longamp  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Name:
    LongAmp Taq PCR Kit
    Description:
    LongAmp Taq PCR Kit 100 rxns
    Catalog Number:
    E5200S
    Price:
    117
    Category:
    Long distance PCR Kits
    Size:
    100 rxns
    Buy from Supplier


    Structured Review

    New England Biolabs longamp
    LongAmp Taq PCR Kit
    LongAmp Taq PCR Kit 100 rxns
    https://www.bioz.com/result/longamp/product/New England Biolabs
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    longamp - by Bioz Stars, 2021-07
    86/100 stars

    Images

    1) Product Images from "In vitro synthesis of gene-length single-stranded DNA"

    Article Title: In vitro synthesis of gene-length single-stranded DNA

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-24677-5

    ssDNA production by aPCR. ( a ) aPCR reactions were assembled with a 50-molar excess of a forward primer for the amplification of a 1,000 nt ssDNA fragment using the M13mp18 ssDNA plasmid as template, and with 10 different polymerases that were tested for highest yield of ssDNA production (upper band: expected dsDNA size is 1,000 bp; lower band: expected ssDNA size is 1,000 nt) as judged by agarose gel electrophoresis (right panel). QuantaBio AccuStart HiFi, polymerase (lane 2, boxed) produced the highest amount without overlapping dsDNA contaminants. 1. Accustart; 2. Accustart HiFi; 3. Accustart II; 4. AccuPrime; 5. GoTaq; 6. DreamTaq; 7. Phusion; 8. Platinum SuperFi; 9. Q5; 10. Tth polymerase. ( b ) Biochemical validation of ssDNA production by incubating 1,000 nt aPCR reaction products with the ssDNA-specific ExoI or S1 nucleases or dsDNA-specific restriction enzymes Eco RI and Nae I (left panel). Agarose gel electrophoresis of the digestion products as labeled by lane (right panel). M: Marker, C: aPCR product control, ExoI: exonuclease I, S1: S1 nuclease, Enz: Eco RI + Nae I. ( c ) NEB LongAmp was used to generate ssDNA up to 15,000 nt long using lambda phage dsDNA as template. Purification of the 10 kb fragment shows a single band of higher molecular weight than the M13mp18 ssDNA (7,249 nt). ( d ) The primer design algorithm aPrime was used to select primers for product sizes between 500 and 3,000 nt using M13mp18 ssDNA as template and the Quantabio Accustart HiFi enzyme. SYBR Safe stained agarose gels illuminated under blue light show dsDNA as yellow bands, while ssDNA show as orange bands.
    Figure Legend Snippet: ssDNA production by aPCR. ( a ) aPCR reactions were assembled with a 50-molar excess of a forward primer for the amplification of a 1,000 nt ssDNA fragment using the M13mp18 ssDNA plasmid as template, and with 10 different polymerases that were tested for highest yield of ssDNA production (upper band: expected dsDNA size is 1,000 bp; lower band: expected ssDNA size is 1,000 nt) as judged by agarose gel electrophoresis (right panel). QuantaBio AccuStart HiFi, polymerase (lane 2, boxed) produced the highest amount without overlapping dsDNA contaminants. 1. Accustart; 2. Accustart HiFi; 3. Accustart II; 4. AccuPrime; 5. GoTaq; 6. DreamTaq; 7. Phusion; 8. Platinum SuperFi; 9. Q5; 10. Tth polymerase. ( b ) Biochemical validation of ssDNA production by incubating 1,000 nt aPCR reaction products with the ssDNA-specific ExoI or S1 nucleases or dsDNA-specific restriction enzymes Eco RI and Nae I (left panel). Agarose gel electrophoresis of the digestion products as labeled by lane (right panel). M: Marker, C: aPCR product control, ExoI: exonuclease I, S1: S1 nuclease, Enz: Eco RI + Nae I. ( c ) NEB LongAmp was used to generate ssDNA up to 15,000 nt long using lambda phage dsDNA as template. Purification of the 10 kb fragment shows a single band of higher molecular weight than the M13mp18 ssDNA (7,249 nt). ( d ) The primer design algorithm aPrime was used to select primers for product sizes between 500 and 3,000 nt using M13mp18 ssDNA as template and the Quantabio Accustart HiFi enzyme. SYBR Safe stained agarose gels illuminated under blue light show dsDNA as yellow bands, while ssDNA show as orange bands.

    Techniques Used: Amplification, Plasmid Preparation, Agarose Gel Electrophoresis, Produced, Labeling, Marker, Purification, Molecular Weight, Staining

    Related Articles

    Variant Assay:

    Article Title: Induction of Stress Granule-Like Structures in Vesicular Stomatitis Virus-Infected Cells
    Article Snippet: Alexa Fluor 594-labeled donkey anti-goat IgG (A-11058), Alexa Fluor 488-labeled donkey anti-mouse IgG (A-21202), Alexa Fluor 488-labeled donkey anti-rabbit IgG (A-21206), Alexa Fluor 647-labeled donkey anti-rabbit IgG (A-31573), Alexa Fluor 594-labeled goat anti-mouse IgG (A-11005), and Alexa Fluor 488-labeled goat anti-rabbit IgG (A-11034) were obtained from Invitrogen. .. Coding sequences of TIA1a (variant 2; ) and TIARb (variant 1; ) were amplified using total RNA from HeLa cells and a LongAmp kit (New England Biolabs) with the specific primers shown in . .. The PCR products were digested with KpnI and EcoRI and were cloned into pcDHA (a plasmid carrying an HA epitope tag) as described previously ( ).

    Amplification:

    Article Title: Induction of Stress Granule-Like Structures in Vesicular Stomatitis Virus-Infected Cells
    Article Snippet: Alexa Fluor 594-labeled donkey anti-goat IgG (A-11058), Alexa Fluor 488-labeled donkey anti-mouse IgG (A-21202), Alexa Fluor 488-labeled donkey anti-rabbit IgG (A-21206), Alexa Fluor 647-labeled donkey anti-rabbit IgG (A-31573), Alexa Fluor 594-labeled goat anti-mouse IgG (A-11005), and Alexa Fluor 488-labeled goat anti-rabbit IgG (A-11034) were obtained from Invitrogen. .. Coding sequences of TIA1a (variant 2; ) and TIARb (variant 1; ) were amplified using total RNA from HeLa cells and a LongAmp kit (New England Biolabs) with the specific primers shown in . .. The PCR products were digested with KpnI and EcoRI and were cloned into pcDHA (a plasmid carrying an HA epitope tag) as described previously ( ).

    Article Title: Viral Small Interfering RNAs Target Host Genes to Mediate Disease Symptoms in Plants A Viral Satellite RNA Induces Yellow Symptoms on Tobacco by Targeting a Gene Involved in Chlorophyll Biosynthesis using the RNA Silencing Machinery
    Article Snippet: This search identified theN. tobacum CHLI cDNA (accessions: U67064 and AF014053) as the “best” match with the Y-Sat sequence. .. Plasmid construction Full-length genomic and cDNA sequences of the CHLI gene were amplified from total DNA and RNA using the NEB Long Amp Taq kit and Qiagen One Step RT-PCR kit respectively according to the manufacturer's instructions. .. The CHLI forward primer ( 5′ ATCTGGTACCAAAATGGCTTCACTACTAGGAACTTCC 3′ ) and reverse primer ( 5′ TCTAGTCTAGAAGCTTAAAACAGCTTAGGCGAAAACCTC 3′ ) were used for both the PCR and RT-PCR reactions.

    Article Title: The gut microbiome of the sea urchin, Lytechinus variegatus, from its natural habitat demonstrates selective attributes of microbial taxa and predictive metabolic profiles
    Article Snippet: An amplicon library was prepared from metacommunity DNA, using unique bar-coded oligonucleotide primers through PCR to amplify the hyper variable region 4 (V4) of the 16S rRNA gene (Kozich et al. ; Kumar et al. ; Caporaso et al. , ), and were as follows: forward primer (515F) V4: 5′-AATGATACGGCGACCACCGAGATCTACACTATGGTAATTGTGTG-CCAGCMGCCGCGGTAA-3′; and reverse primer modified from 806R to include uniquely bar-coded 5′ region and adaptor sequence V4: 5′-CAAGAGAAGACGGCATAC-GAGATNNNNNNAGTCAGTCAGCCGGACTACHVGGGTWTCTAAT-3′ (Eurofins Genomics, Inc., Huntsville, AL, USA) (Kumar et al. ). .. PCR amplification was set up as follows: 10 μL of 5× Reaction Buffer; 1.5 μL (200 μM) of each of the dNTPs; 2 μL (1.5 μM) of each oligonucleotide primer solution; 1.5 μL (5 U) of the LongAmp® enzyme kit (New England Biolabs, Ipswich, MA, USA; catalog no. E5200S); 30 μL (2–5 ng μL–1 ) of the template DNA; and 3 μL of sterile H2 O for a total reaction volume of 50 μL. .. The PCR cycling parameters were as follows: initial denaturation at 94°C for 1 min; 32 cycles of amplification with each cycle consisting of 94°C for 30 s, 50°C for 1 min, 65°C for 1 min; followed by final extension of 65°C for 3 min and a final hold at 4°C.

    Article Title: CpG Methylation, a Parent-of-Origin Effect for Maternal-Biased Transmission of Congenital Myotonic Dystrophy
    Article Snippet: .. For analysis of the expanded CTG, a specific PCR for long fragments followed by Southern blot was performed in DM1 samples as described previously., 10 to 100 pg of DNA was amplified using the LongAmp Taq PCR Kit (New England Biolabs) with 2.5 units LongAmp Taq DNA polymerase, 1x LongAmp buffer (New England Biolabs), 0.2 mM dNTPs, and 0.4 μM of primers DM101 and DM102 (IDT) (sequences in ) in a total reaction volume of 25 μL on a Veriti thermal cycler (Life Technologies). ..

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Identification of Theileria lestoquardi Antigens Recognized by CD8+ T Cells
    Article Snippet: Total RNA was extracted with the Qiagen RNeasy Mini kit from cryopreserved lymphocytes of T . lestoquardi -infected sheep. .. Contaminating DNA was removed with the Turbo DNA-free™ kit (Applied Biosystems) before cDNA synthesis, which was carried out using the AMV LongAmp® Taq RT-PCR kit (New England Biolabs). .. Partial MHC class I sequences were amplified from cDNA samples using class I generic primers 416 (5' CGGCTACGTGGACGACAYG 3') and Cr (5' ATGGGTCACATGTGYCTTTG 3'), which bind within exons 1 and 3 [ ], generating a 500 bp product.

    Article Title: Viral Small Interfering RNAs Target Host Genes to Mediate Disease Symptoms in Plants A Viral Satellite RNA Induces Yellow Symptoms on Tobacco by Targeting a Gene Involved in Chlorophyll Biosynthesis using the RNA Silencing Machinery
    Article Snippet: This search identified theN. tobacum CHLI cDNA (accessions: U67064 and AF014053) as the “best” match with the Y-Sat sequence. .. Plasmid construction Full-length genomic and cDNA sequences of the CHLI gene were amplified from total DNA and RNA using the NEB Long Amp Taq kit and Qiagen One Step RT-PCR kit respectively according to the manufacturer's instructions. .. The CHLI forward primer ( 5′ ATCTGGTACCAAAATGGCTTCACTACTAGGAACTTCC 3′ ) and reverse primer ( 5′ TCTAGTCTAGAAGCTTAAAACAGCTTAGGCGAAAACCTC 3′ ) were used for both the PCR and RT-PCR reactions.

    Homologous Recombination:

    Article Title: Resolving TYK2 locus genotype-to-phenotype differences in autoimmunity
    Article Snippet: .. Successful homologous recombination between vector and endogenous Tyk2 locus was detected by long-range PCR using the 5HR-F2 (5’-GGGGCTCC TGTCTACAGCTC-3’) and 5HR-R2 (5’-TGTCGATCAGGATGATCTGG-3’), and the 3HR-F1 (5’-CGCGGGGATCTCA TGCTGGAGTTC-3’) and 3HR-R1 (5’-CCCATGTGTGTCCCTTGA TCCTGC-3’) primers and the LongAmp™ Taq PCR kit (New England Biolabs). .. Positive clones were further validated by Southern blotting using standard methods with probe amplification using the 5’-GGATCCGA ACATGGTCCCTTGGATGT-3’ and 5’-GCTAGCGGCTTCACCTGTATCCCACT-3’ primers.

    Article Title: Epistatic Interactions Between Mutations of Deoxyribonuclease 1-Like 3 and the Inhibitory Fc Gamma Receptor IIB Result in Very Early and Massive Autoantibodies Against Double-Stranded DNA
    Article Snippet: Standard techniques were used to transfect the V6.5 embryonic stem cell line (kindly provided by R. Jaenisch, Boston) derived from a C57BL/6x129Sv F1 cross ( ). .. Homologous recombination was screened with left arm and right arm primers by PCR using LongAmp® Taq (New England Biolabs) according to the instructions of the manufacturer. ..

    Plasmid Preparation:

    Article Title: Resolving TYK2 locus genotype-to-phenotype differences in autoimmunity
    Article Snippet: .. Successful homologous recombination between vector and endogenous Tyk2 locus was detected by long-range PCR using the 5HR-F2 (5’-GGGGCTCC TGTCTACAGCTC-3’) and 5HR-R2 (5’-TGTCGATCAGGATGATCTGG-3’), and the 3HR-F1 (5’-CGCGGGGATCTCA TGCTGGAGTTC-3’) and 3HR-R1 (5’-CCCATGTGTGTCCCTTGA TCCTGC-3’) primers and the LongAmp™ Taq PCR kit (New England Biolabs). .. Positive clones were further validated by Southern blotting using standard methods with probe amplification using the 5’-GGATCCGA ACATGGTCCCTTGGATGT-3’ and 5’-GCTAGCGGCTTCACCTGTATCCCACT-3’ primers.

    Article Title: Viral Small Interfering RNAs Target Host Genes to Mediate Disease Symptoms in Plants A Viral Satellite RNA Induces Yellow Symptoms on Tobacco by Targeting a Gene Involved in Chlorophyll Biosynthesis using the RNA Silencing Machinery
    Article Snippet: This search identified theN. tobacum CHLI cDNA (accessions: U67064 and AF014053) as the “best” match with the Y-Sat sequence. .. Plasmid construction Full-length genomic and cDNA sequences of the CHLI gene were amplified from total DNA and RNA using the NEB Long Amp Taq kit and Qiagen One Step RT-PCR kit respectively according to the manufacturer's instructions. .. The CHLI forward primer ( 5′ ATCTGGTACCAAAATGGCTTCACTACTAGGAACTTCC 3′ ) and reverse primer ( 5′ TCTAGTCTAGAAGCTTAAAACAGCTTAGGCGAAAACCTC 3′ ) were used for both the PCR and RT-PCR reactions.

    Polymerase Chain Reaction:

    Article Title: Resolving TYK2 locus genotype-to-phenotype differences in autoimmunity
    Article Snippet: .. Successful homologous recombination between vector and endogenous Tyk2 locus was detected by long-range PCR using the 5HR-F2 (5’-GGGGCTCC TGTCTACAGCTC-3’) and 5HR-R2 (5’-TGTCGATCAGGATGATCTGG-3’), and the 3HR-F1 (5’-CGCGGGGATCTCA TGCTGGAGTTC-3’) and 3HR-R1 (5’-CCCATGTGTGTCCCTTGA TCCTGC-3’) primers and the LongAmp™ Taq PCR kit (New England Biolabs). .. Positive clones were further validated by Southern blotting using standard methods with probe amplification using the 5’-GGATCCGA ACATGGTCCCTTGGATGT-3’ and 5’-GCTAGCGGCTTCACCTGTATCCCACT-3’ primers.

    Article Title: Epistatic Interactions Between Mutations of Deoxyribonuclease 1-Like 3 and the Inhibitory Fc Gamma Receptor IIB Result in Very Early and Massive Autoantibodies Against Double-Stranded DNA
    Article Snippet: Standard techniques were used to transfect the V6.5 embryonic stem cell line (kindly provided by R. Jaenisch, Boston) derived from a C57BL/6x129Sv F1 cross ( ). .. Homologous recombination was screened with left arm and right arm primers by PCR using LongAmp® Taq (New England Biolabs) according to the instructions of the manufacturer. ..

    Article Title: Dynamics of genome reorganization during human cardiogenesis reveal an RBM20-dependent splicing factory
    Article Snippet: .. Genomic DNA was extracted using the QIAGEN DNeasy Blood & Tissue Kit, and used as template for PCR with LongAmp Taq (NEB). .. Genomic DNA was extracted using the QIAGEN DNeasy Blood & Tissue Kit, and used as template for PCR with LongAmp Taq (NEB).

    Article Title: The gut microbiome of the sea urchin, Lytechinus variegatus, from its natural habitat demonstrates selective attributes of microbial taxa and predictive metabolic profiles
    Article Snippet: An amplicon library was prepared from metacommunity DNA, using unique bar-coded oligonucleotide primers through PCR to amplify the hyper variable region 4 (V4) of the 16S rRNA gene (Kozich et al. ; Kumar et al. ; Caporaso et al. , ), and were as follows: forward primer (515F) V4: 5′-AATGATACGGCGACCACCGAGATCTACACTATGGTAATTGTGTG-CCAGCMGCCGCGGTAA-3′; and reverse primer modified from 806R to include uniquely bar-coded 5′ region and adaptor sequence V4: 5′-CAAGAGAAGACGGCATAC-GAGATNNNNNNAGTCAGTCAGCCGGACTACHVGGGTWTCTAAT-3′ (Eurofins Genomics, Inc., Huntsville, AL, USA) (Kumar et al. ). .. PCR amplification was set up as follows: 10 μL of 5× Reaction Buffer; 1.5 μL (200 μM) of each of the dNTPs; 2 μL (1.5 μM) of each oligonucleotide primer solution; 1.5 μL (5 U) of the LongAmp® enzyme kit (New England Biolabs, Ipswich, MA, USA; catalog no. E5200S); 30 μL (2–5 ng μL–1 ) of the template DNA; and 3 μL of sterile H2 O for a total reaction volume of 50 μL. .. The PCR cycling parameters were as follows: initial denaturation at 94°C for 1 min; 32 cycles of amplification with each cycle consisting of 94°C for 30 s, 50°C for 1 min, 65°C for 1 min; followed by final extension of 65°C for 3 min and a final hold at 4°C.

    Article Title: CpG Methylation, a Parent-of-Origin Effect for Maternal-Biased Transmission of Congenital Myotonic Dystrophy
    Article Snippet: .. For analysis of the expanded CTG, a specific PCR for long fragments followed by Southern blot was performed in DM1 samples as described previously., 10 to 100 pg of DNA was amplified using the LongAmp Taq PCR Kit (New England Biolabs) with 2.5 units LongAmp Taq DNA polymerase, 1x LongAmp buffer (New England Biolabs), 0.2 mM dNTPs, and 0.4 μM of primers DM101 and DM102 (IDT) (sequences in ) in a total reaction volume of 25 μL on a Veriti thermal cycler (Life Technologies). ..

    Southern Blot:

    Article Title: CpG Methylation, a Parent-of-Origin Effect for Maternal-Biased Transmission of Congenital Myotonic Dystrophy
    Article Snippet: .. For analysis of the expanded CTG, a specific PCR for long fragments followed by Southern blot was performed in DM1 samples as described previously., 10 to 100 pg of DNA was amplified using the LongAmp Taq PCR Kit (New England Biolabs) with 2.5 units LongAmp Taq DNA polymerase, 1x LongAmp buffer (New England Biolabs), 0.2 mM dNTPs, and 0.4 μM of primers DM101 and DM102 (IDT) (sequences in ) in a total reaction volume of 25 μL on a Veriti thermal cycler (Life Technologies). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs crimson longamp taq polymerase
    Derivative dissociation plots produced by different reagents using one microliter of lysate produced by homogenizing one H. armigera leg with 24 H. zea legs in 625 μl of modified squish buffer. (A) Amplification reactions made with KAPA SYBR Fast Master Mix (purple) and NEB <t>LongAmp</t> <t>Taq</t> polymerase and buffer with 2.5 mM MgCl2 (Red). Peaks representing 18S rRNA control amplicon and species-specific amplicons of H. armigera and H. zea are present in all reactions, but melting temperatures were different in two reagents. (B) An enlarged view of the derivative dissociation plot produced by amplification reactions with NEB LongAmp Taq polymerase and buffer. Although variations in dissociation plots between samples were observed, the 3-peak dissociation plot was clearly identifiable.
    Crimson Longamp Taq Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/crimson longamp taq polymerase/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    crimson longamp taq polymerase - by Bioz Stars, 2021-07
    99/100 stars
      Buy from Supplier

    Image Search Results


    Derivative dissociation plots produced by different reagents using one microliter of lysate produced by homogenizing one H. armigera leg with 24 H. zea legs in 625 μl of modified squish buffer. (A) Amplification reactions made with KAPA SYBR Fast Master Mix (purple) and NEB LongAmp Taq polymerase and buffer with 2.5 mM MgCl2 (Red). Peaks representing 18S rRNA control amplicon and species-specific amplicons of H. armigera and H. zea are present in all reactions, but melting temperatures were different in two reagents. (B) An enlarged view of the derivative dissociation plot produced by amplification reactions with NEB LongAmp Taq polymerase and buffer. Although variations in dissociation plots between samples were observed, the 3-peak dissociation plot was clearly identifiable.

    Journal: Journal of Insect Science

    Article Title: Rapid Identification of Helicoverpa armigera and Helicoverpa zea (Lepidoptera: Noctuidae) Using Ribosomal RNA Internal Transcribed Spacer 1

    doi: 10.1093/jisesa/iev137

    Figure Lengend Snippet: Derivative dissociation plots produced by different reagents using one microliter of lysate produced by homogenizing one H. armigera leg with 24 H. zea legs in 625 μl of modified squish buffer. (A) Amplification reactions made with KAPA SYBR Fast Master Mix (purple) and NEB LongAmp Taq polymerase and buffer with 2.5 mM MgCl2 (Red). Peaks representing 18S rRNA control amplicon and species-specific amplicons of H. armigera and H. zea are present in all reactions, but melting temperatures were different in two reagents. (B) An enlarged view of the derivative dissociation plot produced by amplification reactions with NEB LongAmp Taq polymerase and buffer. Although variations in dissociation plots between samples were observed, the 3-peak dissociation plot was clearly identifiable.

    Article Snippet: Initial tests of species-specific fragment amplification were carried out using Crimson LongAmp Taq polymerase with a 45 s initial denaturation step at 95°C followed by 35 cycles of 15 s denaturation at 95°C, 10 s annealing at 60°C, and 30 s extension at 72°C.

    Techniques: Produced, Modification, Amplification

    Effect of DNase I treatment on Taq DNA polymerase-mediated RT-qPCR assay. Taq DNA polymerase purchased from NEB was used to operate CDC SARS-CoV-2 N1, N2, and N3 TaqMan RT-qPCR assays using SARS-CoV-2 viral genomic RNA (panels A-C) or N gene armored RNA (panels D-F) treated with DNase I. Amplification curves shown in panels A-C resulted from 6000 (black traces), 600 (red traces), 60 (blue traces), 6 (pink traces), and 0 (gray traces) copies of SARS-CoV-2 genomic RNA. Amplification curves in panels D-F resulted from 30,000 (black traces), 3,000 (red traces), 300 (blue traces), 30 (pink traces) and 0 (gray traces) copies of N gene armored RNA. Representative Ct values for RT-qPCR amplification of indicated copies of untreated and DNase I treated SARS-CoV-2 genomic RNA and N gene armored RNA are tabulated.

    Journal: bioRxiv

    Article Title: One enzyme reverse transcription qPCR using Taq DNA polymerase

    doi: 10.1101/2020.05.27.120238

    Figure Lengend Snippet: Effect of DNase I treatment on Taq DNA polymerase-mediated RT-qPCR assay. Taq DNA polymerase purchased from NEB was used to operate CDC SARS-CoV-2 N1, N2, and N3 TaqMan RT-qPCR assays using SARS-CoV-2 viral genomic RNA (panels A-C) or N gene armored RNA (panels D-F) treated with DNase I. Amplification curves shown in panels A-C resulted from 6000 (black traces), 600 (red traces), 60 (blue traces), 6 (pink traces), and 0 (gray traces) copies of SARS-CoV-2 genomic RNA. Amplification curves in panels D-F resulted from 30,000 (black traces), 3,000 (red traces), 300 (blue traces), 30 (pink traces) and 0 (gray traces) copies of N gene armored RNA. Representative Ct values for RT-qPCR amplification of indicated copies of untreated and DNase I treated SARS-CoV-2 genomic RNA and N gene armored RNA are tabulated.

    Article Snippet: These results demonstrate that Taq polymerase can generate amplicons from RNA during a normal thermal cycling reaction, and that a pre-incubation step greatly improves detection.

    Techniques: Quantitative RT-PCR, Amplification

    SARS-CoV-2 N1 TaqMan RT-qPCR assays performed using NEB Taq DNA polymerase and N gene armored RNA in indicated buffers. Buffer compositions are detailed in Table 2 . Amplification curves resulting from 3 × 10 5 (black traces), 3 × 10 4 (red traces), 3 × 10 3 (blue traces), 3 × 10 2 (pink traces), 30 (green traces), and 0 (gray) copies of SARS-CoV-2 N gene armored RNA are depicted.

    Journal: bioRxiv

    Article Title: One enzyme reverse transcription qPCR using Taq DNA polymerase

    doi: 10.1101/2020.05.27.120238

    Figure Lengend Snippet: SARS-CoV-2 N1 TaqMan RT-qPCR assays performed using NEB Taq DNA polymerase and N gene armored RNA in indicated buffers. Buffer compositions are detailed in Table 2 . Amplification curves resulting from 3 × 10 5 (black traces), 3 × 10 4 (red traces), 3 × 10 3 (blue traces), 3 × 10 2 (pink traces), 30 (green traces), and 0 (gray) copies of SARS-CoV-2 N gene armored RNA are depicted.

    Article Snippet: These results demonstrate that Taq polymerase can generate amplicons from RNA during a normal thermal cycling reaction, and that a pre-incubation step greatly improves detection.

    Techniques: Quantitative RT-PCR, Amplification

    TaqMan RT-qPCR analysis of SARS-CoV-2 viral genomic RNA and RNaseP armored RNA using Taq DNA polymerase-based one-enzyme assays. CDC SARS-CoV-2 N gene assays, N1, N2, and N3, and RNaseP assay were performed using Taq DNA polymerase from either NEB (panels A-H) or Thermo Fisher (panels I-P). Assays were performed either using the companion commercial buffer (panels A-D and panels I-L) or using Gen 6 A buffer (panels E-H and panels M-P). Amplification curves from 6000 (black traces), 600 (red traces), 60 (blue traces), 6 (pink traces), and 0 (gray traces) copies of viral genomic RNA are depicted in panels A-C, E-G, I-K, and M-O. Amplification curves from 3 × 10 5 (black traces), 3 × 10 4 (red traces), 3 × 10 3 (blue traces), 3 × 10 2 (pink traces) and 0 (gray traces) copies of armored RNaseP RNA are depicted in panes D, H, L, and P.

    Journal: bioRxiv

    Article Title: One enzyme reverse transcription qPCR using Taq DNA polymerase

    doi: 10.1101/2020.05.27.120238

    Figure Lengend Snippet: TaqMan RT-qPCR analysis of SARS-CoV-2 viral genomic RNA and RNaseP armored RNA using Taq DNA polymerase-based one-enzyme assays. CDC SARS-CoV-2 N gene assays, N1, N2, and N3, and RNaseP assay were performed using Taq DNA polymerase from either NEB (panels A-H) or Thermo Fisher (panels I-P). Assays were performed either using the companion commercial buffer (panels A-D and panels I-L) or using Gen 6 A buffer (panels E-H and panels M-P). Amplification curves from 6000 (black traces), 600 (red traces), 60 (blue traces), 6 (pink traces), and 0 (gray traces) copies of viral genomic RNA are depicted in panels A-C, E-G, I-K, and M-O. Amplification curves from 3 × 10 5 (black traces), 3 × 10 4 (red traces), 3 × 10 3 (blue traces), 3 × 10 2 (pink traces) and 0 (gray traces) copies of armored RNaseP RNA are depicted in panes D, H, L, and P.

    Article Snippet: These results demonstrate that Taq polymerase can generate amplicons from RNA during a normal thermal cycling reaction, and that a pre-incubation step greatly improves detection.

    Techniques: Quantitative RT-PCR, Amplification

    DMPK CTG repeat contraction and loss of methylation in the upstream CpG rich region in MSH2KD clonal lines. The top of the graph represents the DMPK CTG repeat region, with the 25 upstream CpG sites (vertical bars) and the CTCF1 site. The methylation levels are shown on the left and CTG repeat length distributions are shown on the right per clonal line of VUB03-DM1 and VUB19-DM1 from passage 4 to passage 20. The X-axis shows the passage number and median CTG repeat size. Methylation is shown for 25 CpG sites and a total of 100 epi-alleles were analyzed per cell passage. Bubble size is relative to the number of epi-alleles with the indicated percentage of CpG methylation, as previously described 19 . The horizontal grey line represents the threshold for non-methylated alleles and is established on methylation levels in non-DM1 individuals as described in Barbé et al. (2017) 19 . All alleles above the threshold are considered as methylated alleles. In the right panel, each dot represents the median (most frequently present) CTG repeat size of one low input LongAmp PCR reaction, spanning the repeat. The horizontal line represents the median for that clonal cell line and passage number. Abbreviations: pas.: passage

    Journal: bioRxiv

    Article Title: MSH2 knock-down shows CTG repeat stability and concomitant upstream demethylation at the DMPK locus in myotonic dystrophy type 1 human embryonic stem cells

    doi: 10.1101/2020.09.25.313197

    Figure Lengend Snippet: DMPK CTG repeat contraction and loss of methylation in the upstream CpG rich region in MSH2KD clonal lines. The top of the graph represents the DMPK CTG repeat region, with the 25 upstream CpG sites (vertical bars) and the CTCF1 site. The methylation levels are shown on the left and CTG repeat length distributions are shown on the right per clonal line of VUB03-DM1 and VUB19-DM1 from passage 4 to passage 20. The X-axis shows the passage number and median CTG repeat size. Methylation is shown for 25 CpG sites and a total of 100 epi-alleles were analyzed per cell passage. Bubble size is relative to the number of epi-alleles with the indicated percentage of CpG methylation, as previously described 19 . The horizontal grey line represents the threshold for non-methylated alleles and is established on methylation levels in non-DM1 individuals as described in Barbé et al. (2017) 19 . All alleles above the threshold are considered as methylated alleles. In the right panel, each dot represents the median (most frequently present) CTG repeat size of one low input LongAmp PCR reaction, spanning the repeat. The horizontal line represents the median for that clonal cell line and passage number. Abbreviations: pas.: passage

    Article Snippet: Twenty to 50pg of DNA was amplified in a 25 µL reaction mix containing 2.5 units LongAmp Taq DNA polymerase, 1x LongAmp buffer (New England Biolabs), 0.2 mM dNTPs (Illustra DNA polymerization mix, GE Healthcare) and 0.4 µM of primers DM101 and DM102 (Integrated DNA Technologies) and 2.5% dimethyl sulphoxide (DMSO).

    Techniques: Methylation, CpG Methylation Assay, Polymerase Chain Reaction

    Thermal shock is crucial for successful PCR amplification from fungal spores. A. fumigatus spores at three different concentrations (8 × 10 8 /ml, 1 × 10 8 /ml, and 5 × 10 7 /ml) were prepared as described in Basic Protocol 1 . 3 µl of spore suspension were used as the DNA template for PCR. ( A ) PCR result from spore suspension subjected to thermal shock of 95°C for 15 min and −80°C for 10 min prior to PCR, as described in Basic Protocol 2 . No thermal shock was done for spore suspensions from Panels B and C . Subsequently, a PCR was run with an initial denaturation step of 95°C for 1 min (A), 5 min (B), or 15 min (C) with primers ITS1 and D2 (expected PCR product ∼1.2 kb) and LongAmp Taq DNA polymerase with PCR conditions described in Basic Protocol 2 . P: positive PCR control amplified from genomic DNA (50 ng) of the A. fumigatus wild‐type strain; N: negative control (no DNA).

    Journal: Current Protocols in Microbiology

    Article Title: Fast and Reliable PCR Amplification from Aspergillus fumigatus Spore Suspension Without Traditional DNA Extraction). Fast and reliable PCR amplification from Aspergillus fumigatus spore suspension without traditional DNA extraction

    doi: 10.1002/cpmc.89

    Figure Lengend Snippet: Thermal shock is crucial for successful PCR amplification from fungal spores. A. fumigatus spores at three different concentrations (8 × 10 8 /ml, 1 × 10 8 /ml, and 5 × 10 7 /ml) were prepared as described in Basic Protocol 1 . 3 µl of spore suspension were used as the DNA template for PCR. ( A ) PCR result from spore suspension subjected to thermal shock of 95°C for 15 min and −80°C for 10 min prior to PCR, as described in Basic Protocol 2 . No thermal shock was done for spore suspensions from Panels B and C . Subsequently, a PCR was run with an initial denaturation step of 95°C for 1 min (A), 5 min (B), or 15 min (C) with primers ITS1 and D2 (expected PCR product ∼1.2 kb) and LongAmp Taq DNA polymerase with PCR conditions described in Basic Protocol 2 . P: positive PCR control amplified from genomic DNA (50 ng) of the A. fumigatus wild‐type strain; N: negative control (no DNA).

    Article Snippet: LongAmp Taq DNA polymerase (New England Biolabs) was used in our experiments with great success.

    Techniques: Polymerase Chain Reaction, Amplification, Negative Control

    Spore PCR using the supernatant from spore suspensions of different filamentous fungi with primers ITS1/D2 (expected PCR band size is ∼1.2 kb) and ITS1/ITS4 (expected PCR band size ∼600 bp). Two different spore concentrations were tested (i.e., 5 × 10 7 /ml and 1 × 10 7 /ml). 1 µl of the supernatant was used in the PCR reaction with the LongAmp Taq DNA polymerase. Positive PCR controls were amplified from DNA (50 ng) of the A. fumigatus wild‐type strain with primers ITS1/D2 (P1) and ITS1/ITS4 (P2). N: negative control (no DNA).

    Journal: Current Protocols in Microbiology

    Article Title: Fast and Reliable PCR Amplification from Aspergillus fumigatus Spore Suspension Without Traditional DNA Extraction). Fast and reliable PCR amplification from Aspergillus fumigatus spore suspension without traditional DNA extraction

    doi: 10.1002/cpmc.89

    Figure Lengend Snippet: Spore PCR using the supernatant from spore suspensions of different filamentous fungi with primers ITS1/D2 (expected PCR band size is ∼1.2 kb) and ITS1/ITS4 (expected PCR band size ∼600 bp). Two different spore concentrations were tested (i.e., 5 × 10 7 /ml and 1 × 10 7 /ml). 1 µl of the supernatant was used in the PCR reaction with the LongAmp Taq DNA polymerase. Positive PCR controls were amplified from DNA (50 ng) of the A. fumigatus wild‐type strain with primers ITS1/D2 (P1) and ITS1/ITS4 (P2). N: negative control (no DNA).

    Article Snippet: LongAmp Taq DNA polymerase (New England Biolabs) was used in our experiments with great success.

    Techniques: Polymerase Chain Reaction, Amplification, Negative Control