long range pcr  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Name:
    TaKaRa LA Taq DNA Polymerase
    Description:

    Catalog Number:
    RR002A
    Price:
    None
    Category:
    PCR
    Size:
    125 Units
    Buy from Supplier


    Structured Review

    TaKaRa long range pcr
    Structures of the pre- and post-Cre floxed mouse Zip5 gene and integration and genotyping screen designs. ( A ) The mouse Zip5 gene was captured using gap-repair and manipulated using galK recombineering. Exons ( 1–12 ) and the exon encoding transmembrane domain 1 ( TMD1 ) are indicated, as are the positions of LoxP sites (intron 4 and downstream of PGK Neo ), the PGK-neomycin ( PGK Neo ) cassette and the locations of primers used for genotyping. The LoxP site in intron 4 is flanked by an EcoRV restriction enzyme cleavage site. ( B ) The structure of the Zip5 gene after Cre recombination is shown. Recombination eliminates the transmembrane domain of ZIP5. ( C ) The floxed Zip5 gene was targeted into <t>E14</t> ES cells and properly targeted ES cells were identified by long range <t>PCR</t> using flanking and internal primers. PCR products from the wild-type ( Wt ) and floxed ( Fx ) alleles are indicated. EcoRV cleavage was used to differentiate between the floxed and wild-type alleles in the 5′ PCR screen whereas the 3′ PCR screen yielded the predicted larger product from the wild-type allele. Targeted ES cells were used to generate mice homozygous for the floxed Zip5 allele. ( D ) Mice were genotyped by PCR amplification of the intron 4 region containing the LoxP site. The PCR product from homozygous Zip5 floxed mice before Cre-induced recombination is shown in the left lane while that from control mice is shown in the center lane and that from Zip5 -knockout mice ( Ko ) is shown in the right lane . For the intestine- and pancreas-specific knockout mice, detection of Zip5 mRNA and/or protein was employed to monitor the efficacy of recombination.

    https://www.bioz.com/result/long range pcr/product/TaKaRa
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    long range pcr - by Bioz Stars, 2021-07
    86/100 stars

    Images

    1) Product Images from "The Zinc Transporter Zip5 (Slc39a5) Regulates Intestinal Zinc Excretion and Protects the Pancreas against Zinc Toxicity"

    Article Title: The Zinc Transporter Zip5 (Slc39a5) Regulates Intestinal Zinc Excretion and Protects the Pancreas against Zinc Toxicity

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0082149

    Structures of the pre- and post-Cre floxed mouse Zip5 gene and integration and genotyping screen designs. ( A ) The mouse Zip5 gene was captured using gap-repair and manipulated using galK recombineering. Exons ( 1–12 ) and the exon encoding transmembrane domain 1 ( TMD1 ) are indicated, as are the positions of LoxP sites (intron 4 and downstream of PGK Neo ), the PGK-neomycin ( PGK Neo ) cassette and the locations of primers used for genotyping. The LoxP site in intron 4 is flanked by an EcoRV restriction enzyme cleavage site. ( B ) The structure of the Zip5 gene after Cre recombination is shown. Recombination eliminates the transmembrane domain of ZIP5. ( C ) The floxed Zip5 gene was targeted into E14 ES cells and properly targeted ES cells were identified by long range PCR using flanking and internal primers. PCR products from the wild-type ( Wt ) and floxed ( Fx ) alleles are indicated. EcoRV cleavage was used to differentiate between the floxed and wild-type alleles in the 5′ PCR screen whereas the 3′ PCR screen yielded the predicted larger product from the wild-type allele. Targeted ES cells were used to generate mice homozygous for the floxed Zip5 allele. ( D ) Mice were genotyped by PCR amplification of the intron 4 region containing the LoxP site. The PCR product from homozygous Zip5 floxed mice before Cre-induced recombination is shown in the left lane while that from control mice is shown in the center lane and that from Zip5 -knockout mice ( Ko ) is shown in the right lane . For the intestine- and pancreas-specific knockout mice, detection of Zip5 mRNA and/or protein was employed to monitor the efficacy of recombination.
    Figure Legend Snippet: Structures of the pre- and post-Cre floxed mouse Zip5 gene and integration and genotyping screen designs. ( A ) The mouse Zip5 gene was captured using gap-repair and manipulated using galK recombineering. Exons ( 1–12 ) and the exon encoding transmembrane domain 1 ( TMD1 ) are indicated, as are the positions of LoxP sites (intron 4 and downstream of PGK Neo ), the PGK-neomycin ( PGK Neo ) cassette and the locations of primers used for genotyping. The LoxP site in intron 4 is flanked by an EcoRV restriction enzyme cleavage site. ( B ) The structure of the Zip5 gene after Cre recombination is shown. Recombination eliminates the transmembrane domain of ZIP5. ( C ) The floxed Zip5 gene was targeted into E14 ES cells and properly targeted ES cells were identified by long range PCR using flanking and internal primers. PCR products from the wild-type ( Wt ) and floxed ( Fx ) alleles are indicated. EcoRV cleavage was used to differentiate between the floxed and wild-type alleles in the 5′ PCR screen whereas the 3′ PCR screen yielded the predicted larger product from the wild-type allele. Targeted ES cells were used to generate mice homozygous for the floxed Zip5 allele. ( D ) Mice were genotyped by PCR amplification of the intron 4 region containing the LoxP site. The PCR product from homozygous Zip5 floxed mice before Cre-induced recombination is shown in the left lane while that from control mice is shown in the center lane and that from Zip5 -knockout mice ( Ko ) is shown in the right lane . For the intestine- and pancreas-specific knockout mice, detection of Zip5 mRNA and/or protein was employed to monitor the efficacy of recombination.

    Techniques Used: Polymerase Chain Reaction, Mouse Assay, Amplification, Knock-Out

    2) Product Images from "Genome editing in plants using CRISPR type I-D nuclease"

    Article Title: Genome editing in plants using CRISPR type I-D nuclease

    Journal: Communications Biology

    doi: 10.1038/s42003-020-01366-6

    Generation of the tomato RIN mutants with long-range mutations by using CRISPR TiD. a The detection of long-range deletion mutations in the SlRIN gene induced by the CRISPR TiD. Gene structure, gRNA positions, and the different primer sets to amplify the mutation were indicated. Numbers show the primer sets (1; 1 st PCR, 2; nested PCR). The PCR amplified fragments separated on agarose gels indicate CRISPR TiD induced long-range deletions at the tomato RIN locus in the mutant calli (Micro-Tom, T0 generation). VC; vector control plants, 1–7; the transgenic callus lines. b The PCR amplified fragments separated on agarose gels indicate CRISPR TiD induced long-range deletions at the tomato RIN locus in the mutant shoots (Micro-Tom, T0 generation). WT; wild-type, 1–12; the transgenic shoot lines. The large deletions were detected in the lines #4, 5, 6 and 12. The bands with the same length as those of wild-type were non-specific bands. Arrows indicate the specific bands that were subjected to further sequencing analyses; red arrows indicate the fragment1 and blue arrows indicate the fragment2 as shown in c . Young mutant shoots for tomato RIN (Right; Micro-Tom, T0 generation #6) generated by CRISPR TiD. Bar = 1 cm. c Sanger sequencing using the cloned DNA from the CRISPR TiD transgenic tomato shoots (T0; #4, 5, 6, and 12) indicated the large deletion mutations occurred identically, however, the mutation frequencies were varied in the lines. d The mutation sequences of the cloned DNA from a . The nucleotide positions from the PAM were indicated on the sequence.
    Figure Legend Snippet: Generation of the tomato RIN mutants with long-range mutations by using CRISPR TiD. a The detection of long-range deletion mutations in the SlRIN gene induced by the CRISPR TiD. Gene structure, gRNA positions, and the different primer sets to amplify the mutation were indicated. Numbers show the primer sets (1; 1 st PCR, 2; nested PCR). The PCR amplified fragments separated on agarose gels indicate CRISPR TiD induced long-range deletions at the tomato RIN locus in the mutant calli (Micro-Tom, T0 generation). VC; vector control plants, 1–7; the transgenic callus lines. b The PCR amplified fragments separated on agarose gels indicate CRISPR TiD induced long-range deletions at the tomato RIN locus in the mutant shoots (Micro-Tom, T0 generation). WT; wild-type, 1–12; the transgenic shoot lines. The large deletions were detected in the lines #4, 5, 6 and 12. The bands with the same length as those of wild-type were non-specific bands. Arrows indicate the specific bands that were subjected to further sequencing analyses; red arrows indicate the fragment1 and blue arrows indicate the fragment2 as shown in c . Young mutant shoots for tomato RIN (Right; Micro-Tom, T0 generation #6) generated by CRISPR TiD. Bar = 1 cm. c Sanger sequencing using the cloned DNA from the CRISPR TiD transgenic tomato shoots (T0; #4, 5, 6, and 12) indicated the large deletion mutations occurred identically, however, the mutation frequencies were varied in the lines. d The mutation sequences of the cloned DNA from a . The nucleotide positions from the PAM were indicated on the sequence.

    Techniques Used: CRISPR, Mutagenesis, Polymerase Chain Reaction, Nested PCR, Amplification, Plasmid Preparation, Transgenic Assay, Sequencing, Generated, Clone Assay

    Plant genome editing with long-range deletions by using CRISPR TiD. The detection of long-range deletion mutations in the SlIAA9 gene induced by the CRISPR TiD. Gene structure, gRNA positions, and the different primer sets to amplify the mutation are indicated. Numbers show the primer sets (1; 1 st PCR, 2; nested PCR). The PCR amplified fragments separated on agarose gels are also shown in left panels. The results of large deletion mutations analyzed by the Sanger sequencing of the cloned DNA from the CRISPR TiD transgenic tomato calli are shown in right panels. The nucleotide positions from the PAM were indicated on the sequence. Arrows indicate the specific bands used for the cloning and sequencing. All results in the electrophoresis and sequence analysis are typical examples from the representative mutant plants generated by TiD.
    Figure Legend Snippet: Plant genome editing with long-range deletions by using CRISPR TiD. The detection of long-range deletion mutations in the SlIAA9 gene induced by the CRISPR TiD. Gene structure, gRNA positions, and the different primer sets to amplify the mutation are indicated. Numbers show the primer sets (1; 1 st PCR, 2; nested PCR). The PCR amplified fragments separated on agarose gels are also shown in left panels. The results of large deletion mutations analyzed by the Sanger sequencing of the cloned DNA from the CRISPR TiD transgenic tomato calli are shown in right panels. The nucleotide positions from the PAM were indicated on the sequence. Arrows indicate the specific bands used for the cloning and sequencing. All results in the electrophoresis and sequence analysis are typical examples from the representative mutant plants generated by TiD.

    Techniques Used: CRISPR, Mutagenesis, Polymerase Chain Reaction, Nested PCR, Amplification, Sequencing, Clone Assay, Transgenic Assay, Electrophoresis, Generated

    3) Product Images from "Pathogenic exon-trapping by SVA retrotransposon and rescue in Fukuyama muscular dystrophy"

    Article Title: Pathogenic exon-trapping by SVA retrotransposon and rescue in Fukuyama muscular dystrophy

    Journal: Nature

    doi: 10.1038/nature10456

    An SVA retrotransposal insertion induces abnormal splicing in FCMD a, Expression analysis of various regions of fukutin mRNA in lymphoblasts. Gray bar, the ratio of RT-PCR product in FCMD patients relative to the normal control; Numbers on the X axis, nucleotide positions of both forward and reverse primers in fukutin . Error bars, s.e.m. b, Long range PCR using primers flanking the expression-decreasing area (nucleotide position 1061 to 5941) detected a 3-kb PCR product in FCMD lymphoblast cDNA (open arrow) and 8-kb product in FCMD genomic DNA (closed arrow). In the normal control, cDNA and genomic DNA both showed 5-kb PCR products. The 8-kb band was weak probably because VNTR region of SVA is GC-rich (82%). c, Schematic representation of genomic DNA and cDNA in FCMD. Black and white arrows, forward and reverse sequencing primers. The intronic sequence in FCMD is indicated in lower case. The authentic stop codon is colored in red, and the new stop codon is colored in blue. d, e, Northern blot analysis of fukutin in human lymphoblasts ( d ) and model mice ( e ). F, FCMD; N, nomal control. The wild-type mouse fukutin mRNA was detected at a size of 6.1 kb. Both skeletal muscle (left) and brain (right) showed smaller, abnormal bands (open arrows) in Hp/Hp mice. Wt, wild type; Hn, Hn/Hn mice; Hp, Hp/Hp mice. f, Schematic representation of genomic DNA and cDNA in ARH ( LDLRAP1 , left), NLSDM ( PNPLA2 , middle), and human ( AB627340 , right).
    Figure Legend Snippet: An SVA retrotransposal insertion induces abnormal splicing in FCMD a, Expression analysis of various regions of fukutin mRNA in lymphoblasts. Gray bar, the ratio of RT-PCR product in FCMD patients relative to the normal control; Numbers on the X axis, nucleotide positions of both forward and reverse primers in fukutin . Error bars, s.e.m. b, Long range PCR using primers flanking the expression-decreasing area (nucleotide position 1061 to 5941) detected a 3-kb PCR product in FCMD lymphoblast cDNA (open arrow) and 8-kb product in FCMD genomic DNA (closed arrow). In the normal control, cDNA and genomic DNA both showed 5-kb PCR products. The 8-kb band was weak probably because VNTR region of SVA is GC-rich (82%). c, Schematic representation of genomic DNA and cDNA in FCMD. Black and white arrows, forward and reverse sequencing primers. The intronic sequence in FCMD is indicated in lower case. The authentic stop codon is colored in red, and the new stop codon is colored in blue. d, e, Northern blot analysis of fukutin in human lymphoblasts ( d ) and model mice ( e ). F, FCMD; N, nomal control. The wild-type mouse fukutin mRNA was detected at a size of 6.1 kb. Both skeletal muscle (left) and brain (right) showed smaller, abnormal bands (open arrows) in Hp/Hp mice. Wt, wild type; Hn, Hn/Hn mice; Hp, Hp/Hp mice. f, Schematic representation of genomic DNA and cDNA in ARH ( LDLRAP1 , left), NLSDM ( PNPLA2 , middle), and human ( AB627340 , right).

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Sequencing, Northern Blot, Mouse Assay

    AON cocktail rescues normal fukutin mRNA a, RT-PCR diagram of three primers designed to assess normal fukutin mRNA recovery (upper). Black closed arrow, a common forward primer located on fukutin coding region; black open arrow, a reverse primer to detect the abnormal RT-PCR product (161 bp); gray closed arrow, the other reverse primer to detect the restored normal RT-PCR product (129 bp). The effect on Hp/Hp ES cells treated with each single or a cocktail of AONs (lower). F, FCMD; N, normal sample. b, Rescue from abnormal splicing in VMO-treated in Hp/Hp mice and Hp/− mice. Local injection of AED cocktail into TA (n=3). Dys, a negative control. c, Rescue from abnormal splicing in VMO-treated human FCMD lymphoblasts (left, n=2) and myotubes (right, n=2). The Y axis shows the percent recovery of normal mRNA (* p
    Figure Legend Snippet: AON cocktail rescues normal fukutin mRNA a, RT-PCR diagram of three primers designed to assess normal fukutin mRNA recovery (upper). Black closed arrow, a common forward primer located on fukutin coding region; black open arrow, a reverse primer to detect the abnormal RT-PCR product (161 bp); gray closed arrow, the other reverse primer to detect the restored normal RT-PCR product (129 bp). The effect on Hp/Hp ES cells treated with each single or a cocktail of AONs (lower). F, FCMD; N, normal sample. b, Rescue from abnormal splicing in VMO-treated in Hp/Hp mice and Hp/− mice. Local injection of AED cocktail into TA (n=3). Dys, a negative control. c, Rescue from abnormal splicing in VMO-treated human FCMD lymphoblasts (left, n=2) and myotubes (right, n=2). The Y axis shows the percent recovery of normal mRNA (* p

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Mouse Assay, Injection, Negative Control

    4) Product Images from "A large deletion spanning PITX2 and PANCR in a Chinese family with Axenfeld-Rieger syndrome"

    Article Title: A large deletion spanning PITX2 and PANCR in a Chinese family with Axenfeld-Rieger syndrome

    Journal: Molecular Vision

    doi:

    Identification of the large genomic deletion spanning PITX2 in the family. A : Confirming and mapping the deleted region around PITX2 with quantitative PCR (qPCR). The deletion was positioned between 26.4 kb upstream and 4.5 kb downstream of the PITX2 gene. B : The DNA fragment containing the breakpoint was amplified with long-range PCR using the −26.4k-F/+4.5k-R primers. C : The sequencing result of the DNA fragment above shows an approximate 50 kb deletion spanning the first exon of PANCR and the entire PITX2 gene.
    Figure Legend Snippet: Identification of the large genomic deletion spanning PITX2 in the family. A : Confirming and mapping the deleted region around PITX2 with quantitative PCR (qPCR). The deletion was positioned between 26.4 kb upstream and 4.5 kb downstream of the PITX2 gene. B : The DNA fragment containing the breakpoint was amplified with long-range PCR using the −26.4k-F/+4.5k-R primers. C : The sequencing result of the DNA fragment above shows an approximate 50 kb deletion spanning the first exon of PANCR and the entire PITX2 gene.

    Techniques Used: Real-time Polymerase Chain Reaction, Amplification, Polymerase Chain Reaction, Sequencing

    5) Product Images from "Molecular Heterogeneity in Acute Promyelocytic Leukemia - a Single Center Experience from India"

    Article Title: Molecular Heterogeneity in Acute Promyelocytic Leukemia - a Single Center Experience from India

    Journal: Mediterranean Journal of Hematology and Infectious Diseases

    doi: 10.4084/MJHID.2018.002

    Cellular Morphology and PML-RARA fusion transcript detection. Abnormal promyelocytes with characteristic bilobed nuclei (B) and presence of abundant cytoplasmic granules which showed strong cytochemical myeloperoxidase positivity (D) is seen in the uppermost panel. Some unusual myeloid differentiation is also seen (A C). PCR amplicon size (480 bp) of novel Bcr3 PML-RARA transcript on agarose gel (middle panel) and capillary (lower panel) electrophoresis.
    Figure Legend Snippet: Cellular Morphology and PML-RARA fusion transcript detection. Abnormal promyelocytes with characteristic bilobed nuclei (B) and presence of abundant cytoplasmic granules which showed strong cytochemical myeloperoxidase positivity (D) is seen in the uppermost panel. Some unusual myeloid differentiation is also seen (A C). PCR amplicon size (480 bp) of novel Bcr3 PML-RARA transcript on agarose gel (middle panel) and capillary (lower panel) electrophoresis.

    Techniques Used: Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Electrophoresis

    6) Product Images from "Phytoene Synthase 2 Can Compensate for the Absence of Psy1 in Pepper Fruit (Capsicum annuum)"

    Article Title: Phytoene Synthase 2 Can Compensate for the Absence of Psy1 in Pepper Fruit (Capsicum annuum)

    Journal: bioRxiv

    doi: 10.1101/797977

    Structural variations of PSY1 and CCS in MY. (A) An almost 20-kb deletion spanning the PSY1 genomic region, revealed using genome walking from Capana04g002520 . The deleted region is indicated with the diagonal lines. The primer used for the first genome walking run is indicated with a red arrow. (B) An almost 7-kb Ty1/Copia-like retrotransposon insertion was discovered 1,339 nt along CCS in MY. LTR, long terminal repeat. TSD, target site duplication. (C) Transcriptional variant of CCS in MY. Compared with the full CCS sequence in MR, much smaller bands were amplified from MY using RT-PCR. Such transcriptional variation was regarded as being caused by the provision of a conserved sequence in the splicing junction by the inserted sequence. The red letters represent the conserved sequences of the exon-intron junction. The genomic region indicated with a solid line denotes the region which is spliced out during transcription.
    Figure Legend Snippet: Structural variations of PSY1 and CCS in MY. (A) An almost 20-kb deletion spanning the PSY1 genomic region, revealed using genome walking from Capana04g002520 . The deleted region is indicated with the diagonal lines. The primer used for the first genome walking run is indicated with a red arrow. (B) An almost 7-kb Ty1/Copia-like retrotransposon insertion was discovered 1,339 nt along CCS in MY. LTR, long terminal repeat. TSD, target site duplication. (C) Transcriptional variant of CCS in MY. Compared with the full CCS sequence in MR, much smaller bands were amplified from MY using RT-PCR. Such transcriptional variation was regarded as being caused by the provision of a conserved sequence in the splicing junction by the inserted sequence. The red letters represent the conserved sequences of the exon-intron junction. The genomic region indicated with a solid line denotes the region which is spliced out during transcription.

    Techniques Used: Variant Assay, Sequencing, Amplification, Reverse Transcription Polymerase Chain Reaction

    Polymorphism survey of the carotenoid biosynthetic genes. (A) gDNA amplification of six carotenoid biosynthetic genes using PCR. Primers were design to amplify the full length of each gene. From the two genotypes, the expected amplicon sizes were obtained for PSY2, Lcyb, CrtZ-2, and ZEP . No amplicon was obtained for PSY1 and CCS in MY. (B) gDNA PCR amplification of the PSY genes. A difference in the amplification pattern between MY and MR was only detected for PSY1 , for which no amplicon was obtained from MY.
    Figure Legend Snippet: Polymorphism survey of the carotenoid biosynthetic genes. (A) gDNA amplification of six carotenoid biosynthetic genes using PCR. Primers were design to amplify the full length of each gene. From the two genotypes, the expected amplicon sizes were obtained for PSY2, Lcyb, CrtZ-2, and ZEP . No amplicon was obtained for PSY1 and CCS in MY. (B) gDNA PCR amplification of the PSY genes. A difference in the amplification pattern between MY and MR was only detected for PSY1 , for which no amplicon was obtained from MY.

    Techniques Used: Amplification, Polymerase Chain Reaction

    7) Product Images from "Clinical and genomic analysis of a large Chinese family with familial cortical myoclonic tremor with epilepsy and SAMD12 intronic repeat expansion, et al. Clinical and genomic analysis of a large Chinese family with familial cortical myoclonic tremor with epilepsy and SAMD12 intronic repeat expansion"

    Article Title: Clinical and genomic analysis of a large Chinese family with familial cortical myoclonic tremor with epilepsy and SAMD12 intronic repeat expansion, et al. Clinical and genomic analysis of a large Chinese family with familial cortical myoclonic tremor with epilepsy and SAMD12 intronic repeat expansion

    Journal: Epilepsia Open

    doi: 10.1002/epi4.12450

    Characterization of the mutant allele by repeat‐primed and long‐range PCR and PacBio sequencing. A, Representative plots of repeat‐primed PCR for TTTTA and TTTCA repeats from an unaffected (411 in Figure 1A ) and affected individual (46 in Figure 1A ). B, Gel image showing the amplification of mutant and WT alleles by long‐range PCR from 24 family members whose DNA was available. Identity of each sample (corresponding to Figure 1A ) is marked on the top. Red circles mark two samples where mutant allele is detected by RP‐PCR but not robustly by long‐range PCR due to the low‐quality DNA. The ladder used is Mass Ruler DNA ladder mix where the top band is 10 kb. C, Size and pattern of the SAMD12 intronic pentanucleotide repeat motifs in each patient demonstrating its unstable nature
    Figure Legend Snippet: Characterization of the mutant allele by repeat‐primed and long‐range PCR and PacBio sequencing. A, Representative plots of repeat‐primed PCR for TTTTA and TTTCA repeats from an unaffected (411 in Figure 1A ) and affected individual (46 in Figure 1A ). B, Gel image showing the amplification of mutant and WT alleles by long‐range PCR from 24 family members whose DNA was available. Identity of each sample (corresponding to Figure 1A ) is marked on the top. Red circles mark two samples where mutant allele is detected by RP‐PCR but not robustly by long‐range PCR due to the low‐quality DNA. The ladder used is Mass Ruler DNA ladder mix where the top band is 10 kb. C, Size and pattern of the SAMD12 intronic pentanucleotide repeat motifs in each patient demonstrating its unstable nature

    Techniques Used: Mutagenesis, Polymerase Chain Reaction, Sequencing, Amplification

    8) Product Images from "Complete Unique Genome Sequence, Expression Profile, and Salivary Gland Tissue Tropism of the Herpesvirus 7 Homolog in Pigtailed Macaques"

    Article Title: Complete Unique Genome Sequence, Expression Profile, and Salivary Gland Tissue Tropism of the Herpesvirus 7 Homolog in Pigtailed Macaques

    Journal: Journal of Virology

    doi: 10.1128/JVI.00651-16

    Schematic overview of MneHV7 genomic sequences obtained by de novo assembly. (A) A large contiguous sequence (contig) of 122 kb covering most of the unique MneHV7 genome segment and a smaller contig of 6.8 kb with similarity to the HHV-7 U95 and U100 genes were aligned to the HHV-7 (strain RK) reference genome. The gap between the two contigs consisted mostly of the R2 repeat region and was resolved by long-range PCR and Sanger sequencing. (B) An additional contig of 2.4 kb with similarity to HHV-7 end-terminal repeat elements (DR-L/DR-R) was also identified and contained the sequence for the DR1 gene and the first exon as well as most of the intron of the DR6 gene. (C) Sequences at both ends of the 122-kb contig extended into the end-terminal sequences and exhibited strong similarity with the conserved cleavage-packaging motifs, Pac-1 and Pac-2, of human roseoloviruses flanked by the telomeric repeat regions, T1 and T2. The segments containing conserved nucleotide reiterations (highlighted or shaded) for Pac-1 and Pac-2 and flanking telomeric repeat regions (T1, T2) are indicated. All sequences identified to be part of an end-terminal repeat element were duplicated at both genomic ends, on the basis of homology with HHV-7. The MneHV7 unique genome sequence and a segment of the DRs at the genomic termini, including the DR1 gene and the DR6 first exon, are available in GenBank under accession number KU351741 .
    Figure Legend Snippet: Schematic overview of MneHV7 genomic sequences obtained by de novo assembly. (A) A large contiguous sequence (contig) of 122 kb covering most of the unique MneHV7 genome segment and a smaller contig of 6.8 kb with similarity to the HHV-7 U95 and U100 genes were aligned to the HHV-7 (strain RK) reference genome. The gap between the two contigs consisted mostly of the R2 repeat region and was resolved by long-range PCR and Sanger sequencing. (B) An additional contig of 2.4 kb with similarity to HHV-7 end-terminal repeat elements (DR-L/DR-R) was also identified and contained the sequence for the DR1 gene and the first exon as well as most of the intron of the DR6 gene. (C) Sequences at both ends of the 122-kb contig extended into the end-terminal sequences and exhibited strong similarity with the conserved cleavage-packaging motifs, Pac-1 and Pac-2, of human roseoloviruses flanked by the telomeric repeat regions, T1 and T2. The segments containing conserved nucleotide reiterations (highlighted or shaded) for Pac-1 and Pac-2 and flanking telomeric repeat regions (T1, T2) are indicated. All sequences identified to be part of an end-terminal repeat element were duplicated at both genomic ends, on the basis of homology with HHV-7. The MneHV7 unique genome sequence and a segment of the DRs at the genomic termini, including the DR1 gene and the DR6 first exon, are available in GenBank under accession number KU351741 .

    Techniques Used: Genomic Sequencing, Sequencing, Polymerase Chain Reaction

    9) Product Images from "ITPase deficiency causes a Martsolf-like syndrome with a lethal infantile dilated cardiomyopathy"

    Article Title: ITPase deficiency causes a Martsolf-like syndrome with a lethal infantile dilated cardiomyopathy

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1007605

    Inosine incorporation into nucleic acids in human and mouse cells lacking functional ITPase. (A) Bar chart showing a significantly increased inosine base content of RNA in lymphoblastoid cell lines (LCLs) derived from an affected individual (5196 III:3) as compared to that derived from her mother (5196 II:2) (B) Bar chart showing significantly increased inosine base content of RNA in Itpa -null mouse embryonic stem (ES) cells as compared to control ES cells. (C) Bar chart showing increased inosine base content of RNA derived from Itpa -null tissue as compared to controls. Inosine content is significantly higher in RNA derived from Itpa -null hearts than that stage-matched control hearts. There was no significant (ns) difference in IMP content in RNA derived from Itpa -null compared to control kidneys. Error bars ±SEM. (D) Alkaline-gel electrophoresis of total DNA and mtDNA extracted from mouse ES cells untreated or treated with bacterial endonuclease V (EndoV). All lanes shown are on the same gel, and these data are representative of three independent experiments. (E) Densitometry of gels shown in D does not identify any difference between control (green lines) and Itpa -null (red lines) cells for genomic DNA (top panel) but for mtDNA (bottom panel) there is a shift in the migration pattern in the Itpa -null cells suggestive of an increase EndoV digestion compared to the controls. (F) Long-range PCR (LR-PCR) of the mitochondrial genome shows no evidence for increased deletions in Itpa -null ES cells as compared to controls. The data shown are representative of three independent experiments. The primers used are listed in S2 Table . (G) Quantitative RT-PCR (qPCR) on total DNA shows that ratios of mtDNA to genomic DNA are comparable between control and Itpa -null cells. The data shown are derived from analysis of six individual DNA preparations per genotype, each analysed in triplicate. All the primers used are listed in S2 Table . (H,I) Alkaline comet assays on LCLs derived from an affected individual (5196 III:3) and her mother (5196 II:2) and null and parental mouse ESC respectively with cells exposed to hydrogen peroxide as a positive control. Neither cell type shows evidence for increase single or double strand breaks in genomic DNA. Quantitation of DNA damage is by Olive tail moment (the product of the tail length and the fraction of total DNA in the tail) and is a measure of both the extent of DNA fragmentation and size of fragmented DNA.
    Figure Legend Snippet: Inosine incorporation into nucleic acids in human and mouse cells lacking functional ITPase. (A) Bar chart showing a significantly increased inosine base content of RNA in lymphoblastoid cell lines (LCLs) derived from an affected individual (5196 III:3) as compared to that derived from her mother (5196 II:2) (B) Bar chart showing significantly increased inosine base content of RNA in Itpa -null mouse embryonic stem (ES) cells as compared to control ES cells. (C) Bar chart showing increased inosine base content of RNA derived from Itpa -null tissue as compared to controls. Inosine content is significantly higher in RNA derived from Itpa -null hearts than that stage-matched control hearts. There was no significant (ns) difference in IMP content in RNA derived from Itpa -null compared to control kidneys. Error bars ±SEM. (D) Alkaline-gel electrophoresis of total DNA and mtDNA extracted from mouse ES cells untreated or treated with bacterial endonuclease V (EndoV). All lanes shown are on the same gel, and these data are representative of three independent experiments. (E) Densitometry of gels shown in D does not identify any difference between control (green lines) and Itpa -null (red lines) cells for genomic DNA (top panel) but for mtDNA (bottom panel) there is a shift in the migration pattern in the Itpa -null cells suggestive of an increase EndoV digestion compared to the controls. (F) Long-range PCR (LR-PCR) of the mitochondrial genome shows no evidence for increased deletions in Itpa -null ES cells as compared to controls. The data shown are representative of three independent experiments. The primers used are listed in S2 Table . (G) Quantitative RT-PCR (qPCR) on total DNA shows that ratios of mtDNA to genomic DNA are comparable between control and Itpa -null cells. The data shown are derived from analysis of six individual DNA preparations per genotype, each analysed in triplicate. All the primers used are listed in S2 Table . (H,I) Alkaline comet assays on LCLs derived from an affected individual (5196 III:3) and her mother (5196 II:2) and null and parental mouse ESC respectively with cells exposed to hydrogen peroxide as a positive control. Neither cell type shows evidence for increase single or double strand breaks in genomic DNA. Quantitation of DNA damage is by Olive tail moment (the product of the tail length and the fraction of total DNA in the tail) and is a measure of both the extent of DNA fragmentation and size of fragmented DNA.

    Techniques Used: Functional Assay, Derivative Assay, Nucleic Acid Electrophoresis, Migration, Polymerase Chain Reaction, Quantitative RT-PCR, Real-time Polymerase Chain Reaction, Positive Control, Quantitation Assay

    10) Product Images from "Genome editing in plants using CRISPR type I-D nuclease"

    Article Title: Genome editing in plants using CRISPR type I-D nuclease

    Journal: Communications Biology

    doi: 10.1038/s42003-020-01366-6

    Generation of the tomato RIN mutants with long-range mutations by using CRISPR TiD. a The detection of long-range deletion mutations in the SlRIN gene induced by the CRISPR TiD. Gene structure, gRNA positions, and the different primer sets to amplify the mutation were indicated. Numbers show the primer sets (1; 1 st PCR, 2; nested PCR). The PCR amplified fragments separated on agarose gels indicate CRISPR TiD induced long-range deletions at the tomato RIN locus in the mutant calli (Micro-Tom, T0 generation). VC; vector control plants, 1–7; the transgenic callus lines. b The PCR amplified fragments separated on agarose gels indicate CRISPR TiD induced long-range deletions at the tomato RIN locus in the mutant shoots (Micro-Tom, T0 generation). WT; wild-type, 1–12; the transgenic shoot lines. The large deletions were detected in the lines #4, 5, 6 and 12. The bands with the same length as those of wild-type were non-specific bands. Arrows indicate the specific bands that were subjected to further sequencing analyses; red arrows indicate the fragment1 and blue arrows indicate the fragment2 as shown in c . Young mutant shoots for tomato RIN (Right; Micro-Tom, T0 generation #6) generated by CRISPR TiD. Bar = 1 cm. c Sanger sequencing using the cloned DNA from the CRISPR TiD transgenic tomato shoots (T0; #4, 5, 6, and 12) indicated the large deletion mutations occurred identically, however, the mutation frequencies were varied in the lines. d The mutation sequences of the cloned DNA from a . The nucleotide positions from the PAM were indicated on the sequence.
    Figure Legend Snippet: Generation of the tomato RIN mutants with long-range mutations by using CRISPR TiD. a The detection of long-range deletion mutations in the SlRIN gene induced by the CRISPR TiD. Gene structure, gRNA positions, and the different primer sets to amplify the mutation were indicated. Numbers show the primer sets (1; 1 st PCR, 2; nested PCR). The PCR amplified fragments separated on agarose gels indicate CRISPR TiD induced long-range deletions at the tomato RIN locus in the mutant calli (Micro-Tom, T0 generation). VC; vector control plants, 1–7; the transgenic callus lines. b The PCR amplified fragments separated on agarose gels indicate CRISPR TiD induced long-range deletions at the tomato RIN locus in the mutant shoots (Micro-Tom, T0 generation). WT; wild-type, 1–12; the transgenic shoot lines. The large deletions were detected in the lines #4, 5, 6 and 12. The bands with the same length as those of wild-type were non-specific bands. Arrows indicate the specific bands that were subjected to further sequencing analyses; red arrows indicate the fragment1 and blue arrows indicate the fragment2 as shown in c . Young mutant shoots for tomato RIN (Right; Micro-Tom, T0 generation #6) generated by CRISPR TiD. Bar = 1 cm. c Sanger sequencing using the cloned DNA from the CRISPR TiD transgenic tomato shoots (T0; #4, 5, 6, and 12) indicated the large deletion mutations occurred identically, however, the mutation frequencies were varied in the lines. d The mutation sequences of the cloned DNA from a . The nucleotide positions from the PAM were indicated on the sequence.

    Techniques Used: CRISPR, Mutagenesis, Polymerase Chain Reaction, Nested PCR, Amplification, Plasmid Preparation, Transgenic Assay, Sequencing, Generated, Clone Assay

    Plant genome editing with long-range deletions by using CRISPR TiD. The detection of long-range deletion mutations in the SlIAA9 gene induced by the CRISPR TiD. Gene structure, gRNA positions, and the different primer sets to amplify the mutation are indicated. Numbers show the primer sets (1; 1 st PCR, 2; nested PCR). The PCR amplified fragments separated on agarose gels are also shown in left panels. The results of large deletion mutations analyzed by the Sanger sequencing of the cloned DNA from the CRISPR TiD transgenic tomato calli are shown in right panels. The nucleotide positions from the PAM were indicated on the sequence. Arrows indicate the specific bands used for the cloning and sequencing. All results in the electrophoresis and sequence analysis are typical examples from the representative mutant plants generated by TiD.
    Figure Legend Snippet: Plant genome editing with long-range deletions by using CRISPR TiD. The detection of long-range deletion mutations in the SlIAA9 gene induced by the CRISPR TiD. Gene structure, gRNA positions, and the different primer sets to amplify the mutation are indicated. Numbers show the primer sets (1; 1 st PCR, 2; nested PCR). The PCR amplified fragments separated on agarose gels are also shown in left panels. The results of large deletion mutations analyzed by the Sanger sequencing of the cloned DNA from the CRISPR TiD transgenic tomato calli are shown in right panels. The nucleotide positions from the PAM were indicated on the sequence. Arrows indicate the specific bands used for the cloning and sequencing. All results in the electrophoresis and sequence analysis are typical examples from the representative mutant plants generated by TiD.

    Techniques Used: CRISPR, Mutagenesis, Polymerase Chain Reaction, Nested PCR, Amplification, Sequencing, Clone Assay, Transgenic Assay, Electrophoresis, Generated

    11) Product Images from "Novel Endothelial Cell-Specific AQP1 Knockout Mice Confirm the Crucial Role of Endothelial AQP1 in Ultrafiltration during Peritoneal Dialysis"

    Article Title: Novel Endothelial Cell-Specific AQP1 Knockout Mice Confirm the Crucial Role of Endothelial AQP1 in Ultrafiltration during Peritoneal Dialysis

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0145513

    Generation and validation of the floxed AQP1 allele. (A) Both 5' and 3' homologous recombinants were screened by long-range PCR with neo-specific primers P1F/1R and P2F/2R. PCR of representative embryonic stem (ES) clones showed the targeted 5'-(9,1kb) and the 3'- (5.3kb) homologous recombination events, respectively. (B) Targeted ES clones in (A) were confirmed by Southern blot analysis. Using the 5' probe (upper panel), the 3' probe (middle panel), and the neo probe (lower panel), the representative resulting Southern hybridisation signals appeared upon digestion of genomic DNA from ES clones with the Xho I (3' probe and neo probe) or Nsi I (5' probe). The genotypes of WT (+) and targeted ES clones with neo cassette (fl-neo) and the size of the detected fragments are indicated. Detection of a single 7.3 kb fragment with the neo probe indicates a singular integration event, whereas one clone (#) showed an additional integration of the neo cassette. Germline transmission was obtained from the clone indicated with an asterisk following blastocyst injection. (C) Genotyping of AQP1 +/+ (+), AQP1 fl-neo/+ (fl-neo) and AQP1 flox/+ (fl) mice by PCR using primers 3F and 3R. (D) WT (+/+), heterozygous (fl/+), homozygous (fl/fl) floxed alleles were distinguished by PCR with primers 4F and 4R. (E) Immunoblot of total protein fractions from visceral peritoneal (VP) homogenate probed with AQP1 antibody. Equal loading (40 μg of protein from each sample was verified using an anti-β-actin antibody. (F) AQP1 immunostaining showed normal localisation in the microvascular endothelium (arrows, stained in red) in VP and no apparent difference was observed between the AQP1 +/+ and AQP1 fl/fl mice. Calibration bar: 50μM.
    Figure Legend Snippet: Generation and validation of the floxed AQP1 allele. (A) Both 5' and 3' homologous recombinants were screened by long-range PCR with neo-specific primers P1F/1R and P2F/2R. PCR of representative embryonic stem (ES) clones showed the targeted 5'-(9,1kb) and the 3'- (5.3kb) homologous recombination events, respectively. (B) Targeted ES clones in (A) were confirmed by Southern blot analysis. Using the 5' probe (upper panel), the 3' probe (middle panel), and the neo probe (lower panel), the representative resulting Southern hybridisation signals appeared upon digestion of genomic DNA from ES clones with the Xho I (3' probe and neo probe) or Nsi I (5' probe). The genotypes of WT (+) and targeted ES clones with neo cassette (fl-neo) and the size of the detected fragments are indicated. Detection of a single 7.3 kb fragment with the neo probe indicates a singular integration event, whereas one clone (#) showed an additional integration of the neo cassette. Germline transmission was obtained from the clone indicated with an asterisk following blastocyst injection. (C) Genotyping of AQP1 +/+ (+), AQP1 fl-neo/+ (fl-neo) and AQP1 flox/+ (fl) mice by PCR using primers 3F and 3R. (D) WT (+/+), heterozygous (fl/+), homozygous (fl/fl) floxed alleles were distinguished by PCR with primers 4F and 4R. (E) Immunoblot of total protein fractions from visceral peritoneal (VP) homogenate probed with AQP1 antibody. Equal loading (40 μg of protein from each sample was verified using an anti-β-actin antibody. (F) AQP1 immunostaining showed normal localisation in the microvascular endothelium (arrows, stained in red) in VP and no apparent difference was observed between the AQP1 +/+ and AQP1 fl/fl mice. Calibration bar: 50μM.

    Techniques Used: Polymerase Chain Reaction, Homologous Recombination, Clone Assay, Southern Blot, Hybridization, Transmission Assay, Injection, Mouse Assay, Immunostaining, Staining

    Targeting construct and screening strategies. A part of the wild type (+) allele of mouse AQP1 is shown with indicated exons (black boxes) and restriction enzyme sites. The targeting allele (fl-neo) is indicated with 3’ and 5’ targeting arms (thick lines), loxP / FRT sites and pro- and eukaryotic neomycin selection cassette (neo-gb2-PGK). The 5’ probe and 3’ probe for Southern blot located outside the targeting vector detect 11.1-kb (+) and or 7.1-kb (fl-neo) fragments from Nsi I-digested genomic DNA and 22.6-kb (+) and or 7.3-kb (fl-neo) fragments following Xho I-digestion genomic DNA, respectively. Mice carrying the floxed allele (AQP fl-neo ) were crossed to FLPeR mice for excision of the FRT-flanked neo cassette. The resulting floxed mice (AQP fl ) were crossed to Cdh5 (PAC)-CreERT2 (Cdh5-Cre) transgenic mice to excise exons 2 and 3 following tamoxifen induction, and then generate the AQP1 null allele (AQP1 del ) in endothelial cells. The P1F/1R, P2F/2R, P3F/3R and P4F/4R primers for PCR-based genotype analyses and the lengths of their responding PCR products are indicated.
    Figure Legend Snippet: Targeting construct and screening strategies. A part of the wild type (+) allele of mouse AQP1 is shown with indicated exons (black boxes) and restriction enzyme sites. The targeting allele (fl-neo) is indicated with 3’ and 5’ targeting arms (thick lines), loxP / FRT sites and pro- and eukaryotic neomycin selection cassette (neo-gb2-PGK). The 5’ probe and 3’ probe for Southern blot located outside the targeting vector detect 11.1-kb (+) and or 7.1-kb (fl-neo) fragments from Nsi I-digested genomic DNA and 22.6-kb (+) and or 7.3-kb (fl-neo) fragments following Xho I-digestion genomic DNA, respectively. Mice carrying the floxed allele (AQP fl-neo ) were crossed to FLPeR mice for excision of the FRT-flanked neo cassette. The resulting floxed mice (AQP fl ) were crossed to Cdh5 (PAC)-CreERT2 (Cdh5-Cre) transgenic mice to excise exons 2 and 3 following tamoxifen induction, and then generate the AQP1 null allele (AQP1 del ) in endothelial cells. The P1F/1R, P2F/2R, P3F/3R and P4F/4R primers for PCR-based genotype analyses and the lengths of their responding PCR products are indicated.

    Techniques Used: Construct, Selection, Southern Blot, Plasmid Preparation, Mouse Assay, Transgenic Assay, Polymerase Chain Reaction

    12) Product Images from "The transcriptome of the novel dinoflagellate Oxyrrhis marina (Alveolata: Dinophyceae): response to salinity examined by 454 sequencing"

    Article Title: The transcriptome of the novel dinoflagellate Oxyrrhis marina (Alveolata: Dinophyceae): response to salinity examined by 454 sequencing

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-12-519

    Sequence alignment of 3' and 5' ends of the HSP90 gene and contiguous intergenic regions . Coding regions have been translated to amino acid sequences to highlight the position of synonymous (open circles) and non-synonymous (filled circles) substitutions. Note a single non synonymous substitution occurred at amino acid position -28. The lengths of 3'/5' UTRs (blue) and intergenic regions (red) were inferred from comparison of genomic and cDNA sequences. IG1-6 refer to genomic sequence classes derived from PCR and cloning of the intergenic region.
    Figure Legend Snippet: Sequence alignment of 3' and 5' ends of the HSP90 gene and contiguous intergenic regions . Coding regions have been translated to amino acid sequences to highlight the position of synonymous (open circles) and non-synonymous (filled circles) substitutions. Note a single non synonymous substitution occurred at amino acid position -28. The lengths of 3'/5' UTRs (blue) and intergenic regions (red) were inferred from comparison of genomic and cDNA sequences. IG1-6 refer to genomic sequence classes derived from PCR and cloning of the intergenic region.

    Techniques Used: Sequencing, Derivative Assay, Polymerase Chain Reaction, Clone Assay

    13) Product Images from "Differential Actions of Estrogen Receptor α and β via Nongenomic Signaling in Human Prostate Stem and Progenitor Cells"

    Article Title: Differential Actions of Estrogen Receptor α and β via Nongenomic Signaling in Human Prostate Stem and Progenitor Cells

    Journal: Endocrinology

    doi: 10.1210/en.2019-00177

    Prostate cancer stem-like cells express ER β on their membranes and signal through the MAPK pathway. (A) qRT-PCR shows high expression of ER β mRNA and an absence of ER α mRNA in HuSLCs. (B) Immunocytochemistry of HuSLCs for ER β shows intracellular, nuclear, and membrane-bound (arrowheads) ER β protein (green). Nuclei were stained with DAPI (blue). Magnification ×40. (C) Membrane fractions of HuSLCs were separated by density gradient centrifugation followed by western blot analysis for ER β protein. ER β was found at high levels in the whole plasma membrane fraction (PM) and the lipid raft fractions (5–8) marked by caveolin-1 expression. (D) HuSLCs treated with 10 nM E2 for 15, 30, and 60 min showed AKT phosphorylation but no activation of ERK1/2. (E) Prostate cancer stem/progenitor cells were isolated from DU145 cultures by transferring to three-dimensional Matrigel culture for 3 wk. Harvested DU145 spheres were exposed to 10 nM E2 for 30 min. Western blot analysis showed an increased ERK1/2 phosphorylation but no AKT activation as compared with vehicle-treated controls. Graphic representation of p-ERK1/2 signal at right for n =3.
    Figure Legend Snippet: Prostate cancer stem-like cells express ER β on their membranes and signal through the MAPK pathway. (A) qRT-PCR shows high expression of ER β mRNA and an absence of ER α mRNA in HuSLCs. (B) Immunocytochemistry of HuSLCs for ER β shows intracellular, nuclear, and membrane-bound (arrowheads) ER β protein (green). Nuclei were stained with DAPI (blue). Magnification ×40. (C) Membrane fractions of HuSLCs were separated by density gradient centrifugation followed by western blot analysis for ER β protein. ER β was found at high levels in the whole plasma membrane fraction (PM) and the lipid raft fractions (5–8) marked by caveolin-1 expression. (D) HuSLCs treated with 10 nM E2 for 15, 30, and 60 min showed AKT phosphorylation but no activation of ERK1/2. (E) Prostate cancer stem/progenitor cells were isolated from DU145 cultures by transferring to three-dimensional Matrigel culture for 3 wk. Harvested DU145 spheres were exposed to 10 nM E2 for 30 min. Western blot analysis showed an increased ERK1/2 phosphorylation but no AKT activation as compared with vehicle-treated controls. Graphic representation of p-ERK1/2 signal at right for n =3.

    Techniques Used: Quantitative RT-PCR, Expressing, Immunocytochemistry, Staining, Gradient Centrifugation, Western Blot, Activation Assay, Isolation, Transferring

    Receptor subtype–specific signaling cascades are elicited via membrane ERs. (A) Day 5 prostaspheres with ER α or ER β knocked down by siRNA were exposed to 10 nM E2 for 30 min followed by western blot analysis of AKT and ERK1/2 phosphorylation. Spheroid cells with reduced ER α showed no p-AKT increase upon E2 exposure whereas p-ERK1/2 was robust. In contrast, spheres with reduced ER β exhibited increased p-AKT with E2 treatment but no phosphorylation of ERK1/2. Images are representative of three to four separate experiments. (B–E) ER α (ER α OE) or ER β (ER β OE) were overexpressed in WPE-stem cells, and phosphorylation of AKT and ERK1/2 was examined by western blot analysis. (B) qRT-PCR confirms overexpression of ER α in ER α OE cells. (C) Western blots of ER α OE WPE-cells show increased basal p-AKT compared with control vector, which further increased after 30 min of exposure to 10 nM E2. There was no ERK1/2 phosphorylation in ER α OE cells with/without 10 nM E2. Bar graph shows p-AKT in vehicle and with 15 to 30 min of 10 nM E2 (n = 5). * P
    Figure Legend Snippet: Receptor subtype–specific signaling cascades are elicited via membrane ERs. (A) Day 5 prostaspheres with ER α or ER β knocked down by siRNA were exposed to 10 nM E2 for 30 min followed by western blot analysis of AKT and ERK1/2 phosphorylation. Spheroid cells with reduced ER α showed no p-AKT increase upon E2 exposure whereas p-ERK1/2 was robust. In contrast, spheres with reduced ER β exhibited increased p-AKT with E2 treatment but no phosphorylation of ERK1/2. Images are representative of three to four separate experiments. (B–E) ER α (ER α OE) or ER β (ER β OE) were overexpressed in WPE-stem cells, and phosphorylation of AKT and ERK1/2 was examined by western blot analysis. (B) qRT-PCR confirms overexpression of ER α in ER α OE cells. (C) Western blots of ER α OE WPE-cells show increased basal p-AKT compared with control vector, which further increased after 30 min of exposure to 10 nM E2. There was no ERK1/2 phosphorylation in ER α OE cells with/without 10 nM E2. Bar graph shows p-AKT in vehicle and with 15 to 30 min of 10 nM E2 (n = 5). * P

    Techniques Used: Western Blot, Quantitative RT-PCR, Over Expression, Plasmid Preparation

    14) Product Images from "Overexpression of blaOXA-58 Gene Driven by ISAba3 Is Associated with Imipenem Resistance in a Clinical Acinetobacter baumannii Isolate from Vietnam"

    Article Title: Overexpression of blaOXA-58 Gene Driven by ISAba3 Is Associated with Imipenem Resistance in a Clinical Acinetobacter baumannii Isolate from Vietnam

    Journal: BioMed Research International

    doi: 10.1155/2020/7213429

    Duplex real-time RT-PCR analysis of the bla OXA-51 and bla OXA-58 mRNA relative expression in three A. baumannii isolates. The error bars represent the deviation for the normalized fold expression of bla OXA-51 and bla OXA-58 in three isolates which were positive or negative for the IS Aba3 upstream of the bla OXA-58 gene. −: not induced; +: induced.
    Figure Legend Snippet: Duplex real-time RT-PCR analysis of the bla OXA-51 and bla OXA-58 mRNA relative expression in three A. baumannii isolates. The error bars represent the deviation for the normalized fold expression of bla OXA-51 and bla OXA-58 in three isolates which were positive or negative for the IS Aba3 upstream of the bla OXA-58 gene. −: not induced; +: induced.

    Techniques Used: Quantitative RT-PCR, Expressing

    15) Product Images from "Overexpression of blaOXA-58 Gene Driven by ISAba3 is Associated with Imipenem Resistance in a Clinical Acinetobacter baumannii Isolate from Vietnam"

    Article Title: Overexpression of blaOXA-58 Gene Driven by ISAba3 is Associated with Imipenem Resistance in a Clinical Acinetobacter baumannii Isolate from Vietnam

    Journal: bioRxiv

    doi: 10.1101/2020.06.29.178632

    Duplex real-time RT-PCR analysis of the bla OXA-51 and bla OXA-58 mRNA relative expression in three A. baumannii isolates. The error bars represent the deviation for the normalized fold expression of bla OXA-51 and bla OXA-58 in three isolates which were positive or negative for the IS Aba3 upstream of the bla OXA-58 gene. (−), not induced; (+), induced
    Figure Legend Snippet: Duplex real-time RT-PCR analysis of the bla OXA-51 and bla OXA-58 mRNA relative expression in three A. baumannii isolates. The error bars represent the deviation for the normalized fold expression of bla OXA-51 and bla OXA-58 in three isolates which were positive or negative for the IS Aba3 upstream of the bla OXA-58 gene. (−), not induced; (+), induced

    Techniques Used: Quantitative RT-PCR, Expressing

    16) Product Images from "Noninvasive Immunohistochemical Diagnosis and Novel MUC1 Mutations Causing Autosomal Dominant Tubulointerstitial Kidney Disease"

    Article Title: Noninvasive Immunohistochemical Diagnosis and Novel MUC1 Mutations Causing Autosomal Dominant Tubulointerstitial Kidney Disease

    Journal: Journal of the American Society of Nephrology : JASN

    doi: 10.1681/ASN.2018020180

    MUC1 VNTR sequencing identifies novel mutations causing ADTKD- MUC1 . (A) Sequence logo showing the most conserved regions of the VNTR repeats. Corresponding amino acid sequences of wild-type MUC1 (wt_AA) and MUC1 fs (mut_AA) are shown below. To find novel frameshift mutations that change the open reading frame, different conserved 10-mers of the wild-type repeat were used as sequence anchors (underlined DNA sequence as an example). For each anchor pair, all sequences delimited by these two anchors that are changing an open reading frame ( i.e. , adding or deleting nucleotides) were selected from the FASTQ file. (B) Sequences of the canonical 60 nucleotide long wild-type VNTR repeat (wt) and candidate frameshift mutations identified in this study. (C) Random mutations are generated in DNA molecules during PCR amplification step. To find true germline mutations, the percentage of reads with a given sequence (putative frameshift mutation) from all reads was calculated for each of the analyzed samples ( y -axis), and this needed to be higher than the average+2 SD of the nine wild-type control samples. Indicated are numbers of controls (wt), patients with individual MUC1 mutations (27dupC, 28dupA, 26_27insG, 1–16dup, 23delinsAT, 51dupC), and individuals with still unknown MUC1 mutation(s) who have urinary cell smears positive for MUC1fs and who tested negative for 27dupC by conventional genotyping assay (unknown). (D) 27dupC, confirmed by a mass spectrometry-based primer extension assay. The 27dupC extension product is observed at 5904 D (red asterisk). (E) 28dupA, confirmed by a mass spectrometry-based assay. The 28dupA extension product is observed at 6571 D (red asterisk). (F) 26_27insG, confirmed by a mass spectrometry-based assay. The 26_27insG extension product is observed at 5944.85 D (red arrow). (G) 1–16dup confirmed by restriction analysis. The mutation creates new restriction site for Eci I enzyme. The electrophoretogram shows amplified VNTR regions of the affected patient (P1), two healthy relatives (H1, H2), and one unrelated control (NC) after (EciI) and before restriction by Eci I (PCR). The patient’s (P1) mutated allele (5000 bp) was cut into two fragments of 3000 and 2000 bp. (H) 23delinsAT, confirmed by restriction analysis. The mutation creates new restriction site for Fok I enzyme. The electrophoretogram is showing amplified VNTR regions of two affected patients (P1, P2) and one unrelated control (NC) after (FokI) and before restriction by Fok I (PCR). The patients’ (P1, P2) mutated alleles (3000 bp) were cut into two fragments of 2000 and 1000 bp.
    Figure Legend Snippet: MUC1 VNTR sequencing identifies novel mutations causing ADTKD- MUC1 . (A) Sequence logo showing the most conserved regions of the VNTR repeats. Corresponding amino acid sequences of wild-type MUC1 (wt_AA) and MUC1 fs (mut_AA) are shown below. To find novel frameshift mutations that change the open reading frame, different conserved 10-mers of the wild-type repeat were used as sequence anchors (underlined DNA sequence as an example). For each anchor pair, all sequences delimited by these two anchors that are changing an open reading frame ( i.e. , adding or deleting nucleotides) were selected from the FASTQ file. (B) Sequences of the canonical 60 nucleotide long wild-type VNTR repeat (wt) and candidate frameshift mutations identified in this study. (C) Random mutations are generated in DNA molecules during PCR amplification step. To find true germline mutations, the percentage of reads with a given sequence (putative frameshift mutation) from all reads was calculated for each of the analyzed samples ( y -axis), and this needed to be higher than the average+2 SD of the nine wild-type control samples. Indicated are numbers of controls (wt), patients with individual MUC1 mutations (27dupC, 28dupA, 26_27insG, 1–16dup, 23delinsAT, 51dupC), and individuals with still unknown MUC1 mutation(s) who have urinary cell smears positive for MUC1fs and who tested negative for 27dupC by conventional genotyping assay (unknown). (D) 27dupC, confirmed by a mass spectrometry-based primer extension assay. The 27dupC extension product is observed at 5904 D (red asterisk). (E) 28dupA, confirmed by a mass spectrometry-based assay. The 28dupA extension product is observed at 6571 D (red asterisk). (F) 26_27insG, confirmed by a mass spectrometry-based assay. The 26_27insG extension product is observed at 5944.85 D (red arrow). (G) 1–16dup confirmed by restriction analysis. The mutation creates new restriction site for Eci I enzyme. The electrophoretogram shows amplified VNTR regions of the affected patient (P1), two healthy relatives (H1, H2), and one unrelated control (NC) after (EciI) and before restriction by Eci I (PCR). The patient’s (P1) mutated allele (5000 bp) was cut into two fragments of 3000 and 2000 bp. (H) 23delinsAT, confirmed by restriction analysis. The mutation creates new restriction site for Fok I enzyme. The electrophoretogram is showing amplified VNTR regions of two affected patients (P1, P2) and one unrelated control (NC) after (FokI) and before restriction by Fok I (PCR). The patients’ (P1, P2) mutated alleles (3000 bp) were cut into two fragments of 2000 and 1000 bp.

    Techniques Used: Sequencing, Generated, Polymerase Chain Reaction, Amplification, Mutagenesis, Genotyping Assay, Mass Spectrometry, Primer Extension Assay

    17) Product Images from "Phytoene synthase 2 can compensate for the absence of PSY1 in the control of color in Capsicum fruit"

    Article Title: Phytoene synthase 2 can compensate for the absence of PSY1 in the control of color in Capsicum fruit

    Journal: Journal of Experimental Botany

    doi: 10.1093/jxb/eraa155

    Polymorphism survey of carotenoid biosynthetic genes in the pepper genotypes ‘MicroPep Red’ (MR) and ‘MicroPep Yellow’ (MY). (A) gDNA amplification of six carotenoid biosynthetic genes using PCR. Primers were design to amplify the full length of each gene. The expected amplicon sizes were obtained for PSY2 , Lcyb , CrtZ-2 , and ZEP . No amplicon was obtained for PSY1 and CCS in MY. (B) gDNA PCR amplification of the PSY genes. No amplicon was obtained for PSY1 in MY. PSY , phytoene synthase ; Lcyb , lycopene ß-cyclase ; CrtZ-2 , ß-carotene hydroxylase ; ZEP , zeaxanthin epoxidase ; CCS , capsanthin-capsorubin synthase .
    Figure Legend Snippet: Polymorphism survey of carotenoid biosynthetic genes in the pepper genotypes ‘MicroPep Red’ (MR) and ‘MicroPep Yellow’ (MY). (A) gDNA amplification of six carotenoid biosynthetic genes using PCR. Primers were design to amplify the full length of each gene. The expected amplicon sizes were obtained for PSY2 , Lcyb , CrtZ-2 , and ZEP . No amplicon was obtained for PSY1 and CCS in MY. (B) gDNA PCR amplification of the PSY genes. No amplicon was obtained for PSY1 in MY. PSY , phytoene synthase ; Lcyb , lycopene ß-cyclase ; CrtZ-2 , ß-carotene hydroxylase ; ZEP , zeaxanthin epoxidase ; CCS , capsanthin-capsorubin synthase .

    Techniques Used: Amplification, Polymerase Chain Reaction

    Structural variations of PSY1 and CCS in pepper ‘MicroPep Yellow’ (MY) and ‘MicroPep Red’ (MR). (A) Genome-walking from Capana04g002520 identifies a deletion of almost 20 kb spanning the PSY1 genomic region. The primer used for the first genome-walking run is indicated by the arrow. (B) A Ty1/Copia-like retrotransposon insertion of almost 7 kb was discovered 1339 nt along CCS in MY. LTR, long terminal repeat; TSD, target site duplication. (C) The transcriptional variant of CCS in MY. Compared with the full CCS sequence in MR, much smaller bands were amplified from MY using RT-PCR. This transcriptional variation was regarded as being caused by the provision of a conserved sequence in the splicing junction by the inserted sequence. The letters underlined represent the conserved sequences of the exon–intron junction. The dotted lines and arrows indicate the genomic region that is spliced out during transcription.
    Figure Legend Snippet: Structural variations of PSY1 and CCS in pepper ‘MicroPep Yellow’ (MY) and ‘MicroPep Red’ (MR). (A) Genome-walking from Capana04g002520 identifies a deletion of almost 20 kb spanning the PSY1 genomic region. The primer used for the first genome-walking run is indicated by the arrow. (B) A Ty1/Copia-like retrotransposon insertion of almost 7 kb was discovered 1339 nt along CCS in MY. LTR, long terminal repeat; TSD, target site duplication. (C) The transcriptional variant of CCS in MY. Compared with the full CCS sequence in MR, much smaller bands were amplified from MY using RT-PCR. This transcriptional variation was regarded as being caused by the provision of a conserved sequence in the splicing junction by the inserted sequence. The letters underlined represent the conserved sequences of the exon–intron junction. The dotted lines and arrows indicate the genomic region that is spliced out during transcription.

    Techniques Used: Variant Assay, Sequencing, Amplification, Reverse Transcription Polymerase Chain Reaction

    18) Product Images from "Targeting Human α-Lactalbumin Gene Insertion into the Goat β-Lactoglobulin Locus by TALEN-Mediated Homologous Recombination"

    Article Title: Targeting Human α-Lactalbumin Gene Insertion into the Goat β-Lactoglobulin Locus by TALEN-Mediated Homologous Recombination

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0156636

    Targeting BLG in goat fibroblasts. (A) Schematic overview depicting the targeting strategy for the BLG locus. Blue boxes, exons of BLG; Diagonal lines above, TALEN1/2 pair binding sites; Level arrow lines, primers used for PCR; The predicted size of southern hybridization bands with BamHI digestion, for both the endogenous BLG locus and the BLG targeted locus, is indicated. (B) PCR-based measurements of TALEN-driven exogenous gene integration into the BLG locus in goat fibroblasts. Cells were right untransfected (lane 4, for negative control) or were transfected with an expression cassette for TALENs that induce a DSB at exon1 of BLG locus (lane 3), and donor plasmids carrying a foreign gene flanked by two homology arms, in the absence (lane 2) and presence (lane 1) of the TALEN. (C) 3’ Junction PCR results from cell lysis templates. TALEN-mediated transgene insertion yielded 2,300-bp PCR products using primers B31 and B32, which were specific to the neo gene and the BLG locus, respectively. (D) 5’ Junction PCR analysis performed on genomic DNA of 3’ junction PCR-positive colonies using primers B51 and B52 to amplify the 1,800-bp left-hand junction between the endogenous BLG locus and the exogenous hLA.
    Figure Legend Snippet: Targeting BLG in goat fibroblasts. (A) Schematic overview depicting the targeting strategy for the BLG locus. Blue boxes, exons of BLG; Diagonal lines above, TALEN1/2 pair binding sites; Level arrow lines, primers used for PCR; The predicted size of southern hybridization bands with BamHI digestion, for both the endogenous BLG locus and the BLG targeted locus, is indicated. (B) PCR-based measurements of TALEN-driven exogenous gene integration into the BLG locus in goat fibroblasts. Cells were right untransfected (lane 4, for negative control) or were transfected with an expression cassette for TALENs that induce a DSB at exon1 of BLG locus (lane 3), and donor plasmids carrying a foreign gene flanked by two homology arms, in the absence (lane 2) and presence (lane 1) of the TALEN. (C) 3’ Junction PCR results from cell lysis templates. TALEN-mediated transgene insertion yielded 2,300-bp PCR products using primers B31 and B32, which were specific to the neo gene and the BLG locus, respectively. (D) 5’ Junction PCR analysis performed on genomic DNA of 3’ junction PCR-positive colonies using primers B51 and B52 to amplify the 1,800-bp left-hand junction between the endogenous BLG locus and the exogenous hLA.

    Techniques Used: Binding Assay, Polymerase Chain Reaction, Hybridization, Negative Control, Transfection, Expressing, TALENs, Lysis

    Identification for BLG bi-allelic modification clones. (A) Long-range PCR analysis performed on genomic DNA by primers LRF and LRR. Lane WT, non-transgenic cells; Lanes 1–22, gene-targeted clones. The wild-type allele PCR product was 0.5 kb and the targeted allele PCR product was 4.7 kb. (B) Southern blot analysis for gene targeted clones. Lane WT, non-transgenic cells; Lanes 1–8, BLG bi-allelic modification clones identified by LR-PCR; Lanes 9–14, BLG mono-allelic modification clones identified by LR-PCR.
    Figure Legend Snippet: Identification for BLG bi-allelic modification clones. (A) Long-range PCR analysis performed on genomic DNA by primers LRF and LRR. Lane WT, non-transgenic cells; Lanes 1–22, gene-targeted clones. The wild-type allele PCR product was 0.5 kb and the targeted allele PCR product was 4.7 kb. (B) Southern blot analysis for gene targeted clones. Lane WT, non-transgenic cells; Lanes 1–8, BLG bi-allelic modification clones identified by LR-PCR; Lanes 9–14, BLG mono-allelic modification clones identified by LR-PCR.

    Techniques Used: Modification, Polymerase Chain Reaction, Transgenic Assay, Clone Assay, Southern Blot

    19) Product Images from "Decreased N-TAF1 expression in X-linked dystonia-parkinsonism patient-specific neural stem cells"

    Article Title: Decreased N-TAF1 expression in X-linked dystonia-parkinsonism patient-specific neural stem cells

    Journal: Disease Models & Mechanisms

    doi: 10.1242/dmm.022590

    TAF1 and MTS transcript expression levels in fibroblasts. (A) Genomic DNA (gDNA) from all individuals was PCR amplified with primers flanking the insertion site to confirm the presence of the SVA. Lane 1: 1 kb DNA ladder. Lane 2: no template control (H 2 O). Lanes 3-7: XDP lines (left to right) 32517, 33109, 33363, 33808, 34363. Lanes 8-12: Control lines (left to right) 32643, 33113, 33114, 33809, 33362. The predicted 3229 bp SVA product was present in all XDP samples (upper arrow), whereas controls had a product of ∼599 bp (lower arrow), a difference consistent with the size of the SVA. (B) Quantitative expression analysis of TAF1 transcript fragments in XDP vs control fibroblasts ( n =5 each) based on comparative Ct method. Expression levels were normalized to the mean of housekeeping genes HPRT1 and TFRC . Levels of transcript fragments amplified by primer sets TA02-334, TAF1-3′, TA14-385N and TAF1-3′N were significantly lower in XDP vs control cells, whereas expression of the transcript amplified by TA09-693 was significantly increased in XDP vs control samples. The neural-specific transcript, N-TAF1, amplified by primer set TA14-391, as well as all six transcripts incorporating MTS sequences, were not detected in fibroblasts. Data represent mean fold changes±standard errors, analyzed by Student's t -test. * P
    Figure Legend Snippet: TAF1 and MTS transcript expression levels in fibroblasts. (A) Genomic DNA (gDNA) from all individuals was PCR amplified with primers flanking the insertion site to confirm the presence of the SVA. Lane 1: 1 kb DNA ladder. Lane 2: no template control (H 2 O). Lanes 3-7: XDP lines (left to right) 32517, 33109, 33363, 33808, 34363. Lanes 8-12: Control lines (left to right) 32643, 33113, 33114, 33809, 33362. The predicted 3229 bp SVA product was present in all XDP samples (upper arrow), whereas controls had a product of ∼599 bp (lower arrow), a difference consistent with the size of the SVA. (B) Quantitative expression analysis of TAF1 transcript fragments in XDP vs control fibroblasts ( n =5 each) based on comparative Ct method. Expression levels were normalized to the mean of housekeeping genes HPRT1 and TFRC . Levels of transcript fragments amplified by primer sets TA02-334, TAF1-3′, TA14-385N and TAF1-3′N were significantly lower in XDP vs control cells, whereas expression of the transcript amplified by TA09-693 was significantly increased in XDP vs control samples. The neural-specific transcript, N-TAF1, amplified by primer set TA14-391, as well as all six transcripts incorporating MTS sequences, were not detected in fibroblasts. Data represent mean fold changes±standard errors, analyzed by Student's t -test. * P

    Techniques Used: Expressing, Polymerase Chain Reaction, Amplification

    20) Product Images from "Noninvasive Immunohistochemical Diagnosis and Novel MUC1 Mutations Causing Autosomal Dominant Tubulointerstitial Kidney Disease"

    Article Title: Noninvasive Immunohistochemical Diagnosis and Novel MUC1 Mutations Causing Autosomal Dominant Tubulointerstitial Kidney Disease

    Journal: Journal of the American Society of Nephrology : JASN

    doi: 10.1681/ASN.2018020180

    MUC1 VNTR sequencing identifies novel mutations causing ADTKD- MUC1 . (A) Sequence logo showing the most conserved regions of the VNTR repeats. Corresponding amino acid sequences of wild-type MUC1 (wt_AA) and MUC1 fs (mut_AA) are shown below. To find novel frameshift mutations that change the open reading frame, different conserved 10-mers of the wild-type repeat were used as sequence anchors (underlined DNA sequence as an example). For each anchor pair, all sequences delimited by these two anchors that are changing an open reading frame ( i.e. , adding or deleting nucleotides) were selected from the FASTQ file. (B) Sequences of the canonical 60 nucleotide long wild-type VNTR repeat (wt) and candidate frameshift mutations identified in this study. (C) Random mutations are generated in DNA molecules during PCR amplification step. To find true germline mutations, the percentage of reads with a given sequence (putative frameshift mutation) from all reads was calculated for each of the analyzed samples ( y -axis), and this needed to be higher than the average+2 SD of the nine wild-type control samples. Indicated are numbers of controls (wt), patients with individual MUC1 mutations (27dupC, 28dupA, 26_27insG, 1–16dup, 23delinsAT, 51dupC), and individuals with still unknown MUC1 mutation(s) who have urinary cell smears positive for MUC1fs and who tested negative for 27dupC by conventional genotyping assay (unknown). (D) 27dupC, confirmed by a mass spectrometry-based primer extension assay. The 27dupC extension product is observed at 5904 D (red asterisk). (E) 28dupA, confirmed by a mass spectrometry-based assay. The 28dupA extension product is observed at 6571 D (red asterisk). (F) 26_27insG, confirmed by a mass spectrometry-based assay. The 26_27insG extension product is observed at 5944.85 D (red arrow). (G) 1–16dup confirmed by restriction analysis. The mutation creates new restriction site for Eci I enzyme. The electrophoretogram shows amplified VNTR regions of the affected patient (P1), two healthy relatives (H1, H2), and one unrelated control (NC) after (EciI) and before restriction by Eci I (PCR). The patient’s (P1) mutated allele (5000 bp) was cut into two fragments of 3000 and 2000 bp. (H) 23delinsAT, confirmed by restriction analysis. The mutation creates new restriction site for Fok I enzyme. The electrophoretogram is showing amplified VNTR regions of two affected patients (P1, P2) and one unrelated control (NC) after (FokI) and before restriction by Fok I (PCR). The patients’ (P1, P2) mutated alleles (3000 bp) were cut into two fragments of 2000 and 1000 bp.
    Figure Legend Snippet: MUC1 VNTR sequencing identifies novel mutations causing ADTKD- MUC1 . (A) Sequence logo showing the most conserved regions of the VNTR repeats. Corresponding amino acid sequences of wild-type MUC1 (wt_AA) and MUC1 fs (mut_AA) are shown below. To find novel frameshift mutations that change the open reading frame, different conserved 10-mers of the wild-type repeat were used as sequence anchors (underlined DNA sequence as an example). For each anchor pair, all sequences delimited by these two anchors that are changing an open reading frame ( i.e. , adding or deleting nucleotides) were selected from the FASTQ file. (B) Sequences of the canonical 60 nucleotide long wild-type VNTR repeat (wt) and candidate frameshift mutations identified in this study. (C) Random mutations are generated in DNA molecules during PCR amplification step. To find true germline mutations, the percentage of reads with a given sequence (putative frameshift mutation) from all reads was calculated for each of the analyzed samples ( y -axis), and this needed to be higher than the average+2 SD of the nine wild-type control samples. Indicated are numbers of controls (wt), patients with individual MUC1 mutations (27dupC, 28dupA, 26_27insG, 1–16dup, 23delinsAT, 51dupC), and individuals with still unknown MUC1 mutation(s) who have urinary cell smears positive for MUC1fs and who tested negative for 27dupC by conventional genotyping assay (unknown). (D) 27dupC, confirmed by a mass spectrometry-based primer extension assay. The 27dupC extension product is observed at 5904 D (red asterisk). (E) 28dupA, confirmed by a mass spectrometry-based assay. The 28dupA extension product is observed at 6571 D (red asterisk). (F) 26_27insG, confirmed by a mass spectrometry-based assay. The 26_27insG extension product is observed at 5944.85 D (red arrow). (G) 1–16dup confirmed by restriction analysis. The mutation creates new restriction site for Eci I enzyme. The electrophoretogram shows amplified VNTR regions of the affected patient (P1), two healthy relatives (H1, H2), and one unrelated control (NC) after (EciI) and before restriction by Eci I (PCR). The patient’s (P1) mutated allele (5000 bp) was cut into two fragments of 3000 and 2000 bp. (H) 23delinsAT, confirmed by restriction analysis. The mutation creates new restriction site for Fok I enzyme. The electrophoretogram is showing amplified VNTR regions of two affected patients (P1, P2) and one unrelated control (NC) after (FokI) and before restriction by Fok I (PCR). The patients’ (P1, P2) mutated alleles (3000 bp) were cut into two fragments of 2000 and 1000 bp.

    Techniques Used: Sequencing, Generated, Polymerase Chain Reaction, Amplification, Mutagenesis, Genotyping Assay, Mass Spectrometry, Primer Extension Assay

    Related Articles

    Amplification:

    Article Title: Detection of virulence factors of South African Lactococcus garvieae isolated from rainbow trout, Oncorhynchus mykiss (Walbaum)
    Article Snippet: .. The L. garvieae EPS synthesis gene cluster, as described in L. garvieae Lg2 (Miyauchi et al. ), was amplified in isolates A1–A3, A5, A6, A11 and A12 using the TaKaRa LA PCR Kit (TaKaRa Bio Inc. #RR002A, Kyoto, Japan). .. Amplicons were visualised on a 1% agarose gel.

    Article Title: Loss of the Transcriptional Repressor PAG-3/Gfi-1 Results in Enhanced Neurosecretion that is Dependent on the Dense-Core Vesicle Membrane Protein IDA-1/IA-2
    Article Snippet: .. Further confirmation of the pag-3(gv560) mutation was provided by rescuing the mutant phenotypes with a 6.5-kb genomic fragment covering the entire coding region of pag-3 that was amplified by long-PCR (TaKaRa LA Taq DNA Polymerase, Takara Bio USA Corporate, Madison, WI). .. Animals were injected with the purified PCR products at 1–10 ng/µl together with the co-injection marker pRF4 (rol-6(su1006) ) at 100 ng/µl and analyzed for rescue of IDA-1::GFP intensity and distribution.

    Article Title: Identifying new variation at the J locus, previously identified as e6, in long juvenile ‘Paranagoiana’ soybean
    Article Snippet: .. Please note that in order to have a proper amplification and to ensure strong band signals, TaKaRa LA Taq® DNA Polymerase (Mg2+plus buffer) must be used. ..

    Article Title: Simultaneous Use of MutS and RecA for Suppression of Nonspecific Amplification during PCR
    Article Snippet: .. To determine whether ttRecA and ttMutS preclude the effect of each other, a 611-bp region of the ttha0122 gene was amplified by Takara LA Taq using T. thermophilus HB8 genomic DNA as a template. .. In the absence of ttRecA and ttMutS, relatively weak amplification of the target sequence and the nonspecific amplification of 1000- to 1500-bp were observed ( ).

    Article Title: Simultaneous Use of MutS and RecA for Suppression of Nonspecific Amplification during PCR
    Article Snippet: Therefore, we examined whether or not ATP interferes with the error-suppressing effect of MutS during PCR. .. The 423-base pair (bp) region of the ttha1806 gene was amplified by Takara LA Taq using T. thermophilus HB8 genomic DNA as the template. .. Without ttMutS and ttRecA, 1000- to 5000-bp DNA fragments were amplified nonspecifically ( ). ttMutS showed a significant suppressing effect on the nonspecific amplifications in the presence of 0 to 0.4 mM ATP ( ).

    Polymerase Chain Reaction:

    Article Title: Detection of virulence factors of South African Lactococcus garvieae isolated from rainbow trout, Oncorhynchus mykiss (Walbaum)
    Article Snippet: .. The L. garvieae EPS synthesis gene cluster, as described in L. garvieae Lg2 (Miyauchi et al. ), was amplified in isolates A1–A3, A5, A6, A11 and A12 using the TaKaRa LA PCR Kit (TaKaRa Bio Inc. #RR002A, Kyoto, Japan). .. Amplicons were visualised on a 1% agarose gel.

    Article Title: A Multiplex PCR Detection Assay for the Identification of Clinically Relevant Anaplasma Species in Field Blood Samples
    Article Snippet: Optimization of the PCR Conditions To ensure optimal amplification conditions for the four target sequences in a multiplex PCR assay, a range of PCR-related parameters were evaluated such as the annealing temperatures of the primers, the dosage of primers, and the concentrations of La Taq DNA polymerase. .. PCR conditions were investigated including the variation of the annealing temperature from 57 to 64°C, the concentration of primer sets from 0.08 to 0.56 μM, the concentration of La Taq DNA polymerase (TaKaRa, Dalian, China) from 0.75 to 1.75 U, and the concentration of PCR buffer (10×) and the dNTPs (2.5 mM) from 1.5 to 3 μL and 2 to 6 μL, respectively. ..

    Article Title: A Multiplex PCR Detection Assay for the Identification of Clinically Relevant Anaplasma Species in Field Blood Samples
    Article Snippet: Infection rates were assessed using the Chi-square test with Yates’ correction, and a P -value ≤0.05 was considered to represent statistical significance. .. Optimization of the Multiplex PCR After optimization, the optimum multiplex PCR assay was performed in a final volume of 25 μL, containing 2.5 μL of 10× PCR La buffer, 4 μL of dNTPs at 2.5 mM, 1.25 U of La Taq DNA polymerase, 0.32 μM of each primer, and 2 μL of the DNA template. ..

    Mutagenesis:

    Article Title: Loss of the Transcriptional Repressor PAG-3/Gfi-1 Results in Enhanced Neurosecretion that is Dependent on the Dense-Core Vesicle Membrane Protein IDA-1/IA-2
    Article Snippet: .. Further confirmation of the pag-3(gv560) mutation was provided by rescuing the mutant phenotypes with a 6.5-kb genomic fragment covering the entire coding region of pag-3 that was amplified by long-PCR (TaKaRa LA Taq DNA Polymerase, Takara Bio USA Corporate, Madison, WI). .. Animals were injected with the purified PCR products at 1–10 ng/µl together with the co-injection marker pRF4 (rol-6(su1006) ) at 100 ng/µl and analyzed for rescue of IDA-1::GFP intensity and distribution.

    Concentration Assay:

    Article Title: A Multiplex PCR Detection Assay for the Identification of Clinically Relevant Anaplasma Species in Field Blood Samples
    Article Snippet: Optimization of the PCR Conditions To ensure optimal amplification conditions for the four target sequences in a multiplex PCR assay, a range of PCR-related parameters were evaluated such as the annealing temperatures of the primers, the dosage of primers, and the concentrations of La Taq DNA polymerase. .. PCR conditions were investigated including the variation of the annealing temperature from 57 to 64°C, the concentration of primer sets from 0.08 to 0.56 μM, the concentration of La Taq DNA polymerase (TaKaRa, Dalian, China) from 0.75 to 1.75 U, and the concentration of PCR buffer (10×) and the dNTPs (2.5 mM) from 1.5 to 3 μL and 2 to 6 μL, respectively. ..

    Multiplex Assay:

    Article Title: A Multiplex PCR Detection Assay for the Identification of Clinically Relevant Anaplasma Species in Field Blood Samples
    Article Snippet: Infection rates were assessed using the Chi-square test with Yates’ correction, and a P -value ≤0.05 was considered to represent statistical significance. .. Optimization of the Multiplex PCR After optimization, the optimum multiplex PCR assay was performed in a final volume of 25 μL, containing 2.5 μL of 10× PCR La buffer, 4 μL of dNTPs at 2.5 mM, 1.25 U of La Taq DNA polymerase, 0.32 μM of each primer, and 2 μL of the DNA template. ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    TaKaRa long range pcr
    Structures of the pre- and post-Cre floxed mouse Zip5 gene and integration and genotyping screen designs. ( A ) The mouse Zip5 gene was captured using gap-repair and manipulated using galK recombineering. Exons ( 1–12 ) and the exon encoding transmembrane domain 1 ( TMD1 ) are indicated, as are the positions of LoxP sites (intron 4 and downstream of PGK Neo ), the PGK-neomycin ( PGK Neo ) cassette and the locations of primers used for genotyping. The LoxP site in intron 4 is flanked by an EcoRV restriction enzyme cleavage site. ( B ) The structure of the Zip5 gene after Cre recombination is shown. Recombination eliminates the transmembrane domain of ZIP5. ( C ) The floxed Zip5 gene was targeted into <t>E14</t> ES cells and properly targeted ES cells were identified by long range <t>PCR</t> using flanking and internal primers. PCR products from the wild-type ( Wt ) and floxed ( Fx ) alleles are indicated. EcoRV cleavage was used to differentiate between the floxed and wild-type alleles in the 5′ PCR screen whereas the 3′ PCR screen yielded the predicted larger product from the wild-type allele. Targeted ES cells were used to generate mice homozygous for the floxed Zip5 allele. ( D ) Mice were genotyped by PCR amplification of the intron 4 region containing the LoxP site. The PCR product from homozygous Zip5 floxed mice before Cre-induced recombination is shown in the left lane while that from control mice is shown in the center lane and that from Zip5 -knockout mice ( Ko ) is shown in the right lane . For the intestine- and pancreas-specific knockout mice, detection of Zip5 mRNA and/or protein was employed to monitor the efficacy of recombination.
    Long Range Pcr, supplied by TaKaRa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/long range pcr/product/TaKaRa
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    long range pcr - by Bioz Stars, 2021-07
    86/100 stars
      Buy from Supplier

    99
    TaKaRa long range pcr polymerase
    mtDNA deletions and mutations increase when endogenous Parkin is lost in striata of PD-mito- Pst I mice. A , Schematic representation of mouse mtDNA. Scissors indicate the Pst I cleavage sites. Red arrows represent encoded proteins. Gray arrows represent mt-tRNAs. Color-coded representation of the position of the amplicons used for the qPCRs is maintained in the graphs. B , mtDNA levels measured by qPCR of LCM-collected SN TH + neurons ( n = 5/group; T = p value after t test). C , D , Southern blot probing striatal <t>DNA</t> with mtDNA and nuclear DNA probes ( C ) and mtDNA content measured by qPCR ( D ) in 4-month-old animals. E , Quantification by qPCR of full-length mtDNA content in striata of 4-month-old animals. F , Recombination events detected by qPCR using primers flanking the Pst I sites in striatal samples. G , H , Long-range <t>PCR</t> amplification of a 10 kb and a 117 bp fragment from striatal DNA ( G ) and relative quantification of a 10 kb fragment normalized to the 117 bp fragment ( H ). Boxes in graphs B , D , and F represent one individual animal. * p
    Long Range Pcr Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/long range pcr polymerase/product/TaKaRa
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    long range pcr polymerase - by Bioz Stars, 2021-07
    99/100 stars
      Buy from Supplier

    86
    TaKaRa long range pcr mtdna
    iPSC and iPSC‐derived neurons do not exhibit <t>mtDNA</t> deletions or copy number variations. (A) Left panel: MtDNA copy number (CN) per cell measurement showing the mean with standard error of the mean calculated from six independent assays using two clones per subject. Right panel: Correlation of ND1 and ND4 Ct values in neurons showing a strong correlation (Pearson r = 0.9887) and implying that no deletions in mtDNA were present. An asterisk represents a deletion control. Gels show representative images of long‐range <t>PCR</t> analysis on DNA isolated from iPSC‐derived neurons (B) and iPSC lines (C). bp = base pair; Ct = threshold cycle; iPSC = induced pluripotent stem cell; mtDNA = mitochondrial DNA; Opa1 = optic atrophy 1.
    Long Range Pcr Mtdna, supplied by TaKaRa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/long range pcr mtdna/product/TaKaRa
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    long range pcr mtdna - by Bioz Stars, 2021-07
    86/100 stars
      Buy from Supplier

    96
    TaKaRa la pcr genome dna set
    Tissue-related variation in heteroplasmy levels for maternal (H1a1) and paternal (R0a1) haplogroups in Patient II-4 of Family A. ( A ) Pedigree of Family A. The black-filled symbols indicate the four family members (II-1, II-3, II-4, and III-6) that show biparental mtDNA transmission. The diagonal-filled symbols indicate the three family members (IV-1, IV-2, and IV-3) who carry a high number and level of mtDNA heteroplasmies which underwent normal maternal transmission. ( B ) Variable heteroplasmy levels detected by <t>PCR-NGS</t> in blood, saliva, hair follicle (HF), urine, sperm, and fibroblast (FB) samples collected from Patient II-4. ( C ) Heteroplasmy drift over time increases the proportion of the paternal haplogroup in primary fibroblast cells derived from Patient II-4. ( D, E ) Single cell-derived <t>DNA</t> samples from Patient II-4 were sequenced to measure cell-to-cell variability in heteroplasmy levels. Sanger sequencing for single-sperm samples ( D ) and PCR-NGS for colonies derived from individual primary fibroblast cells ( E ) show marked differences in heteroplasmy levels, even for cells derived from the same tissue.
    La Pcr Genome Dna Set, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/la pcr genome dna set/product/TaKaRa
    Average 96 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    la pcr genome dna set - by Bioz Stars, 2021-07
    96/100 stars
      Buy from Supplier

    Image Search Results


    Structures of the pre- and post-Cre floxed mouse Zip5 gene and integration and genotyping screen designs. ( A ) The mouse Zip5 gene was captured using gap-repair and manipulated using galK recombineering. Exons ( 1–12 ) and the exon encoding transmembrane domain 1 ( TMD1 ) are indicated, as are the positions of LoxP sites (intron 4 and downstream of PGK Neo ), the PGK-neomycin ( PGK Neo ) cassette and the locations of primers used for genotyping. The LoxP site in intron 4 is flanked by an EcoRV restriction enzyme cleavage site. ( B ) The structure of the Zip5 gene after Cre recombination is shown. Recombination eliminates the transmembrane domain of ZIP5. ( C ) The floxed Zip5 gene was targeted into E14 ES cells and properly targeted ES cells were identified by long range PCR using flanking and internal primers. PCR products from the wild-type ( Wt ) and floxed ( Fx ) alleles are indicated. EcoRV cleavage was used to differentiate between the floxed and wild-type alleles in the 5′ PCR screen whereas the 3′ PCR screen yielded the predicted larger product from the wild-type allele. Targeted ES cells were used to generate mice homozygous for the floxed Zip5 allele. ( D ) Mice were genotyped by PCR amplification of the intron 4 region containing the LoxP site. The PCR product from homozygous Zip5 floxed mice before Cre-induced recombination is shown in the left lane while that from control mice is shown in the center lane and that from Zip5 -knockout mice ( Ko ) is shown in the right lane . For the intestine- and pancreas-specific knockout mice, detection of Zip5 mRNA and/or protein was employed to monitor the efficacy of recombination.

    Journal: PLoS ONE

    Article Title: The Zinc Transporter Zip5 (Slc39a5) Regulates Intestinal Zinc Excretion and Protects the Pancreas against Zinc Toxicity

    doi: 10.1371/journal.pone.0082149

    Figure Lengend Snippet: Structures of the pre- and post-Cre floxed mouse Zip5 gene and integration and genotyping screen designs. ( A ) The mouse Zip5 gene was captured using gap-repair and manipulated using galK recombineering. Exons ( 1–12 ) and the exon encoding transmembrane domain 1 ( TMD1 ) are indicated, as are the positions of LoxP sites (intron 4 and downstream of PGK Neo ), the PGK-neomycin ( PGK Neo ) cassette and the locations of primers used for genotyping. The LoxP site in intron 4 is flanked by an EcoRV restriction enzyme cleavage site. ( B ) The structure of the Zip5 gene after Cre recombination is shown. Recombination eliminates the transmembrane domain of ZIP5. ( C ) The floxed Zip5 gene was targeted into E14 ES cells and properly targeted ES cells were identified by long range PCR using flanking and internal primers. PCR products from the wild-type ( Wt ) and floxed ( Fx ) alleles are indicated. EcoRV cleavage was used to differentiate between the floxed and wild-type alleles in the 5′ PCR screen whereas the 3′ PCR screen yielded the predicted larger product from the wild-type allele. Targeted ES cells were used to generate mice homozygous for the floxed Zip5 allele. ( D ) Mice were genotyped by PCR amplification of the intron 4 region containing the LoxP site. The PCR product from homozygous Zip5 floxed mice before Cre-induced recombination is shown in the left lane while that from control mice is shown in the center lane and that from Zip5 -knockout mice ( Ko ) is shown in the right lane . For the intestine- and pancreas-specific knockout mice, detection of Zip5 mRNA and/or protein was employed to monitor the efficacy of recombination.

    Article Snippet: The Zip5 Fx targeting vector was electroporated into E14 embryonic stem (ES) cells and colonies were screened using long range PCR with LA-Taq (TaKaRa Bio, Inc.) and primers outside the captured Zip5 locus paired with primers within the Zip5 gene itself ( ).

    Techniques: Polymerase Chain Reaction, Mouse Assay, Amplification, Knock-Out

    mtDNA deletions and mutations increase when endogenous Parkin is lost in striata of PD-mito- Pst I mice. A , Schematic representation of mouse mtDNA. Scissors indicate the Pst I cleavage sites. Red arrows represent encoded proteins. Gray arrows represent mt-tRNAs. Color-coded representation of the position of the amplicons used for the qPCRs is maintained in the graphs. B , mtDNA levels measured by qPCR of LCM-collected SN TH + neurons ( n = 5/group; T = p value after t test). C , D , Southern blot probing striatal DNA with mtDNA and nuclear DNA probes ( C ) and mtDNA content measured by qPCR ( D ) in 4-month-old animals. E , Quantification by qPCR of full-length mtDNA content in striata of 4-month-old animals. F , Recombination events detected by qPCR using primers flanking the Pst I sites in striatal samples. G , H , Long-range PCR amplification of a 10 kb and a 117 bp fragment from striatal DNA ( G ) and relative quantification of a 10 kb fragment normalized to the 117 bp fragment ( H ). Boxes in graphs B , D , and F represent one individual animal. * p

    Journal: The Journal of Neuroscience

    Article Title: Lack of Parkin Anticipates the Phenotype and Affects Mitochondrial Morphology and mtDNA Levels in a Mouse Model of Parkinson's Disease

    doi: 10.1523/JNEUROSCI.1384-17.2017

    Figure Lengend Snippet: mtDNA deletions and mutations increase when endogenous Parkin is lost in striata of PD-mito- Pst I mice. A , Schematic representation of mouse mtDNA. Scissors indicate the Pst I cleavage sites. Red arrows represent encoded proteins. Gray arrows represent mt-tRNAs. Color-coded representation of the position of the amplicons used for the qPCRs is maintained in the graphs. B , mtDNA levels measured by qPCR of LCM-collected SN TH + neurons ( n = 5/group; T = p value after t test). C , D , Southern blot probing striatal DNA with mtDNA and nuclear DNA probes ( C ) and mtDNA content measured by qPCR ( D ) in 4-month-old animals. E , Quantification by qPCR of full-length mtDNA content in striata of 4-month-old animals. F , Recombination events detected by qPCR using primers flanking the Pst I sites in striatal samples. G , H , Long-range PCR amplification of a 10 kb and a 117 bp fragment from striatal DNA ( G ) and relative quantification of a 10 kb fragment normalized to the 117 bp fragment ( H ). Boxes in graphs B , D , and F represent one individual animal. * p

    Article Snippet: Fifteen nanograms of DNA was amplified to generate a 10 kb fragment using a Long-Range PCR Polymerase (Takara).

    Techniques: Mouse Assay, Real-time Polymerase Chain Reaction, Laser Capture Microdissection, Southern Blot, Polymerase Chain Reaction, Amplification

    iPSC and iPSC‐derived neurons do not exhibit mtDNA deletions or copy number variations. (A) Left panel: MtDNA copy number (CN) per cell measurement showing the mean with standard error of the mean calculated from six independent assays using two clones per subject. Right panel: Correlation of ND1 and ND4 Ct values in neurons showing a strong correlation (Pearson r = 0.9887) and implying that no deletions in mtDNA were present. An asterisk represents a deletion control. Gels show representative images of long‐range PCR analysis on DNA isolated from iPSC‐derived neurons (B) and iPSC lines (C). bp = base pair; Ct = threshold cycle; iPSC = induced pluripotent stem cell; mtDNA = mitochondrial DNA; Opa1 = optic atrophy 1.

    Journal: Annals of Neurology

    Article Title: Stem cell modeling of mitochondrial parkinsonism reveals key functions of OPA1

    doi: 10.1002/ana.25221

    Figure Lengend Snippet: iPSC and iPSC‐derived neurons do not exhibit mtDNA deletions or copy number variations. (A) Left panel: MtDNA copy number (CN) per cell measurement showing the mean with standard error of the mean calculated from six independent assays using two clones per subject. Right panel: Correlation of ND1 and ND4 Ct values in neurons showing a strong correlation (Pearson r = 0.9887) and implying that no deletions in mtDNA were present. An asterisk represents a deletion control. Gels show representative images of long‐range PCR analysis on DNA isolated from iPSC‐derived neurons (B) and iPSC lines (C). bp = base pair; Ct = threshold cycle; iPSC = induced pluripotent stem cell; mtDNA = mitochondrial DNA; Opa1 = optic atrophy 1.

    Article Snippet: mtDNA Copy Number and Deletion Levels Determination and Long‐Range PCR mtDNA was amplified in two fragments of approximately 9.9 kilobases (kb) and 15.4 kb in length using Takara PrimeSTAR GXL DNA polymerase (Takara Bio Inc., Kusatsu, Japan).

    Techniques: Derivative Assay, Clone Assay, Polymerase Chain Reaction, Isolation

    Tissue-related variation in heteroplasmy levels for maternal (H1a1) and paternal (R0a1) haplogroups in Patient II-4 of Family A. ( A ) Pedigree of Family A. The black-filled symbols indicate the four family members (II-1, II-3, II-4, and III-6) that show biparental mtDNA transmission. The diagonal-filled symbols indicate the three family members (IV-1, IV-2, and IV-3) who carry a high number and level of mtDNA heteroplasmies which underwent normal maternal transmission. ( B ) Variable heteroplasmy levels detected by PCR-NGS in blood, saliva, hair follicle (HF), urine, sperm, and fibroblast (FB) samples collected from Patient II-4. ( C ) Heteroplasmy drift over time increases the proportion of the paternal haplogroup in primary fibroblast cells derived from Patient II-4. ( D, E ) Single cell-derived DNA samples from Patient II-4 were sequenced to measure cell-to-cell variability in heteroplasmy levels. Sanger sequencing for single-sperm samples ( D ) and PCR-NGS for colonies derived from individual primary fibroblast cells ( E ) show marked differences in heteroplasmy levels, even for cells derived from the same tissue.

    Journal: bioRxiv

    Article Title: Heteroplasmy variability in individuals with biparentally inherited mitochondrial DNA

    doi: 10.1101/2020.02.26.939405

    Figure Lengend Snippet: Tissue-related variation in heteroplasmy levels for maternal (H1a1) and paternal (R0a1) haplogroups in Patient II-4 of Family A. ( A ) Pedigree of Family A. The black-filled symbols indicate the four family members (II-1, II-3, II-4, and III-6) that show biparental mtDNA transmission. The diagonal-filled symbols indicate the three family members (IV-1, IV-2, and IV-3) who carry a high number and level of mtDNA heteroplasmies which underwent normal maternal transmission. ( B ) Variable heteroplasmy levels detected by PCR-NGS in blood, saliva, hair follicle (HF), urine, sperm, and fibroblast (FB) samples collected from Patient II-4. ( C ) Heteroplasmy drift over time increases the proportion of the paternal haplogroup in primary fibroblast cells derived from Patient II-4. ( D, E ) Single cell-derived DNA samples from Patient II-4 were sequenced to measure cell-to-cell variability in heteroplasmy levels. Sanger sequencing for single-sperm samples ( D ) and PCR-NGS for colonies derived from individual primary fibroblast cells ( E ) show marked differences in heteroplasmy levels, even for cells derived from the same tissue.

    Article Snippet: For Method 2 (used for Family E), the forward and reverse primers used for long-range PCR included: mt16426F (CCGCACAAGAGTGCTACTCTCCTC) and mt16425R (GATATTGATTTCACGGAGGATGGTG).

    Techniques: Transmission Assay, Polymerase Chain Reaction, Next-Generation Sequencing, Derivative Assay, Sequencing