long range pcr  (New England Biolabs)

Journal: International Immunology

Article Title: Phenotype and function of B cells and dendritic cells from interferon regulatory factor 5-deficient mice with and without a mutation in DOCK2

doi: 10.1093/intimm/dxs114

Figure Lengend Snippet: A DOCK2 mutation is detected in IRF5 −/− mice backcrossed 11 generations to C57BL/6 ( IRF5 −/− 11G) mice but not in IRF5 −/− mice backcrossed 15 generations to C57BL/6 ( IRF5 −/− 15G). (A) RT–PCR to detect the DOCK2 mutation (DOCK2mu). RNA was purified from splenic B cells of wild-type C57BL/6 mice from The Jackson Laboratory (Jackson wild-type), IRF5 +/+ and IRF5 −/− 15G littermates and IRF5 −/− ). Primers used in the left-hand gel give a 577-bp product for the DOCK2 mutation and a 383-bp product for wild-type DOCK2. Primers used in the right-hand gel give a 158-bp product for the DOCK2 mutation and do not amplify wild-type DOCK2. (B) The diagram shows the hypothesized differences in genomic DOCK2 DNA between wild-type and DOCK2 mutant IRF5 −/− mice. In the DOCK2 mutant mice, the duplicated exon 28 and 29 together with some flanking DNA is inserted into the intron between exons 27 and 28. The gel shows a PCR performed using a forward primer, which recognizes exon 29 (Ex29F2) and 27 reverse primers (R1-R26 or Ex28R2), which detect the region in the intron between exons 27 and 28 that is closest to exon 28. PCR products were obtained with the R23–R25 primers. IRF5 −/− 11G genomic DNA containing the DOCK2 mutation was used as the template. (C) PCR was performed using the R23 reverse primer and 10 forward primers, which recognize either exon 29 (Ex29F2) or the intron between exons 29 and 30 (In\.1F to In29.9F). (D) DNA sequence of the 3′-end of DOCK2 mutation. The shaded region is the duplicated intronic sequence between exons 29 and 30, and the unshaded region is the non-duplicated intron between exons 27 and 28. (E) Diagram of the DOCK2 mutation. The duplicated segment of the DOCK2 gene present in the DOCK2 mutation ends at 3991bp after exon 29. This duplicated segment is inserted into intron 27–28 at 17 306bp before exon 28. (F) PCR to detect the DOCK2 mutation. Genomic DNA from IRF5 −/− 11G mice gave a PCR product for the DOCK2 mutation (305bp), whereas DNA from IRF5 +/+ and IRF5 −/− 15G littermates did not. CD19 PCR was used as an internal control to verify the adequacy of DNA preparation in each sample.

Article Snippet: Long-range PCR was performed using LongAmp Taq DNA polymerase (New England BioLabs, Ipswich, MA, USA), which can amplify up to 30kb.

Techniques: Mutagenesis, Mouse Assay, Reverse Transcription Polymerase Chain Reaction, Purification, Polymerase Chain Reaction, Sequencing

Journal: BMC Medical Genetics

Article Title: Structural variation and missense mutation in SBDS associated with Shwachman-Diamond syndrome

doi: 10.1186/1471-2350-15-64

Figure Lengend Snippet: Additional studies of the genomic segment that includes SBDS supports the presence of an insertion of unknown origin within the paternal allele. a . Agarose gel analysis of a 13.1 kb long-range PCR product spanning SBDS and flanking region, the region targeted by the Southern blotting studies (Figures 2 and 3 ). DNA from patient (BAB3762), parents (BAB3763- mother, BAB3764-father) and a normal controls (CTL1 and CTL2) were amplified using primers DelFb + KpnR, and then digested with either Kpn I or Sac I. Kpn I did not digest the 13.1 kb PCR product, consistent with lack of amplification of the paternal allele. Consistently, Sac I digestion of the 13.1 kb PCR product showed an identical pattern in samples and controls. b . Sanger sequencing of intron 2 amplified along with exon 2 using short range PCR revealed inconsistent segregation of a paternal genotype for two polymorphic SNPs in the patient (BAB3762). *Non-digested PCR product.

Article Snippet: Long-range PCR products were digested using restriction enzymes Kpn I and Sac I (New England BioLabs, Ipswich, MA) for 2 hours at 37°C, followed by separation on a 1% agarose gel in 0.5X Tris–Borate–EDTA buffer.

Techniques: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Southern Blot, Amplification, Sequencing

Journal: Developmental biology

Article Title: A Sprouty4 reporter to monitor FGF/ERK signaling activity in ESCs and mice

doi: 10.1016/j.ydbio.2018.06.017

Figure Lengend Snippet: Developing a fluorescent reporter for the FGF/ERK target Spry4 in mouse ESCs. A. Schematic diagram of ESC treatment regime for identifying FGF/ERK signaling targets. ESCs were grown for 3 days in serum/LIF medium with the MEK inhibitor PD0325901 (MEKi) and then released into inhibitor-free medium. Samples were collected 0, 2, 4, 6 and 8 hours after MEKi removal (indicated by red arrows) for qRT-PCR analysis. B. qRT-PCR data showing mRNA levels of FGF/ERK target genes in ESCs after treatment described in (A). Graph shows mean +/− SD of relative mRNA levels normalized to Ppia housekeeping gene expression from 2 ( Spry2 , Dusp6 )or 3 (all other genes) independent experiments. C. Schematic representation of the Spry4 H2B-Venus targeting strategy. A reporter cassette encoding the H2B-Venus fluorophore preceded by an Engrailed 2 ( En2 ) intron and followed by a neomycin resistance cassette (NEO) was targeted immediately upstream of the second, ATG-containing exon of the Spry4 locus. Boxes denote exons (Ex1 and Ex2) with non-coding UTR shown as white boxes and open reading frame coding sequence as black boxes, triangles denote loxP sites (black) and Rox site (gray) that enable removal of coding exon and NEO, respectively. Open triangle indicates position of an FRT site from the original EUCOMM vector design. ATG, start codon; TAG, stop codon; pA, single polyadenylation sequences. Red bars and arrows indicate PCR amplicons and primers used to identify correctly targeted alleles. Distances within the diagram are not drawn to scale. D. Representative image of the Spry4 H2B-Venus reporter imaged live in ESCs. Nuclei were stained with SiR-Hoechst (Spirochrome). E. Venus expression and POU5F1 (OCT3/4) and NANOG immunofluorescence staining of reporter-bearing ESCs grown in serum/LIF. Note the heterogeneous expression of NANOG and the Venus reporter, in contrast to the homogeneously expressed POU5F1. Scale bars, 20 μm.

Article Snippet: The targeting construct was introduced into cells by electroporation, and correct targeting to the Spry4 locus was determined by long-range PCR amplification of the 5’ and 3’ arm junctions using the LongAmp Taq PCR Kit (NEB, #e5200) and the following primers: Spry4_GF3 (GACATGCTCACCTTCAACTTGGA) with R1RN_rev (TGATATCGTGGTATCGTTATGCGCCT) to detect the 5’ arm junction (correctly targeted: 6.7kb product); Spry4_GR3 (CTCCTGCTTAATGCGTCCAGATG) with LRPCR_neoR_fwd (GGGATCTCATGCTGGAGTTC) to detect the 3’ arm junction (correctly targeted: 7.5 kb product).

Techniques: Quantitative RT-PCR, Expressing, Sequencing, Plasmid Preparation, Polymerase Chain Reaction, Staining, Immunofluorescence

Journal: JIMD Reports

Article Title: Mitochondrial DNA Depletion and Deletions in Paediatric Patients with Neuromuscular Diseases: Novel Phenotypes

doi: 10.1007/8904_2015_438

Figure Lengend Snippet: Long-range PCR of muscle DNA. ( a ) Lane 1, patient 4 presenting with Kearns-Sayre/Pearson-like syndrome; lane 2, a positive control for mtDNA deletions. Intact 16.6 kb mtDNA is marked with a black arrow . ( b ) Lanes 1 and 8, 5-year-old healthy control; lanes 2–5, patient samples with unspecific deletion bands; lane 6, Patient 5 presenting with a single large-scale deletion with no intact 16.6 kb mtDNA band. In addition, smaller deletion bands are visible signifying multiple mtDNA deletions; lane 7, a patient sample with unspecific 0.5 kb band

Article Snippet: Deletions of mitochondrial DNA were detected by long-range PCR (XL-PCR) amplification of mtDNA using Phusion DNA polymerase (New England Biolabs, Ipswich, MA, USA).

Techniques: Polymerase Chain Reaction, Positive Control