long range pcr  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Name:
    Extensor Long Range PCR Polymerase Blend Kits and Master Mixes
    Description:

    Catalog Number:
    ab-0792/b
    Price:
    None
    Buy from Supplier


    Structured Review

    Thermo Fisher long range pcr
    <t>PCR-based</t> breakpoint identification. (A) Long-range PCR products of ~ 16 kb covering the breakpoint region of the derivative chromosome 12. M: DNA size marker; 1. II-1, 2. II-3, 3: I-2, 4: I-1, 5: water blank, 6: positive control for long-range PCR using genomic DNA as a template, 7. positive control for long-range PCR using phage lambda as a template. (B) The breakpoint region of derivative chromosome 12 was further narrowed down to a PCR product of ~ 2 kb. M: DNA size marker; 1. II-1, 2. II-3, 3: I-2, 4: I-1, 5: positive control for long-range PCR using genomic DNA as a template (C). To sequence the breakpoint region, a PCR product of 600 bp covering the breakpoint region of derivative chromosome 12 was generated and subjected to <t>autosequencing.</t> M: DNA size marker; 1. II-1, 2. II-3, 3: I-2, 4: I-1, 5: water blank. (D) PCR products of ~ 1 kb covering the breakpoint region of derivative chromosome 1 were obtained and subjected to autosequencing. M: DNA size marker; 1. II-1, 2. II-3, 3: I-2, 4: I-1, 5: water blank.

    https://www.bioz.com/result/long range pcr/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    long range pcr - by Bioz Stars, 2021-03
    86/100 stars

    Images

    1) Product Images from "Clinical and molecular characterization of a transmitted reciprocal translocation t(1;12)(p32.1;q21.3) in a family co-segregating with mental retardation, language delay, and microcephaly"

    Article Title: Clinical and molecular characterization of a transmitted reciprocal translocation t(1;12)(p32.1;q21.3) in a family co-segregating with mental retardation, language delay, and microcephaly

    Journal: BMC Medical Genetics

    doi: 10.1186/1471-2350-12-70

    PCR-based breakpoint identification. (A) Long-range PCR products of ~ 16 kb covering the breakpoint region of the derivative chromosome 12. M: DNA size marker; 1. II-1, 2. II-3, 3: I-2, 4: I-1, 5: water blank, 6: positive control for long-range PCR using genomic DNA as a template, 7. positive control for long-range PCR using phage lambda as a template. (B) The breakpoint region of derivative chromosome 12 was further narrowed down to a PCR product of ~ 2 kb. M: DNA size marker; 1. II-1, 2. II-3, 3: I-2, 4: I-1, 5: positive control for long-range PCR using genomic DNA as a template (C). To sequence the breakpoint region, a PCR product of 600 bp covering the breakpoint region of derivative chromosome 12 was generated and subjected to autosequencing. M: DNA size marker; 1. II-1, 2. II-3, 3: I-2, 4: I-1, 5: water blank. (D) PCR products of ~ 1 kb covering the breakpoint region of derivative chromosome 1 were obtained and subjected to autosequencing. M: DNA size marker; 1. II-1, 2. II-3, 3: I-2, 4: I-1, 5: water blank.
    Figure Legend Snippet: PCR-based breakpoint identification. (A) Long-range PCR products of ~ 16 kb covering the breakpoint region of the derivative chromosome 12. M: DNA size marker; 1. II-1, 2. II-3, 3: I-2, 4: I-1, 5: water blank, 6: positive control for long-range PCR using genomic DNA as a template, 7. positive control for long-range PCR using phage lambda as a template. (B) The breakpoint region of derivative chromosome 12 was further narrowed down to a PCR product of ~ 2 kb. M: DNA size marker; 1. II-1, 2. II-3, 3: I-2, 4: I-1, 5: positive control for long-range PCR using genomic DNA as a template (C). To sequence the breakpoint region, a PCR product of 600 bp covering the breakpoint region of derivative chromosome 12 was generated and subjected to autosequencing. M: DNA size marker; 1. II-1, 2. II-3, 3: I-2, 4: I-1, 5: water blank. (D) PCR products of ~ 1 kb covering the breakpoint region of derivative chromosome 1 were obtained and subjected to autosequencing. M: DNA size marker; 1. II-1, 2. II-3, 3: I-2, 4: I-1, 5: water blank.

    Techniques Used: Polymerase Chain Reaction, Marker, Positive Control, Sequencing, Generated

    The sequences of chromosome 1 and chromosome 12 breakpoint. The sequences flanking the breakpoint junction of derivative chromosome 12 (A) and derivative chromosome 1 (B) were obtained after autosequencing the PCR amplicons covering the breakpoint regions. The nucleotide positions of the breakpoints were based on the human genome sequences Build 37.1.
    Figure Legend Snippet: The sequences of chromosome 1 and chromosome 12 breakpoint. The sequences flanking the breakpoint junction of derivative chromosome 12 (A) and derivative chromosome 1 (B) were obtained after autosequencing the PCR amplicons covering the breakpoint regions. The nucleotide positions of the breakpoints were based on the human genome sequences Build 37.1.

    Techniques Used: Polymerase Chain Reaction

    2) Product Images from "Human PPP1R26P1 Functions as cis-Repressive Element in Mouse Rb1"

    Article Title: Human PPP1R26P1 Functions as cis-Repressive Element in Mouse Rb1

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0074159

    Transcription at CpG85. A) Expression of the transcript is elevated towards the 3’-end of CpG85. Quantitative RT-PCR with primer / probe assays (localization is shown in Figure 3B top) demonstrates significantly higher expression at the more 3’-end of CpG85. For comparison, expression of Rb1 is shown as measured with assays at exons 4/6 and exons 18/19. Analysis was conducted in six independent clones in two biological and two technical replicates, respectively. Expression levels are normalized to the level of β-actin. The p-value was calculated using the Welch two-sample test. B) RNA polymerase II (RNAPII) is enriched at the 3’ end of CpG85. Presence of initiating and elongating RNAPII at the Rb1 and CpG85 promoters was tested for by ChIP. Top: schemes showing localization of primer / probe assays for qPCR over the Rb1 promoter (three assays) and CpG85 (four assays), as well as the mapped transcriptional start sites in CpG85. Results are depicted as % input and the non-related antibody (against PML protein) control is shown in black. Both types of RNAPII could be found at both promoters. Three independent experiments are shown, one in cells with genotype SNV_ PPP1R26P1 /wt and two in independent clones of genotype SNV / PPP1R26P1 .
    Figure Legend Snippet: Transcription at CpG85. A) Expression of the transcript is elevated towards the 3’-end of CpG85. Quantitative RT-PCR with primer / probe assays (localization is shown in Figure 3B top) demonstrates significantly higher expression at the more 3’-end of CpG85. For comparison, expression of Rb1 is shown as measured with assays at exons 4/6 and exons 18/19. Analysis was conducted in six independent clones in two biological and two technical replicates, respectively. Expression levels are normalized to the level of β-actin. The p-value was calculated using the Welch two-sample test. B) RNA polymerase II (RNAPII) is enriched at the 3’ end of CpG85. Presence of initiating and elongating RNAPII at the Rb1 and CpG85 promoters was tested for by ChIP. Top: schemes showing localization of primer / probe assays for qPCR over the Rb1 promoter (three assays) and CpG85 (four assays), as well as the mapped transcriptional start sites in CpG85. Results are depicted as % input and the non-related antibody (against PML protein) control is shown in black. Both types of RNAPII could be found at both promoters. Three independent experiments are shown, one in cells with genotype SNV_ PPP1R26P1 /wt and two in independent clones of genotype SNV / PPP1R26P1 .

    Techniques Used: Expressing, Quantitative RT-PCR, Clone Assay, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction

    Targeting human PPP1R26P1 into mouse Rb1 intron 2. A) Top: structure of the human PPP1R26 gene on chromosome 9, consisting of four exons; non-coding sequences are indicated by lower box height. Four small CpG islands are represented by black lines below exon 4. Middle: mRNA structure of PPP1R26 . Below: scheme of exons 1 to 3 (black vertical boxes) of the human RB1 locus on chromosome 13. Integration of PPP1R26P1 in intron 2 of RB1 occurred in inverted orientation and skipping part of exon 1 of the PPP1R26 mRNA. The pseudogene has two larger CpG islands, CpG42 and CpG85, their methylation status is indicated by circles: filled – methylated, open – not methylated. Expression of RB1 is skewed in favor of the maternal allele indicated by a thicker arrow. The new exon 2B is shown as white box in PPP1R26P1 , it splices onto exon 3 of RB1 . The light gray boxes in intron 2 indicate ECRs A and B. B) Generation of modified ES cells. The order of targeting experiments is shown, indicating the number and designations of clones analyzed. Above the arrows the type of experiment is given: SNV or PPP1R26P1 construct: introduction of targeting vectors; PFGE: analysis of phasing of the two targeting events; Cre: removal of selection cassette by Cre expression. C) The targeting strategy in murine ES cells. Top: wild type mouse Rb1 locus on chromosome 14 is shown from exon 1 to 5 (black boxes), also showing the positions of ECRs A and B (grey boxes). Below: constructs used to introduce the SNV (indicated by P for the newly generated PstI restriction site) into exon 3 of Rb1 (SNV targeting vector) and to introduce human PPP1R26P1 (gray dotted box, positions of CpG42 and CpG85 shown as black lines) into intron 2 of Rb1 ( PPP1R26P1 targeting vector). The homology region of the latter was amplified by PCR, primers are indicated as black arrows. Both contracts contained a neomycin selection cassette (striped box) flanked by either loxP (white triangles) or loxP511 (black triangles) sites, respectively. Restriction enzymes: B: BamHI, E: EcoRI, H: HindIII, Hc: HincII, P: PstI, Sw: SwaI, X: XcmI. Southern blot probes are indicated in the top scheme as black lines and labeled. The two possible genomic combinations of targeted alleles are depicted in the lower panel: genotype SNV_ PPP1R26P1 /wt, having both targeting events and the same allele or genotype SNV / PPP1R26P1 with the two targeting events on different alleles. D) Southern blot analysis of targeted clones carrying the SNV in exon 3 of Rb1 . Probe SNP 5’ ext hybridized to HincII-digested genomic DNA shows an 8 kb fragment for the targeted allele in Rb1 _SNVneo and a 12 kb band for the targeted allele after selection cassette removal in Rb1 _SNV clones. E) Southern blot analysis for targeting of PPP1R26P1 into intron 2 of Rb1 . Probe KIAA 5’ ext hybridized to HincII-digested genomic DNA identifies a 4 kb fragment for the targeted allele in the SNV_ PPP1R26P1 neo clone and a 10kb fragment in SNV_ PPP1R26P1 clones after removal of the selection cassette. F) Southern blot analysis of PFGE to determine phasing of the two targeting events. Probe KIAA 5’ ext was hybridised to EcoRV-digested DNA to identify either a 23 kb and a 27 kb band in clones having genotype SNV_ PPP1R26P1 neo/wt (both events on one allele) or a 20kb and a 30kb fragment in clones with genotype SNV / PPP1R26P1 neo with the two events occurred on different alleles.
    Figure Legend Snippet: Targeting human PPP1R26P1 into mouse Rb1 intron 2. A) Top: structure of the human PPP1R26 gene on chromosome 9, consisting of four exons; non-coding sequences are indicated by lower box height. Four small CpG islands are represented by black lines below exon 4. Middle: mRNA structure of PPP1R26 . Below: scheme of exons 1 to 3 (black vertical boxes) of the human RB1 locus on chromosome 13. Integration of PPP1R26P1 in intron 2 of RB1 occurred in inverted orientation and skipping part of exon 1 of the PPP1R26 mRNA. The pseudogene has two larger CpG islands, CpG42 and CpG85, their methylation status is indicated by circles: filled – methylated, open – not methylated. Expression of RB1 is skewed in favor of the maternal allele indicated by a thicker arrow. The new exon 2B is shown as white box in PPP1R26P1 , it splices onto exon 3 of RB1 . The light gray boxes in intron 2 indicate ECRs A and B. B) Generation of modified ES cells. The order of targeting experiments is shown, indicating the number and designations of clones analyzed. Above the arrows the type of experiment is given: SNV or PPP1R26P1 construct: introduction of targeting vectors; PFGE: analysis of phasing of the two targeting events; Cre: removal of selection cassette by Cre expression. C) The targeting strategy in murine ES cells. Top: wild type mouse Rb1 locus on chromosome 14 is shown from exon 1 to 5 (black boxes), also showing the positions of ECRs A and B (grey boxes). Below: constructs used to introduce the SNV (indicated by P for the newly generated PstI restriction site) into exon 3 of Rb1 (SNV targeting vector) and to introduce human PPP1R26P1 (gray dotted box, positions of CpG42 and CpG85 shown as black lines) into intron 2 of Rb1 ( PPP1R26P1 targeting vector). The homology region of the latter was amplified by PCR, primers are indicated as black arrows. Both contracts contained a neomycin selection cassette (striped box) flanked by either loxP (white triangles) or loxP511 (black triangles) sites, respectively. Restriction enzymes: B: BamHI, E: EcoRI, H: HindIII, Hc: HincII, P: PstI, Sw: SwaI, X: XcmI. Southern blot probes are indicated in the top scheme as black lines and labeled. The two possible genomic combinations of targeted alleles are depicted in the lower panel: genotype SNV_ PPP1R26P1 /wt, having both targeting events and the same allele or genotype SNV / PPP1R26P1 with the two targeting events on different alleles. D) Southern blot analysis of targeted clones carrying the SNV in exon 3 of Rb1 . Probe SNP 5’ ext hybridized to HincII-digested genomic DNA shows an 8 kb fragment for the targeted allele in Rb1 _SNVneo and a 12 kb band for the targeted allele after selection cassette removal in Rb1 _SNV clones. E) Southern blot analysis for targeting of PPP1R26P1 into intron 2 of Rb1 . Probe KIAA 5’ ext hybridized to HincII-digested genomic DNA identifies a 4 kb fragment for the targeted allele in the SNV_ PPP1R26P1 neo clone and a 10kb fragment in SNV_ PPP1R26P1 clones after removal of the selection cassette. F) Southern blot analysis of PFGE to determine phasing of the two targeting events. Probe KIAA 5’ ext was hybridised to EcoRV-digested DNA to identify either a 23 kb and a 27 kb band in clones having genotype SNV_ PPP1R26P1 neo/wt (both events on one allele) or a 20kb and a 30kb fragment in clones with genotype SNV / PPP1R26P1 neo with the two events occurred on different alleles.

    Techniques Used: Methylation, Expressing, Modification, Clone Assay, Construct, Selection, Introduce, Generated, Plasmid Preparation, Amplification, Polymerase Chain Reaction, Southern Blot, Labeling

    3) Product Images from "A novel pathogenic germline mutation in the adenomatous polyposis coli gene in a Chinese family with familial adenomatous coli"

    Article Title: A novel pathogenic germline mutation in the adenomatous polyposis coli gene in a Chinese family with familial adenomatous coli

    Journal: Oncotarget

    doi:

    Verification of the deletion in II7 and III7 by real-time PCR Relative amplification (RA) level of the exon 15 in patient II7 and control is nearly 1, and the RA level in III7 is approximately half. GAPDH DNA was used as a loading control.
    Figure Legend Snippet: Verification of the deletion in II7 and III7 by real-time PCR Relative amplification (RA) level of the exon 15 in patient II7 and control is nearly 1, and the RA level in III7 is approximately half. GAPDH DNA was used as a loading control.

    Techniques Used: Real-time Polymerase Chain Reaction, Amplification

    4) Product Images from "A Complex Structural Variation on Chromosome 27 Leads to the Ectopic Expression of HOXB8 and the Muffs and Beard Phenotype in Chickens"

    Article Title: A Complex Structural Variation on Chromosome 27 Leads to the Ectopic Expression of HOXB8 and the Muffs and Beard Phenotype in Chickens

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1006071

    Analyzing the breakpoints of the copy number variations on GGA27 to clarify the rearrangement pattern. The duplicated regions identified by array-CGH are illustrated by green (CNV1), blue (CNV2) and pink (CNV3) boxes, respectively. (A) The boundaries of the CNVs were tested using 8 primers indicated by the arrows located in the known duplicated region of CNV1 and CNV3. All possible amplifications were considered and performed in both Mb and wild-type chickens. (B) The breakpoints of both CNV1_3’ (1,721,521 bp) and CNV3_5’ (4,470,331 bp) were identified after sequencing the specifically-amplified PCR product obtained in Mb chickens using primer F1 and R2. An overlap of two nucleotides was detected in the junction region. Outward facing primers (green and pink arrows) were designed to analyze the other boundary of CNV1 and CNV3. (C) CNV2 was found to be located next to CNV3 in chickens with the Mb phenotype using a genome-walking strategy. The breakpoints of both CNV3_3’ (4,503,417 bp) and CNV2_5’ (3,578,409 bp) were verified by sequencing. A two-nucleotide insertion was found in the junction region. (D) The breakpoints of both CNV2_3’ (3,592,890 bp) and CNV1_5’ (1,702,269 bp) were confirmed through unmapped read alignment of whole genome re-sequencing data. An eight-base insertion was detected in the junction.
    Figure Legend Snippet: Analyzing the breakpoints of the copy number variations on GGA27 to clarify the rearrangement pattern. The duplicated regions identified by array-CGH are illustrated by green (CNV1), blue (CNV2) and pink (CNV3) boxes, respectively. (A) The boundaries of the CNVs were tested using 8 primers indicated by the arrows located in the known duplicated region of CNV1 and CNV3. All possible amplifications were considered and performed in both Mb and wild-type chickens. (B) The breakpoints of both CNV1_3’ (1,721,521 bp) and CNV3_5’ (4,470,331 bp) were identified after sequencing the specifically-amplified PCR product obtained in Mb chickens using primer F1 and R2. An overlap of two nucleotides was detected in the junction region. Outward facing primers (green and pink arrows) were designed to analyze the other boundary of CNV1 and CNV3. (C) CNV2 was found to be located next to CNV3 in chickens with the Mb phenotype using a genome-walking strategy. The breakpoints of both CNV3_3’ (4,503,417 bp) and CNV2_5’ (3,578,409 bp) were verified by sequencing. A two-nucleotide insertion was found in the junction region. (D) The breakpoints of both CNV2_3’ (3,592,890 bp) and CNV1_5’ (1,702,269 bp) were confirmed through unmapped read alignment of whole genome re-sequencing data. An eight-base insertion was detected in the junction.

    Techniques Used: Sequencing, Amplification, Polymerase Chain Reaction

    5) Product Images from "A Large Deletion in the NSDHL Gene in Labrador Retrievers with a Congenital Cornification Disorder"

    Article Title: A Large Deletion in the NSDHL Gene in Labrador Retrievers with a Congenital Cornification Disorder

    Journal: G3: Genes|Genomes|Genetics

    doi: 10.1534/g3.117.1124

    Confirmation of the deletion by PCR. (A) A PCR with the three primers NSDHL_F1, NSDHL_R1 and NSDHL_R2 was performed to genotype cases and controls by fragment length analysis. The exon and intron sizes of the canine NSDHL gene are not drawn to scale. The protein-coding region is indicated by solid filling of the exons. Note that the number of 5′-untranslated exons varies between species and transcript isoforms, whereas the seven protein-coding 3′-exons are highly conserved between human, mouse, and dog. (B) A control dog homozygous for the wildtype allele showed only a single band of 753 bp generated by amplification with the primers NSDHL_F and NSDHL_R2. The two cases heterozygous for the deletion showed the wildtype band, and an additional 1166 bp band that resulted from the amplification of NSDHL_F and NSDHL_R1 on the deletion allele. The primers NSDHL_F and NSDHL_R1 did not amplify any specific product on the wildtype allele as their binding sites were > 15 kb apart.
    Figure Legend Snippet: Confirmation of the deletion by PCR. (A) A PCR with the three primers NSDHL_F1, NSDHL_R1 and NSDHL_R2 was performed to genotype cases and controls by fragment length analysis. The exon and intron sizes of the canine NSDHL gene are not drawn to scale. The protein-coding region is indicated by solid filling of the exons. Note that the number of 5′-untranslated exons varies between species and transcript isoforms, whereas the seven protein-coding 3′-exons are highly conserved between human, mouse, and dog. (B) A control dog homozygous for the wildtype allele showed only a single band of 753 bp generated by amplification with the primers NSDHL_F and NSDHL_R2. The two cases heterozygous for the deletion showed the wildtype band, and an additional 1166 bp band that resulted from the amplification of NSDHL_F and NSDHL_R1 on the deletion allele. The primers NSDHL_F and NSDHL_R1 did not amplify any specific product on the wildtype allele as their binding sites were > 15 kb apart.

    Techniques Used: Polymerase Chain Reaction, Generated, Amplification, Binding Assay

    Related Articles

    Polymerase Chain Reaction:

    Article Title: A Large Deletion in the NSDHL Gene in Labrador Retrievers with a Congenital Cornification Disorder
    Article Snippet: The selection of candidate genes was based on known X-linked human genodermatoses , and included ATP7A , DKC1 , EBP , EDA , EFNB1 , IKBKG , MBTPS2 , NSDHL , PORCN , SAT1 , and STS . .. PCR, fragment length analysis, and Sanger sequencing To confirm the presence of the large heterozygous deletion in the two affected dogs, and its absence in the nonaffected control dogs, we performed a long-range PCR using the three primers NSDHL_F: TGCCATGAACATCTGGAGAG, NSDHL_R1: ACCCCAAACAACGAATCCT, NSDHL_R2: ACAGCTTCCCCTGCTAAGGT, and SequalPrep long range polymerase (Thermo Fisher). .. In heterozygous dogs, this resulted in PCR products with sizes of 753 bp for the wildtype and 1166 bp for the deletion allele.

    Article Title: Differential expression of microRNAs during melanoma progression: miR-200c, miR-205 and miR-211 are downregulated in melanoma and act as tumour suppressors
    Article Snippet: Gene expression assays Both miRNA and mRNA expressions were determined by TaqMan assays. .. Assays for individual miRNAs and mRNAs, reverse transcription and PCR kits were all obtained from Applied Biosystems (Carlsbad, CA, USA). .. The miRNA expression was standardised against the miR-92 control and mRNAs were standardised against β -actin.

    Article Title: Recurrent duplications of the annexin A1 gene (ANXA1) in autism spectrum disorders
    Article Snippet: .. Breakpoint mapping For breakpoint mapping, ANXA1 duplications were amplified using Long Range PCR and PCR products were sequenced in both directions using fluorescent dye terminators (BigDye Terminator v1.1 Cycle Sequencing Kit, Applied Biosystems, Forest City, CA, USA) and the same PCR primers on the ABI3730xls DNA Analyzer (Applied Biosystems). ..

    Article Title: Silencing of MUC20 suppresses the malignant character of pancreatic ductal adenocarcinoma cells through inhibition of the HGF/MET pathway
    Article Snippet: MUC20 overexpression and its mock control cells were established by transfection of MUC20/pcDNA3.1 A plasmid or pcDNA3.1 A vector, respectively, using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s protocol. .. Human wild-type MUC20 (NCBI Accession No. NM_001282506.1) and truncated MUC20 were cloned using PCR kit (Invitrogen). ..

    Article Title: A Complex Structural Variation on Chromosome 27 Leads to the Ectopic Expression of HOXB8 and the Muffs and Beard Phenotype in Chickens
    Article Snippet: The whole-genome sequencing data had been deposited in the SRA database at NCBI with a BioProject accession number PRJNA306810. .. Re-sequencing of targeted genomic regions Re-sequencing of the three identified CNVs sequences was performed using long-range PCR and Ion Torrent Technology. ..

    Article Title: Molecular approaches underlying the oogenic cycle of the scleractinian coral, Acropora tenuis
    Article Snippet: .. Partial fragments of AtVasa and AtLDLR were amplified by long-range polymerase chain reaction (PCR) using the following conditions: LA Taq DNA Polymerase, 35 cycles of denaturation (10 s at 98 °C), annealing (30 s at 60 °C), and extension (2 min at 68 °C). .. PCR products were subcloned into the pGEM-T Easy vector (Promega, Madison, WI, USA) and transformed into JM109 competent cells (Takara Bio).

    Article Title: Functioning of the Drosophila integral U1/U2 protein Snf independent of U1 and U2 small nuclear ribonucleoprotein particles is revealed by snf+ gene dose effects
    Article Snippet: DNA isolated from Sxl Mf1 /Y, Sxl M12 /Y, and Sxl M6 / Sxl fP7bo animals was scanned for gross DNA changes by Southern blots and PCR amplification (Ampli Taq DNA polymerase from Perkin–Elmer) using a set of 14 primer pairs that provide full coverage of the Sxl transcription unit (−2, 260 to +22, 430 with 0 as the Sxl Pm transcription start site). .. Regions including gross changes were amplified by long-range PCR (Elongase Amplification System of GIBCO/BRL), were gel isolated, and then were partially sequenced (Applied Biosystems Prism 377 DNA sequencer with the Big Dye Terminator Cycle Sequencing Ready Reaction kit). ..

    Article Title: Secreted Effector Proteins of Salmonella enterica Serotype Typhimurium Elicit Host-Specific Chemokine Profiles in Animal Models of Typhoid Fever and Enterocolitis
    Article Snippet: To quantify the differences in CXC chemokine gene expression observed between the treatment groups, real-time PCR analyses were performed with RNA samples collected at 1 and 8 h postinoculation. .. Real-time PCR was performed by using the SYBR Green method according to instructions provided by the manufacturer of the PCR kit (Applied Biosystems, Foster City, Calif.). .. Primers for murine glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were purchased (Biosource International, Camarillo, Calif.), and the remaining primers are listed in Table .

    Sequencing:

    Article Title: A Large Deletion in the NSDHL Gene in Labrador Retrievers with a Congenital Cornification Disorder
    Article Snippet: The selection of candidate genes was based on known X-linked human genodermatoses , and included ATP7A , DKC1 , EBP , EDA , EFNB1 , IKBKG , MBTPS2 , NSDHL , PORCN , SAT1 , and STS . .. PCR, fragment length analysis, and Sanger sequencing To confirm the presence of the large heterozygous deletion in the two affected dogs, and its absence in the nonaffected control dogs, we performed a long-range PCR using the three primers NSDHL_F: TGCCATGAACATCTGGAGAG, NSDHL_R1: ACCCCAAACAACGAATCCT, NSDHL_R2: ACAGCTTCCCCTGCTAAGGT, and SequalPrep long range polymerase (Thermo Fisher). .. In heterozygous dogs, this resulted in PCR products with sizes of 753 bp for the wildtype and 1166 bp for the deletion allele.

    Article Title: Recurrent duplications of the annexin A1 gene (ANXA1) in autism spectrum disorders
    Article Snippet: .. Breakpoint mapping For breakpoint mapping, ANXA1 duplications were amplified using Long Range PCR and PCR products were sequenced in both directions using fluorescent dye terminators (BigDye Terminator v1.1 Cycle Sequencing Kit, Applied Biosystems, Forest City, CA, USA) and the same PCR primers on the ABI3730xls DNA Analyzer (Applied Biosystems). ..

    Article Title: Functioning of the Drosophila integral U1/U2 protein Snf independent of U1 and U2 small nuclear ribonucleoprotein particles is revealed by snf+ gene dose effects
    Article Snippet: DNA isolated from Sxl Mf1 /Y, Sxl M12 /Y, and Sxl M6 / Sxl fP7bo animals was scanned for gross DNA changes by Southern blots and PCR amplification (Ampli Taq DNA polymerase from Perkin–Elmer) using a set of 14 primer pairs that provide full coverage of the Sxl transcription unit (−2, 260 to +22, 430 with 0 as the Sxl Pm transcription start site). .. Regions including gross changes were amplified by long-range PCR (Elongase Amplification System of GIBCO/BRL), were gel isolated, and then were partially sequenced (Applied Biosystems Prism 377 DNA sequencer with the Big Dye Terminator Cycle Sequencing Ready Reaction kit). ..

    Amplification:

    Article Title: Recurrent duplications of the annexin A1 gene (ANXA1) in autism spectrum disorders
    Article Snippet: .. Breakpoint mapping For breakpoint mapping, ANXA1 duplications were amplified using Long Range PCR and PCR products were sequenced in both directions using fluorescent dye terminators (BigDye Terminator v1.1 Cycle Sequencing Kit, Applied Biosystems, Forest City, CA, USA) and the same PCR primers on the ABI3730xls DNA Analyzer (Applied Biosystems). ..

    Article Title: Molecular approaches underlying the oogenic cycle of the scleractinian coral, Acropora tenuis
    Article Snippet: .. Partial fragments of AtVasa and AtLDLR were amplified by long-range polymerase chain reaction (PCR) using the following conditions: LA Taq DNA Polymerase, 35 cycles of denaturation (10 s at 98 °C), annealing (30 s at 60 °C), and extension (2 min at 68 °C). .. PCR products were subcloned into the pGEM-T Easy vector (Promega, Madison, WI, USA) and transformed into JM109 competent cells (Takara Bio).

    Article Title: Functioning of the Drosophila integral U1/U2 protein Snf independent of U1 and U2 small nuclear ribonucleoprotein particles is revealed by snf+ gene dose effects
    Article Snippet: DNA isolated from Sxl Mf1 /Y, Sxl M12 /Y, and Sxl M6 / Sxl fP7bo animals was scanned for gross DNA changes by Southern blots and PCR amplification (Ampli Taq DNA polymerase from Perkin–Elmer) using a set of 14 primer pairs that provide full coverage of the Sxl transcription unit (−2, 260 to +22, 430 with 0 as the Sxl Pm transcription start site). .. Regions including gross changes were amplified by long-range PCR (Elongase Amplification System of GIBCO/BRL), were gel isolated, and then were partially sequenced (Applied Biosystems Prism 377 DNA sequencer with the Big Dye Terminator Cycle Sequencing Ready Reaction kit). ..

    Clone Assay:

    Article Title: Silencing of MUC20 suppresses the malignant character of pancreatic ductal adenocarcinoma cells through inhibition of the HGF/MET pathway
    Article Snippet: MUC20 overexpression and its mock control cells were established by transfection of MUC20/pcDNA3.1 A plasmid or pcDNA3.1 A vector, respectively, using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s protocol. .. Human wild-type MUC20 (NCBI Accession No. NM_001282506.1) and truncated MUC20 were cloned using PCR kit (Invitrogen). ..

    Isolation:

    Article Title: Functioning of the Drosophila integral U1/U2 protein Snf independent of U1 and U2 small nuclear ribonucleoprotein particles is revealed by snf+ gene dose effects
    Article Snippet: DNA isolated from Sxl Mf1 /Y, Sxl M12 /Y, and Sxl M6 / Sxl fP7bo animals was scanned for gross DNA changes by Southern blots and PCR amplification (Ampli Taq DNA polymerase from Perkin–Elmer) using a set of 14 primer pairs that provide full coverage of the Sxl transcription unit (−2, 260 to +22, 430 with 0 as the Sxl Pm transcription start site). .. Regions including gross changes were amplified by long-range PCR (Elongase Amplification System of GIBCO/BRL), were gel isolated, and then were partially sequenced (Applied Biosystems Prism 377 DNA sequencer with the Big Dye Terminator Cycle Sequencing Ready Reaction kit). ..

    Real-time Polymerase Chain Reaction:

    Article Title: Secreted Effector Proteins of Salmonella enterica Serotype Typhimurium Elicit Host-Specific Chemokine Profiles in Animal Models of Typhoid Fever and Enterocolitis
    Article Snippet: To quantify the differences in CXC chemokine gene expression observed between the treatment groups, real-time PCR analyses were performed with RNA samples collected at 1 and 8 h postinoculation. .. Real-time PCR was performed by using the SYBR Green method according to instructions provided by the manufacturer of the PCR kit (Applied Biosystems, Foster City, Calif.). .. Primers for murine glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were purchased (Biosource International, Camarillo, Calif.), and the remaining primers are listed in Table .

    SYBR Green Assay:

    Article Title: Secreted Effector Proteins of Salmonella enterica Serotype Typhimurium Elicit Host-Specific Chemokine Profiles in Animal Models of Typhoid Fever and Enterocolitis
    Article Snippet: To quantify the differences in CXC chemokine gene expression observed between the treatment groups, real-time PCR analyses were performed with RNA samples collected at 1 and 8 h postinoculation. .. Real-time PCR was performed by using the SYBR Green method according to instructions provided by the manufacturer of the PCR kit (Applied Biosystems, Foster City, Calif.). .. Primers for murine glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were purchased (Biosource International, Camarillo, Calif.), and the remaining primers are listed in Table .

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Thermo Fisher long range pcr
    Analyzing the breakpoints of the copy number variations on GGA27 to clarify the rearrangement pattern. The duplicated regions identified by array-CGH are illustrated by green (CNV1), blue (CNV2) and pink (CNV3) boxes, respectively. (A) The boundaries of the <t>CNVs</t> were tested using 8 primers indicated by the arrows located in the known duplicated region of CNV1 and CNV3. All possible amplifications were considered and performed in both Mb and wild-type chickens. (B) The breakpoints of both CNV1_3’ (1,721,521 bp) and CNV3_5’ (4,470,331 bp) were identified after sequencing the specifically-amplified <t>PCR</t> product obtained in Mb chickens using primer F1 and R2. An overlap of two nucleotides was detected in the junction region. Outward facing primers (green and pink arrows) were designed to analyze the other boundary of CNV1 and CNV3. (C) CNV2 was found to be located next to CNV3 in chickens with the Mb phenotype using a genome-walking strategy. The breakpoints of both CNV3_3’ (4,503,417 bp) and CNV2_5’ (3,578,409 bp) were verified by sequencing. A two-nucleotide insertion was found in the junction region. (D) The breakpoints of both CNV2_3’ (3,592,890 bp) and CNV1_5’ (1,702,269 bp) were confirmed through unmapped read alignment of whole genome re-sequencing data. An eight-base insertion was detected in the junction.
    Long Range Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/long range pcr/product/Thermo Fisher
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    long range pcr - by Bioz Stars, 2021-03
    94/100 stars
      Buy from Supplier

    Image Search Results


    Analyzing the breakpoints of the copy number variations on GGA27 to clarify the rearrangement pattern. The duplicated regions identified by array-CGH are illustrated by green (CNV1), blue (CNV2) and pink (CNV3) boxes, respectively. (A) The boundaries of the CNVs were tested using 8 primers indicated by the arrows located in the known duplicated region of CNV1 and CNV3. All possible amplifications were considered and performed in both Mb and wild-type chickens. (B) The breakpoints of both CNV1_3’ (1,721,521 bp) and CNV3_5’ (4,470,331 bp) were identified after sequencing the specifically-amplified PCR product obtained in Mb chickens using primer F1 and R2. An overlap of two nucleotides was detected in the junction region. Outward facing primers (green and pink arrows) were designed to analyze the other boundary of CNV1 and CNV3. (C) CNV2 was found to be located next to CNV3 in chickens with the Mb phenotype using a genome-walking strategy. The breakpoints of both CNV3_3’ (4,503,417 bp) and CNV2_5’ (3,578,409 bp) were verified by sequencing. A two-nucleotide insertion was found in the junction region. (D) The breakpoints of both CNV2_3’ (3,592,890 bp) and CNV1_5’ (1,702,269 bp) were confirmed through unmapped read alignment of whole genome re-sequencing data. An eight-base insertion was detected in the junction.

    Journal: PLoS Genetics

    Article Title: A Complex Structural Variation on Chromosome 27 Leads to the Ectopic Expression of HOXB8 and the Muffs and Beard Phenotype in Chickens

    doi: 10.1371/journal.pgen.1006071

    Figure Lengend Snippet: Analyzing the breakpoints of the copy number variations on GGA27 to clarify the rearrangement pattern. The duplicated regions identified by array-CGH are illustrated by green (CNV1), blue (CNV2) and pink (CNV3) boxes, respectively. (A) The boundaries of the CNVs were tested using 8 primers indicated by the arrows located in the known duplicated region of CNV1 and CNV3. All possible amplifications were considered and performed in both Mb and wild-type chickens. (B) The breakpoints of both CNV1_3’ (1,721,521 bp) and CNV3_5’ (4,470,331 bp) were identified after sequencing the specifically-amplified PCR product obtained in Mb chickens using primer F1 and R2. An overlap of two nucleotides was detected in the junction region. Outward facing primers (green and pink arrows) were designed to analyze the other boundary of CNV1 and CNV3. (C) CNV2 was found to be located next to CNV3 in chickens with the Mb phenotype using a genome-walking strategy. The breakpoints of both CNV3_3’ (4,503,417 bp) and CNV2_5’ (3,578,409 bp) were verified by sequencing. A two-nucleotide insertion was found in the junction region. (D) The breakpoints of both CNV2_3’ (3,592,890 bp) and CNV1_5’ (1,702,269 bp) were confirmed through unmapped read alignment of whole genome re-sequencing data. An eight-base insertion was detected in the junction.

    Article Snippet: Re-sequencing of targeted genomic regions Re-sequencing of the three identified CNVs sequences was performed using long-range PCR and Ion Torrent Technology.

    Techniques: Sequencing, Amplification, Polymerase Chain Reaction

    Bacterial taxonomic composition of nasopharyngeal samples in cases and controls. (A) Graphs show the mean proportion of the most frequent bacterial genera as inferred by PCR amplification and pyrosequencing of the 16S rRNA gene. The mean proportions were calculated based on 1,000 sequences per sample. Those bacteria at a proportion lower than 1% are indicated as “Others” and were particularly abundant in cases. (B) Shows a description of those low-frequency bacteria in patients with IPD, which include many oral organisms (bacteria at a proportion

    Journal: Frontiers in Microbiology

    Article Title: Nasopharyngeal Microbiota in Children With Invasive Pneumococcal Disease: Identification of Bacteria With Potential Disease-Promoting and Protective Effects

    doi: 10.3389/fmicb.2019.00011

    Figure Lengend Snippet: Bacterial taxonomic composition of nasopharyngeal samples in cases and controls. (A) Graphs show the mean proportion of the most frequent bacterial genera as inferred by PCR amplification and pyrosequencing of the 16S rRNA gene. The mean proportions were calculated based on 1,000 sequences per sample. Those bacteria at a proportion lower than 1% are indicated as “Others” and were particularly abundant in cases. (B) Shows a description of those low-frequency bacteria in patients with IPD, which include many oral organisms (bacteria at a proportion

    Article Snippet: PCR amplification of the 16S rRNA gene was performed using high fidelity Extensor Long Range PCR Enzyme (Thermo Fisher Scientific, Massachusetts, USA), with the degenerate universal bacterial primers of 16S rRNA gene 8F (5′-CAGAGTTTGATCMTGGCTCAG-3′) and 785R (5′-GGCCVGGGTATCTAATCC-3′) (Simón-Soro et al., ) and the following cycling conditions to minimize amplification biases (Simón-Soro et al., ): 2 min at 94°C, followed by 30 cycles of 10s at 94°C, 30s at 52°C, 90s at 68°C, and a final step of 7 min at 68°C.

    Techniques: Polymerase Chain Reaction, Amplification

    Confirmation of the deletion by PCR. (A) A PCR with the three primers NSDHL_F1, NSDHL_R1 and NSDHL_R2 was performed to genotype cases and controls by fragment length analysis. The exon and intron sizes of the canine NSDHL gene are not drawn to scale. The protein-coding region is indicated by solid filling of the exons. Note that the number of 5′-untranslated exons varies between species and transcript isoforms, whereas the seven protein-coding 3′-exons are highly conserved between human, mouse, and dog. (B) A control dog homozygous for the wildtype allele showed only a single band of 753 bp generated by amplification with the primers NSDHL_F and NSDHL_R2. The two cases heterozygous for the deletion showed the wildtype band, and an additional 1166 bp band that resulted from the amplification of NSDHL_F and NSDHL_R1 on the deletion allele. The primers NSDHL_F and NSDHL_R1 did not amplify any specific product on the wildtype allele as their binding sites were > 15 kb apart.

    Journal: G3: Genes|Genomes|Genetics

    Article Title: A Large Deletion in the NSDHL Gene in Labrador Retrievers with a Congenital Cornification Disorder

    doi: 10.1534/g3.117.1124

    Figure Lengend Snippet: Confirmation of the deletion by PCR. (A) A PCR with the three primers NSDHL_F1, NSDHL_R1 and NSDHL_R2 was performed to genotype cases and controls by fragment length analysis. The exon and intron sizes of the canine NSDHL gene are not drawn to scale. The protein-coding region is indicated by solid filling of the exons. Note that the number of 5′-untranslated exons varies between species and transcript isoforms, whereas the seven protein-coding 3′-exons are highly conserved between human, mouse, and dog. (B) A control dog homozygous for the wildtype allele showed only a single band of 753 bp generated by amplification with the primers NSDHL_F and NSDHL_R2. The two cases heterozygous for the deletion showed the wildtype band, and an additional 1166 bp band that resulted from the amplification of NSDHL_F and NSDHL_R1 on the deletion allele. The primers NSDHL_F and NSDHL_R1 did not amplify any specific product on the wildtype allele as their binding sites were > 15 kb apart.

    Article Snippet: PCR, fragment length analysis, and Sanger sequencing To confirm the presence of the large heterozygous deletion in the two affected dogs, and its absence in the nonaffected control dogs, we performed a long-range PCR using the three primers NSDHL_F: TGCCATGAACATCTGGAGAG, NSDHL_R1: ACCCCAAACAACGAATCCT, NSDHL_R2: ACAGCTTCCCCTGCTAAGGT, and SequalPrep long range polymerase (Thermo Fisher).

    Techniques: Polymerase Chain Reaction, Generated, Amplification, Binding Assay

    Genomic characterization of ANXA1 duplication: gene location and structure. We performed a Long Range PCR to determine whether the duplication was in tandem , using primers pointing outwards from the location of the first and last duplicated SNP. The four duplicated exons are represented in blue. A sequence of microhomology of three nucleotides (TCA) was also identified and is probably mediating the duplication.

    Journal: Molecular Autism

    Article Title: Recurrent duplications of the annexin A1 gene (ANXA1) in autism spectrum disorders

    doi: 10.1186/2040-2392-5-28

    Figure Lengend Snippet: Genomic characterization of ANXA1 duplication: gene location and structure. We performed a Long Range PCR to determine whether the duplication was in tandem , using primers pointing outwards from the location of the first and last duplicated SNP. The four duplicated exons are represented in blue. A sequence of microhomology of three nucleotides (TCA) was also identified and is probably mediating the duplication.

    Article Snippet: Breakpoint mapping For breakpoint mapping, ANXA1 duplications were amplified using Long Range PCR and PCR products were sequenced in both directions using fluorescent dye terminators (BigDye Terminator v1.1 Cycle Sequencing Kit, Applied Biosystems, Forest City, CA, USA) and the same PCR primers on the ABI3730xls DNA Analyzer (Applied Biosystems).

    Techniques: Polymerase Chain Reaction, Sequencing