clonase  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher lr clonase
    Construction of a recombination cloning plasmid for the production of avidin fusion proteins. (A) Gene for mAvidin was synthesized with restriction sites NdeI and NotI and subcloned into pDEST17 between the 6x histidine and the gateway cassette to generate p17-Avi plasmid. OVA peptide 323-339 and ESAT6 DNA sequences terminated with att B sites were cloned into pDONR221 via BP <t>Clonase</t> reaction. Thereafter, genes of interest were subcloned into p17-Avi by mean of one step LR Clonase reaction. (B) E . coli BL21 was transformed with p17-Avi encoding ESAT6 and OVA peptide 323-339 . Recombinant Avi-proteins were purified from inclusion bodies and subjected to 12% SDS-PAGE gel and EZ blue staining to analyze the quality of fusion protein preparations. Expected sizes for Avi-ESAT6 and Avi-OVA 757-1037 are 26.8 and 27.3 kDa respectively.
    Lr Clonase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 687 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lr clonase/product/Thermo Fisher
    Average 99 stars, based on 687 article reviews
    Price from $9.99 to $1999.99
    lr clonase - by Bioz Stars, 2020-02
    99/100 stars

    Images

    1) Product Images from "Improving the Immunogenicity of the Mycobacterium bovis BCG Vaccine by Non-Genetic Bacterial Surface Decoration Using the Avidin-Biotin System"

    Article Title: Improving the Immunogenicity of the Mycobacterium bovis BCG Vaccine by Non-Genetic Bacterial Surface Decoration Using the Avidin-Biotin System

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0145833

    Construction of a recombination cloning plasmid for the production of avidin fusion proteins. (A) Gene for mAvidin was synthesized with restriction sites NdeI and NotI and subcloned into pDEST17 between the 6x histidine and the gateway cassette to generate p17-Avi plasmid. OVA peptide 323-339 and ESAT6 DNA sequences terminated with att B sites were cloned into pDONR221 via BP Clonase reaction. Thereafter, genes of interest were subcloned into p17-Avi by mean of one step LR Clonase reaction. (B) E . coli BL21 was transformed with p17-Avi encoding ESAT6 and OVA peptide 323-339 . Recombinant Avi-proteins were purified from inclusion bodies and subjected to 12% SDS-PAGE gel and EZ blue staining to analyze the quality of fusion protein preparations. Expected sizes for Avi-ESAT6 and Avi-OVA 757-1037 are 26.8 and 27.3 kDa respectively.
    Figure Legend Snippet: Construction of a recombination cloning plasmid for the production of avidin fusion proteins. (A) Gene for mAvidin was synthesized with restriction sites NdeI and NotI and subcloned into pDEST17 between the 6x histidine and the gateway cassette to generate p17-Avi plasmid. OVA peptide 323-339 and ESAT6 DNA sequences terminated with att B sites were cloned into pDONR221 via BP Clonase reaction. Thereafter, genes of interest were subcloned into p17-Avi by mean of one step LR Clonase reaction. (B) E . coli BL21 was transformed with p17-Avi encoding ESAT6 and OVA peptide 323-339 . Recombinant Avi-proteins were purified from inclusion bodies and subjected to 12% SDS-PAGE gel and EZ blue staining to analyze the quality of fusion protein preparations. Expected sizes for Avi-ESAT6 and Avi-OVA 757-1037 are 26.8 and 27.3 kDa respectively.

    Techniques Used: Clone Assay, Plasmid Preparation, Avidin-Biotin Assay, Synthesized, Transformation Assay, Recombinant, Purification, SDS Page, Staining

    Related Articles

    Transduction:

    Article Title: Disrupted apical exocytosis of cargo vesicles causes enteropathy in FHL5 patients with Munc18-2 mutations
    Article Snippet: .. For lentiviral transduction, cDNA was further subcloned via LR clonase into a pCCL-EF1α-BlastiR-DEST lentiviral vector using Gateway Cloning Technology (Invitrogen). ..

    Article Title: Endothelial CD99 signals through soluble adenylyl cyclase and PKA to regulate leukocyte transendothelial migration
    Article Snippet: .. These vectors were recombined with the adenoviral vector pAd/PL-DEST (Invitrogen) using LR Clonase (Invitrogen) according to the manufacturer’s guidelines and used to produce adenovirus for transduction according to standard methods ( ). .. The full-length CD99-GFP construct and its pCMV promoter were cloned into the pENTR4 vector.

    Clone Assay:

    Article Title: The Serine Protease Inhibitor Elafin Maintains Normal Growth Control by Opposing the Mitogenic Effects of Neutrophil Elastase
    Article Snippet: .. Following sequence validation, elafin pENTR vectors were cloned into the plenti CMV Blast DEST vector (Eric Campeau lab, obtained from the Addgene repository) using LR clonase (Invitrogen). .. Viral packaging was performed as described for lentiviral shRNA vectors.

    Article Title: Improving the Immunogenicity of the Mycobacterium bovis BCG Vaccine by Non-Genetic Bacterial Surface Decoration Using the Avidin-Biotin System
    Article Snippet: The resulting PCR product was used for directional cloning into pDONR-221 using BP clonase (Invitrogen) to obtain pDONR-OVA. .. Thereafter, OVA DNA ORF was transferred into p17-Avi through site-specific in vitro recombination using the LR clonase (Invitrogen).

    Article Title: Concerted suppression of all starch branching enzyme genes in barley produces amylose-only starch granules
    Article Snippet: This resulted in a DNA fragment with the following syntax: SalI-SBEIIa-SBEIIb-SBEI-XhoI, which was cloned into the RNAi silencing vector pSTARGATE forming a chimeric triple RNAi hairpin construct. .. The resulting vector (pENTRY4-SBE-RNAi) was confirmed by direct sequencing, and recombined by LR clonase (Invitrogen) into the RNAi vector pSTARGATE by the following protocol (1 uL pSTARGATE vector (140 ng), 3 uL pENTR4-SBE-RNAi (240 ng), 4 uL LR Clonase, 4 uL TE Buffer pH 8.0, incubated at room-temperature for 18 hours.

    Article Title: Profiling Synaptic Proteins Identifies Regulators of Insulin Secretion and Lifespan
    Article Snippet: .. For the following constructs, entry clones from the ORFeome project corresponding to the gene used was cloned into the destination vector KP#1284 using the gateway strategy with LR clonase (Invitrogen): pDS178 Punc-129::gelsolin::Venus and KP#1496 Punc-129::ins-22::Venus . .. KP#708 Pttx-3::mRFP or pPD118.33 Pmyo-2::GFP were used as transgenic markers.

    Article Title: Host-Pathogen Interaction Profiling Using Self-Assembling Human Protein Arrays
    Article Snippet: PCR fragments were digested with the specified enzymes and cloned into pFN22k or pFC15k (Promega), encoding an N-terminal or C-terminal HaloTag, respectively. .. Plasmids for production of GFP-tagged Rab1B, Rab8B, Rab10, Rab27A, and OCEL1 were constructed by recombining pDONR221 plasmids containing each individual gene (DNASU DNA plasmid repository, ) with pcDNA6.2/N-EmGFP-DEST (Life Technologies) using LR Clonase (Life Technologies).

    Article Title: Identification of Phosphoinositide-Binding Protein PATELLIN2 as a Substrate of Arabidopsis MPK4 MAP Kinase during Septum Formation in Cytokinesis
    Article Snippet: The amplified DNA fragment was cloned into pDONR201 with BP clonase® (Life Technologies, http://www.lifetechnologies.com/ ). .. From this entry clone, the recombinant cDNA was transferred to various destination vectors by LR® clonase (Life Technologies).

    Article Title: Sensitivity to splicing modulation of BCL2 family genes defines cancer therapeutic strategies for splicing modulators
    Article Snippet: .. MCL1-L pENTR-D-TOPO and BCL2A1 variant 1 pDONR (GeneCopoeia GC-I0365) were Gateway cloned (LR clonase, Thermo Fisher Scientific) into pINDUCER20 . ..

    Article Title: Disrupted apical exocytosis of cargo vesicles causes enteropathy in FHL5 patients with Munc18-2 mutations
    Article Snippet: .. For lentiviral transduction, cDNA was further subcloned via LR clonase into a pCCL-EF1α-BlastiR-DEST lentiviral vector using Gateway Cloning Technology (Invitrogen). ..

    Article Title: Endothelial CD99 signals through soluble adenylyl cyclase and PKA to regulate leukocyte transendothelial migration
    Article Snippet: Paragraph title: Cloning of shRNA, CD99, sAC, and ezrin adenoviral constructs. ... These vectors were recombined with the adenoviral vector pAd/PL-DEST (Invitrogen) using LR Clonase (Invitrogen) according to the manufacturer’s guidelines and used to produce adenovirus for transduction according to standard methods ( ).

    Centrifugation:

    Article Title: (ADP-ribose) polymerase 1 and AMP-activated protein kinase mediate progressive dopaminergic neuronal degeneration in a mouse model of Parkinson's disease
    Article Snippet: AMPKα 2 was PCR-amplified and subcloned into a pAd/CMV/V5-DEST vector (Invitrogen) using a Gateway system with LR clonase (Invitrogen). eGFP cDNA was used as a control after subcloning into a pAd/CMV/V5-DEST vector. .. Cell lysates were clarified to remove cellular debris by centrifugation in a Beckman CS-6R at 3000 r.p.m. for 10 min. For stereotaxic injection, virus particles were concentrated, and 1 × 1012 particles/ml and 1.5 μ l viral solution were injected into the right striatum (anterior, +0.06 mm; medial, −0.22 mm; dorsal, −0.35 mm relative to bregma) with a 30-gauge microsyringe at a rate of 0.5 μ l/min.

    Amplification:

    Article Title: Aicardi-Goutières syndrome gene Rnaseh2c is a metastasis susceptibility gene in breast cancer
    Article Snippet: Rnaseh2c cDNA was amplified using Phusion polymerase and directional TOPO-cloning primers Fwd- 5’-CACCATGAAGAACCCGGAGGAAG-3’ and Rev- 5’-TCAGTCCTCAGGGACCT-3’. .. DNA was purified using the QiaQuick Gel extraction kit (Qiagen) and inserted into a Gateway entry vector using LR clonase (Invitrogen) according to the manufacturer’s protocol with an overnight ligation reaction.

    Article Title: Host-Pathogen Interaction Profiling Using Self-Assembling Human Protein Arrays
    Article Snippet: Plasmid pGEX6p1- sidM was used as a template for PCR amplification with mutation-directing primers MMO325 (5'-GCCACTGAGTATAGTGCGCTAGCTGCCTTTGTTATTGTT-3') and MMO326 (5'-AACAATAACAAAGGCAGCTAGCGCACTATACTCAGTGGC-3') to generate plasmid pGEX6p1- sidM D110/112A . .. Plasmids for production of GFP-tagged Rab1B, Rab8B, Rab10, Rab27A, and OCEL1 were constructed by recombining pDONR221 plasmids containing each individual gene (DNASU DNA plasmid repository, ) with pcDNA6.2/N-EmGFP-DEST (Life Technologies) using LR Clonase (Life Technologies).

    Article Title: Identification of Phosphoinositide-Binding Protein PATELLIN2 as a Substrate of Arabidopsis MPK4 MAP Kinase during Septum Formation in Cytokinesis
    Article Snippet: The amplified DNA fragment was cloned into pDONR201 with BP clonase® (Life Technologies, http://www.lifetechnologies.com/ ). .. From this entry clone, the recombinant cDNA was transferred to various destination vectors by LR® clonase (Life Technologies).

    Article Title: TelAP1 links telomere complexes with developmental expression site silencing in African trypanosomes
    Article Snippet: A TelAP1 fragment (position 187–627) was amplified from genomic DNA using primers specific for TelAP1 open reading frame (ORF) with attB1 and attB2 sites. .. This plasmid was used in an LR clonase (Invitrogen) recombination reaction with the pTrypRNAiGate vector to generate the final RNAi construct.

    Article Title: Sensitivity to splicing modulation of BCL2 family genes defines cancer therapeutic strategies for splicing modulators
    Article Snippet: MCL1-L cDNA (EX-Y4182-Lv105, Genecopoeia) was PCR amplified using MCl1-pENTR D TOPO.KOZAK.v1-F (CACCATGTTTGGCCTCAAAAGAAAC) and MCl1-L D TOPO.v1-R (CTATCTTATTAGATATGCCAAACCAGC) primers using PfuUltra II HotStart Master Mix (Agilent) and cloned into pENTR-D-TOPO. .. MCL1-L pENTR-D-TOPO and BCL2A1 variant 1 pDONR (GeneCopoeia GC-I0365) were Gateway cloned (LR clonase, Thermo Fisher Scientific) into pINDUCER20 .

    Article Title: Sox9 Increases the Proliferation and Colony-forming Activity of Outer Root Sheath Cells Cultured In Vitro
    Article Snippet: The amplified full-length cDNA for Sox9 was subcloned into pENT/GFP vector that has attL sites for site-specific recombination with a Gateway destination vector (Invitrogen, Carlsbad, CA, USA). .. Briefly, site-specific recombination between entry vector and adenoviral destination vector was achieved by LR clonase (Invitrogen).

    Article Title: Disrupted apical exocytosis of cargo vesicles causes enteropathy in FHL5 patients with Munc18-2 mutations
    Article Snippet: Human Munc18-2 was amplified via PCR from cDNA/plasmids, ligated into a pENTR-HA-STREP vector (a gift from Dr. Stephan Geley, [Division of Molecular Pathophysiology, Medical Innsbruck University, Innsbruck, Austria]). .. For lentiviral transduction, cDNA was further subcloned via LR clonase into a pCCL-EF1α-BlastiR-DEST lentiviral vector using Gateway Cloning Technology (Invitrogen).

    Construct:

    Article Title: Aicardi-Goutières syndrome gene Rnaseh2c is a metastasis susceptibility gene in breast cancer
    Article Snippet: Paragraph title: Overexpression constructs ... DNA was purified using the QiaQuick Gel extraction kit (Qiagen) and inserted into a Gateway entry vector using LR clonase (Invitrogen) according to the manufacturer’s protocol with an overnight ligation reaction.

    Article Title: Concerted suppression of all starch branching enzyme genes in barley produces amylose-only starch granules
    Article Snippet: Paragraph title: Transgenic construct design and barley transformation ... The resulting vector (pENTRY4-SBE-RNAi) was confirmed by direct sequencing, and recombined by LR clonase (Invitrogen) into the RNAi vector pSTARGATE by the following protocol (1 uL pSTARGATE vector (140 ng), 3 uL pENTR4-SBE-RNAi (240 ng), 4 uL LR Clonase, 4 uL TE Buffer pH 8.0, incubated at room-temperature for 18 hours.

    Article Title: Profiling Synaptic Proteins Identifies Regulators of Insulin Secretion and Lifespan
    Article Snippet: .. For the following constructs, entry clones from the ORFeome project corresponding to the gene used was cloned into the destination vector KP#1284 using the gateway strategy with LR clonase (Invitrogen): pDS178 Punc-129::gelsolin::Venus and KP#1496 Punc-129::ins-22::Venus . .. KP#708 Pttx-3::mRFP or pPD118.33 Pmyo-2::GFP were used as transgenic markers.

    Article Title: Host-Pathogen Interaction Profiling Using Self-Assembling Human Protein Arrays
    Article Snippet: .. Plasmids for production of GFP-tagged Rab1B, Rab8B, Rab10, Rab27A, and OCEL1 were constructed by recombining pDONR221 plasmids containing each individual gene (DNASU DNA plasmid repository, ) with pcDNA6.2/N-EmGFP-DEST (Life Technologies) using LR Clonase (Life Technologies). .. For the expression of mCherry-tagged LidA, a DNA fragment containing the lidA open reading frame was amplified by PCR using the forward primer MMO660 containing an EcoRI restriction site (5’-CGGAATTCTATGGCAAAAGATAAC-3’) and the reverse primer MMO642 containing a BamHI restriction site (5’-CGGTGGATCCCGTGATGTCTTGAATGG-3’).

    Article Title: TelAP1 links telomere complexes with developmental expression site silencing in African trypanosomes
    Article Snippet: .. This plasmid was used in an LR clonase (Invitrogen) recombination reaction with the pTrypRNAiGate vector to generate the final RNAi construct. ..

    Article Title: Endothelial CD99 signals through soluble adenylyl cyclase and PKA to regulate leukocyte transendothelial migration
    Article Snippet: Paragraph title: Cloning of shRNA, CD99, sAC, and ezrin adenoviral constructs. ... These vectors were recombined with the adenoviral vector pAd/PL-DEST (Invitrogen) using LR Clonase (Invitrogen) according to the manufacturer’s guidelines and used to produce adenovirus for transduction according to standard methods ( ).

    Incubation:

    Article Title: Concerted suppression of all starch branching enzyme genes in barley produces amylose-only starch granules
    Article Snippet: .. The resulting vector (pENTRY4-SBE-RNAi) was confirmed by direct sequencing, and recombined by LR clonase (Invitrogen) into the RNAi vector pSTARGATE by the following protocol (1 uL pSTARGATE vector (140 ng), 3 uL pENTR4-SBE-RNAi (240 ng), 4 uL LR Clonase, 4 uL TE Buffer pH 8.0, incubated at room-temperature for 18 hours. ..

    Luciferase:

    Article Title: Improving total saccharification yield of Arabidopsis plants by vessel-specific complementation of caffeoyl shikimate esterase (cse) mutants
    Article Snippet: .. Protoplast transactivation assay The CSE promoter entry clone described above was subcloned via LR Clonase (Invitrogen) into the destination vector pm42GW7 to generate the reporter vector driving the expression of the firefly luciferase gene [ ]. .. The ORF clones of the secondary wall-associated transcription factors were obtained from the Arabidopsis Biological Resource Center (stock numbers U16973, G85333, U86850, DQ446863, DQ056658, and G85140 for MYB46 , MYB83 , MYB63 , MYB85 , SND2 , and KNAT7 , respectively) or cloned from cDNA into pDONR221 (MYB103 , SND1 , and SND3 ) [ ].

    Infection:

    Article Title: The Serine Protease Inhibitor Elafin Maintains Normal Growth Control by Opposing the Mitogenic Effects of Neutrophil Elastase
    Article Snippet: Following sequence validation, elafin pENTR vectors were cloned into the plenti CMV Blast DEST vector (Eric Campeau lab, obtained from the Addgene repository) using LR clonase (Invitrogen). .. Elafin shRNA cells were infected with elafin containing plenti CMV vectors and selected in 20 μg/ml blasticidin and 1 μg/ml puromycin.

    Article Title: (ADP-ribose) polymerase 1 and AMP-activated protein kinase mediate progressive dopaminergic neuronal degeneration in a mouse model of Parkinson's disease
    Article Snippet: Paragraph title: Virus preparation and infection ... AMPKα 2 was PCR-amplified and subcloned into a pAd/CMV/V5-DEST vector (Invitrogen) using a Gateway system with LR clonase (Invitrogen). eGFP cDNA was used as a control after subcloning into a pAd/CMV/V5-DEST vector.

    Article Title: Sensitivity to splicing modulation of BCL2 family genes defines cancer therapeutic strategies for splicing modulators
    Article Snippet: MCL1-L pENTR-D-TOPO and BCL2A1 variant 1 pDONR (GeneCopoeia GC-I0365) were Gateway cloned (LR clonase, Thermo Fisher Scientific) into pINDUCER20 . .. Cells were infected with or without spin infection using Polybrene (Millipore).

    Article Title: Disrupted apical exocytosis of cargo vesicles causes enteropathy in FHL5 patients with Munc18-2 mutations
    Article Snippet: For lentiviral transduction, cDNA was further subcloned via LR clonase into a pCCL-EF1α-BlastiR-DEST lentiviral vector using Gateway Cloning Technology (Invitrogen). .. Viral supernatant was harvested 48 and 72 hours after transfection and directly used for CaCo2 cell infection.

    Expressing:

    Article Title: Improving the Immunogenicity of the Mycobacterium bovis BCG Vaccine by Non-Genetic Bacterial Surface Decoration Using the Avidin-Biotin System
    Article Snippet: Thereafter, OVA DNA ORF was transferred into p17-Avi through site-specific in vitro recombination using the LR clonase (Invitrogen). .. The resulting plasmid, p17-Avi-OVA was transformed into E . coli BL21 and protein expression was induced with IPTG (0.1 M) for 3 h at 37°C.

    Article Title: Concerted suppression of all starch branching enzyme genes in barley produces amylose-only starch granules
    Article Snippet: To secure high expression, the construct was expressed under control of the maize Ubiquitin-2 constitutive promoter (2 kb) [ ]. .. The resulting vector (pENTRY4-SBE-RNAi) was confirmed by direct sequencing, and recombined by LR clonase (Invitrogen) into the RNAi vector pSTARGATE by the following protocol (1 uL pSTARGATE vector (140 ng), 3 uL pENTR4-SBE-RNAi (240 ng), 4 uL LR Clonase, 4 uL TE Buffer pH 8.0, incubated at room-temperature for 18 hours.

    Article Title: Host-Pathogen Interaction Profiling Using Self-Assembling Human Protein Arrays
    Article Snippet: Plasmids for production of GFP-tagged Rab1B, Rab8B, Rab10, Rab27A, and OCEL1 were constructed by recombining pDONR221 plasmids containing each individual gene (DNASU DNA plasmid repository, ) with pcDNA6.2/N-EmGFP-DEST (Life Technologies) using LR Clonase (Life Technologies). .. For the expression of mCherry-tagged LidA, a DNA fragment containing the lidA open reading frame was amplified by PCR using the forward primer MMO660 containing an EcoRI restriction site (5’-CGGAATTCTATGGCAAAAGATAAC-3’) and the reverse primer MMO642 containing a BamHI restriction site (5’-CGGTGGATCCCGTGATGTCTTGAATGG-3’).

    Article Title: Identification of Phosphoinositide-Binding Protein PATELLIN2 as a Substrate of Arabidopsis MPK4 MAP Kinase during Septum Formation in Cytokinesis
    Article Snippet: From this entry clone, the recombinant cDNA was transferred to various destination vectors by LR® clonase (Life Technologies). .. For expression of GST-fused and MBP-fused PATL2 in E. coli , pDEST17 and pDESTMAL, derived from pMAL-c5X, were used as destination vectors, respectively.

    Article Title: Sox9 Increases the Proliferation and Colony-forming Activity of Outer Root Sheath Cells Cultured In Vitro
    Article Snippet: The replication-incompetent adenoviruses were created using Virapower adenovirus expression system (Invitrogen), according to a previously reported method . .. Briefly, site-specific recombination between entry vector and adenoviral destination vector was achieved by LR clonase (Invitrogen).

    Article Title: Improving total saccharification yield of Arabidopsis plants by vessel-specific complementation of caffeoyl shikimate esterase (cse) mutants
    Article Snippet: .. Protoplast transactivation assay The CSE promoter entry clone described above was subcloned via LR Clonase (Invitrogen) into the destination vector pm42GW7 to generate the reporter vector driving the expression of the firefly luciferase gene [ ]. .. The ORF clones of the secondary wall-associated transcription factors were obtained from the Arabidopsis Biological Resource Center (stock numbers U16973, G85333, U86850, DQ446863, DQ056658, and G85140 for MYB46 , MYB83 , MYB63 , MYB85 , SND2 , and KNAT7 , respectively) or cloned from cDNA into pDONR221 (MYB103 , SND1 , and SND3 ) [ ].

    Modification:

    Article Title: Sensitivity to splicing modulation of BCL2 family genes defines cancer therapeutic strategies for splicing modulators
    Article Snippet: MCL1 shRNA 48 (GCATCGAACCATTAGCAGAAA) was cloned into AgeI and EcoRI of the Tet-inducible lentiviral pLKO-iKD-U6 puro vector, modified from pLKO-iKD-H1 puro vector where the H1 promoter was excised and U6 cloned in. .. MCL1-L pENTR-D-TOPO and BCL2A1 variant 1 pDONR (GeneCopoeia GC-I0365) were Gateway cloned (LR clonase, Thermo Fisher Scientific) into pINDUCER20 .

    Transformation Assay:

    Article Title: Improving the Immunogenicity of the Mycobacterium bovis BCG Vaccine by Non-Genetic Bacterial Surface Decoration Using the Avidin-Biotin System
    Article Snippet: Thereafter, OVA DNA ORF was transferred into p17-Avi through site-specific in vitro recombination using the LR clonase (Invitrogen). .. The resulting plasmid, p17-Avi-OVA was transformed into E . coli BL21 and protein expression was induced with IPTG (0.1 M) for 3 h at 37°C.

    Article Title: Saccharomyces cerevisiae Expressing Gp43 Protects Mice against Paracoccidioides brasiliensis Infection
    Article Snippet: The recombined products were transformed in Escherichia coli . .. After a plasmid extraction, ORF containing plasmid DNAs were recombined into a destination vector pBG1805 (described in (24)), using LR Clonase (Invitrogen).

    Article Title: Concerted suppression of all starch branching enzyme genes in barley produces amylose-only starch granules
    Article Snippet: Paragraph title: Transgenic construct design and barley transformation ... The resulting vector (pENTRY4-SBE-RNAi) was confirmed by direct sequencing, and recombined by LR clonase (Invitrogen) into the RNAi vector pSTARGATE by the following protocol (1 uL pSTARGATE vector (140 ng), 3 uL pENTR4-SBE-RNAi (240 ng), 4 uL LR Clonase, 4 uL TE Buffer pH 8.0, incubated at room-temperature for 18 hours.

    Over Expression:

    Article Title: Aicardi-Goutières syndrome gene Rnaseh2c is a metastasis susceptibility gene in breast cancer
    Article Snippet: Paragraph title: Overexpression constructs ... DNA was purified using the QiaQuick Gel extraction kit (Qiagen) and inserted into a Gateway entry vector using LR clonase (Invitrogen) according to the manufacturer’s protocol with an overnight ligation reaction.

    Article Title: Saccharomyces cerevisiae Expressing Gp43 Protects Mice against Paracoccidioides brasiliensis Infection
    Article Snippet: After a plasmid extraction, ORF containing plasmid DNAs were recombined into a destination vector pBG1805 (described in (24)), using LR Clonase (Invitrogen). .. The resulting strain (yMAgp43) was used for protein overexpression.

    Derivative Assay:

    Article Title: Saccharomyces cerevisiae Expressing Gp43 Protects Mice against Paracoccidioides brasiliensis Infection
    Article Snippet: The forward oligonucleotides contained 14 nucleotides derived from the attB1 site and 25 nucleotides contained in the gp43 ORF near to the ATG translation initiator (5’-CAAAAAAGCAGGCTTCATGAATTTTAGTTCTCTTAACCTGG-3’). .. After a plasmid extraction, ORF containing plasmid DNAs were recombined into a destination vector pBG1805 (described in (24)), using LR Clonase (Invitrogen).

    Article Title: Identification of Phosphoinositide-Binding Protein PATELLIN2 as a Substrate of Arabidopsis MPK4 MAP Kinase during Septum Formation in Cytokinesis
    Article Snippet: From this entry clone, the recombinant cDNA was transferred to various destination vectors by LR® clonase (Life Technologies). .. For expression of GST-fused and MBP-fused PATL2 in E. coli , pDEST17 and pDESTMAL, derived from pMAL-c5X, were used as destination vectors, respectively.

    Transfection:

    Article Title: Sensitivity to splicing modulation of BCL2 family genes defines cancer therapeutic strategies for splicing modulators
    Article Snippet: MCL1-L pENTR-D-TOPO and BCL2A1 variant 1 pDONR (GeneCopoeia GC-I0365) were Gateway cloned (LR clonase, Thermo Fisher Scientific) into pINDUCER20 . .. Cells were transfected with 2.4 µg of target pLKO-shRNA or pINDUCER20 plasmid, plus 2.4 µg of pΔ8.91 (packaging), and 0.6 µg VSVG (envelope) using TransIT reagent (Mirus). pINDUCER20+MCL1-L, pINDUCER20 vector, pLKO-iKD-U6 puro+MCL1 shRNA 48, and pLKO-iKD-U6 puro vector viruses were used to infect A549, NCI-H23, NCI-H1568, NCI-H1650, NCI-H1975, and NCI-H2110. pLKO-iKD-H1 puro+BCLxL shRNA 1 and pLKO-iKD-H1 puro viruses were used to infect A549, NCI-H23, NCI-H1568, and NCI-H2110. pINDUCER20+BCL2A1 and pINDUCER20 vector viruses were used to infect HT144 and COLO829.

    Article Title: Sox9 Increases the Proliferation and Colony-forming Activity of Outer Root Sheath Cells Cultured In Vitro
    Article Snippet: Briefly, site-specific recombination between entry vector and adenoviral destination vector was achieved by LR clonase (Invitrogen). .. The resulting adenoviral expression vector was then transfected into 293A cells using Lipofectamine 2000 (Invitrogen).

    Article Title: Disrupted apical exocytosis of cargo vesicles causes enteropathy in FHL5 patients with Munc18-2 mutations
    Article Snippet: For lentiviral transduction, cDNA was further subcloned via LR clonase into a pCCL-EF1α-BlastiR-DEST lentiviral vector using Gateway Cloning Technology (Invitrogen). .. Viral supernatant was harvested 48 and 72 hours after transfection and directly used for CaCo2 cell infection.

    Sequencing:

    Article Title: The Serine Protease Inhibitor Elafin Maintains Normal Growth Control by Opposing the Mitogenic Effects of Neutrophil Elastase
    Article Snippet: .. Following sequence validation, elafin pENTR vectors were cloned into the plenti CMV Blast DEST vector (Eric Campeau lab, obtained from the Addgene repository) using LR clonase (Invitrogen). .. Viral packaging was performed as described for lentiviral shRNA vectors.

    Article Title: Improving the Immunogenicity of the Mycobacterium bovis BCG Vaccine by Non-Genetic Bacterial Surface Decoration Using the Avidin-Biotin System
    Article Snippet: DNA sequence corresponding to OVA polypeptide757-1035 ( ) was PCR-amplified with 3’ and 5’ primers flanked with att B1 and att B2 sequences respectively , using pUC57-OVA plasmid (GenScript, Piscataway, NJ) as template. .. Thereafter, OVA DNA ORF was transferred into p17-Avi through site-specific in vitro recombination using the LR clonase (Invitrogen).

    Article Title: Concerted suppression of all starch branching enzyme genes in barley produces amylose-only starch granules
    Article Snippet: .. The resulting vector (pENTRY4-SBE-RNAi) was confirmed by direct sequencing, and recombined by LR clonase (Invitrogen) into the RNAi vector pSTARGATE by the following protocol (1 uL pSTARGATE vector (140 ng), 3 uL pENTR4-SBE-RNAi (240 ng), 4 uL LR Clonase, 4 uL TE Buffer pH 8.0, incubated at room-temperature for 18 hours. ..

    Article Title: Improving total saccharification yield of Arabidopsis plants by vessel-specific complementation of caffeoyl shikimate esterase (cse) mutants
    Article Snippet: Protoplast transactivation assay The CSE promoter entry clone described above was subcloned via LR Clonase (Invitrogen) into the destination vector pm42GW7 to generate the reporter vector driving the expression of the firefly luciferase gene [ ]. .. The coding sequence of MYB52 was PCR-amplified from wild-type cDNA (primers in Additional file ) and cloned into pDONR221.

    Ligation:

    Article Title: Aicardi-Goutières syndrome gene Rnaseh2c is a metastasis susceptibility gene in breast cancer
    Article Snippet: .. DNA was purified using the QiaQuick Gel extraction kit (Qiagen) and inserted into a Gateway entry vector using LR clonase (Invitrogen) according to the manufacturer’s protocol with an overnight ligation reaction. .. Virus transduction 1 x 106 HEK293T cells were plated in 6 cm dishes 24 hr prior to transfection in P/S-free 10% FBS DMEM media.

    Protease Inhibitor:

    Article Title: The Serine Protease Inhibitor Elafin Maintains Normal Growth Control by Opposing the Mitogenic Effects of Neutrophil Elastase
    Article Snippet: The M25G mutation to the protease inhibitor domain ( ) was created via the same method. .. Following sequence validation, elafin pENTR vectors were cloned into the plenti CMV Blast DEST vector (Eric Campeau lab, obtained from the Addgene repository) using LR clonase (Invitrogen).

    Cell Culture:

    Article Title: Sox9 Increases the Proliferation and Colony-forming Activity of Outer Root Sheath Cells Cultured In Vitro
    Article Snippet: Total RNA was isolated from cultured ORS cells using Easy-blue RNA extraction kit (Intron, Daejeon, Korea). .. Briefly, site-specific recombination between entry vector and adenoviral destination vector was achieved by LR clonase (Invitrogen).

    DNA Sequencing:

    Article Title: Improving total saccharification yield of Arabidopsis plants by vessel-specific complementation of caffeoyl shikimate esterase (cse) mutants
    Article Snippet: Protoplast transactivation assay The CSE promoter entry clone described above was subcloned via LR Clonase (Invitrogen) into the destination vector pm42GW7 to generate the reporter vector driving the expression of the firefly luciferase gene [ ]. .. After confirmation of sequence identity by DNA sequencing, the entry clones were subcloned into the destination vector p2GW7 to generate the effector vectors, in which a constitutive CaMV 35S promoter drives the expression of the secondary cell wall transcription factor genes.

    Polymerase Chain Reaction:

    Article Title: Improving the Immunogenicity of the Mycobacterium bovis BCG Vaccine by Non-Genetic Bacterial Surface Decoration Using the Avidin-Biotin System
    Article Snippet: The resulting PCR product was used for directional cloning into pDONR-221 using BP clonase (Invitrogen) to obtain pDONR-OVA. .. Thereafter, OVA DNA ORF was transferred into p17-Avi through site-specific in vitro recombination using the LR clonase (Invitrogen).

    Article Title: (ADP-ribose) polymerase 1 and AMP-activated protein kinase mediate progressive dopaminergic neuronal degeneration in a mouse model of Parkinson's disease
    Article Snippet: .. AMPKα 2 was PCR-amplified and subcloned into a pAd/CMV/V5-DEST vector (Invitrogen) using a Gateway system with LR clonase (Invitrogen). eGFP cDNA was used as a control after subcloning into a pAd/CMV/V5-DEST vector. .. Infected 293 cells from 25 to 50 15-cm tissue culture plates were collected and centrifuged in a Beckman CS-6R desktop centrifuge (Brea, CA, USA) at 1500 r.p.m. for 5 min.

    Article Title: Saccharomyces cerevisiae Expressing Gp43 Protects Mice against Paracoccidioides brasiliensis Infection
    Article Snippet: PCR products were recombined into the Gateway vector pDONR 201 using BP Clonase (Invitrogen). .. After a plasmid extraction, ORF containing plasmid DNAs were recombined into a destination vector pBG1805 (described in (24)), using LR Clonase (Invitrogen).

    Article Title: Host-Pathogen Interaction Profiling Using Self-Assembling Human Protein Arrays
    Article Snippet: Plasmid pGEX6p1- sidM was used as a template for PCR amplification with mutation-directing primers MMO325 (5'-GCCACTGAGTATAGTGCGCTAGCTGCCTTTGTTATTGTT-3') and MMO326 (5'-AACAATAACAAAGGCAGCTAGCGCACTATACTCAGTGGC-3') to generate plasmid pGEX6p1- sidM D110/112A . .. Plasmids for production of GFP-tagged Rab1B, Rab8B, Rab10, Rab27A, and OCEL1 were constructed by recombining pDONR221 plasmids containing each individual gene (DNASU DNA plasmid repository, ) with pcDNA6.2/N-EmGFP-DEST (Life Technologies) using LR Clonase (Life Technologies).

    Article Title: TelAP1 links telomere complexes with developmental expression site silencing in African trypanosomes
    Article Snippet: The polymerase chain reaction (PCR) product was inserted into the intermediate vector pDONR207 by a BP clonase reaction (Invitrogen). .. This plasmid was used in an LR clonase (Invitrogen) recombination reaction with the pTrypRNAiGate vector to generate the final RNAi construct.

    Article Title: Sensitivity to splicing modulation of BCL2 family genes defines cancer therapeutic strategies for splicing modulators
    Article Snippet: MCL1-L cDNA (EX-Y4182-Lv105, Genecopoeia) was PCR amplified using MCl1-pENTR D TOPO.KOZAK.v1-F (CACCATGTTTGGCCTCAAAAGAAAC) and MCl1-L D TOPO.v1-R (CTATCTTATTAGATATGCCAAACCAGC) primers using PfuUltra II HotStart Master Mix (Agilent) and cloned into pENTR-D-TOPO. .. MCL1-L pENTR-D-TOPO and BCL2A1 variant 1 pDONR (GeneCopoeia GC-I0365) were Gateway cloned (LR clonase, Thermo Fisher Scientific) into pINDUCER20 .

    Article Title: Sox9 Increases the Proliferation and Colony-forming Activity of Outer Root Sheath Cells Cultured In Vitro
    Article Snippet: Aliquot of RT mixture was subjected to polymerase chain reaction (PCR) cycles with primers for Sox9 (5'-GCAACCGGATCCATGAATCTCCTGGACCCCTT and 5'-GCAACCGGATCCTCAAGGTCGAGTGAGCTGT). .. Briefly, site-specific recombination between entry vector and adenoviral destination vector was achieved by LR clonase (Invitrogen).

    Article Title: Improving total saccharification yield of Arabidopsis plants by vessel-specific complementation of caffeoyl shikimate esterase (cse) mutants
    Article Snippet: Protoplast transactivation assay The CSE promoter entry clone described above was subcloned via LR Clonase (Invitrogen) into the destination vector pm42GW7 to generate the reporter vector driving the expression of the firefly luciferase gene [ ]. .. The coding sequence of MYB52 was PCR-amplified from wild-type cDNA (primers in Additional file ) and cloned into pDONR221.

    Article Title: Disrupted apical exocytosis of cargo vesicles causes enteropathy in FHL5 patients with Munc18-2 mutations
    Article Snippet: The “d232” deletion was introduced via PCR-based mutagenesis. .. For lentiviral transduction, cDNA was further subcloned via LR clonase into a pCCL-EF1α-BlastiR-DEST lentiviral vector using Gateway Cloning Technology (Invitrogen).

    Injection:

    Article Title: (ADP-ribose) polymerase 1 and AMP-activated protein kinase mediate progressive dopaminergic neuronal degeneration in a mouse model of Parkinson's disease
    Article Snippet: AMPKα 2 was PCR-amplified and subcloned into a pAd/CMV/V5-DEST vector (Invitrogen) using a Gateway system with LR clonase (Invitrogen). eGFP cDNA was used as a control after subcloning into a pAd/CMV/V5-DEST vector. .. Cell lysates were clarified to remove cellular debris by centrifugation in a Beckman CS-6R at 3000 r.p.m. for 10 min. For stereotaxic injection, virus particles were concentrated, and 1 × 1012 particles/ml and 1.5 μ l viral solution were injected into the right striatum (anterior, +0.06 mm; medial, −0.22 mm; dorsal, −0.35 mm relative to bregma) with a 30-gauge microsyringe at a rate of 0.5 μ l/min.

    Article Title: Profiling Synaptic Proteins Identifies Regulators of Insulin Secretion and Lifespan
    Article Snippet: For the following constructs, entry clones from the ORFeome project corresponding to the gene used was cloned into the destination vector KP#1284 using the gateway strategy with LR clonase (Invitrogen): pDS178 Punc-129::gelsolin::Venus and KP#1496 Punc-129::ins-22::Venus . .. Presynaptic marker constructs were injected at 10–25ng/ul, and transgenic markers were injected at 50 ng/µl for KP#708 and 10 ng/µl for pPD118.33.

    Recombinant:

    Article Title: Host-Pathogen Interaction Profiling Using Self-Assembling Human Protein Arrays
    Article Snippet: Plasmids for production and purification of recombinant His-tagged LidA and SidM in Escherichia coli were constructed by recombining pDONR221 plasmids containing the lidA or sidM open reading frame (gift of R. Isberg, Tufts University) with pDEST17 (Life Technologies), encoding an N-terminal His6 fusion, using LR clonase (Life Technologies). .. Plasmids for production of GFP-tagged Rab1B, Rab8B, Rab10, Rab27A, and OCEL1 were constructed by recombining pDONR221 plasmids containing each individual gene (DNASU DNA plasmid repository, ) with pcDNA6.2/N-EmGFP-DEST (Life Technologies) using LR Clonase (Life Technologies).

    Article Title: Identification of Phosphoinositide-Binding Protein PATELLIN2 as a Substrate of Arabidopsis MPK4 MAP Kinase during Septum Formation in Cytokinesis
    Article Snippet: .. From this entry clone, the recombinant cDNA was transferred to various destination vectors by LR® clonase (Life Technologies). .. For expression of GST-fused and MBP-fused PATL2 in E. coli , pDEST17 and pDESTMAL, derived from pMAL-c5X, were used as destination vectors, respectively.

    Article Title: Sox9 Increases the Proliferation and Colony-forming Activity of Outer Root Sheath Cells Cultured In Vitro
    Article Snippet: Briefly, site-specific recombination between entry vector and adenoviral destination vector was achieved by LR clonase (Invitrogen). .. Cells were grown until 80% cytopathic effect was seen, then harvested for preparation of recombinant adenovirus.

    Mutagenesis:

    Article Title: The Serine Protease Inhibitor Elafin Maintains Normal Growth Control by Opposing the Mitogenic Effects of Neutrophil Elastase
    Article Snippet: The M25G mutation to the protease inhibitor domain ( ) was created via the same method. .. Following sequence validation, elafin pENTR vectors were cloned into the plenti CMV Blast DEST vector (Eric Campeau lab, obtained from the Addgene repository) using LR clonase (Invitrogen).

    Article Title: (ADP-ribose) polymerase 1 and AMP-activated protein kinase mediate progressive dopaminergic neuronal degeneration in a mouse model of Parkinson's disease
    Article Snippet: Virus preparation and infection Adenovirus carrying dominant-negative mutant AMPKα 2 cDNA (DN-AMPK; kindly provided by Dr. Joohun Ha, Kyung Hee University School of Medicine, Seoul, Korea) was prepared using a ViraPower adenovirus expression system (Invitrogen, Carlsbad, CA, USA). .. AMPKα 2 was PCR-amplified and subcloned into a pAd/CMV/V5-DEST vector (Invitrogen) using a Gateway system with LR clonase (Invitrogen). eGFP cDNA was used as a control after subcloning into a pAd/CMV/V5-DEST vector.

    Article Title: Host-Pathogen Interaction Profiling Using Self-Assembling Human Protein Arrays
    Article Snippet: These primers were also used to generate pmCherry-C1- sidM D110/112A by site-directed mutagenesis. .. Plasmids for production of GFP-tagged Rab1B, Rab8B, Rab10, Rab27A, and OCEL1 were constructed by recombining pDONR221 plasmids containing each individual gene (DNASU DNA plasmid repository, ) with pcDNA6.2/N-EmGFP-DEST (Life Technologies) using LR Clonase (Life Technologies).

    Article Title: Disrupted apical exocytosis of cargo vesicles causes enteropathy in FHL5 patients with Munc18-2 mutations
    Article Snippet: The “d232” deletion was introduced via PCR-based mutagenesis. .. For lentiviral transduction, cDNA was further subcloned via LR clonase into a pCCL-EF1α-BlastiR-DEST lentiviral vector using Gateway Cloning Technology (Invitrogen).

    Article Title: Endothelial CD99 signals through soluble adenylyl cyclase and PKA to regulate leukocyte transendothelial migration
    Article Snippet: These vectors were recombined with the adenoviral vector pAd/PL-DEST (Invitrogen) using LR Clonase (Invitrogen) according to the manufacturer’s guidelines and used to produce adenovirus for transduction according to standard methods ( ). .. Site-directed mutagenesis was then performed to generate the CD99-GFP cytoplasmic tail mutants.

    Isolation:

    Article Title: Sox9 Increases the Proliferation and Colony-forming Activity of Outer Root Sheath Cells Cultured In Vitro
    Article Snippet: Total RNA was isolated from cultured ORS cells using Easy-blue RNA extraction kit (Intron, Daejeon, Korea). .. Briefly, site-specific recombination between entry vector and adenoviral destination vector was achieved by LR clonase (Invitrogen).

    Subcloning:

    Article Title: (ADP-ribose) polymerase 1 and AMP-activated protein kinase mediate progressive dopaminergic neuronal degeneration in a mouse model of Parkinson's disease
    Article Snippet: .. AMPKα 2 was PCR-amplified and subcloned into a pAd/CMV/V5-DEST vector (Invitrogen) using a Gateway system with LR clonase (Invitrogen). eGFP cDNA was used as a control after subcloning into a pAd/CMV/V5-DEST vector. .. Infected 293 cells from 25 to 50 15-cm tissue culture plates were collected and centrifuged in a Beckman CS-6R desktop centrifuge (Brea, CA, USA) at 1500 r.p.m. for 5 min.

    Purification:

    Article Title: Improving the Immunogenicity of the Mycobacterium bovis BCG Vaccine by Non-Genetic Bacterial Surface Decoration Using the Avidin-Biotin System
    Article Snippet: Thereafter, OVA DNA ORF was transferred into p17-Avi through site-specific in vitro recombination using the LR clonase (Invitrogen). .. Bacteria were lysed and 6x-histidine-Avi-OVA protein was purified from the inclusion bodies fraction using Ni-NTA columns (Qiagen, Toronto, Ontario, Canada).

    Article Title: Aicardi-Goutières syndrome gene Rnaseh2c is a metastasis susceptibility gene in breast cancer
    Article Snippet: .. DNA was purified using the QiaQuick Gel extraction kit (Qiagen) and inserted into a Gateway entry vector using LR clonase (Invitrogen) according to the manufacturer’s protocol with an overnight ligation reaction. .. Virus transduction 1 x 106 HEK293T cells were plated in 6 cm dishes 24 hr prior to transfection in P/S-free 10% FBS DMEM media.

    Article Title: Concerted suppression of all starch branching enzyme genes in barley produces amylose-only starch granules
    Article Snippet: The resulting vector (pENTRY4-SBE-RNAi) was confirmed by direct sequencing, and recombined by LR clonase (Invitrogen) into the RNAi vector pSTARGATE by the following protocol (1 uL pSTARGATE vector (140 ng), 3 uL pENTR4-SBE-RNAi (240 ng), 4 uL LR Clonase, 4 uL TE Buffer pH 8.0, incubated at room-temperature for 18 hours. .. Plasmid DNA was purified by a ‘Fastplasmid Mini Kit’ as described by the manufacturer (5Prime, Germany) and analyzed by restriction enzyme digestion (BamHI or SmaI).

    Article Title: Host-Pathogen Interaction Profiling Using Self-Assembling Human Protein Arrays
    Article Snippet: Plasmids for production and purification of recombinant His-tagged LidA and SidM in Escherichia coli were constructed by recombining pDONR221 plasmids containing the lidA or sidM open reading frame (gift of R. Isberg, Tufts University) with pDEST17 (Life Technologies), encoding an N-terminal His6 fusion, using LR clonase (Life Technologies). .. Plasmids for production of GFP-tagged Rab1B, Rab8B, Rab10, Rab27A, and OCEL1 were constructed by recombining pDONR221 plasmids containing each individual gene (DNASU DNA plasmid repository, ) with pcDNA6.2/N-EmGFP-DEST (Life Technologies) using LR Clonase (Life Technologies).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Identification of Phosphoinositide-Binding Protein PATELLIN2 as a Substrate of Arabidopsis MPK4 MAP Kinase during Septum Formation in Cytokinesis
    Article Snippet: Construction of plasmids The cDNA for PATL2 was cloned by RT–PCR with primers 5′-ACAAGTTTGTACAAAAAAGCAGGCTTCATGGCTCAAGAAGAGATACAG-3′ and 5′-ACCACTTTGTACAAGAAAGCTGGGTATGCTTGGGTTTTGGACCT-3′. .. From this entry clone, the recombinant cDNA was transferred to various destination vectors by LR® clonase (Life Technologies).

    Transactivation Assay:

    Article Title: Improving total saccharification yield of Arabidopsis plants by vessel-specific complementation of caffeoyl shikimate esterase (cse) mutants
    Article Snippet: .. Protoplast transactivation assay The CSE promoter entry clone described above was subcloned via LR Clonase (Invitrogen) into the destination vector pm42GW7 to generate the reporter vector driving the expression of the firefly luciferase gene [ ]. .. The ORF clones of the secondary wall-associated transcription factors were obtained from the Arabidopsis Biological Resource Center (stock numbers U16973, G85333, U86850, DQ446863, DQ056658, and G85140 for MYB46 , MYB83 , MYB63 , MYB85 , SND2 , and KNAT7 , respectively) or cloned from cDNA into pDONR221 (MYB103 , SND1 , and SND3 ) [ ].

    Plasmid Preparation:

    Article Title: The Serine Protease Inhibitor Elafin Maintains Normal Growth Control by Opposing the Mitogenic Effects of Neutrophil Elastase
    Article Snippet: .. Following sequence validation, elafin pENTR vectors were cloned into the plenti CMV Blast DEST vector (Eric Campeau lab, obtained from the Addgene repository) using LR clonase (Invitrogen). .. Viral packaging was performed as described for lentiviral shRNA vectors.

    Article Title: Improving the Immunogenicity of the Mycobacterium bovis BCG Vaccine by Non-Genetic Bacterial Surface Decoration Using the Avidin-Biotin System
    Article Snippet: DNA sequence corresponding to OVA polypeptide757-1035 ( ) was PCR-amplified with 3’ and 5’ primers flanked with att B1 and att B2 sequences respectively , using pUC57-OVA plasmid (GenScript, Piscataway, NJ) as template. .. Thereafter, OVA DNA ORF was transferred into p17-Avi through site-specific in vitro recombination using the LR clonase (Invitrogen).

    Article Title: (ADP-ribose) polymerase 1 and AMP-activated protein kinase mediate progressive dopaminergic neuronal degeneration in a mouse model of Parkinson's disease
    Article Snippet: .. AMPKα 2 was PCR-amplified and subcloned into a pAd/CMV/V5-DEST vector (Invitrogen) using a Gateway system with LR clonase (Invitrogen). eGFP cDNA was used as a control after subcloning into a pAd/CMV/V5-DEST vector. .. Infected 293 cells from 25 to 50 15-cm tissue culture plates were collected and centrifuged in a Beckman CS-6R desktop centrifuge (Brea, CA, USA) at 1500 r.p.m. for 5 min.

    Article Title: Aicardi-Goutières syndrome gene Rnaseh2c is a metastasis susceptibility gene in breast cancer
    Article Snippet: .. DNA was purified using the QiaQuick Gel extraction kit (Qiagen) and inserted into a Gateway entry vector using LR clonase (Invitrogen) according to the manufacturer’s protocol with an overnight ligation reaction. .. Virus transduction 1 x 106 HEK293T cells were plated in 6 cm dishes 24 hr prior to transfection in P/S-free 10% FBS DMEM media.

    Article Title: Saccharomyces cerevisiae Expressing Gp43 Protects Mice against Paracoccidioides brasiliensis Infection
    Article Snippet: .. After a plasmid extraction, ORF containing plasmid DNAs were recombined into a destination vector pBG1805 (described in (24)), using LR Clonase (Invitrogen). .. E . coli was transformed with the recombined plasmid pBG1805_Gp43.

    Article Title: Concerted suppression of all starch branching enzyme genes in barley produces amylose-only starch granules
    Article Snippet: .. The resulting vector (pENTRY4-SBE-RNAi) was confirmed by direct sequencing, and recombined by LR clonase (Invitrogen) into the RNAi vector pSTARGATE by the following protocol (1 uL pSTARGATE vector (140 ng), 3 uL pENTR4-SBE-RNAi (240 ng), 4 uL LR Clonase, 4 uL TE Buffer pH 8.0, incubated at room-temperature for 18 hours. ..

    Article Title: Profiling Synaptic Proteins Identifies Regulators of Insulin Secretion and Lifespan
    Article Snippet: .. For the following constructs, entry clones from the ORFeome project corresponding to the gene used was cloned into the destination vector KP#1284 using the gateway strategy with LR clonase (Invitrogen): pDS178 Punc-129::gelsolin::Venus and KP#1496 Punc-129::ins-22::Venus . .. KP#708 Pttx-3::mRFP or pPD118.33 Pmyo-2::GFP were used as transgenic markers.

    Article Title: Host-Pathogen Interaction Profiling Using Self-Assembling Human Protein Arrays
    Article Snippet: .. Plasmids for production of GFP-tagged Rab1B, Rab8B, Rab10, Rab27A, and OCEL1 were constructed by recombining pDONR221 plasmids containing each individual gene (DNASU DNA plasmid repository, ) with pcDNA6.2/N-EmGFP-DEST (Life Technologies) using LR Clonase (Life Technologies). .. For the expression of mCherry-tagged LidA, a DNA fragment containing the lidA open reading frame was amplified by PCR using the forward primer MMO660 containing an EcoRI restriction site (5’-CGGAATTCTATGGCAAAAGATAAC-3’) and the reverse primer MMO642 containing a BamHI restriction site (5’-CGGTGGATCCCGTGATGTCTTGAATGG-3’).

    Article Title: TelAP1 links telomere complexes with developmental expression site silencing in African trypanosomes
    Article Snippet: .. This plasmid was used in an LR clonase (Invitrogen) recombination reaction with the pTrypRNAiGate vector to generate the final RNAi construct. ..

    Article Title: Sensitivity to splicing modulation of BCL2 family genes defines cancer therapeutic strategies for splicing modulators
    Article Snippet: MCL1 shRNA 48 (GCATCGAACCATTAGCAGAAA) was cloned into AgeI and EcoRI of the Tet-inducible lentiviral pLKO-iKD-U6 puro vector, modified from pLKO-iKD-H1 puro vector where the H1 promoter was excised and U6 cloned in. .. MCL1-L pENTR-D-TOPO and BCL2A1 variant 1 pDONR (GeneCopoeia GC-I0365) were Gateway cloned (LR clonase, Thermo Fisher Scientific) into pINDUCER20 .

    Article Title: Sox9 Increases the Proliferation and Colony-forming Activity of Outer Root Sheath Cells Cultured In Vitro
    Article Snippet: .. Briefly, site-specific recombination between entry vector and adenoviral destination vector was achieved by LR clonase (Invitrogen). .. The resulting adenoviral expression vector was then transfected into 293A cells using Lipofectamine 2000 (Invitrogen).

    Article Title: Improving total saccharification yield of Arabidopsis plants by vessel-specific complementation of caffeoyl shikimate esterase (cse) mutants
    Article Snippet: .. Protoplast transactivation assay The CSE promoter entry clone described above was subcloned via LR Clonase (Invitrogen) into the destination vector pm42GW7 to generate the reporter vector driving the expression of the firefly luciferase gene [ ]. .. The ORF clones of the secondary wall-associated transcription factors were obtained from the Arabidopsis Biological Resource Center (stock numbers U16973, G85333, U86850, DQ446863, DQ056658, and G85140 for MYB46 , MYB83 , MYB63 , MYB85 , SND2 , and KNAT7 , respectively) or cloned from cDNA into pDONR221 (MYB103 , SND1 , and SND3 ) [ ].

    Article Title: Disrupted apical exocytosis of cargo vesicles causes enteropathy in FHL5 patients with Munc18-2 mutations
    Article Snippet: .. For lentiviral transduction, cDNA was further subcloned via LR clonase into a pCCL-EF1α-BlastiR-DEST lentiviral vector using Gateway Cloning Technology (Invitrogen). ..

    Article Title: Endothelial CD99 signals through soluble adenylyl cyclase and PKA to regulate leukocyte transendothelial migration
    Article Snippet: .. These vectors were recombined with the adenoviral vector pAd/PL-DEST (Invitrogen) using LR Clonase (Invitrogen) according to the manufacturer’s guidelines and used to produce adenovirus for transduction according to standard methods ( ). .. The full-length CD99-GFP construct and its pCMV promoter were cloned into the pENTR4 vector.

    Dominant Negative Mutation:

    Article Title: (ADP-ribose) polymerase 1 and AMP-activated protein kinase mediate progressive dopaminergic neuronal degeneration in a mouse model of Parkinson's disease
    Article Snippet: Virus preparation and infection Adenovirus carrying dominant-negative mutant AMPKα 2 cDNA (DN-AMPK; kindly provided by Dr. Joohun Ha, Kyung Hee University School of Medicine, Seoul, Korea) was prepared using a ViraPower adenovirus expression system (Invitrogen, Carlsbad, CA, USA). .. AMPKα 2 was PCR-amplified and subcloned into a pAd/CMV/V5-DEST vector (Invitrogen) using a Gateway system with LR clonase (Invitrogen). eGFP cDNA was used as a control after subcloning into a pAd/CMV/V5-DEST vector.

    RNA Extraction:

    Article Title: Sox9 Increases the Proliferation and Colony-forming Activity of Outer Root Sheath Cells Cultured In Vitro
    Article Snippet: Total RNA was isolated from cultured ORS cells using Easy-blue RNA extraction kit (Intron, Daejeon, Korea). .. Briefly, site-specific recombination between entry vector and adenoviral destination vector was achieved by LR clonase (Invitrogen).

    shRNA:

    Article Title: The Serine Protease Inhibitor Elafin Maintains Normal Growth Control by Opposing the Mitogenic Effects of Neutrophil Elastase
    Article Snippet: To create shRNA-resistant elafin, three consecutive codons along the shRNA targeting region were mutated at the wobble position using the Quikchange Lightning site-directed mutagenesis kit (Stratagene). .. Following sequence validation, elafin pENTR vectors were cloned into the plenti CMV Blast DEST vector (Eric Campeau lab, obtained from the Addgene repository) using LR clonase (Invitrogen).

    Article Title: Sensitivity to splicing modulation of BCL2 family genes defines cancer therapeutic strategies for splicing modulators
    Article Snippet: Paragraph title: Cell line engineering with cDNA or shRNA ... MCL1-L pENTR-D-TOPO and BCL2A1 variant 1 pDONR (GeneCopoeia GC-I0365) were Gateway cloned (LR clonase, Thermo Fisher Scientific) into pINDUCER20 .

    Article Title: Endothelial CD99 signals through soluble adenylyl cyclase and PKA to regulate leukocyte transendothelial migration
    Article Snippet: Paragraph title: Cloning of shRNA, CD99, sAC, and ezrin adenoviral constructs. ... These vectors were recombined with the adenoviral vector pAd/PL-DEST (Invitrogen) using LR Clonase (Invitrogen) according to the manufacturer’s guidelines and used to produce adenovirus for transduction according to standard methods ( ).

    In Vitro:

    Article Title: Improving the Immunogenicity of the Mycobacterium bovis BCG Vaccine by Non-Genetic Bacterial Surface Decoration Using the Avidin-Biotin System
    Article Snippet: .. Thereafter, OVA DNA ORF was transferred into p17-Avi through site-specific in vitro recombination using the LR clonase (Invitrogen). .. The resulting plasmid, p17-Avi-OVA was transformed into E . coli BL21 and protein expression was induced with IPTG (0.1 M) for 3 h at 37°C.

    Transgenic Assay:

    Article Title: Concerted suppression of all starch branching enzyme genes in barley produces amylose-only starch granules
    Article Snippet: Paragraph title: Transgenic construct design and barley transformation ... The resulting vector (pENTRY4-SBE-RNAi) was confirmed by direct sequencing, and recombined by LR clonase (Invitrogen) into the RNAi vector pSTARGATE by the following protocol (1 uL pSTARGATE vector (140 ng), 3 uL pENTR4-SBE-RNAi (240 ng), 4 uL LR Clonase, 4 uL TE Buffer pH 8.0, incubated at room-temperature for 18 hours.

    Article Title: Profiling Synaptic Proteins Identifies Regulators of Insulin Secretion and Lifespan
    Article Snippet: For the following constructs, entry clones from the ORFeome project corresponding to the gene used was cloned into the destination vector KP#1284 using the gateway strategy with LR clonase (Invitrogen): pDS178 Punc-129::gelsolin::Venus and KP#1496 Punc-129::ins-22::Venus . .. KP#708 Pttx-3::mRFP or pPD118.33 Pmyo-2::GFP were used as transgenic markers.

    Produced:

    Article Title: Improving the Immunogenicity of the Mycobacterium bovis BCG Vaccine by Non-Genetic Bacterial Surface Decoration Using the Avidin-Biotin System
    Article Snippet: Preparation of mAvidin fusion antigens Initially we produced mAvidin in fusion with OVA surrogate antigen (I-Ab - and H-2Kb -restricted epitopes). .. Thereafter, OVA DNA ORF was transferred into p17-Avi through site-specific in vitro recombination using the LR clonase (Invitrogen).

    Marker:

    Article Title: Profiling Synaptic Proteins Identifies Regulators of Insulin Secretion and Lifespan
    Article Snippet: For the following constructs, entry clones from the ORFeome project corresponding to the gene used was cloned into the destination vector KP#1284 using the gateway strategy with LR clonase (Invitrogen): pDS178 Punc-129::gelsolin::Venus and KP#1496 Punc-129::ins-22::Venus . .. Presynaptic marker constructs were injected at 10–25ng/ul, and transgenic markers were injected at 50 ng/µl for KP#708 and 10 ng/µl for pPD118.33.

    Gel Extraction:

    Article Title: Aicardi-Goutières syndrome gene Rnaseh2c is a metastasis susceptibility gene in breast cancer
    Article Snippet: .. DNA was purified using the QiaQuick Gel extraction kit (Qiagen) and inserted into a Gateway entry vector using LR clonase (Invitrogen) according to the manufacturer’s protocol with an overnight ligation reaction. .. Virus transduction 1 x 106 HEK293T cells were plated in 6 cm dishes 24 hr prior to transfection in P/S-free 10% FBS DMEM media.

    Variant Assay:

    Article Title: Sensitivity to splicing modulation of BCL2 family genes defines cancer therapeutic strategies for splicing modulators
    Article Snippet: .. MCL1-L pENTR-D-TOPO and BCL2A1 variant 1 pDONR (GeneCopoeia GC-I0365) were Gateway cloned (LR clonase, Thermo Fisher Scientific) into pINDUCER20 . ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher lr clonase ii plus
    FOXO3A and FOXO3B can be targeted for deletion independently with the spJCRISPR approach. A. Cartoon depiction of spJCRISPR targeting strategy for FOXO3A and FOXO3B loci. Red indicates 5p and 3p UTRs, green intronic sequence and blue protein coding sequence. Red arrows indicate sgRNAs, black arrows primers used for both RT-PCR and genomic PCR, blue arrows primers used for genomic PCR only and green arrows RT-PCR only. B. A cartoon depiction of the multisite <t>Clonase</t> strategy utilizing modified MuLE entry vectors.
    Lr Clonase Ii Plus, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 47 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lr clonase ii plus/product/Thermo Fisher
    Average 90 stars, based on 47 article reviews
    Price from $9.99 to $1999.99
    lr clonase ii plus - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher gateway lr clonase ii enzyme mix
    FOXO3A and FOXO3B can be targeted for deletion independently with the spJCRISPR approach. A. Cartoon depiction of spJCRISPR targeting strategy for FOXO3A and FOXO3B loci. Red indicates 5p and 3p UTRs, green intronic sequence and blue protein coding sequence. Red arrows indicate sgRNAs, black arrows primers used for both RT-PCR and genomic PCR, blue arrows primers used for genomic PCR only and green arrows RT-PCR only. B. A cartoon depiction of the multisite <t>Clonase</t> strategy utilizing modified MuLE entry vectors.
    Gateway Lr Clonase Ii Enzyme Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 286 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gateway lr clonase ii enzyme mix/product/Thermo Fisher
    Average 90 stars, based on 286 article reviews
    Price from $9.99 to $1999.99
    gateway lr clonase ii enzyme mix - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    99
    Thermo Fisher lr clonase
    FOXO3A and FOXO3B can be targeted for deletion independently with the spJCRISPR approach. A. Cartoon depiction of spJCRISPR targeting strategy for FOXO3A and FOXO3B loci. Red indicates 5p and 3p UTRs, green intronic sequence and blue protein coding sequence. Red arrows indicate sgRNAs, black arrows primers used for both RT-PCR and genomic PCR, blue arrows primers used for genomic PCR only and green arrows RT-PCR only. B. A cartoon depiction of the multisite <t>Clonase</t> strategy utilizing modified MuLE entry vectors.
    Lr Clonase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 687 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lr clonase/product/Thermo Fisher
    Average 99 stars, based on 687 article reviews
    Price from $9.99 to $1999.99
    lr clonase - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    Image Search Results


    FOXO3A and FOXO3B can be targeted for deletion independently with the spJCRISPR approach. A. Cartoon depiction of spJCRISPR targeting strategy for FOXO3A and FOXO3B loci. Red indicates 5p and 3p UTRs, green intronic sequence and blue protein coding sequence. Red arrows indicate sgRNAs, black arrows primers used for both RT-PCR and genomic PCR, blue arrows primers used for genomic PCR only and green arrows RT-PCR only. B. A cartoon depiction of the multisite Clonase strategy utilizing modified MuLE entry vectors.

    Journal: Gene

    Article Title: A Splice Junction-Targeted CRISPR Approach (spJCRISPR) Reveals Human FOXO3B To Be A Protein-Coding Gene

    doi: 10.1016/j.gene.2018.06.048

    Figure Lengend Snippet: FOXO3A and FOXO3B can be targeted for deletion independently with the spJCRISPR approach. A. Cartoon depiction of spJCRISPR targeting strategy for FOXO3A and FOXO3B loci. Red indicates 5p and 3p UTRs, green intronic sequence and blue protein coding sequence. Red arrows indicate sgRNAs, black arrows primers used for both RT-PCR and genomic PCR, blue arrows primers used for genomic PCR only and green arrows RT-PCR only. B. A cartoon depiction of the multisite Clonase strategy utilizing modified MuLE entry vectors.

    Article Snippet: LR Clonase II Plus (Thermo 12538) reactions were performed with 2 μl Clonase LR II Plus, 20 fmoles pLenti X1 Puro DEST, 10 fmoles of each sgRNA pENTR and 10 fmoles of pENTR hCas9D10A all to 10 μl volume in Tris-EDTA (TE) buffer pH 8.

    Techniques: Sequencing, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Modification

    FOXO3A and FOXO3B can be targeted for deletion independently with the spJCRISPR approach. A. Cartoon depiction of spJCRISPR targeting strategy for FOXO3A and FOXO3B loci. Red indicates 5p and 3p UTRs, green intronic sequence and blue protein coding sequence. Red arrows indicate sgRNAs, black arrows primers used for both RT-PCR and genomic PCR, blue arrows primers used for genomic PCR only and green arrows RT-PCR only. B. A cartoon depiction of the multisite Clonase strategy utilizing modified MuLE entry vectors.

    Journal: Gene

    Article Title: A Splice Junction-Targeted CRISPR Approach (spJCRISPR) Reveals Human FOXO3B To Be A Protein-Coding Gene

    doi: 10.1016/j.gene.2018.06.048

    Figure Lengend Snippet: FOXO3A and FOXO3B can be targeted for deletion independently with the spJCRISPR approach. A. Cartoon depiction of spJCRISPR targeting strategy for FOXO3A and FOXO3B loci. Red indicates 5p and 3p UTRs, green intronic sequence and blue protein coding sequence. Red arrows indicate sgRNAs, black arrows primers used for both RT-PCR and genomic PCR, blue arrows primers used for genomic PCR only and green arrows RT-PCR only. B. A cartoon depiction of the multisite Clonase strategy utilizing modified MuLE entry vectors.

    Article Snippet: LR Clonase II (Thermo 11791100) reactions were performed with a modified form of the pInducer20 vector (Addgene #44012) where the Neo resistance cassette was replaced with a blasticidin resistance cassette.

    Techniques: Sequencing, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Modification