longamp taq  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    New England Biolabs longamp taq
    Longamp Taq, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/longamp taq/product/New England Biolabs
    Average 99 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    longamp taq - by Bioz Stars, 2020-03
    99/100 stars

    Images

    Related Articles

    Centrifugation:

    Article Title: Targeted, High-Resolution RNA Sequencing of Non-coding Genomic Regions Associated With Neuropsychiatric Functions
    Article Snippet: Following overnight incubation (∼18 h), 100 μl M-270 Streptavidin Dynabeads (65305, Thermo Fisher) per sample were washed twice with 200 μl 1x wash buffer (SeqCap EZ Hybridization and Wash Kit: 05 634 261 001, Roche), once with 100 μl, and then placed in the thermocycler set to 47° C. Incubated samples (15 μl) were transferred immediately to the beads for 45 min. Non-target DNA was removed through washing the beads with buffers of the SeqCap EZ Hybridization and Wash Kit (05 634 261 001, Roche) as per manufacturer’s instructions with the following modifications: pipette-mixing was replaced by inversion-mixing and brief centrifugation. .. The following PCR reaction was set up: 48 μl sample; 2 μl PRM primers; 50 μl LongAmp Taq 2x master mix (M0287S, NEB).

    Amplification:

    Article Title: Compensatory sequence variation between trans-species small RNAs and their target sites
    Article Snippet: .. Ligation was performed combining the prior reaction with 0.5 μL denatured adapter (NJ411), 5 u RNA Ligase 1 (NEB), 0.25 μL 10x RNA ligase buffer, 10 u RNAse inhibitor, 0.5 μL ATP (10 mM), and water to 15 uL and incubated for 1 hr at 25°C. ( Step 5 ) Reverse transcription was performed immediately following ligation, combining the prior reaction with 100 u Protoscript II reverse transcriptase (NEB), 4.5 μL 5x first strand synthesis buffer, 1 μL dNTPs (10 uM), 1.5 μL DTT (0.1 M), and 10 u RNAse inhibitor equaling 23 μL in total volume and incubated for 1 hr at 50°C followed by heat-killing for 15 min at 70°C. ( Step 6 ) Library amplification was performed, combining 5 μL of cDNA with 25 μL LongAmp Taq 2x master mix (NEB), 1.25 μL SR primer (NJ412, 10 μM), 1.25 μL barcode primer (‘NEB’ primers, 10 μM), and water to 50 μL total volume. ..

    Article Title: A novel method for the multiplexed target enrichment of MinION next generation sequencing libraries using PCR-generated baits
    Article Snippet: .. We amplified the captured Phage Lambda library using the MinION provided primers (PCR primer PR2—3580F, Table ) targeting the ligated PCR-adapters and the LongAmp Taq 2x Master Mix (M0287S, New England BioLabs, Hitchin, UK). .. We added barcoding sequences at the forward primer used in the amplification of E. coli strains O157:H7 and K12/W3110 enriched libraries (PCR primer Bar01_PR2_F, Bar02_PR2_F, Table ).

    Article Title: Targeted, High-Resolution RNA Sequencing of Non-coding Genomic Regions Associated With Neuropsychiatric Functions
    Article Snippet: The following PCR reaction was set up: 48 μl sample; 2 μl PRM primers; 50 μl LongAmp Taq 2x master mix (M0287S, NEB). .. The reaction mixes were split into 50 μl aliquots and amplified with the following thermocycler conditions: initial denaturation at 95° C for 3 min; 22 cycles of 95° C for 15 s, 62° C for 15 s, and 65° C for 10 min; a final extension at 65° C for 10 min; and holding indefinitely at 4° C. Resulting DNA was purified by a 10 min incubation with 70 μl (0.7X) Agencourt AMPure XP beads (A63880, Beckman Coulter), 2 × 200 μl washes with 80% ethanol for 30 s each, 3 min air drying, and elution in 52 μl nuclease-free water.

    Article Title: Efficient CRISPR/Cas9-Mediated Gene Knockin in Mouse Hematopoietic Stem and Progenitor Cells
    Article Snippet: .. The on-target and off-target sites were amplified using LongAmp® Taq 2x master mix (NEB) with gene specific primers ( ). .. PCR products were cleaned using AMPure XP beads (Beckman Coulter).

    DNA Ligation:

    Article Title: Targeted, High-Resolution RNA Sequencing of Non-coding Genomic Regions Associated With Neuropsychiatric Functions
    Article Snippet: The following PCR reaction was set up: 48 μl sample; 2 μl PRM primers; 50 μl LongAmp Taq 2x master mix (M0287S, NEB). .. The captured samples were barcoded using ONT 1D native barcoding genomic DNA kit (EXP-NBD103), and the library prep was performed using the 1D genomic DNA by ligation kit and protocol for the PromethION sequencer (SQK-LSK109).

    Ligation:

    Article Title: Compensatory sequence variation between trans-species small RNAs and their target sites
    Article Snippet: .. Ligation was performed combining the prior reaction with 0.5 μL denatured adapter (NJ411), 5 u RNA Ligase 1 (NEB), 0.25 μL 10x RNA ligase buffer, 10 u RNAse inhibitor, 0.5 μL ATP (10 mM), and water to 15 uL and incubated for 1 hr at 25°C. ( Step 5 ) Reverse transcription was performed immediately following ligation, combining the prior reaction with 100 u Protoscript II reverse transcriptase (NEB), 4.5 μL 5x first strand synthesis buffer, 1 μL dNTPs (10 uM), 1.5 μL DTT (0.1 M), and 10 u RNAse inhibitor equaling 23 μL in total volume and incubated for 1 hr at 50°C followed by heat-killing for 15 min at 70°C. ( Step 6 ) Library amplification was performed, combining 5 μL of cDNA with 25 μL LongAmp Taq 2x master mix (NEB), 1.25 μL SR primer (NJ412, 10 μM), 1.25 μL barcode primer (‘NEB’ primers, 10 μM), and water to 50 μL total volume. ..

    Article Title: Targeted, High-Resolution RNA Sequencing of Non-coding Genomic Regions Associated With Neuropsychiatric Functions
    Article Snippet: Targeted Enrichment and Preparation of ONT Sequencing Libraries Following ligation of the PCR adapters, the 4 samples had the following concentrations: 36.0 ng/μl (SupCol), 25.2 ng/μl (PFC), 30.2 ng/μl (VCx), and 24.6 ng/μl (caudate) according to genomic DNA screentape analysis (5067–5365/5067–5365, Agilent). .. The following PCR reaction was set up: 48 μl sample; 2 μl PRM primers; 50 μl LongAmp Taq 2x master mix (M0287S, NEB).

    Lambda DNA Preparation:

    Article Title: A novel method for the multiplexed target enrichment of MinION next generation sequencing libraries using PCR-generated baits
    Article Snippet: We mixed 500ng of PCR-adapter-ligated Lambda DNA (15ul), 2x Hybridization buffer (final volume/2 ul) and Hybridization component A (final volume/10 ul). .. We amplified the captured Phage Lambda library using the MinION provided primers (PCR primer PR2—3580F, Table ) targeting the ligated PCR-adapters and the LongAmp Taq 2x Master Mix (M0287S, New England BioLabs, Hitchin, UK).

    Sequencing:

    Article Title: Compensatory sequence variation between trans-species small RNAs and their target sites
    Article Snippet: Paragraph title: Sequencing library preparation ... Ligation was performed combining the prior reaction with 0.5 μL denatured adapter (NJ411), 5 u RNA Ligase 1 (NEB), 0.25 μL 10x RNA ligase buffer, 10 u RNAse inhibitor, 0.5 μL ATP (10 mM), and water to 15 uL and incubated for 1 hr at 25°C. ( Step 5 ) Reverse transcription was performed immediately following ligation, combining the prior reaction with 100 u Protoscript II reverse transcriptase (NEB), 4.5 μL 5x first strand synthesis buffer, 1 μL dNTPs (10 uM), 1.5 μL DTT (0.1 M), and 10 u RNAse inhibitor equaling 23 μL in total volume and incubated for 1 hr at 50°C followed by heat-killing for 15 min at 70°C. ( Step 6 ) Library amplification was performed, combining 5 μL of cDNA with 25 μL LongAmp Taq 2x master mix (NEB), 1.25 μL SR primer (NJ412, 10 μM), 1.25 μL barcode primer (‘NEB’ primers, 10 μM), and water to 50 μL total volume.

    Article Title: A novel method for the multiplexed target enrichment of MinION next generation sequencing libraries using PCR-generated baits
    Article Snippet: Finally we ligated the 3’end T-overhanging Y-formed PCR-adapters that were included in the MAP003-MinION gDNA Sequencing Kit (Adapter Short_Y_LI32—LI33, Table ) to the d-A tailed DNA. .. We amplified the captured Phage Lambda library using the MinION provided primers (PCR primer PR2—3580F, Table ) targeting the ligated PCR-adapters and the LongAmp Taq 2x Master Mix (M0287S, New England BioLabs, Hitchin, UK).

    Article Title: Targeted, High-Resolution RNA Sequencing of Non-coding Genomic Regions Associated With Neuropsychiatric Functions
    Article Snippet: Paragraph title: Targeted Enrichment and Preparation of ONT Sequencing Libraries ... The following PCR reaction was set up: 48 μl sample; 2 μl PRM primers; 50 μl LongAmp Taq 2x master mix (M0287S, NEB).

    Transferring:

    Article Title: Targeted, High-Resolution RNA Sequencing of Non-coding Genomic Regions Associated With Neuropsychiatric Functions
    Article Snippet: Following overnight incubation (∼18 h), 100 μl M-270 Streptavidin Dynabeads (65305, Thermo Fisher) per sample were washed twice with 200 μl 1x wash buffer (SeqCap EZ Hybridization and Wash Kit: 05 634 261 001, Roche), once with 100 μl, and then placed in the thermocycler set to 47° C. Incubated samples (15 μl) were transferred immediately to the beads for 45 min. Non-target DNA was removed through washing the beads with buffers of the SeqCap EZ Hybridization and Wash Kit (05 634 261 001, Roche) as per manufacturer’s instructions with the following modifications: pipette-mixing was replaced by inversion-mixing and brief centrifugation. .. The following PCR reaction was set up: 48 μl sample; 2 μl PRM primers; 50 μl LongAmp Taq 2x master mix (M0287S, NEB).

    Blocking Assay:

    Article Title: Targeted, High-Resolution RNA Sequencing of Non-coding Genomic Regions Associated With Neuropsychiatric Functions
    Article Snippet: To prepare the hybridization reaction, 1 μg of each of the samples was combined with 5 μg Cot-1 DNA (15279011, Thermo Fisher) and 1 μl of 1mM blocking oligo (5′ AGGTTAAACACCCAAGCAGACGCCGCAATATCAGCACCAACAGAA 3′) and dried down in a vacuum concentrator for 1 h. The dry contents were resuspended by addition of 7.5 μl hybridization buffer and 3 μl hybridization component A (SeqCap EZ Hybridization and Wash Kit: 05 634 261 001, Roche), mixed by tapping, briefly spun by microfuge, and denatured at 95° C for 10 min. .. The following PCR reaction was set up: 48 μl sample; 2 μl PRM primers; 50 μl LongAmp Taq 2x master mix (M0287S, NEB).

    Purification:

    Article Title: Compensatory sequence variation between trans-species small RNAs and their target sites
    Article Snippet: Ligation was performed combining the prior reaction with 0.5 μL denatured adapter (NJ411), 5 u RNA Ligase 1 (NEB), 0.25 μL 10x RNA ligase buffer, 10 u RNAse inhibitor, 0.5 μL ATP (10 mM), and water to 15 uL and incubated for 1 hr at 25°C. ( Step 5 ) Reverse transcription was performed immediately following ligation, combining the prior reaction with 100 u Protoscript II reverse transcriptase (NEB), 4.5 μL 5x first strand synthesis buffer, 1 μL dNTPs (10 uM), 1.5 μL DTT (0.1 M), and 10 u RNAse inhibitor equaling 23 μL in total volume and incubated for 1 hr at 50°C followed by heat-killing for 15 min at 70°C. ( Step 6 ) Library amplification was performed, combining 5 μL of cDNA with 25 μL LongAmp Taq 2x master mix (NEB), 1.25 μL SR primer (NJ412, 10 μM), 1.25 μL barcode primer (‘NEB’ primers, 10 μM), and water to 50 μL total volume. .. Reactions were purified and size selected for sRNAs 15–40 nt in length by PAGE.

    Article Title: A novel method for the multiplexed target enrichment of MinION next generation sequencing libraries using PCR-generated baits
    Article Snippet: We amplified the captured Phage Lambda library using the MinION provided primers (PCR primer PR2—3580F, Table ) targeting the ligated PCR-adapters and the LongAmp Taq 2x Master Mix (M0287S, New England BioLabs, Hitchin, UK). .. In a post-PCR magnetic separation, we removed the beads and the baits and we purified the remaining PCR product using AMPure XP beads, optimized to select DNA fragments larger that 1000 bp.

    Article Title: Targeted, High-Resolution RNA Sequencing of Non-coding Genomic Regions Associated With Neuropsychiatric Functions
    Article Snippet: The following PCR reaction was set up: 48 μl sample; 2 μl PRM primers; 50 μl LongAmp Taq 2x master mix (M0287S, NEB). .. The reaction mixes were split into 50 μl aliquots and amplified with the following thermocycler conditions: initial denaturation at 95° C for 3 min; 22 cycles of 95° C for 15 s, 62° C for 15 s, and 65° C for 10 min; a final extension at 65° C for 10 min; and holding indefinitely at 4° C. Resulting DNA was purified by a 10 min incubation with 70 μl (0.7X) Agencourt AMPure XP beads (A63880, Beckman Coulter), 2 × 200 μl washes with 80% ethanol for 30 s each, 3 min air drying, and elution in 52 μl nuclease-free water.

    Real-time Polymerase Chain Reaction:

    Article Title: Compensatory sequence variation between trans-species small RNAs and their target sites
    Article Snippet: Ligation was performed combining the prior reaction with 0.5 μL denatured adapter (NJ411), 5 u RNA Ligase 1 (NEB), 0.25 μL 10x RNA ligase buffer, 10 u RNAse inhibitor, 0.5 μL ATP (10 mM), and water to 15 uL and incubated for 1 hr at 25°C. ( Step 5 ) Reverse transcription was performed immediately following ligation, combining the prior reaction with 100 u Protoscript II reverse transcriptase (NEB), 4.5 μL 5x first strand synthesis buffer, 1 μL dNTPs (10 uM), 1.5 μL DTT (0.1 M), and 10 u RNAse inhibitor equaling 23 μL in total volume and incubated for 1 hr at 50°C followed by heat-killing for 15 min at 70°C. ( Step 6 ) Library amplification was performed, combining 5 μL of cDNA with 25 μL LongAmp Taq 2x master mix (NEB), 1.25 μL SR primer (NJ412, 10 μM), 1.25 μL barcode primer (‘NEB’ primers, 10 μM), and water to 50 μL total volume. .. Extracted bands were quantified by qPCR and quality-controlled by high-sensitivity DNA chip (Agilent).

    Polymerase Chain Reaction:

    Article Title: A novel method for the multiplexed target enrichment of MinION next generation sequencing libraries using PCR-generated baits
    Article Snippet: .. We amplified the captured Phage Lambda library using the MinION provided primers (PCR primer PR2—3580F, Table ) targeting the ligated PCR-adapters and the LongAmp Taq 2x Master Mix (M0287S, New England BioLabs, Hitchin, UK). .. We added barcoding sequences at the forward primer used in the amplification of E. coli strains O157:H7 and K12/W3110 enriched libraries (PCR primer Bar01_PR2_F, Bar02_PR2_F, Table ).

    Article Title: Targeted, High-Resolution RNA Sequencing of Non-coding Genomic Regions Associated With Neuropsychiatric Functions
    Article Snippet: .. The following PCR reaction was set up: 48 μl sample; 2 μl PRM primers; 50 μl LongAmp Taq 2x master mix (M0287S, NEB). .. The reaction mixes were split into 50 μl aliquots and amplified with the following thermocycler conditions: initial denaturation at 95° C for 3 min; 22 cycles of 95° C for 15 s, 62° C for 15 s, and 65° C for 10 min; a final extension at 65° C for 10 min; and holding indefinitely at 4° C. Resulting DNA was purified by a 10 min incubation with 70 μl (0.7X) Agencourt AMPure XP beads (A63880, Beckman Coulter), 2 × 200 μl washes with 80% ethanol for 30 s each, 3 min air drying, and elution in 52 μl nuclease-free water.

    Article Title: Efficient CRISPR/Cas9-Mediated Gene Knockin in Mouse Hematopoietic Stem and Progenitor Cells
    Article Snippet: The on-target and off-target sites were amplified using LongAmp® Taq 2x master mix (NEB) with gene specific primers ( ). .. PCR products were cleaned using AMPure XP beads (Beckman Coulter).

    Incubation:

    Article Title: Compensatory sequence variation between trans-species small RNAs and their target sites
    Article Snippet: .. Ligation was performed combining the prior reaction with 0.5 μL denatured adapter (NJ411), 5 u RNA Ligase 1 (NEB), 0.25 μL 10x RNA ligase buffer, 10 u RNAse inhibitor, 0.5 μL ATP (10 mM), and water to 15 uL and incubated for 1 hr at 25°C. ( Step 5 ) Reverse transcription was performed immediately following ligation, combining the prior reaction with 100 u Protoscript II reverse transcriptase (NEB), 4.5 μL 5x first strand synthesis buffer, 1 μL dNTPs (10 uM), 1.5 μL DTT (0.1 M), and 10 u RNAse inhibitor equaling 23 μL in total volume and incubated for 1 hr at 50°C followed by heat-killing for 15 min at 70°C. ( Step 6 ) Library amplification was performed, combining 5 μL of cDNA with 25 μL LongAmp Taq 2x master mix (NEB), 1.25 μL SR primer (NJ412, 10 μM), 1.25 μL barcode primer (‘NEB’ primers, 10 μM), and water to 50 μL total volume. ..

    Article Title: Targeted, High-Resolution RNA Sequencing of Non-coding Genomic Regions Associated With Neuropsychiatric Functions
    Article Snippet: Following overnight incubation (∼18 h), 100 μl M-270 Streptavidin Dynabeads (65305, Thermo Fisher) per sample were washed twice with 200 μl 1x wash buffer (SeqCap EZ Hybridization and Wash Kit: 05 634 261 001, Roche), once with 100 μl, and then placed in the thermocycler set to 47° C. Incubated samples (15 μl) were transferred immediately to the beads for 45 min. Non-target DNA was removed through washing the beads with buffers of the SeqCap EZ Hybridization and Wash Kit (05 634 261 001, Roche) as per manufacturer’s instructions with the following modifications: pipette-mixing was replaced by inversion-mixing and brief centrifugation. .. The following PCR reaction was set up: 48 μl sample; 2 μl PRM primers; 50 μl LongAmp Taq 2x master mix (M0287S, NEB).

    Polyacrylamide Gel Electrophoresis:

    Article Title: Compensatory sequence variation between trans-species small RNAs and their target sites
    Article Snippet: Ligation was performed combining the prior reaction with 0.5 μL denatured adapter (NJ411), 5 u RNA Ligase 1 (NEB), 0.25 μL 10x RNA ligase buffer, 10 u RNAse inhibitor, 0.5 μL ATP (10 mM), and water to 15 uL and incubated for 1 hr at 25°C. ( Step 5 ) Reverse transcription was performed immediately following ligation, combining the prior reaction with 100 u Protoscript II reverse transcriptase (NEB), 4.5 μL 5x first strand synthesis buffer, 1 μL dNTPs (10 uM), 1.5 μL DTT (0.1 M), and 10 u RNAse inhibitor equaling 23 μL in total volume and incubated for 1 hr at 50°C followed by heat-killing for 15 min at 70°C. ( Step 6 ) Library amplification was performed, combining 5 μL of cDNA with 25 μL LongAmp Taq 2x master mix (NEB), 1.25 μL SR primer (NJ412, 10 μM), 1.25 μL barcode primer (‘NEB’ primers, 10 μM), and water to 50 μL total volume. .. Reactions were purified and size selected for sRNAs 15–40 nt in length by PAGE.

    Modification:

    Article Title: A novel method for the multiplexed target enrichment of MinION next generation sequencing libraries using PCR-generated baits
    Article Snippet: The hybridization of the pooled biotin-baits with the PCR-adapter-ligated DNA was based on the protocol of SeqCap Hybridization and Wash Kit (05634261001, Roche Diagnostics, Indianapolis, IN, USA), after the modification of the initial hybridization mixture. .. We amplified the captured Phage Lambda library using the MinION provided primers (PCR primer PR2—3580F, Table ) targeting the ligated PCR-adapters and the LongAmp Taq 2x Master Mix (M0287S, New England BioLabs, Hitchin, UK).

    Chromatin Immunoprecipitation:

    Article Title: Compensatory sequence variation between trans-species small RNAs and their target sites
    Article Snippet: Ligation was performed combining the prior reaction with 0.5 μL denatured adapter (NJ411), 5 u RNA Ligase 1 (NEB), 0.25 μL 10x RNA ligase buffer, 10 u RNAse inhibitor, 0.5 μL ATP (10 mM), and water to 15 uL and incubated for 1 hr at 25°C. ( Step 5 ) Reverse transcription was performed immediately following ligation, combining the prior reaction with 100 u Protoscript II reverse transcriptase (NEB), 4.5 μL 5x first strand synthesis buffer, 1 μL dNTPs (10 uM), 1.5 μL DTT (0.1 M), and 10 u RNAse inhibitor equaling 23 μL in total volume and incubated for 1 hr at 50°C followed by heat-killing for 15 min at 70°C. ( Step 6 ) Library amplification was performed, combining 5 μL of cDNA with 25 μL LongAmp Taq 2x master mix (NEB), 1.25 μL SR primer (NJ412, 10 μM), 1.25 μL barcode primer (‘NEB’ primers, 10 μM), and water to 50 μL total volume. .. Extracted bands were quantified by qPCR and quality-controlled by high-sensitivity DNA chip (Agilent).

    Hybridization:

    Article Title: Compensatory sequence variation between trans-species small RNAs and their target sites
    Article Snippet: Entire reaction was combined with premixed 100 u RNA Ligase 2, truncated KQ (NEB), 1 μL 10x T4 RNA reaction buffer, 10 u RNAse inhibitor and 3 μL 50% PEG8000, to a total volume of 10 μL and incubated 1 hr at 25°C. ( Step 3 ) Primer hybridization was performed adding 0.5 μL SR RT primer (NJ391, 10 μM) and 2.25 μL water to the prior reaction and incubated as follows: 5 min at 75°C, 15 min at 37°C, 15 min at 25°C, and holding at 4°C. ( Step 4 ) 5’ SR RNA adaptor (NJ411) was diluted to 10 μM and denatured for 2 min at 70°C, moved to ice and used immediately for ligation. .. Ligation was performed combining the prior reaction with 0.5 μL denatured adapter (NJ411), 5 u RNA Ligase 1 (NEB), 0.25 μL 10x RNA ligase buffer, 10 u RNAse inhibitor, 0.5 μL ATP (10 mM), and water to 15 uL and incubated for 1 hr at 25°C. ( Step 5 ) Reverse transcription was performed immediately following ligation, combining the prior reaction with 100 u Protoscript II reverse transcriptase (NEB), 4.5 μL 5x first strand synthesis buffer, 1 μL dNTPs (10 uM), 1.5 μL DTT (0.1 M), and 10 u RNAse inhibitor equaling 23 μL in total volume and incubated for 1 hr at 50°C followed by heat-killing for 15 min at 70°C. ( Step 6 ) Library amplification was performed, combining 5 μL of cDNA with 25 μL LongAmp Taq 2x master mix (NEB), 1.25 μL SR primer (NJ412, 10 μM), 1.25 μL barcode primer (‘NEB’ primers, 10 μM), and water to 50 μL total volume.

    Article Title: A novel method for the multiplexed target enrichment of MinION next generation sequencing libraries using PCR-generated baits
    Article Snippet: We mixed 500ng of PCR-adapter-ligated Lambda DNA (15ul), 2x Hybridization buffer (final volume/2 ul) and Hybridization component A (final volume/10 ul). .. We amplified the captured Phage Lambda library using the MinION provided primers (PCR primer PR2—3580F, Table ) targeting the ligated PCR-adapters and the LongAmp Taq 2x Master Mix (M0287S, New England BioLabs, Hitchin, UK).

    Article Title: Targeted, High-Resolution RNA Sequencing of Non-coding Genomic Regions Associated With Neuropsychiatric Functions
    Article Snippet: Following overnight incubation (∼18 h), 100 μl M-270 Streptavidin Dynabeads (65305, Thermo Fisher) per sample were washed twice with 200 μl 1x wash buffer (SeqCap EZ Hybridization and Wash Kit: 05 634 261 001, Roche), once with 100 μl, and then placed in the thermocycler set to 47° C. Incubated samples (15 μl) were transferred immediately to the beads for 45 min. Non-target DNA was removed through washing the beads with buffers of the SeqCap EZ Hybridization and Wash Kit (05 634 261 001, Roche) as per manufacturer’s instructions with the following modifications: pipette-mixing was replaced by inversion-mixing and brief centrifugation. .. The following PCR reaction was set up: 48 μl sample; 2 μl PRM primers; 50 μl LongAmp Taq 2x master mix (M0287S, NEB).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs longamp taq dna polymerase
    Thermal shock is crucial for successful PCR amplification from fungal spores. A. fumigatus spores at three different concentrations (8 × 10 8 /ml, 1 × 10 8 /ml, and 5 × 10 7 /ml) were prepared as described in Basic Protocol 1 . 3 µl of spore suspension were used as the <t>DNA</t> template for PCR. ( A ) PCR result from spore suspension subjected to thermal shock of 95°C for 15 min and −80°C for 10 min prior to PCR, as described in Basic Protocol 2 . No thermal shock was done for spore suspensions from Panels B and C . Subsequently, a PCR was run with an initial denaturation step of 95°C for 1 min (A), 5 min (B), or 15 min (C) with primers ITS1 and D2 (expected PCR product ∼1.2 kb) and <t>LongAmp</t> <t>Taq</t> DNA polymerase with PCR conditions described in Basic Protocol 2 . P: positive PCR control amplified from genomic DNA (50 ng) of the A. fumigatus wild‐type strain; N: negative control (no DNA).
    Longamp Taq Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 123 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/longamp taq dna polymerase/product/New England Biolabs
    Average 99 stars, based on 123 article reviews
    Price from $9.99 to $1999.99
    longamp taq dna polymerase - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    89
    New England Biolabs neb longamp taq
    ssDNA production by aPCR. ( a ) aPCR reactions were assembled with a 50-molar excess of a forward primer for the amplification of a 1,000 nt ssDNA fragment using the M13mp18 ssDNA plasmid as template, and with 10 different polymerases that were tested for highest yield of ssDNA production (upper band: expected dsDNA size is 1,000 bp; lower band: expected ssDNA size is 1,000 nt) as judged by agarose gel electrophoresis (right panel). QuantaBio AccuStart HiFi, polymerase (lane 2, boxed) produced the highest amount without overlapping dsDNA contaminants. 1. Accustart; 2. Accustart HiFi; 3. Accustart II; 4. AccuPrime; 5. GoTaq; 6. DreamTaq; 7. Phusion; 8. Platinum SuperFi; 9. Q5; 10. Tth polymerase. ( b ) Biochemical validation of ssDNA production by incubating 1,000 nt aPCR reaction products with the ssDNA-specific ExoI or S1 nucleases or dsDNA-specific restriction enzymes Eco RI and Nae I (left panel). Agarose gel electrophoresis of the digestion products as labeled by lane (right panel). M: Marker, C: aPCR product control, ExoI: exonuclease I, S1: S1 nuclease, Enz: Eco RI + Nae I. ( c ) <t>NEB</t> <t>LongAmp</t> was used to generate ssDNA up to 15,000 nt long using lambda phage dsDNA as template. Purification of the 10 kb fragment shows a single band of higher molecular weight than the M13mp18 ssDNA (7,249 nt). ( d ) The primer design algorithm aPrime was used to select primers for product sizes between 500 and 3,000 nt using M13mp18 ssDNA as template and the Quantabio Accustart HiFi enzyme. SYBR Safe stained agarose gels illuminated under blue light show dsDNA as yellow bands, while ssDNA show as orange bands.
    Neb Longamp Taq, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/neb longamp taq/product/New England Biolabs
    Average 89 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    neb longamp taq - by Bioz Stars, 2020-03
    89/100 stars
      Buy from Supplier

    Image Search Results


    Thermal shock is crucial for successful PCR amplification from fungal spores. A. fumigatus spores at three different concentrations (8 × 10 8 /ml, 1 × 10 8 /ml, and 5 × 10 7 /ml) were prepared as described in Basic Protocol 1 . 3 µl of spore suspension were used as the DNA template for PCR. ( A ) PCR result from spore suspension subjected to thermal shock of 95°C for 15 min and −80°C for 10 min prior to PCR, as described in Basic Protocol 2 . No thermal shock was done for spore suspensions from Panels B and C . Subsequently, a PCR was run with an initial denaturation step of 95°C for 1 min (A), 5 min (B), or 15 min (C) with primers ITS1 and D2 (expected PCR product ∼1.2 kb) and LongAmp Taq DNA polymerase with PCR conditions described in Basic Protocol 2 . P: positive PCR control amplified from genomic DNA (50 ng) of the A. fumigatus wild‐type strain; N: negative control (no DNA).

    Journal: Current Protocols in Microbiology

    Article Title: Fast and Reliable PCR Amplification from Aspergillus fumigatus Spore Suspension Without Traditional DNA Extraction). Fast and reliable PCR amplification from Aspergillus fumigatus spore suspension without traditional DNA extraction

    doi: 10.1002/cpmc.89

    Figure Lengend Snippet: Thermal shock is crucial for successful PCR amplification from fungal spores. A. fumigatus spores at three different concentrations (8 × 10 8 /ml, 1 × 10 8 /ml, and 5 × 10 7 /ml) were prepared as described in Basic Protocol 1 . 3 µl of spore suspension were used as the DNA template for PCR. ( A ) PCR result from spore suspension subjected to thermal shock of 95°C for 15 min and −80°C for 10 min prior to PCR, as described in Basic Protocol 2 . No thermal shock was done for spore suspensions from Panels B and C . Subsequently, a PCR was run with an initial denaturation step of 95°C for 1 min (A), 5 min (B), or 15 min (C) with primers ITS1 and D2 (expected PCR product ∼1.2 kb) and LongAmp Taq DNA polymerase with PCR conditions described in Basic Protocol 2 . P: positive PCR control amplified from genomic DNA (50 ng) of the A. fumigatus wild‐type strain; N: negative control (no DNA).

    Article Snippet: Materials Spore suspension (Basic Protocol ) Primers (5 µM each, forward and reverse; experiment specific) LongAmp Taq DNA polymerase with 5× reaction buffer (New England Biolabs; M0323) dNTP mix (5 mM of each dNTP) Sterile, molecular‐grade water For agarose gel electrophoresis (also see Current Protocols article: Voytas, ): 6× DNA loading dye 1× TAE buffer (see recipe) Ethidium bromide or other DNA gel stain 0.2‐ml PCR tubes, 0.2‐ml/well 96‐well PCR plates, or 150 µl/well 384 well PCR plates with tight (preferably aluminum) seals Thermal cycler Centrifuge UV transilluminator Additional reagents and equipment for agarose gel electrophoresis (see Current Protocols article: Voytas, )

    Techniques: Polymerase Chain Reaction, Amplification, Negative Control

    Spore PCR using the supernatant from spore suspensions of different filamentous fungi with primers ITS1/D2 (expected PCR band size is ∼1.2 kb) and ITS1/ITS4 (expected PCR band size ∼600 bp). Two different spore concentrations were tested (i.e., 5 × 10 7 /ml and 1 × 10 7 /ml). 1 µl of the supernatant was used in the PCR reaction with the LongAmp Taq DNA polymerase. Positive PCR controls were amplified from DNA (50 ng) of the A. fumigatus wild‐type strain with primers ITS1/D2 (P1) and ITS1/ITS4 (P2). N: negative control (no DNA).

    Journal: Current Protocols in Microbiology

    Article Title: Fast and Reliable PCR Amplification from Aspergillus fumigatus Spore Suspension Without Traditional DNA Extraction). Fast and reliable PCR amplification from Aspergillus fumigatus spore suspension without traditional DNA extraction

    doi: 10.1002/cpmc.89

    Figure Lengend Snippet: Spore PCR using the supernatant from spore suspensions of different filamentous fungi with primers ITS1/D2 (expected PCR band size is ∼1.2 kb) and ITS1/ITS4 (expected PCR band size ∼600 bp). Two different spore concentrations were tested (i.e., 5 × 10 7 /ml and 1 × 10 7 /ml). 1 µl of the supernatant was used in the PCR reaction with the LongAmp Taq DNA polymerase. Positive PCR controls were amplified from DNA (50 ng) of the A. fumigatus wild‐type strain with primers ITS1/D2 (P1) and ITS1/ITS4 (P2). N: negative control (no DNA).

    Article Snippet: Materials Spore suspension (Basic Protocol ) Primers (5 µM each, forward and reverse; experiment specific) LongAmp Taq DNA polymerase with 5× reaction buffer (New England Biolabs; M0323) dNTP mix (5 mM of each dNTP) Sterile, molecular‐grade water For agarose gel electrophoresis (also see Current Protocols article: Voytas, ): 6× DNA loading dye 1× TAE buffer (see recipe) Ethidium bromide or other DNA gel stain 0.2‐ml PCR tubes, 0.2‐ml/well 96‐well PCR plates, or 150 µl/well 384 well PCR plates with tight (preferably aluminum) seals Thermal cycler Centrifuge UV transilluminator Additional reagents and equipment for agarose gel electrophoresis (see Current Protocols article: Voytas, )

    Techniques: Polymerase Chain Reaction, Amplification, Negative Control

    Derivative dissociation plots produced by different reagents using one microliter of lysate produced by homogenizing one H. armigera leg with 24 H. zea legs in 625 μl of modified squish buffer. (A) Amplification reactions made with KAPA SYBR Fast Master Mix (purple) and NEB LongAmp Taq polymerase and buffer with 2.5 mM MgCl2 (Red). Peaks representing 18S rRNA control amplicon and species-specific amplicons of H. armigera and H. zea are present in all reactions, but melting temperatures were different in two reagents. (B) An enlarged view of the derivative dissociation plot produced by amplification reactions with NEB LongAmp Taq polymerase and buffer. Although variations in dissociation plots between samples were observed, the 3-peak dissociation plot was clearly identifiable.

    Journal: Journal of Insect Science

    Article Title: Rapid Identification of Helicoverpa armigera and Helicoverpa zea (Lepidoptera: Noctuidae) Using Ribosomal RNA Internal Transcribed Spacer 1

    doi: 10.1093/jisesa/iev137

    Figure Lengend Snippet: Derivative dissociation plots produced by different reagents using one microliter of lysate produced by homogenizing one H. armigera leg with 24 H. zea legs in 625 μl of modified squish buffer. (A) Amplification reactions made with KAPA SYBR Fast Master Mix (purple) and NEB LongAmp Taq polymerase and buffer with 2.5 mM MgCl2 (Red). Peaks representing 18S rRNA control amplicon and species-specific amplicons of H. armigera and H. zea are present in all reactions, but melting temperatures were different in two reagents. (B) An enlarged view of the derivative dissociation plot produced by amplification reactions with NEB LongAmp Taq polymerase and buffer. Although variations in dissociation plots between samples were observed, the 3-peak dissociation plot was clearly identifiable.

    Article Snippet: Initial tests of species-specific fragment amplification were carried out using Crimson LongAmp Taq polymerase with a 45 s initial denaturation step at 95°C followed by 35 cycles of 15 s denaturation at 95°C, 10 s annealing at 60°C, and 30 s extension at 72°C.

    Techniques: Produced, Modification, Amplification

    ssDNA production by aPCR. ( a ) aPCR reactions were assembled with a 50-molar excess of a forward primer for the amplification of a 1,000 nt ssDNA fragment using the M13mp18 ssDNA plasmid as template, and with 10 different polymerases that were tested for highest yield of ssDNA production (upper band: expected dsDNA size is 1,000 bp; lower band: expected ssDNA size is 1,000 nt) as judged by agarose gel electrophoresis (right panel). QuantaBio AccuStart HiFi, polymerase (lane 2, boxed) produced the highest amount without overlapping dsDNA contaminants. 1. Accustart; 2. Accustart HiFi; 3. Accustart II; 4. AccuPrime; 5. GoTaq; 6. DreamTaq; 7. Phusion; 8. Platinum SuperFi; 9. Q5; 10. Tth polymerase. ( b ) Biochemical validation of ssDNA production by incubating 1,000 nt aPCR reaction products with the ssDNA-specific ExoI or S1 nucleases or dsDNA-specific restriction enzymes Eco RI and Nae I (left panel). Agarose gel electrophoresis of the digestion products as labeled by lane (right panel). M: Marker, C: aPCR product control, ExoI: exonuclease I, S1: S1 nuclease, Enz: Eco RI + Nae I. ( c ) NEB LongAmp was used to generate ssDNA up to 15,000 nt long using lambda phage dsDNA as template. Purification of the 10 kb fragment shows a single band of higher molecular weight than the M13mp18 ssDNA (7,249 nt). ( d ) The primer design algorithm aPrime was used to select primers for product sizes between 500 and 3,000 nt using M13mp18 ssDNA as template and the Quantabio Accustart HiFi enzyme. SYBR Safe stained agarose gels illuminated under blue light show dsDNA as yellow bands, while ssDNA show as orange bands.

    Journal: Scientific Reports

    Article Title: In vitro synthesis of gene-length single-stranded DNA

    doi: 10.1038/s41598-018-24677-5

    Figure Lengend Snippet: ssDNA production by aPCR. ( a ) aPCR reactions were assembled with a 50-molar excess of a forward primer for the amplification of a 1,000 nt ssDNA fragment using the M13mp18 ssDNA plasmid as template, and with 10 different polymerases that were tested for highest yield of ssDNA production (upper band: expected dsDNA size is 1,000 bp; lower band: expected ssDNA size is 1,000 nt) as judged by agarose gel electrophoresis (right panel). QuantaBio AccuStart HiFi, polymerase (lane 2, boxed) produced the highest amount without overlapping dsDNA contaminants. 1. Accustart; 2. Accustart HiFi; 3. Accustart II; 4. AccuPrime; 5. GoTaq; 6. DreamTaq; 7. Phusion; 8. Platinum SuperFi; 9. Q5; 10. Tth polymerase. ( b ) Biochemical validation of ssDNA production by incubating 1,000 nt aPCR reaction products with the ssDNA-specific ExoI or S1 nucleases or dsDNA-specific restriction enzymes Eco RI and Nae I (left panel). Agarose gel electrophoresis of the digestion products as labeled by lane (right panel). M: Marker, C: aPCR product control, ExoI: exonuclease I, S1: S1 nuclease, Enz: Eco RI + Nae I. ( c ) NEB LongAmp was used to generate ssDNA up to 15,000 nt long using lambda phage dsDNA as template. Purification of the 10 kb fragment shows a single band of higher molecular weight than the M13mp18 ssDNA (7,249 nt). ( d ) The primer design algorithm aPrime was used to select primers for product sizes between 500 and 3,000 nt using M13mp18 ssDNA as template and the Quantabio Accustart HiFi enzyme. SYBR Safe stained agarose gels illuminated under blue light show dsDNA as yellow bands, while ssDNA show as orange bands.

    Article Snippet: Initial tests with two other Taq -based polymerase sets, NEB LongAmp® Taq and Takara LA® Taq , produced notable amounts of dsDNA byproduct when tested for amplification of the 1,000 nt and the 3,281 nt fragments and reduced amount of ssDNA per reaction for the 1,000 and 3,281 fragments respectively in comparison with the Accustart HiFi (Fig. and Supplementary Table , External Table ).

    Techniques: Amplification, Plasmid Preparation, Agarose Gel Electrophoresis, Produced, Labeling, Marker, Purification, Molecular Weight, Staining