longamp taq reaction buffer  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Standard Taq Reaction Buffer Pack
    Description:
    Standard Taq Reaction Buffer Pack 6 0 ml
    Catalog Number:
    b9014s
    Price:
    22
    Size:
    6 0 ml
    Category:
    Buffers
    Buy from Supplier


    Structured Review

    New England Biolabs longamp taq reaction buffer
    Standard Taq Reaction Buffer Pack
    Standard Taq Reaction Buffer Pack 6 0 ml
    https://www.bioz.com/result/longamp taq reaction buffer/product/New England Biolabs
    Average 99 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    longamp taq reaction buffer - by Bioz Stars, 2020-04
    99/100 stars

    Images

    Related Articles

    Diagnostic Assay:

    Article Title: Characterisation of Casein Kinase 1.1 in Leishmania donovani Using the CRISPR Cas9 Toolkit
    Article Snippet: Paragraph title: 2.5. Diagnostic PCR ... One hundred nanograms of genomic DNA was mixed with 0.3 mM dNTPs, 0.5 μ M forward primer and reverse primer, 3% (v/v) DMSO, 2.5 units LongAmp Taq DNA polymerase (NEB), and 1x LongAmp Taq Reaction Buffer supplemented with Mg2+ (2 mM final, NEB).

    Centrifugation:

    Article Title: Innovative Use of Palladium Compounds To Selectively Detect Live Enterobacteriaceae in Milk by PCR
    Article Snippet: As described above, some bacteria (live and dead cells) treated with Pd compounds (or with none) followed by centrifugation underwent three types of DNA extraction, while other samples were directly subjected to qPCR without laborious DNA extraction (direct-qPCR) for comparison with the typical PMA treatment for routine use. .. Specifically, the direct-qPCR master mix consisted of the following: 0.5 μl of Taq DNA polymerase (with standard Taq buffer [5 U/μl]; New England BioLabs, Japan, Inc., Tokyo, Japan); 2.5 μl of 10× standard Taq reaction buffer (New England BioLabs); 2.0 μl of a 2 mM deoxynucleoside triphosphate (dNTP) mixture (TaKaRa-Bio, Ohtsu, Japan); 0.75 μl of 10 μM forward primer (5′-GTTGTAAAGCACTTTCAGTGGTGAGGAAGG-3′) and 10 μM reverse primer (5′-GCCTCAAGGGCACAACCTCCAAG-3′); 5 μl of 2× SYBR green (Invitrogen, CA, USA) (10,000× stock); 2.5 μl of mixed reagent solution stored at −20°C before use (8.3% Brij 58 from Sigma; 1.9% bovine serum albumin from Sigma; 10 mM trisodium citrate dehydrate from Kanto-Kagaku, Tokyo, Japan; 30 mM MgCl2 from Nakalai-Tesque, Kyoto, Japan; 100 μg/ml lysozyme from egg white purchased from Wako Pure Chemicals Industries, Ltd., Osaka, Japan); 5 μl of PCR template (bacterial cells or isolated DNA); and 6.75 μl of SW.

    Amplification:

    Article Title: Independently founded populations of Sclerotinia sclerotiorum from a tropical and a temperate region have similar genetic structure
    Article Snippet: PCR reactions were performed in a final volume of 20 μl with 2 μl of DNA, 0.5 μl of each primer at 10 mM, 0.5 μl of dNTPs at 10 mM, 2 μl of the 10x Standard Taq Reaction Buffer that includes 1.5 mM MgCl2 , 10mM Tris-HCl and 50 mM KCl (New England Biolabs Inc., Ipswich, MA, USA) and 0.1 μl of Taq DNA polymerase (New England Biolabs, Inc.). .. Amplification was confirmed by using electrophoresis in a 1% agarose gel and TBE and viewed under UV light after staining with GelRed (Biotium, Hayward, CA, USA).

    Article Title: Breaking the speed limit with multimode fast scanning of DNA by Endonuclease V
    Article Snippet: This DNA substrate was prepared by PCR amplification of λ-DNA using primers modified with 5′ biotin (5′-bio-ACTTCGCCTTCTTCCCATTT-3′) and 5′ digoxigenin (5′-dig-ATCTCGCTTTCCACTCCAGA-3′) (Eurofins MWG/Operon). .. The PCR reaction was performed in a 1× LongAmp Taq Reaction Buffer, with a final volume of 50 μl, 300 µM of each dNTP, 0.4 µM of each primer, 2 units LongAmp Taq DNA polymerase (New England Biolabs) and 0.1 ng µl−1 of λ-DNA template.

    Article Title: Innovative Use of Palladium Compounds To Selectively Detect Live Enterobacteriaceae in Milk by PCR
    Article Snippet: Specifically, the direct-qPCR master mix consisted of the following: 0.5 μl of Taq DNA polymerase (with standard Taq buffer [5 U/μl]; New England BioLabs, Japan, Inc., Tokyo, Japan); 2.5 μl of 10× standard Taq reaction buffer (New England BioLabs); 2.0 μl of a 2 mM deoxynucleoside triphosphate (dNTP) mixture (TaKaRa-Bio, Ohtsu, Japan); 0.75 μl of 10 μM forward primer (5′-GTTGTAAAGCACTTTCAGTGGTGAGGAAGG-3′) and 10 μM reverse primer (5′-GCCTCAAGGGCACAACCTCCAAG-3′); 5 μl of 2× SYBR green (Invitrogen, CA, USA) (10,000× stock); 2.5 μl of mixed reagent solution stored at −20°C before use (8.3% Brij 58 from Sigma; 1.9% bovine serum albumin from Sigma; 10 mM trisodium citrate dehydrate from Kanto-Kagaku, Tokyo, Japan; 30 mM MgCl2 from Nakalai-Tesque, Kyoto, Japan; 100 μg/ml lysozyme from egg white purchased from Wako Pure Chemicals Industries, Ltd., Osaka, Japan); 5 μl of PCR template (bacterial cells or isolated DNA); and 6.75 μl of SW. .. The forward and reverse primers, which target a specific region of the 16S rRNA gene in Enterobacteriaceae cells, produced an amplicon of 424 bp ( ).

    Article Title: Characterization of Histone H2A Derived Antimicrobial Peptides, Harriottins, from Sicklefin Chimaera Neoharriotta pinnata (Schnakenbeck, 1931) and Its Evolutionary Divergence with respect to CO1 and Histone H2A
    Article Snippet: .. PCR amplification of 1 μ L of cDNA was performed in a 25 μ L reaction volume containing 1x standard Taq buffer (10 mM Tris-HCl, 50 mM KCl, pH 8.3), 1.5 mM MgCl2 , 200 mM dNTPs, 0.4 mM each primer, and 1 U Taq DNA polymerase (New England Biolabs). .. PCR products were analyzed by electrophoresis in 1.5% agarose gel in TBE buffer, stained with SYBR Safe and visualized under UV light.

    Article Title: Differential roles of the RNases H in preventing chromosome instability
    Article Snippet: .. Regions containing SNPs (SNP locations are listed in ) were amplified by optimized yeast colony PCR as follows: ∼5 μL of the yeast colony was resuspended in 20 μL of 0.02 M NaOH and was boiled for 10 min. Then 1 μL of this boiled yeast colony was used as a template for PCR amplification in the following reaction conditions: 1× Q buffer (Qiagen), 1× standard Taq buffer (New England BioLabs), 0.2 M dNTP, 1 μM of each primer, and 0.5 U Taq polymerase (New England BioLabs). .. Touchdown PCR cycles were used: 94 °C for 1 min; nine cycles of 94 °C for 20 s, 62 °C decreasing by 1 °C each cycle for 45 s, 68 °C for 45 s; and 24 cycles of 94 °C for 20 s, 52 °C for 45 s, 68 °C for 45 s. The PCR-amplified DNA was cleaned using standard enzymatic cleanup conditions [1× CutSmart buffer (New England BioLabs), 1 U rSAP (New England BioLabs), 1.8 U ExoI (Thermo Scientific)] and was incubated at 37 °C for 1 h followed by heat inactivation at 80 °C for 15 min.

    Article Title: Early Control of Mycobacterium tuberculosis Infection Requires il12rb1 Expression by rag1-Dependent Lineages
    Article Snippet: .. To screen for the presence of a wild-type il12rb1 allele, genomic DNA (gDNA) from tail snips was isolated using the Promega Wizard SV Genomic DNA method (Promega, Madison, WI) and amplified with primers NF1 (5′-CAGAGATCCTCCTGCCTCTG-3′) and NF2 (5′-TATGGTTCGGAGGGACAAAG-3′) in a 50-μl reaction mixture comprising 2 μl of gDNA, 1.5× NEB Taq buffer (from a 10× solution), 2 mM MgCl2 , 0.2 μM primer NF1, 0.2 μM primer NF2, 0.2 mM each deoxynucleoside triphosphate (dNTP), 5% dimethyl sulfoxide (DMSO), and 1U of Taq polymerase (New England BioLabs, Ipswich, MA). .. To screen for the knockout (KO) il12rb1 allele, gDNA was amplified with primers NF1 (sequence above) and NF3 (5′-TGGATGTGGAATGTGTGCGAG-3′) in a 50-μl reaction mixture comprising 2 μl of gDNA, 1.0× NEB Taq buffer (from a 10× solution), 2 mM MgCl2 , 0.2 μM primer NF1, 0.2 μM primer NF3, 0.2 mM each dNTP, 5% DMSO, and 1U of Taq polymerase.

    Article Title: Genetic Dissection of Tropodithietic Acid Biosynthesis by Marine Roseobacters ▿Genetic Dissection of Tropodithietic Acid Biosynthesis by Marine Roseobacters ▿ ‡
    Article Snippet: .. The standard PCR amplification conditions were 100 μM concentrations of each deoxynucleoside triphosphate, 0.2 μM concentrations of each primer, and 1 U of Taq DNA polymerase (New England Biolabs) in 1× reaction buffer (New England Biolabs) with an initial denaturing step at 94°C for 3 min, followed by 30 cycles of 94°C for 1 min each, annealing at 55°C for 30 s, and an elongation at 72°C for 1 min. To detect the tdaA-E locus, PCR amplification was conducted with a forward primer complementary to tdaA (5′-CGCTTTCCGGAACTGGAGAT-3′) and a reverse primer complementary to tdaE (5′-GGCTGCCGTATAGTTTCAGCA-3′) using the Expand Long Template PCR system (Roche Applied Science, Indianapolis, IN), and the PCR program conditions and cycle parameters were as described by the supplier. .. DNA-DNA hybridization by Southern slot blot ( ) was used to detect the presence of tda genes in other roseobacters.

    Article Title: Bacterial endophytes from wild maize suppress Fusarium graminearum in modern maize and inhibit mycotoxin accumulation
    Article Snippet: .. For fusA amplification, a PCR master mix (20 μl) was made as follows: 50 ng DNA were added (2.5 ng/μl was the final DNA concentration in the PCR reaction), 50 ng DNA, 2.5 μl Standard Taq Buffer (10 ×) (New England Biolabs), 0.5 μl of 25 mM dNTP mix, 0.25 μl of 50 mM MgCl2 , 0.25 μl of Standard Taq (10 U/μl, New England Biolabs), 1 μl of primer FusAF with sequence 5′- AGGCAAGCTTTGACTTGGAA −3′ and 1 μl of primer FusAR with sequence 5′- CGCTTGCTCAGACCATACAA −3′ and double distilled water up to 20 μl total. .. The PCR amplification conditions were: 96°C for 3 min, followed by 35 amplification cycles (94°C for 30 s, 48°C for 30 s, 72°C for 90 s), and a final extension at 72°C for 7 min, using a PTC200 DNA Thermal Cycler (MJ Scientific, USA).

    Article Title: DNA barcoding and LC-MS metabolite profiling of the lichen-forming genus Melanelia: Specimen identification and discrimination focusing on Icelandic taxa
    Article Snippet: .. Each amplification reaction (25 μL) contained 1×standard Taq reaction buffer for nrITS, 200 μM dNTPs, 0.2 μM forward and reverse primer, 1.25 units of Taq DNA polymerase (New England Biolabs), 1 or 3 μL DNA template, and PCR-grade water. .. PCR cycling conditions were as follows: initial denaturation at 94°C for 3 min, 31 cycles of 94°C for 40s, 54°C for 40s and 68°C for 1min, final extension at 68°C for 7min and cooling down to 4°C.

    Positive Control:

    Article Title: Independently founded populations of Sclerotinia sclerotiorum from a tropical and a temperate region have similar genetic structure
    Article Snippet: DNA of the S . sclerotiorum ‘1980’ isolate obtained from Dr. J. Steadman, University of Nebraska, NE, USA was used as a positive control. .. PCR reactions were performed in a final volume of 20 μl with 2 μl of DNA, 0.5 μl of each primer at 10 mM, 0.5 μl of dNTPs at 10 mM, 2 μl of the 10x Standard Taq Reaction Buffer that includes 1.5 mM MgCl2 , 10mM Tris-HCl and 50 mM KCl (New England Biolabs Inc., Ipswich, MA, USA) and 0.1 μl of Taq DNA polymerase (New England Biolabs, Inc.).

    Picogreen Assay:

    Article Title: DNA barcoding and LC-MS metabolite profiling of the lichen-forming genus Melanelia: Specimen identification and discrimination focusing on Icelandic taxa
    Article Snippet: DNA extracts were stored in 30 μL 1×TE buffer (pH 8.0) and quantified using Quant-iT Picogreen™ assay according to the manufacturer’s instructions. .. Each amplification reaction (25 μL) contained 1×standard Taq reaction buffer for nrITS, 200 μM dNTPs, 0.2 μM forward and reverse primer, 1.25 units of Taq DNA polymerase (New England Biolabs), 1 or 3 μL DNA template, and PCR-grade water.

    Real-time Polymerase Chain Reaction:

    Article Title: Innovative Use of Palladium Compounds To Selectively Detect Live Enterobacteriaceae in Milk by PCR
    Article Snippet: As described above, some bacteria (live and dead cells) treated with Pd compounds (or with none) followed by centrifugation underwent three types of DNA extraction, while other samples were directly subjected to qPCR without laborious DNA extraction (direct-qPCR) for comparison with the typical PMA treatment for routine use. .. Specifically, the direct-qPCR master mix consisted of the following: 0.5 μl of Taq DNA polymerase (with standard Taq buffer [5 U/μl]; New England BioLabs, Japan, Inc., Tokyo, Japan); 2.5 μl of 10× standard Taq reaction buffer (New England BioLabs); 2.0 μl of a 2 mM deoxynucleoside triphosphate (dNTP) mixture (TaKaRa-Bio, Ohtsu, Japan); 0.75 μl of 10 μM forward primer (5′-GTTGTAAAGCACTTTCAGTGGTGAGGAAGG-3′) and 10 μM reverse primer (5′-GCCTCAAGGGCACAACCTCCAAG-3′); 5 μl of 2× SYBR green (Invitrogen, CA, USA) (10,000× stock); 2.5 μl of mixed reagent solution stored at −20°C before use (8.3% Brij 58 from Sigma; 1.9% bovine serum albumin from Sigma; 10 mM trisodium citrate dehydrate from Kanto-Kagaku, Tokyo, Japan; 30 mM MgCl2 from Nakalai-Tesque, Kyoto, Japan; 100 μg/ml lysozyme from egg white purchased from Wako Pure Chemicals Industries, Ltd., Osaka, Japan); 5 μl of PCR template (bacterial cells or isolated DNA); and 6.75 μl of SW.

    Incubation:

    Article Title: Differential roles of the RNases H in preventing chromosome instability
    Article Snippet: Regions containing SNPs (SNP locations are listed in ) were amplified by optimized yeast colony PCR as follows: ∼5 μL of the yeast colony was resuspended in 20 μL of 0.02 M NaOH and was boiled for 10 min. Then 1 μL of this boiled yeast colony was used as a template for PCR amplification in the following reaction conditions: 1× Q buffer (Qiagen), 1× standard Taq buffer (New England BioLabs), 0.2 M dNTP, 1 μM of each primer, and 0.5 U Taq polymerase (New England BioLabs). .. Touchdown PCR cycles were used: 94 °C for 1 min; nine cycles of 94 °C for 20 s, 62 °C decreasing by 1 °C each cycle for 45 s, 68 °C for 45 s; and 24 cycles of 94 °C for 20 s, 52 °C for 45 s, 68 °C for 45 s. The PCR-amplified DNA was cleaned using standard enzymatic cleanup conditions [1× CutSmart buffer (New England BioLabs), 1 U rSAP (New England BioLabs), 1.8 U ExoI (Thermo Scientific)] and was incubated at 37 °C for 1 h followed by heat inactivation at 80 °C for 15 min.

    Touchdown PCR:

    Article Title: Differential roles of the RNases H in preventing chromosome instability
    Article Snippet: Regions containing SNPs (SNP locations are listed in ) were amplified by optimized yeast colony PCR as follows: ∼5 μL of the yeast colony was resuspended in 20 μL of 0.02 M NaOH and was boiled for 10 min. Then 1 μL of this boiled yeast colony was used as a template for PCR amplification in the following reaction conditions: 1× Q buffer (Qiagen), 1× standard Taq buffer (New England BioLabs), 0.2 M dNTP, 1 μM of each primer, and 0.5 U Taq polymerase (New England BioLabs). .. Touchdown PCR cycles were used: 94 °C for 1 min; nine cycles of 94 °C for 20 s, 62 °C decreasing by 1 °C each cycle for 45 s, 68 °C for 45 s; and 24 cycles of 94 °C for 20 s, 52 °C for 45 s, 68 °C for 45 s. The PCR-amplified DNA was cleaned using standard enzymatic cleanup conditions [1× CutSmart buffer (New England BioLabs), 1 U rSAP (New England BioLabs), 1.8 U ExoI (Thermo Scientific)] and was incubated at 37 °C for 1 h followed by heat inactivation at 80 °C for 15 min.

    Modification:

    Article Title: Breaking the speed limit with multimode fast scanning of DNA by Endonuclease V
    Article Snippet: This DNA substrate was prepared by PCR amplification of λ-DNA using primers modified with 5′ biotin (5′-bio-ACTTCGCCTTCTTCCCATTT-3′) and 5′ digoxigenin (5′-dig-ATCTCGCTTTCCACTCCAGA-3′) (Eurofins MWG/Operon). .. The PCR reaction was performed in a 1× LongAmp Taq Reaction Buffer, with a final volume of 50 μl, 300 µM of each dNTP, 0.4 µM of each primer, 2 units LongAmp Taq DNA polymerase (New England Biolabs) and 0.1 ng µl−1 of λ-DNA template.

    Derivative Assay:

    Article Title: Characterization of Histone H2A Derived Antimicrobial Peptides, Harriottins, from Sicklefin Chimaera Neoharriotta pinnata (Schnakenbeck, 1931) and Its Evolutionary Divergence with respect to CO1 and Histone H2A
    Article Snippet: PCR Amplification Amplification of histone H2A derived antimicrobial peptide sequence from cDNA of N. pinnata was done using forward primer (5′-ATGTCCGGRMGMGGSAARAC-3′) and reverse primer (5′-GGGATGATGCGMGTCTTCTTGTT-3′) [ ]. .. PCR amplification of 1 μ L of cDNA was performed in a 25 μ L reaction volume containing 1x standard Taq buffer (10 mM Tris-HCl, 50 mM KCl, pH 8.3), 1.5 mM MgCl2 , 200 mM dNTPs, 0.4 mM each primer, and 1 U Taq DNA polymerase (New England Biolabs).

    Article Title: Differential roles of the RNases H in preventing chromosome instability
    Article Snippet: Regions containing SNPs (SNP locations are listed in ) were amplified by optimized yeast colony PCR as follows: ∼5 μL of the yeast colony was resuspended in 20 μL of 0.02 M NaOH and was boiled for 10 min. Then 1 μL of this boiled yeast colony was used as a template for PCR amplification in the following reaction conditions: 1× Q buffer (Qiagen), 1× standard Taq buffer (New England BioLabs), 0.2 M dNTP, 1 μM of each primer, and 0.5 U Taq polymerase (New England BioLabs). .. Regions containing SNPs (SNP locations are listed in ) were amplified by optimized yeast colony PCR as follows: ∼5 μL of the yeast colony was resuspended in 20 μL of 0.02 M NaOH and was boiled for 10 min. Then 1 μL of this boiled yeast colony was used as a template for PCR amplification in the following reaction conditions: 1× Q buffer (Qiagen), 1× standard Taq buffer (New England BioLabs), 0.2 M dNTP, 1 μM of each primer, and 0.5 U Taq polymerase (New England BioLabs).

    Sequencing:

    Article Title: Characterization of Histone H2A Derived Antimicrobial Peptides, Harriottins, from Sicklefin Chimaera Neoharriotta pinnata (Schnakenbeck, 1931) and Its Evolutionary Divergence with respect to CO1 and Histone H2A
    Article Snippet: PCR Amplification Amplification of histone H2A derived antimicrobial peptide sequence from cDNA of N. pinnata was done using forward primer (5′-ATGTCCGGRMGMGGSAARAC-3′) and reverse primer (5′-GGGATGATGCGMGTCTTCTTGTT-3′) [ ]. .. PCR amplification of 1 μ L of cDNA was performed in a 25 μ L reaction volume containing 1x standard Taq buffer (10 mM Tris-HCl, 50 mM KCl, pH 8.3), 1.5 mM MgCl2 , 200 mM dNTPs, 0.4 mM each primer, and 1 U Taq DNA polymerase (New England Biolabs).

    Article Title: Differential roles of the RNases H in preventing chromosome instability
    Article Snippet: Regions containing SNPs (SNP locations are listed in ) were amplified by optimized yeast colony PCR as follows: ∼5 μL of the yeast colony was resuspended in 20 μL of 0.02 M NaOH and was boiled for 10 min. Then 1 μL of this boiled yeast colony was used as a template for PCR amplification in the following reaction conditions: 1× Q buffer (Qiagen), 1× standard Taq buffer (New England BioLabs), 0.2 M dNTP, 1 μM of each primer, and 0.5 U Taq polymerase (New England BioLabs). .. This reaction was diluted, and the equivalent of 1/20th of the reaction was used for standard Sanger sequencing.

    Article Title: Early Control of Mycobacterium tuberculosis Infection Requires il12rb1 Expression by rag1-Dependent Lineages
    Article Snippet: To screen for the presence of a wild-type il12rb1 allele, genomic DNA (gDNA) from tail snips was isolated using the Promega Wizard SV Genomic DNA method (Promega, Madison, WI) and amplified with primers NF1 (5′-CAGAGATCCTCCTGCCTCTG-3′) and NF2 (5′-TATGGTTCGGAGGGACAAAG-3′) in a 50-μl reaction mixture comprising 2 μl of gDNA, 1.5× NEB Taq buffer (from a 10× solution), 2 mM MgCl2 , 0.2 μM primer NF1, 0.2 μM primer NF2, 0.2 mM each deoxynucleoside triphosphate (dNTP), 5% dimethyl sulfoxide (DMSO), and 1U of Taq polymerase (New England BioLabs, Ipswich, MA). .. To screen for the knockout (KO) il12rb1 allele, gDNA was amplified with primers NF1 (sequence above) and NF3 (5′-TGGATGTGGAATGTGTGCGAG-3′) in a 50-μl reaction mixture comprising 2 μl of gDNA, 1.0× NEB Taq buffer (from a 10× solution), 2 mM MgCl2 , 0.2 μM primer NF1, 0.2 μM primer NF3, 0.2 mM each dNTP, 5% DMSO, and 1U of Taq polymerase.

    Article Title: Genetic Dissection of Tropodithietic Acid Biosynthesis by Marine Roseobacters ▿Genetic Dissection of Tropodithietic Acid Biosynthesis by Marine Roseobacters ▿ ‡
    Article Snippet: A 716-bp sequence internal to tdaE was amplified by using the primers 5′-CAGATGATGGTGCCAAAGGACTAT-3′ and 5′-GGTCAGTTTCTTCTGCACATACTGG-3′, while (in the same reaction) an internal 401-bp fragment of flaA (accession number , locus tag TM1040_2952) was also amplified by using the primers 5′-TTGCAGTATCCAATGGTCGTG-3′ and 5′-TGAATTGCGTCAGAGTTTGCC-3′ as a control. .. The standard PCR amplification conditions were 100 μM concentrations of each deoxynucleoside triphosphate, 0.2 μM concentrations of each primer, and 1 U of Taq DNA polymerase (New England Biolabs) in 1× reaction buffer (New England Biolabs) with an initial denaturing step at 94°C for 3 min, followed by 30 cycles of 94°C for 1 min each, annealing at 55°C for 30 s, and an elongation at 72°C for 1 min. To detect the tdaA-E locus, PCR amplification was conducted with a forward primer complementary to tdaA (5′-CGCTTTCCGGAACTGGAGAT-3′) and a reverse primer complementary to tdaE (5′-GGCTGCCGTATAGTTTCAGCA-3′) using the Expand Long Template PCR system (Roche Applied Science, Indianapolis, IN), and the PCR program conditions and cycle parameters were as described by the supplier.

    Article Title: Bacterial endophytes from wild maize suppress Fusarium graminearum in modern maize and inhibit mycotoxin accumulation
    Article Snippet: .. For fusA amplification, a PCR master mix (20 μl) was made as follows: 50 ng DNA were added (2.5 ng/μl was the final DNA concentration in the PCR reaction), 50 ng DNA, 2.5 μl Standard Taq Buffer (10 ×) (New England Biolabs), 0.5 μl of 25 mM dNTP mix, 0.25 μl of 50 mM MgCl2 , 0.25 μl of Standard Taq (10 U/μl, New England Biolabs), 1 μl of primer FusAF with sequence 5′- AGGCAAGCTTTGACTTGGAA −3′ and 1 μl of primer FusAR with sequence 5′- CGCTTGCTCAGACCATACAA −3′ and double distilled water up to 20 μl total. .. The PCR amplification conditions were: 96°C for 3 min, followed by 35 amplification cycles (94°C for 30 s, 48°C for 30 s, 72°C for 90 s), and a final extension at 72°C for 7 min, using a PTC200 DNA Thermal Cycler (MJ Scientific, USA).

    Article Title: DNA barcoding and LC-MS metabolite profiling of the lichen-forming genus Melanelia: Specimen identification and discrimination focusing on Icelandic taxa
    Article Snippet: Paragraph title: DNA extraction, PCR and sequencing ... Each amplification reaction (25 μL) contained 1×standard Taq reaction buffer for nrITS, 200 μM dNTPs, 0.2 μM forward and reverse primer, 1.25 units of Taq DNA polymerase (New England Biolabs), 1 or 3 μL DNA template, and PCR-grade water.

    DNA Extraction:

    Article Title: Independently founded populations of Sclerotinia sclerotiorum from a tropical and a temperate region have similar genetic structure
    Article Snippet: Paragraph title: DNA extraction and S . sclerotiorum -specific PCR ... PCR reactions were performed in a final volume of 20 μl with 2 μl of DNA, 0.5 μl of each primer at 10 mM, 0.5 μl of dNTPs at 10 mM, 2 μl of the 10x Standard Taq Reaction Buffer that includes 1.5 mM MgCl2 , 10mM Tris-HCl and 50 mM KCl (New England Biolabs Inc., Ipswich, MA, USA) and 0.1 μl of Taq DNA polymerase (New England Biolabs, Inc.).

    Article Title: Innovative Use of Palladium Compounds To Selectively Detect Live Enterobacteriaceae in Milk by PCR
    Article Snippet: Paragraph title: Direct-qPCR without the need for DNA extraction from bacteria (live and dead cells) and with or without Pd compounds for comparison with the currently used PMA method. ... Specifically, the direct-qPCR master mix consisted of the following: 0.5 μl of Taq DNA polymerase (with standard Taq buffer [5 U/μl]; New England BioLabs, Japan, Inc., Tokyo, Japan); 2.5 μl of 10× standard Taq reaction buffer (New England BioLabs); 2.0 μl of a 2 mM deoxynucleoside triphosphate (dNTP) mixture (TaKaRa-Bio, Ohtsu, Japan); 0.75 μl of 10 μM forward primer (5′-GTTGTAAAGCACTTTCAGTGGTGAGGAAGG-3′) and 10 μM reverse primer (5′-GCCTCAAGGGCACAACCTCCAAG-3′); 5 μl of 2× SYBR green (Invitrogen, CA, USA) (10,000× stock); 2.5 μl of mixed reagent solution stored at −20°C before use (8.3% Brij 58 from Sigma; 1.9% bovine serum albumin from Sigma; 10 mM trisodium citrate dehydrate from Kanto-Kagaku, Tokyo, Japan; 30 mM MgCl2 from Nakalai-Tesque, Kyoto, Japan; 100 μg/ml lysozyme from egg white purchased from Wako Pure Chemicals Industries, Ltd., Osaka, Japan); 5 μl of PCR template (bacterial cells or isolated DNA); and 6.75 μl of SW.

    Article Title: DNA barcoding and LC-MS metabolite profiling of the lichen-forming genus Melanelia: Specimen identification and discrimination focusing on Icelandic taxa
    Article Snippet: Paragraph title: DNA extraction, PCR and sequencing ... Each amplification reaction (25 μL) contained 1×standard Taq reaction buffer for nrITS, 200 μM dNTPs, 0.2 μM forward and reverse primer, 1.25 units of Taq DNA polymerase (New England Biolabs), 1 or 3 μL DNA template, and PCR-grade water.

    Fluorescence:

    Article Title: Innovative Use of Palladium Compounds To Selectively Detect Live Enterobacteriaceae in Milk by PCR
    Article Snippet: Specifically, the direct-qPCR master mix consisted of the following: 0.5 μl of Taq DNA polymerase (with standard Taq buffer [5 U/μl]; New England BioLabs, Japan, Inc., Tokyo, Japan); 2.5 μl of 10× standard Taq reaction buffer (New England BioLabs); 2.0 μl of a 2 mM deoxynucleoside triphosphate (dNTP) mixture (TaKaRa-Bio, Ohtsu, Japan); 0.75 μl of 10 μM forward primer (5′-GTTGTAAAGCACTTTCAGTGGTGAGGAAGG-3′) and 10 μM reverse primer (5′-GCCTCAAGGGCACAACCTCCAAG-3′); 5 μl of 2× SYBR green (Invitrogen, CA, USA) (10,000× stock); 2.5 μl of mixed reagent solution stored at −20°C before use (8.3% Brij 58 from Sigma; 1.9% bovine serum albumin from Sigma; 10 mM trisodium citrate dehydrate from Kanto-Kagaku, Tokyo, Japan; 30 mM MgCl2 from Nakalai-Tesque, Kyoto, Japan; 100 μg/ml lysozyme from egg white purchased from Wako Pure Chemicals Industries, Ltd., Osaka, Japan); 5 μl of PCR template (bacterial cells or isolated DNA); and 6.75 μl of SW. .. The qPCR (including direct-qPCR) thermal cycle profile was 1 cycle of 95°C for 20 s; 50 cycles of 95°C for 5 s and 60°C for 45 s; and 1 cycle of 95°C for 3 min. Incidentally, the threshold cycle ( CT ) value in direct-qPCR presents the first PCR cycle at which the fluorescence value stemming from direct-qPCR amplification is above the threshold, and consequently, the CT value decreases in reverse proportion to the increasing number of bacterial cells in the qPCR tube.

    Methylation:

    Article Title: Mycoplasma CG- and GATC-specific DNA methyltransferases selectively and efficiently methylate the host genome and alter the epigenetic landscape in human cells
    Article Snippet: .. PCR was performed in 50 μl reactions consisting of Standard Taq Reaction buffer, Taq DNA polymerase (New England Biolabs), dNTPs (200 μM each), bisulfite converted DNAs (50 ng), and the forward and reverse primers (0.5 μM each) specific for either unmethylated and methylated DNA ( ). .. PCR products were separated on 2% agarose gel, visualized by ethidium bromide, extracted from a gel and sequenced.

    Isolation:

    Article Title: Innovative Use of Palladium Compounds To Selectively Detect Live Enterobacteriaceae in Milk by PCR
    Article Snippet: .. Specifically, the direct-qPCR master mix consisted of the following: 0.5 μl of Taq DNA polymerase (with standard Taq buffer [5 U/μl]; New England BioLabs, Japan, Inc., Tokyo, Japan); 2.5 μl of 10× standard Taq reaction buffer (New England BioLabs); 2.0 μl of a 2 mM deoxynucleoside triphosphate (dNTP) mixture (TaKaRa-Bio, Ohtsu, Japan); 0.75 μl of 10 μM forward primer (5′-GTTGTAAAGCACTTTCAGTGGTGAGGAAGG-3′) and 10 μM reverse primer (5′-GCCTCAAGGGCACAACCTCCAAG-3′); 5 μl of 2× SYBR green (Invitrogen, CA, USA) (10,000× stock); 2.5 μl of mixed reagent solution stored at −20°C before use (8.3% Brij 58 from Sigma; 1.9% bovine serum albumin from Sigma; 10 mM trisodium citrate dehydrate from Kanto-Kagaku, Tokyo, Japan; 30 mM MgCl2 from Nakalai-Tesque, Kyoto, Japan; 100 μg/ml lysozyme from egg white purchased from Wako Pure Chemicals Industries, Ltd., Osaka, Japan); 5 μl of PCR template (bacterial cells or isolated DNA); and 6.75 μl of SW. .. The forward and reverse primers, which target a specific region of the 16S rRNA gene in Enterobacteriaceae cells, produced an amplicon of 424 bp ( ).

    Article Title: Differential roles of the RNases H in preventing chromosome instability
    Article Snippet: Diploid cells with terminal LOH events on chromosome III were isolated on SC-LEU according to the LOH assay described in . .. Regions containing SNPs (SNP locations are listed in ) were amplified by optimized yeast colony PCR as follows: ∼5 μL of the yeast colony was resuspended in 20 μL of 0.02 M NaOH and was boiled for 10 min. Then 1 μL of this boiled yeast colony was used as a template for PCR amplification in the following reaction conditions: 1× Q buffer (Qiagen), 1× standard Taq buffer (New England BioLabs), 0.2 M dNTP, 1 μM of each primer, and 0.5 U Taq polymerase (New England BioLabs).

    Article Title: Characterisation of Casein Kinase 1.1 in Leishmania donovani Using the CRISPR Cas9 Toolkit
    Article Snippet: Diagnostic PCR To assess the loss of the target gene in the knockout cell lines, genomic DNA was isolated from parasites collected after 1 passage post-transfection with the DNeasy Blood & Tissue Kit (Qiagen). .. One hundred nanograms of genomic DNA was mixed with 0.3 mM dNTPs, 0.5 μ M forward primer and reverse primer, 3% (v/v) DMSO, 2.5 units LongAmp Taq DNA polymerase (NEB), and 1x LongAmp Taq Reaction Buffer supplemented with Mg2+ (2 mM final, NEB).

    Article Title: Early Control of Mycobacterium tuberculosis Infection Requires il12rb1 Expression by rag1-Dependent Lineages
    Article Snippet: .. To screen for the presence of a wild-type il12rb1 allele, genomic DNA (gDNA) from tail snips was isolated using the Promega Wizard SV Genomic DNA method (Promega, Madison, WI) and amplified with primers NF1 (5′-CAGAGATCCTCCTGCCTCTG-3′) and NF2 (5′-TATGGTTCGGAGGGACAAAG-3′) in a 50-μl reaction mixture comprising 2 μl of gDNA, 1.5× NEB Taq buffer (from a 10× solution), 2 mM MgCl2 , 0.2 μM primer NF1, 0.2 μM primer NF2, 0.2 mM each deoxynucleoside triphosphate (dNTP), 5% dimethyl sulfoxide (DMSO), and 1U of Taq polymerase (New England BioLabs, Ipswich, MA). .. To screen for the knockout (KO) il12rb1 allele, gDNA was amplified with primers NF1 (sequence above) and NF3 (5′-TGGATGTGGAATGTGTGCGAG-3′) in a 50-μl reaction mixture comprising 2 μl of gDNA, 1.0× NEB Taq buffer (from a 10× solution), 2 mM MgCl2 , 0.2 μM primer NF1, 0.2 μM primer NF3, 0.2 mM each dNTP, 5% DMSO, and 1U of Taq polymerase.

    Article Title: DNA barcoding and LC-MS metabolite profiling of the lichen-forming genus Melanelia: Specimen identification and discrimination focusing on Icelandic taxa
    Article Snippet: DNA extraction, PCR and sequencing Lichen genomic DNA was isolated from dried lichen powder after acetone extraction using the CTAB method [ ]. .. Each amplification reaction (25 μL) contained 1×standard Taq reaction buffer for nrITS, 200 μM dNTPs, 0.2 μM forward and reverse primer, 1.25 units of Taq DNA polymerase (New England Biolabs), 1 or 3 μL DNA template, and PCR-grade water.

    Mouse Assay:

    Article Title: Early Control of Mycobacterium tuberculosis Infection Requires il12rb1 Expression by rag1-Dependent Lineages
    Article Snippet: il12rb1 −/− mice were genotyped using primers we designed specifically for this study due to difficulties we encountered amplifying wild-type (WT) il12rb1 with published primer sets (data not shown). .. To screen for the presence of a wild-type il12rb1 allele, genomic DNA (gDNA) from tail snips was isolated using the Promega Wizard SV Genomic DNA method (Promega, Madison, WI) and amplified with primers NF1 (5′-CAGAGATCCTCCTGCCTCTG-3′) and NF2 (5′-TATGGTTCGGAGGGACAAAG-3′) in a 50-μl reaction mixture comprising 2 μl of gDNA, 1.5× NEB Taq buffer (from a 10× solution), 2 mM MgCl2 , 0.2 μM primer NF1, 0.2 μM primer NF2, 0.2 mM each deoxynucleoside triphosphate (dNTP), 5% dimethyl sulfoxide (DMSO), and 1U of Taq polymerase (New England BioLabs, Ipswich, MA).

    Polymerase Chain Reaction:

    Article Title: Independently founded populations of Sclerotinia sclerotiorum from a tropical and a temperate region have similar genetic structure
    Article Snippet: .. PCR reactions were performed in a final volume of 20 μl with 2 μl of DNA, 0.5 μl of each primer at 10 mM, 0.5 μl of dNTPs at 10 mM, 2 μl of the 10x Standard Taq Reaction Buffer that includes 1.5 mM MgCl2 , 10mM Tris-HCl and 50 mM KCl (New England Biolabs Inc., Ipswich, MA, USA) and 0.1 μl of Taq DNA polymerase (New England Biolabs, Inc.). .. PCR reactions were conducted in a C1000 Thermal Cycler (Bio-Rad, Hercules, CA, USA).

    Article Title: Breaking the speed limit with multimode fast scanning of DNA by Endonuclease V
    Article Snippet: .. The PCR reaction was performed in a 1× LongAmp Taq Reaction Buffer, with a final volume of 50 μl, 300 µM of each dNTP, 0.4 µM of each primer, 2 units LongAmp Taq DNA polymerase (New England Biolabs) and 0.1 ng µl−1 of λ-DNA template. .. The PCR included an initial denaturation step at 94 °C for 3 min, 35 cycles of denaturation (94 °C for 15 s), annealing (60 °C for 60 s) and primer extension (65 °C for 16 min), followed by a final extension step at 65 °C for 10 min.

    Article Title: Innovative Use of Palladium Compounds To Selectively Detect Live Enterobacteriaceae in Milk by PCR
    Article Snippet: .. Specifically, the direct-qPCR master mix consisted of the following: 0.5 μl of Taq DNA polymerase (with standard Taq buffer [5 U/μl]; New England BioLabs, Japan, Inc., Tokyo, Japan); 2.5 μl of 10× standard Taq reaction buffer (New England BioLabs); 2.0 μl of a 2 mM deoxynucleoside triphosphate (dNTP) mixture (TaKaRa-Bio, Ohtsu, Japan); 0.75 μl of 10 μM forward primer (5′-GTTGTAAAGCACTTTCAGTGGTGAGGAAGG-3′) and 10 μM reverse primer (5′-GCCTCAAGGGCACAACCTCCAAG-3′); 5 μl of 2× SYBR green (Invitrogen, CA, USA) (10,000× stock); 2.5 μl of mixed reagent solution stored at −20°C before use (8.3% Brij 58 from Sigma; 1.9% bovine serum albumin from Sigma; 10 mM trisodium citrate dehydrate from Kanto-Kagaku, Tokyo, Japan; 30 mM MgCl2 from Nakalai-Tesque, Kyoto, Japan; 100 μg/ml lysozyme from egg white purchased from Wako Pure Chemicals Industries, Ltd., Osaka, Japan); 5 μl of PCR template (bacterial cells or isolated DNA); and 6.75 μl of SW. .. The forward and reverse primers, which target a specific region of the 16S rRNA gene in Enterobacteriaceae cells, produced an amplicon of 424 bp ( ).

    Article Title: Characterization of Histone H2A Derived Antimicrobial Peptides, Harriottins, from Sicklefin Chimaera Neoharriotta pinnata (Schnakenbeck, 1931) and Its Evolutionary Divergence with respect to CO1 and Histone H2A
    Article Snippet: .. PCR amplification of 1 μ L of cDNA was performed in a 25 μ L reaction volume containing 1x standard Taq buffer (10 mM Tris-HCl, 50 mM KCl, pH 8.3), 1.5 mM MgCl2 , 200 mM dNTPs, 0.4 mM each primer, and 1 U Taq DNA polymerase (New England Biolabs). .. PCR products were analyzed by electrophoresis in 1.5% agarose gel in TBE buffer, stained with SYBR Safe and visualized under UV light.

    Article Title: ABCB1 haplotype and OPRM1 118A > G genotype interaction in methadone maintenance treatment pharmacogenetics
    Article Snippet: .. PCR reactions were performed in 30 μL total volume containing 100 ng DNA, 50 μM dNTPs, 0.1 μM each primer, 2.5 U Taq DNA polymerase and 1 × reaction buffer (New England Biolabs Inc, distributed by Genesearch Pty Ltd, Arundel, Australia). .. PCR cycling conditions were: 5 minutes at 94°C; 45 cycles of 30 seconds at 94°C, 30 seconds at 60°C, and 1.5 minutes at 72°C; and 5 minutes at 72°C.

    Article Title: Mycoplasma CG- and GATC-specific DNA methyltransferases selectively and efficiently methylate the host genome and alter the epigenetic landscape in human cells
    Article Snippet: .. PCR was performed in 50 μl reactions consisting of Standard Taq Reaction buffer, Taq DNA polymerase (New England Biolabs), dNTPs (200 μM each), bisulfite converted DNAs (50 ng), and the forward and reverse primers (0.5 μM each) specific for either unmethylated and methylated DNA ( ). .. PCR products were separated on 2% agarose gel, visualized by ethidium bromide, extracted from a gel and sequenced.

    Article Title: Differential roles of the RNases H in preventing chromosome instability
    Article Snippet: .. Regions containing SNPs (SNP locations are listed in ) were amplified by optimized yeast colony PCR as follows: ∼5 μL of the yeast colony was resuspended in 20 μL of 0.02 M NaOH and was boiled for 10 min. Then 1 μL of this boiled yeast colony was used as a template for PCR amplification in the following reaction conditions: 1× Q buffer (Qiagen), 1× standard Taq buffer (New England BioLabs), 0.2 M dNTP, 1 μM of each primer, and 0.5 U Taq polymerase (New England BioLabs). .. Touchdown PCR cycles were used: 94 °C for 1 min; nine cycles of 94 °C for 20 s, 62 °C decreasing by 1 °C each cycle for 45 s, 68 °C for 45 s; and 24 cycles of 94 °C for 20 s, 52 °C for 45 s, 68 °C for 45 s. The PCR-amplified DNA was cleaned using standard enzymatic cleanup conditions [1× CutSmart buffer (New England BioLabs), 1 U rSAP (New England BioLabs), 1.8 U ExoI (Thermo Scientific)] and was incubated at 37 °C for 1 h followed by heat inactivation at 80 °C for 15 min.

    Article Title: Characterisation of Casein Kinase 1.1 in Leishmania donovani Using the CRISPR Cas9 Toolkit
    Article Snippet: Paragraph title: 2.5. Diagnostic PCR ... One hundred nanograms of genomic DNA was mixed with 0.3 mM dNTPs, 0.5 μ M forward primer and reverse primer, 3% (v/v) DMSO, 2.5 units LongAmp Taq DNA polymerase (NEB), and 1x LongAmp Taq Reaction Buffer supplemented with Mg2+ (2 mM final, NEB).

    Article Title: Genetic Dissection of Tropodithietic Acid Biosynthesis by Marine Roseobacters ▿Genetic Dissection of Tropodithietic Acid Biosynthesis by Marine Roseobacters ▿ ‡
    Article Snippet: .. The standard PCR amplification conditions were 100 μM concentrations of each deoxynucleoside triphosphate, 0.2 μM concentrations of each primer, and 1 U of Taq DNA polymerase (New England Biolabs) in 1× reaction buffer (New England Biolabs) with an initial denaturing step at 94°C for 3 min, followed by 30 cycles of 94°C for 1 min each, annealing at 55°C for 30 s, and an elongation at 72°C for 1 min. To detect the tdaA-E locus, PCR amplification was conducted with a forward primer complementary to tdaA (5′-CGCTTTCCGGAACTGGAGAT-3′) and a reverse primer complementary to tdaE (5′-GGCTGCCGTATAGTTTCAGCA-3′) using the Expand Long Template PCR system (Roche Applied Science, Indianapolis, IN), and the PCR program conditions and cycle parameters were as described by the supplier. .. DNA-DNA hybridization by Southern slot blot ( ) was used to detect the presence of tda genes in other roseobacters.

    Article Title: Bacterial endophytes from wild maize suppress Fusarium graminearum in modern maize and inhibit mycotoxin accumulation
    Article Snippet: .. For fusA amplification, a PCR master mix (20 μl) was made as follows: 50 ng DNA were added (2.5 ng/μl was the final DNA concentration in the PCR reaction), 50 ng DNA, 2.5 μl Standard Taq Buffer (10 ×) (New England Biolabs), 0.5 μl of 25 mM dNTP mix, 0.25 μl of 50 mM MgCl2 , 0.25 μl of Standard Taq (10 U/μl, New England Biolabs), 1 μl of primer FusAF with sequence 5′- AGGCAAGCTTTGACTTGGAA −3′ and 1 μl of primer FusAR with sequence 5′- CGCTTGCTCAGACCATACAA −3′ and double distilled water up to 20 μl total. .. The PCR amplification conditions were: 96°C for 3 min, followed by 35 amplification cycles (94°C for 30 s, 48°C for 30 s, 72°C for 90 s), and a final extension at 72°C for 7 min, using a PTC200 DNA Thermal Cycler (MJ Scientific, USA).

    Article Title: DNA barcoding and LC-MS metabolite profiling of the lichen-forming genus Melanelia: Specimen identification and discrimination focusing on Icelandic taxa
    Article Snippet: .. Each amplification reaction (25 μL) contained 1×standard Taq reaction buffer for nrITS, 200 μM dNTPs, 0.2 μM forward and reverse primer, 1.25 units of Taq DNA polymerase (New England Biolabs), 1 or 3 μL DNA template, and PCR-grade water. .. PCR cycling conditions were as follows: initial denaturation at 94°C for 3 min, 31 cycles of 94°C for 40s, 54°C for 40s and 68°C for 1min, final extension at 68°C for 7min and cooling down to 4°C.

    Purification:

    Article Title: Bacterial endophytes from wild maize suppress Fusarium graminearum in modern maize and inhibit mycotoxin accumulation
    Article Snippet: For fusA amplification, a PCR master mix (20 μl) was made as follows: 50 ng DNA were added (2.5 ng/μl was the final DNA concentration in the PCR reaction), 50 ng DNA, 2.5 μl Standard Taq Buffer (10 ×) (New England Biolabs), 0.5 μl of 25 mM dNTP mix, 0.25 μl of 50 mM MgCl2 , 0.25 μl of Standard Taq (10 U/μl, New England Biolabs), 1 μl of primer FusAF with sequence 5′- AGGCAAGCTTTGACTTGGAA −3′ and 1 μl of primer FusAR with sequence 5′- CGCTTGCTCAGACCATACAA −3′ and double distilled water up to 20 μl total. .. The PCR products were separated on 1.5% agarose gels at ≤ 5 V/cm, then the bands were visualized under UV light; bands were excised and eluted from the gels (Illustra GFX 96 PCR Purification kit, GE Healthcare, USA).

    Article Title: DNA barcoding and LC-MS metabolite profiling of the lichen-forming genus Melanelia: Specimen identification and discrimination focusing on Icelandic taxa
    Article Snippet: Each amplification reaction (25 μL) contained 1×standard Taq reaction buffer for nrITS, 200 μM dNTPs, 0.2 μM forward and reverse primer, 1.25 units of Taq DNA polymerase (New England Biolabs), 1 or 3 μL DNA template, and PCR-grade water. .. PCR amplicons were purified using EXO-SAP (Fermentas) following manufacturer’s instruction.

    Software:

    Article Title: Bacterial endophytes from wild maize suppress Fusarium graminearum in modern maize and inhibit mycotoxin accumulation
    Article Snippet: PCR based approach to detect the fusaricidin biosynthetic gene in the paenibacillus endophyte strains In order to detect the presence of a candidate fusaricidin synthetase gene (fusA ) in the Paenibacillus endophyte strains, two oligonucleotides (FusAF and FusAR) were designed based on the fusA sequence (GenBank accession # EU184010 ) using Primer3 software. .. For fusA amplification, a PCR master mix (20 μl) was made as follows: 50 ng DNA were added (2.5 ng/μl was the final DNA concentration in the PCR reaction), 50 ng DNA, 2.5 μl Standard Taq Buffer (10 ×) (New England Biolabs), 0.5 μl of 25 mM dNTP mix, 0.25 μl of 50 mM MgCl2 , 0.25 μl of Standard Taq (10 U/μl, New England Biolabs), 1 μl of primer FusAF with sequence 5′- AGGCAAGCTTTGACTTGGAA −3′ and 1 μl of primer FusAR with sequence 5′- CGCTTGCTCAGACCATACAA −3′ and double distilled water up to 20 μl total.

    SYBR Green Assay:

    Article Title: Innovative Use of Palladium Compounds To Selectively Detect Live Enterobacteriaceae in Milk by PCR
    Article Snippet: .. Specifically, the direct-qPCR master mix consisted of the following: 0.5 μl of Taq DNA polymerase (with standard Taq buffer [5 U/μl]; New England BioLabs, Japan, Inc., Tokyo, Japan); 2.5 μl of 10× standard Taq reaction buffer (New England BioLabs); 2.0 μl of a 2 mM deoxynucleoside triphosphate (dNTP) mixture (TaKaRa-Bio, Ohtsu, Japan); 0.75 μl of 10 μM forward primer (5′-GTTGTAAAGCACTTTCAGTGGTGAGGAAGG-3′) and 10 μM reverse primer (5′-GCCTCAAGGGCACAACCTCCAAG-3′); 5 μl of 2× SYBR green (Invitrogen, CA, USA) (10,000× stock); 2.5 μl of mixed reagent solution stored at −20°C before use (8.3% Brij 58 from Sigma; 1.9% bovine serum albumin from Sigma; 10 mM trisodium citrate dehydrate from Kanto-Kagaku, Tokyo, Japan; 30 mM MgCl2 from Nakalai-Tesque, Kyoto, Japan; 100 μg/ml lysozyme from egg white purchased from Wako Pure Chemicals Industries, Ltd., Osaka, Japan); 5 μl of PCR template (bacterial cells or isolated DNA); and 6.75 μl of SW. .. The forward and reverse primers, which target a specific region of the 16S rRNA gene in Enterobacteriaceae cells, produced an amplicon of 424 bp ( ).

    Multiplex Assay:

    Article Title: Genetic Dissection of Tropodithietic Acid Biosynthesis by Marine Roseobacters ▿Genetic Dissection of Tropodithietic Acid Biosynthesis by Marine Roseobacters ▿ ‡
    Article Snippet: Multiplex PCR amplification was used to screen for the presence of tda genes in Tda− mutants. .. The standard PCR amplification conditions were 100 μM concentrations of each deoxynucleoside triphosphate, 0.2 μM concentrations of each primer, and 1 U of Taq DNA polymerase (New England Biolabs) in 1× reaction buffer (New England Biolabs) with an initial denaturing step at 94°C for 3 min, followed by 30 cycles of 94°C for 1 min each, annealing at 55°C for 30 s, and an elongation at 72°C for 1 min. To detect the tdaA-E locus, PCR amplification was conducted with a forward primer complementary to tdaA (5′-CGCTTTCCGGAACTGGAGAT-3′) and a reverse primer complementary to tdaE (5′-GGCTGCCGTATAGTTTCAGCA-3′) using the Expand Long Template PCR system (Roche Applied Science, Indianapolis, IN), and the PCR program conditions and cycle parameters were as described by the supplier.

    Agarose Gel Electrophoresis:

    Article Title: Independently founded populations of Sclerotinia sclerotiorum from a tropical and a temperate region have similar genetic structure
    Article Snippet: The integrity of the DNA samples was analyzed using electrophoresis on a 1% agarose gel (1% wt/vol agarose in Tris-borate-EDTA [TBE]) amended with 0.5× (v/v) nucleic acid stain GelRed (Biotium, Inc., Hayward, CA). .. PCR reactions were performed in a final volume of 20 μl with 2 μl of DNA, 0.5 μl of each primer at 10 mM, 0.5 μl of dNTPs at 10 mM, 2 μl of the 10x Standard Taq Reaction Buffer that includes 1.5 mM MgCl2 , 10mM Tris-HCl and 50 mM KCl (New England Biolabs Inc., Ipswich, MA, USA) and 0.1 μl of Taq DNA polymerase (New England Biolabs, Inc.).

    Article Title: Characterization of Histone H2A Derived Antimicrobial Peptides, Harriottins, from Sicklefin Chimaera Neoharriotta pinnata (Schnakenbeck, 1931) and Its Evolutionary Divergence with respect to CO1 and Histone H2A
    Article Snippet: PCR amplification of 1 μ L of cDNA was performed in a 25 μ L reaction volume containing 1x standard Taq buffer (10 mM Tris-HCl, 50 mM KCl, pH 8.3), 1.5 mM MgCl2 , 200 mM dNTPs, 0.4 mM each primer, and 1 U Taq DNA polymerase (New England Biolabs). .. PCR products were analyzed by electrophoresis in 1.5% agarose gel in TBE buffer, stained with SYBR Safe and visualized under UV light.

    Article Title: Mycoplasma CG- and GATC-specific DNA methyltransferases selectively and efficiently methylate the host genome and alter the epigenetic landscape in human cells
    Article Snippet: PCR was performed in 50 μl reactions consisting of Standard Taq Reaction buffer, Taq DNA polymerase (New England Biolabs), dNTPs (200 μM each), bisulfite converted DNAs (50 ng), and the forward and reverse primers (0.5 μM each) specific for either unmethylated and methylated DNA ( ). .. PCR products were separated on 2% agarose gel, visualized by ethidium bromide, extracted from a gel and sequenced.

    Article Title: Early Control of Mycobacterium tuberculosis Infection Requires il12rb1 Expression by rag1-Dependent Lineages
    Article Snippet: To screen for the presence of a wild-type il12rb1 allele, genomic DNA (gDNA) from tail snips was isolated using the Promega Wizard SV Genomic DNA method (Promega, Madison, WI) and amplified with primers NF1 (5′-CAGAGATCCTCCTGCCTCTG-3′) and NF2 (5′-TATGGTTCGGAGGGACAAAG-3′) in a 50-μl reaction mixture comprising 2 μl of gDNA, 1.5× NEB Taq buffer (from a 10× solution), 2 mM MgCl2 , 0.2 μM primer NF1, 0.2 μM primer NF2, 0.2 mM each deoxynucleoside triphosphate (dNTP), 5% dimethyl sulfoxide (DMSO), and 1U of Taq polymerase (New England BioLabs, Ipswich, MA). .. The parameters for amplification of both wild-type and knockout il12rb1 alleles were the following: one cycle of 95° for 5 min; 35 cycles of 95° for 30 s, 60° for 1 min, and 72° for 1 min; one cycle of 72° for 10 min. Amplicons were resolved on a 1% agarose gel using traditional electrophoresis techniques.

    Electrophoresis:

    Article Title: Independently founded populations of Sclerotinia sclerotiorum from a tropical and a temperate region have similar genetic structure
    Article Snippet: The integrity of the DNA samples was analyzed using electrophoresis on a 1% agarose gel (1% wt/vol agarose in Tris-borate-EDTA [TBE]) amended with 0.5× (v/v) nucleic acid stain GelRed (Biotium, Inc., Hayward, CA). .. PCR reactions were performed in a final volume of 20 μl with 2 μl of DNA, 0.5 μl of each primer at 10 mM, 0.5 μl of dNTPs at 10 mM, 2 μl of the 10x Standard Taq Reaction Buffer that includes 1.5 mM MgCl2 , 10mM Tris-HCl and 50 mM KCl (New England Biolabs Inc., Ipswich, MA, USA) and 0.1 μl of Taq DNA polymerase (New England Biolabs, Inc.).

    Article Title: Characterization of Histone H2A Derived Antimicrobial Peptides, Harriottins, from Sicklefin Chimaera Neoharriotta pinnata (Schnakenbeck, 1931) and Its Evolutionary Divergence with respect to CO1 and Histone H2A
    Article Snippet: PCR amplification of 1 μ L of cDNA was performed in a 25 μ L reaction volume containing 1x standard Taq buffer (10 mM Tris-HCl, 50 mM KCl, pH 8.3), 1.5 mM MgCl2 , 200 mM dNTPs, 0.4 mM each primer, and 1 U Taq DNA polymerase (New England Biolabs). .. PCR products were analyzed by electrophoresis in 1.5% agarose gel in TBE buffer, stained with SYBR Safe and visualized under UV light.

    Article Title: Early Control of Mycobacterium tuberculosis Infection Requires il12rb1 Expression by rag1-Dependent Lineages
    Article Snippet: To screen for the presence of a wild-type il12rb1 allele, genomic DNA (gDNA) from tail snips was isolated using the Promega Wizard SV Genomic DNA method (Promega, Madison, WI) and amplified with primers NF1 (5′-CAGAGATCCTCCTGCCTCTG-3′) and NF2 (5′-TATGGTTCGGAGGGACAAAG-3′) in a 50-μl reaction mixture comprising 2 μl of gDNA, 1.5× NEB Taq buffer (from a 10× solution), 2 mM MgCl2 , 0.2 μM primer NF1, 0.2 μM primer NF2, 0.2 mM each deoxynucleoside triphosphate (dNTP), 5% dimethyl sulfoxide (DMSO), and 1U of Taq polymerase (New England BioLabs, Ipswich, MA). .. The parameters for amplification of both wild-type and knockout il12rb1 alleles were the following: one cycle of 95° for 5 min; 35 cycles of 95° for 30 s, 60° for 1 min, and 72° for 1 min; one cycle of 72° for 10 min. Amplicons were resolved on a 1% agarose gel using traditional electrophoresis techniques.

    Knock-Out:

    Article Title: Characterisation of Casein Kinase 1.1 in Leishmania donovani Using the CRISPR Cas9 Toolkit
    Article Snippet: Diagnostic PCR To assess the loss of the target gene in the knockout cell lines, genomic DNA was isolated from parasites collected after 1 passage post-transfection with the DNeasy Blood & Tissue Kit (Qiagen). .. One hundred nanograms of genomic DNA was mixed with 0.3 mM dNTPs, 0.5 μ M forward primer and reverse primer, 3% (v/v) DMSO, 2.5 units LongAmp Taq DNA polymerase (NEB), and 1x LongAmp Taq Reaction Buffer supplemented with Mg2+ (2 mM final, NEB).

    Article Title: Early Control of Mycobacterium tuberculosis Infection Requires il12rb1 Expression by rag1-Dependent Lineages
    Article Snippet: To screen for the presence of a wild-type il12rb1 allele, genomic DNA (gDNA) from tail snips was isolated using the Promega Wizard SV Genomic DNA method (Promega, Madison, WI) and amplified with primers NF1 (5′-CAGAGATCCTCCTGCCTCTG-3′) and NF2 (5′-TATGGTTCGGAGGGACAAAG-3′) in a 50-μl reaction mixture comprising 2 μl of gDNA, 1.5× NEB Taq buffer (from a 10× solution), 2 mM MgCl2 , 0.2 μM primer NF1, 0.2 μM primer NF2, 0.2 mM each deoxynucleoside triphosphate (dNTP), 5% dimethyl sulfoxide (DMSO), and 1U of Taq polymerase (New England BioLabs, Ipswich, MA). .. To screen for the knockout (KO) il12rb1 allele, gDNA was amplified with primers NF1 (sequence above) and NF3 (5′-TGGATGTGGAATGTGTGCGAG-3′) in a 50-μl reaction mixture comprising 2 μl of gDNA, 1.0× NEB Taq buffer (from a 10× solution), 2 mM MgCl2 , 0.2 μM primer NF1, 0.2 μM primer NF3, 0.2 mM each dNTP, 5% DMSO, and 1U of Taq polymerase.

    Produced:

    Article Title: Innovative Use of Palladium Compounds To Selectively Detect Live Enterobacteriaceae in Milk by PCR
    Article Snippet: Specifically, the direct-qPCR master mix consisted of the following: 0.5 μl of Taq DNA polymerase (with standard Taq buffer [5 U/μl]; New England BioLabs, Japan, Inc., Tokyo, Japan); 2.5 μl of 10× standard Taq reaction buffer (New England BioLabs); 2.0 μl of a 2 mM deoxynucleoside triphosphate (dNTP) mixture (TaKaRa-Bio, Ohtsu, Japan); 0.75 μl of 10 μM forward primer (5′-GTTGTAAAGCACTTTCAGTGGTGAGGAAGG-3′) and 10 μM reverse primer (5′-GCCTCAAGGGCACAACCTCCAAG-3′); 5 μl of 2× SYBR green (Invitrogen, CA, USA) (10,000× stock); 2.5 μl of mixed reagent solution stored at −20°C before use (8.3% Brij 58 from Sigma; 1.9% bovine serum albumin from Sigma; 10 mM trisodium citrate dehydrate from Kanto-Kagaku, Tokyo, Japan; 30 mM MgCl2 from Nakalai-Tesque, Kyoto, Japan; 100 μg/ml lysozyme from egg white purchased from Wako Pure Chemicals Industries, Ltd., Osaka, Japan); 5 μl of PCR template (bacterial cells or isolated DNA); and 6.75 μl of SW. .. The forward and reverse primers, which target a specific region of the 16S rRNA gene in Enterobacteriaceae cells, produced an amplicon of 424 bp ( ).

    Concentration Assay:

    Article Title: Bacterial endophytes from wild maize suppress Fusarium graminearum in modern maize and inhibit mycotoxin accumulation
    Article Snippet: .. For fusA amplification, a PCR master mix (20 μl) was made as follows: 50 ng DNA were added (2.5 ng/μl was the final DNA concentration in the PCR reaction), 50 ng DNA, 2.5 μl Standard Taq Buffer (10 ×) (New England Biolabs), 0.5 μl of 25 mM dNTP mix, 0.25 μl of 50 mM MgCl2 , 0.25 μl of Standard Taq (10 U/μl, New England Biolabs), 1 μl of primer FusAF with sequence 5′- AGGCAAGCTTTGACTTGGAA −3′ and 1 μl of primer FusAR with sequence 5′- CGCTTGCTCAGACCATACAA −3′ and double distilled water up to 20 μl total. .. The PCR amplification conditions were: 96°C for 3 min, followed by 35 amplification cycles (94°C for 30 s, 48°C for 30 s, 72°C for 90 s), and a final extension at 72°C for 7 min, using a PTC200 DNA Thermal Cycler (MJ Scientific, USA).

    Staining:

    Article Title: Independently founded populations of Sclerotinia sclerotiorum from a tropical and a temperate region have similar genetic structure
    Article Snippet: The integrity of the DNA samples was analyzed using electrophoresis on a 1% agarose gel (1% wt/vol agarose in Tris-borate-EDTA [TBE]) amended with 0.5× (v/v) nucleic acid stain GelRed (Biotium, Inc., Hayward, CA). .. PCR reactions were performed in a final volume of 20 μl with 2 μl of DNA, 0.5 μl of each primer at 10 mM, 0.5 μl of dNTPs at 10 mM, 2 μl of the 10x Standard Taq Reaction Buffer that includes 1.5 mM MgCl2 , 10mM Tris-HCl and 50 mM KCl (New England Biolabs Inc., Ipswich, MA, USA) and 0.1 μl of Taq DNA polymerase (New England Biolabs, Inc.).

    Article Title: Characterization of Histone H2A Derived Antimicrobial Peptides, Harriottins, from Sicklefin Chimaera Neoharriotta pinnata (Schnakenbeck, 1931) and Its Evolutionary Divergence with respect to CO1 and Histone H2A
    Article Snippet: PCR amplification of 1 μ L of cDNA was performed in a 25 μ L reaction volume containing 1x standard Taq buffer (10 mM Tris-HCl, 50 mM KCl, pH 8.3), 1.5 mM MgCl2 , 200 mM dNTPs, 0.4 mM each primer, and 1 U Taq DNA polymerase (New England Biolabs). .. PCR products were analyzed by electrophoresis in 1.5% agarose gel in TBE buffer, stained with SYBR Safe and visualized under UV light.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs longamp taq dna polymerase
    Derivative dissociation plots produced by different reagents using one microliter of lysate produced by homogenizing one H. armigera leg with 24 H. zea legs in 625 μl of modified squish buffer. (A) Amplification reactions made with KAPA SYBR Fast Master Mix (purple) and NEB <t>LongAmp</t> <t>Taq</t> polymerase and buffer with 2.5 mM MgCl2 (Red). Peaks representing 18S rRNA control amplicon and species-specific amplicons of H. armigera and H. zea are present in all reactions, but melting temperatures were different in two reagents. (B) An enlarged view of the derivative dissociation plot produced by amplification reactions with NEB LongAmp Taq polymerase and buffer. Although variations in dissociation plots between samples were observed, the 3-peak dissociation plot was clearly identifiable.
    Longamp Taq Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 120 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/longamp taq dna polymerase/product/New England Biolabs
    Average 99 stars, based on 120 article reviews
    Price from $9.99 to $1999.99
    longamp taq dna polymerase - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs longamp taq reaction buffer
    Derivative dissociation plots produced by different reagents using one microliter of lysate produced by homogenizing one H. armigera leg with 24 H. zea legs in 625 μl of modified squish buffer. (A) Amplification reactions made with KAPA SYBR Fast Master Mix (purple) and NEB <t>LongAmp</t> <t>Taq</t> polymerase and buffer with 2.5 mM MgCl2 (Red). Peaks representing 18S rRNA control amplicon and species-specific amplicons of H. armigera and H. zea are present in all reactions, but melting temperatures were different in two reagents. (B) An enlarged view of the derivative dissociation plot produced by amplification reactions with NEB LongAmp Taq polymerase and buffer. Although variations in dissociation plots between samples were observed, the 3-peak dissociation plot was clearly identifiable.
    Longamp Taq Reaction Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/longamp taq reaction buffer/product/New England Biolabs
    Average 99 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    longamp taq reaction buffer - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Derivative dissociation plots produced by different reagents using one microliter of lysate produced by homogenizing one H. armigera leg with 24 H. zea legs in 625 μl of modified squish buffer. (A) Amplification reactions made with KAPA SYBR Fast Master Mix (purple) and NEB LongAmp Taq polymerase and buffer with 2.5 mM MgCl2 (Red). Peaks representing 18S rRNA control amplicon and species-specific amplicons of H. armigera and H. zea are present in all reactions, but melting temperatures were different in two reagents. (B) An enlarged view of the derivative dissociation plot produced by amplification reactions with NEB LongAmp Taq polymerase and buffer. Although variations in dissociation plots between samples were observed, the 3-peak dissociation plot was clearly identifiable.

    Journal: Journal of Insect Science

    Article Title: Rapid Identification of Helicoverpa armigera and Helicoverpa zea (Lepidoptera: Noctuidae) Using Ribosomal RNA Internal Transcribed Spacer 1

    doi: 10.1093/jisesa/iev137

    Figure Lengend Snippet: Derivative dissociation plots produced by different reagents using one microliter of lysate produced by homogenizing one H. armigera leg with 24 H. zea legs in 625 μl of modified squish buffer. (A) Amplification reactions made with KAPA SYBR Fast Master Mix (purple) and NEB LongAmp Taq polymerase and buffer with 2.5 mM MgCl2 (Red). Peaks representing 18S rRNA control amplicon and species-specific amplicons of H. armigera and H. zea are present in all reactions, but melting temperatures were different in two reagents. (B) An enlarged view of the derivative dissociation plot produced by amplification reactions with NEB LongAmp Taq polymerase and buffer. Although variations in dissociation plots between samples were observed, the 3-peak dissociation plot was clearly identifiable.

    Article Snippet: All amplifications with pooled tissue lysates were optimized using KAPA SYBR Fast 2X qPCR Master Mix (KAPA Biosystems, Boston, MA, Item no. KK4604) and LongAmp Taq DNA polymerase and buffer (New England BioLabs, Ipswich, MA, Item no. M0323S).

    Techniques: Produced, Modification, Amplification