long range pcr  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Phusion High Fidelity DNA Polymerase
    Description:
    Phusion High Fidelity DNA Polymerase 500 units
    Catalog Number:
    m0530l
    Price:
    446
    Size:
    500 units
    Category:
    Thermostable DNA Polymerases
    Buy from Supplier


    Structured Review

    New England Biolabs long range pcr
    Phusion High Fidelity DNA Polymerase
    Phusion High Fidelity DNA Polymerase 500 units
    https://www.bioz.com/result/long range pcr/product/New England Biolabs
    Average 99 stars, based on 44 article reviews
    Price from $9.99 to $1999.99
    long range pcr - by Bioz Stars, 2020-08
    99/100 stars

    Images

    1) Product Images from "Phenotype and function of B cells and dendritic cells from interferon regulatory factor 5-deficient mice with and without a mutation in DOCK2"

    Article Title: Phenotype and function of B cells and dendritic cells from interferon regulatory factor 5-deficient mice with and without a mutation in DOCK2

    Journal: International Immunology

    doi: 10.1093/intimm/dxs114

    A DOCK2 mutation is detected in IRF5 −/− mice backcrossed 11 generations to C57BL/6 ( IRF5 −/− 11G) mice but not in IRF5 −/− mice backcrossed 15 generations to C57BL/6 ( IRF5 −/− 15G). (A) RT–PCR to detect the DOCK2 mutation (DOCK2mu). RNA was purified from splenic B cells of wild-type C57BL/6 mice from The Jackson Laboratory (Jackson wild-type), IRF5 +/+ and IRF5 −/− 15G littermates and IRF5 −/− ). Primers used in the left-hand gel give a 577-bp product for the DOCK2 mutation and a 383-bp product for wild-type DOCK2. Primers used in the right-hand gel give a 158-bp product for the DOCK2 mutation and do not amplify wild-type DOCK2. (B) The diagram shows the hypothesized differences in genomic DOCK2 DNA between wild-type and DOCK2 mutant IRF5 −/− mice. In the DOCK2 mutant mice, the duplicated exon 28 and 29 together with some flanking DNA is inserted into the intron between exons 27 and 28. The gel shows a PCR performed using a forward primer, which recognizes exon 29 (Ex29F2) and 27 reverse primers (R1-R26 or Ex28R2), which detect the region in the intron between exons 27 and 28 that is closest to exon 28. PCR products were obtained with the R23–R25 primers. IRF5 −/− 11G genomic DNA containing the DOCK2 mutation was used as the template. (C) PCR was performed using the R23 reverse primer and 10 forward primers, which recognize either exon 29 (Ex29F2) or the intron between exons 29 and 30 (In\.1F to In29.9F). (D) DNA sequence of the 3′-end of DOCK2 mutation. The shaded region is the duplicated intronic sequence between exons 29 and 30, and the unshaded region is the non-duplicated intron between exons 27 and 28. (E) Diagram of the DOCK2 mutation. The duplicated segment of the DOCK2 gene present in the DOCK2 mutation ends at 3991bp after exon 29. This duplicated segment is inserted into intron 27–28 at 17 306bp before exon 28. (F) PCR to detect the DOCK2 mutation. Genomic DNA from IRF5 −/− 11G mice gave a PCR product for the DOCK2 mutation (305bp), whereas DNA from IRF5 +/+ and IRF5 −/− 15G littermates did not. CD19 PCR was used as an internal control to verify the adequacy of DNA preparation in each sample.
    Figure Legend Snippet: A DOCK2 mutation is detected in IRF5 −/− mice backcrossed 11 generations to C57BL/6 ( IRF5 −/− 11G) mice but not in IRF5 −/− mice backcrossed 15 generations to C57BL/6 ( IRF5 −/− 15G). (A) RT–PCR to detect the DOCK2 mutation (DOCK2mu). RNA was purified from splenic B cells of wild-type C57BL/6 mice from The Jackson Laboratory (Jackson wild-type), IRF5 +/+ and IRF5 −/− 15G littermates and IRF5 −/− ). Primers used in the left-hand gel give a 577-bp product for the DOCK2 mutation and a 383-bp product for wild-type DOCK2. Primers used in the right-hand gel give a 158-bp product for the DOCK2 mutation and do not amplify wild-type DOCK2. (B) The diagram shows the hypothesized differences in genomic DOCK2 DNA between wild-type and DOCK2 mutant IRF5 −/− mice. In the DOCK2 mutant mice, the duplicated exon 28 and 29 together with some flanking DNA is inserted into the intron between exons 27 and 28. The gel shows a PCR performed using a forward primer, which recognizes exon 29 (Ex29F2) and 27 reverse primers (R1-R26 or Ex28R2), which detect the region in the intron between exons 27 and 28 that is closest to exon 28. PCR products were obtained with the R23–R25 primers. IRF5 −/− 11G genomic DNA containing the DOCK2 mutation was used as the template. (C) PCR was performed using the R23 reverse primer and 10 forward primers, which recognize either exon 29 (Ex29F2) or the intron between exons 29 and 30 (In\.1F to In29.9F). (D) DNA sequence of the 3′-end of DOCK2 mutation. The shaded region is the duplicated intronic sequence between exons 29 and 30, and the unshaded region is the non-duplicated intron between exons 27 and 28. (E) Diagram of the DOCK2 mutation. The duplicated segment of the DOCK2 gene present in the DOCK2 mutation ends at 3991bp after exon 29. This duplicated segment is inserted into intron 27–28 at 17 306bp before exon 28. (F) PCR to detect the DOCK2 mutation. Genomic DNA from IRF5 −/− 11G mice gave a PCR product for the DOCK2 mutation (305bp), whereas DNA from IRF5 +/+ and IRF5 −/− 15G littermates did not. CD19 PCR was used as an internal control to verify the adequacy of DNA preparation in each sample.

    Techniques Used: Mutagenesis, Mouse Assay, Reverse Transcription Polymerase Chain Reaction, Purification, Polymerase Chain Reaction, Sequencing

    2) Product Images from "Structural variation and missense mutation in SBDS associated with Shwachman-Diamond syndrome"

    Article Title: Structural variation and missense mutation in SBDS associated with Shwachman-Diamond syndrome

    Journal: BMC Medical Genetics

    doi: 10.1186/1471-2350-15-64

    Additional studies of the genomic segment that includes SBDS supports the presence of an insertion of unknown origin within the paternal allele. a . Agarose gel analysis of a 13.1 kb long-range PCR product spanning SBDS and flanking region, the region targeted by the Southern blotting studies (Figures 2 and 3 ). DNA from patient (BAB3762), parents (BAB3763- mother, BAB3764-father) and a normal controls (CTL1 and CTL2) were amplified using primers DelFb + KpnR, and then digested with either Kpn I or Sac I. Kpn I did not digest the 13.1 kb PCR product, consistent with lack of amplification of the paternal allele. Consistently, Sac I digestion of the 13.1 kb PCR product showed an identical pattern in samples and controls. b . Sanger sequencing of intron 2 amplified along with exon 2 using short range PCR revealed inconsistent segregation of a paternal genotype for two polymorphic SNPs in the patient (BAB3762). *Non-digested PCR product.
    Figure Legend Snippet: Additional studies of the genomic segment that includes SBDS supports the presence of an insertion of unknown origin within the paternal allele. a . Agarose gel analysis of a 13.1 kb long-range PCR product spanning SBDS and flanking region, the region targeted by the Southern blotting studies (Figures 2 and 3 ). DNA from patient (BAB3762), parents (BAB3763- mother, BAB3764-father) and a normal controls (CTL1 and CTL2) were amplified using primers DelFb + KpnR, and then digested with either Kpn I or Sac I. Kpn I did not digest the 13.1 kb PCR product, consistent with lack of amplification of the paternal allele. Consistently, Sac I digestion of the 13.1 kb PCR product showed an identical pattern in samples and controls. b . Sanger sequencing of intron 2 amplified along with exon 2 using short range PCR revealed inconsistent segregation of a paternal genotype for two polymorphic SNPs in the patient (BAB3762). *Non-digested PCR product.

    Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Southern Blot, Amplification, Sequencing

    3) Product Images from "piggyBac as a high-capacity transgenesis and gene-therapy vector in human cells and mice"

    Article Title: piggyBac as a high-capacity transgenesis and gene-therapy vector in human cells and mice

    Journal: Disease Models & Mechanisms

    doi: 10.1242/dmm.010827

    PB -mediated BAC transgene expression in mice. (A) RT-PCR analysis showed RORγ but not RORγt expression in the liver, kidney and muscle of wild-type (WT) and transgenic mice. (B) Quantitative real-time PCR with tail genomic DNA revealed different copy numbers of PB[BAC] in each of the the transgenic lines. (C) Real-time RT-PCR showed elevated RORγt expression in the thymus of transgenic animals. (D,E) Similar levels of increased RORγ expression were also observed in the kidney (D) and liver (E). All samples were taken from 20-day-old mice. Line numbers are indicated. *** P
    Figure Legend Snippet: PB -mediated BAC transgene expression in mice. (A) RT-PCR analysis showed RORγ but not RORγt expression in the liver, kidney and muscle of wild-type (WT) and transgenic mice. (B) Quantitative real-time PCR with tail genomic DNA revealed different copy numbers of PB[BAC] in each of the the transgenic lines. (C) Real-time RT-PCR showed elevated RORγt expression in the thymus of transgenic animals. (D,E) Similar levels of increased RORγ expression were also observed in the kidney (D) and liver (E). All samples were taken from 20-day-old mice. Line numbers are indicated. *** P

    Techniques Used: BAC Assay, Expressing, Mouse Assay, Reverse Transcription Polymerase Chain Reaction, Transgenic Assay, Real-time Polymerase Chain Reaction, Quantitative RT-PCR

    Molecular analysis of PB[BAC] insertions in human 293 cells. (A–F) Inverse PCR with primers PBLinvB1 and PBLinvF1 (A) recovered single insertions in most of the clones (B). The insertion sites were confirmed by genotyping PCR using pairs of primers targeting both flanking genomic sequences (G-RL or G-RB) and PB terminal sequences (PBL-B or PBR-F), as shown in panel C. Integrity of PB[BAC] transgenes was analyzed by PCR using ten primer pairs evenly spaced along the BAC insert (fragments 1–10 in panel D). Two clones showed all positive results (E) and were further examined by long-range PCR using 21 pairs of overlapping primers covering the full length (fragments A–U in panel D), as shown in panel F and supplementary material Fig. S2 . M, 1 kb ladder; +, positive control with PB[BAC] as the template, −, negative control with 293 genomic DNA as the template; stars mark location of SNPs used to verify BAC integrity in transgenic mice.
    Figure Legend Snippet: Molecular analysis of PB[BAC] insertions in human 293 cells. (A–F) Inverse PCR with primers PBLinvB1 and PBLinvF1 (A) recovered single insertions in most of the clones (B). The insertion sites were confirmed by genotyping PCR using pairs of primers targeting both flanking genomic sequences (G-RL or G-RB) and PB terminal sequences (PBL-B or PBR-F), as shown in panel C. Integrity of PB[BAC] transgenes was analyzed by PCR using ten primer pairs evenly spaced along the BAC insert (fragments 1–10 in panel D). Two clones showed all positive results (E) and were further examined by long-range PCR using 21 pairs of overlapping primers covering the full length (fragments A–U in panel D), as shown in panel F and supplementary material Fig. S2 . M, 1 kb ladder; +, positive control with PB[BAC] as the template, −, negative control with 293 genomic DNA as the template; stars mark location of SNPs used to verify BAC integrity in transgenic mice.

    Techniques Used: BAC Assay, Inverse PCR, Polymerase Chain Reaction, Genomic Sequencing, Clone Assay, Positive Control, Negative Control, Transgenic Assay, Mouse Assay

    4) Product Images from "Removal of Integrated Hepatitis B Virus DNA Using CRISPR-Cas9"

    Article Title: Removal of Integrated Hepatitis B Virus DNA Using CRISPR-Cas9

    Journal: Frontiers in Cellular and Infection Microbiology

    doi: 10.3389/fcimb.2017.00091

    Analysis of integrated HBV DNA in the stable HBV cell line A64. (A) Integrated HBV DNA in the stable HBV A64 cell line and the gRNA target sites in the repeat region of the 1.1 HBV genome copy. (B) The 4,049-bp DNA fragment representing the 3,362-bp integrated HBV DNA (1.1 copies) plus a 687-bp pTriexHBV1.1-derived flanking sequence was efficiently amplified from cellular genomic DNA using the integrated HBV-specific primers P1 and P2. (C) PCR analysis using the A1AT and HBV S-gene primer sets conducted on total genomic DNA and circular duplex DNA to assess the effect of extraction on circular duplex DNA. (D) PCR analysis of the integrated HBV DNA or circular duplex DNA isolated from cells using the P1/P3 and S-gene primer sets. Using P1 and the HBV core region-specific primer P3, the HBV S-gene amplicons were predicted to be 542- and 572-bp, respectively. Primers P1/P3 did not amplify circular duplex DNA.
    Figure Legend Snippet: Analysis of integrated HBV DNA in the stable HBV cell line A64. (A) Integrated HBV DNA in the stable HBV A64 cell line and the gRNA target sites in the repeat region of the 1.1 HBV genome copy. (B) The 4,049-bp DNA fragment representing the 3,362-bp integrated HBV DNA (1.1 copies) plus a 687-bp pTriexHBV1.1-derived flanking sequence was efficiently amplified from cellular genomic DNA using the integrated HBV-specific primers P1 and P2. (C) PCR analysis using the A1AT and HBV S-gene primer sets conducted on total genomic DNA and circular duplex DNA to assess the effect of extraction on circular duplex DNA. (D) PCR analysis of the integrated HBV DNA or circular duplex DNA isolated from cells using the P1/P3 and S-gene primer sets. Using P1 and the HBV core region-specific primer P3, the HBV S-gene amplicons were predicted to be 542- and 572-bp, respectively. Primers P1/P3 did not amplify circular duplex DNA.

    Techniques Used: Derivative Assay, Sequencing, Amplification, Polymerase Chain Reaction, Isolation

    CRISPR-Cas9/gRNA-69 efficiently removed the integrated HBV genome from a stable HBV cell line. (A) Analysis of PCR amplicon lengths using a primer pair (P1 and P2) targeting the integrated HBV-flanking sequence revealed elimination of the full-length integrated HBV genome (3,173-bp), leaving one fragment (873-bp predicted segment from its flanking region). (B) Diagram showing excision of the full-length integrated HBV genome. The remaining fragment included the expected 687-bp from the integrated HBV flanking sequence and a 186-bp HBV repeat core region sequence. (C) Sanger sequencing of the remaining fragment (873-bp) showing the HBV flanking sequence (small letters, 687-bp) and the partial sequences (189 − 3 = 186-bp) of the integrated HBV repeat region B (green) and repeat region A (red) with a 3-bp deletion around the gRNA-69 targeting site (yellow-highlighted). Elimination of the full-length integrated HBV genome is indicated by a strikethrough. (D,E) The amounts of HBeAg, HBsAg and HBV DNA in cell culture supernatants and HBV cccDNA in the gRNA-empty-treated group (K-15) and gRNA-69-treated group (69-7) over 300 consecutive days. The HBsAg and HBeAg test results in the gRNA-69-treated group (69-7) were always under the negative threshold (0.05 IU/ml for HBsAg and 1 S/CO for HBeAg), and the amounts of HBV DNA and HBV cccDNA in the supernatants were always undetectable (
    Figure Legend Snippet: CRISPR-Cas9/gRNA-69 efficiently removed the integrated HBV genome from a stable HBV cell line. (A) Analysis of PCR amplicon lengths using a primer pair (P1 and P2) targeting the integrated HBV-flanking sequence revealed elimination of the full-length integrated HBV genome (3,173-bp), leaving one fragment (873-bp predicted segment from its flanking region). (B) Diagram showing excision of the full-length integrated HBV genome. The remaining fragment included the expected 687-bp from the integrated HBV flanking sequence and a 186-bp HBV repeat core region sequence. (C) Sanger sequencing of the remaining fragment (873-bp) showing the HBV flanking sequence (small letters, 687-bp) and the partial sequences (189 − 3 = 186-bp) of the integrated HBV repeat region B (green) and repeat region A (red) with a 3-bp deletion around the gRNA-69 targeting site (yellow-highlighted). Elimination of the full-length integrated HBV genome is indicated by a strikethrough. (D,E) The amounts of HBeAg, HBsAg and HBV DNA in cell culture supernatants and HBV cccDNA in the gRNA-empty-treated group (K-15) and gRNA-69-treated group (69-7) over 300 consecutive days. The HBsAg and HBeAg test results in the gRNA-69-treated group (69-7) were always under the negative threshold (0.05 IU/ml for HBsAg and 1 S/CO for HBeAg), and the amounts of HBV DNA and HBV cccDNA in the supernatants were always undetectable (

    Techniques Used: CRISPR, Polymerase Chain Reaction, Amplification, Sequencing, Cell Culture

    Related Articles

    Sequencing:

    Article Title: Deep Sequencing for Evaluation of Genetic Stability of Influenza A/California/07/2009 (H1N1) Vaccine Viruses
    Article Snippet: .. This result demonstrated that adequate distribution of sequencing reads between segments were obtained from a DNA library prepared from samples amplified by Phusion DNA polymerase (DNA library), and by whole-RNA library. .. Consistency of Illumina sequencing, and sequencing analysis of A/PR/8/34 and A/California/07/2009 strains Center for Biologics Evaluation and Research (CBER) stock of A/PR/8/34 was kindly provided by Dr. Peter Palese at Mount.

    Article Title: Demonstration of the Presence of the “Deleted” MIR122 Gene in HepG2 Cells
    Article Snippet: .. Such changes were still observed after amplification with Phusion High Fidelity DNA Polymerase, with 3/15 (20%) of single allele clones obtained from HepG2 and Huh-7 DNA showing apparent poly(T) slippage and also four sequence variants observed that were not seen in other clones of the same haplotype ( ). .. Overall, despite this sequence heterogeneity, the polymorphisms confirmed two different haplotypes in HepG2 DNA, consistent with the presence of two alleles of the pre-mir-122 stem-loop region.

    Clone Assay:

    Article Title: Demonstration of the Presence of the “Deleted” MIR122 Gene in HepG2 Cells
    Article Snippet: .. Such changes were still observed after amplification with Phusion High Fidelity DNA Polymerase, with 3/15 (20%) of single allele clones obtained from HepG2 and Huh-7 DNA showing apparent poly(T) slippage and also four sequence variants observed that were not seen in other clones of the same haplotype ( ). .. Overall, despite this sequence heterogeneity, the polymorphisms confirmed two different haplotypes in HepG2 DNA, consistent with the presence of two alleles of the pre-mir-122 stem-loop region.

    Amplification:

    Article Title: Deep Sequencing for Evaluation of Genetic Stability of Influenza A/California/07/2009 (H1N1) Vaccine Viruses
    Article Snippet: .. This result demonstrated that adequate distribution of sequencing reads between segments were obtained from a DNA library prepared from samples amplified by Phusion DNA polymerase (DNA library), and by whole-RNA library. .. Consistency of Illumina sequencing, and sequencing analysis of A/PR/8/34 and A/California/07/2009 strains Center for Biologics Evaluation and Research (CBER) stock of A/PR/8/34 was kindly provided by Dr. Peter Palese at Mount.

    Article Title: Demonstration of the Presence of the “Deleted” MIR122 Gene in HepG2 Cells
    Article Snippet: .. Such changes were still observed after amplification with Phusion High Fidelity DNA Polymerase, with 3/15 (20%) of single allele clones obtained from HepG2 and Huh-7 DNA showing apparent poly(T) slippage and also four sequence variants observed that were not seen in other clones of the same haplotype ( ). .. Overall, despite this sequence heterogeneity, the polymorphisms confirmed two different haplotypes in HepG2 DNA, consistent with the presence of two alleles of the pre-mir-122 stem-loop region.

    Article Title: Fast and Reliable PCR Amplification from Aspergillus fumigatus Spore Suspension Without Traditional DNA Extraction). Fast and reliable PCR amplification from Aspergillus fumigatus spore suspension without traditional DNA extraction
    Article Snippet: .. Successful PCR amplification has also been obtained with a Phusion High‐Fidelity DNA polymerase (New England Biolabs; M0530; see Fig. A). .. This polymerase was tested in the following PCR conditions for PCR products of ∼1.2 kb: 1 cycle at 98°C for 30 s followed by 35 cycles of 98°C for 10 s, 58°C for 20 s, 72°C for 45 s, and finally 1 cycle of 72°C for 5 min. 8 Following the PCR, mix 5 µl of the PCR reaction with 1 µl of 6× DNA loading dye and load the reactions on an agarose gel (Voytas, ).

    DNA Purification:

    Article Title: Enzymatic Synthesis of Modified Oligonucleotides by PEAR Using Phusion and KOD DNA Polymerases
    Article Snippet: .. Four 2′-fluoro-2′-deoxyribinucleoside-5′-triphosphates (2′-F-dNTPs), including 2′-F-dATP, 2′-F-dCTP, 2′-F-dGTP, 2′-F-dUTP and four 2′-deoxyribonucleotides-5′-O-(1-thiotriphosphate) (dNTPαSs), including dATPαS, dGTPαS, dCTPαS, and dTTPαS, whose structural formula are shown in , were purchased from Trilink BioTechnologies, Inc. KOD DNA polymerase was purchased from TOYOBO (Shanghai) Biotech Co., Ltd. Phusion DNA polymerase, highly thermostable restriction enzyme PspGI, and dNTPs were purchased from New England Biolabs, Inc. UNIQ-10 Spin Column Oligo DNA Purification Kit was purchased from Sangon Biotech (Shanghai) Co., Ltd. .. Synthetic oligodeoxynucleotides, including a target ( X ) and a probe ( P ), were synthesized by Integrated DNA Technologies, Inc. and purified by high-performance liquid chromatography (HPLC).

    Polymerase Chain Reaction:

    Article Title: Variations of five eIF4E genes across cassava accessions exhibiting tolerant and susceptible responses to cassava brown streak disease
    Article Snippet: .. PCR was performed in a 20 μl reaction volume containing 10 unit Phusion DNA polymerase (NEB, Ipswich, MA), 1 μl of 1:5 diluted cDNA template, 1X Phusion PCR buffer, 5 μM each of upstream and downstream primers, and 250 nM dNTP with the following cycling condition: 98°C for 1 minute; 35 cycles of 98°C for 15 seconds, 56°C for 15 seconds, and 72°C for 45 seconds; and finally 72°C for 5 minutes. .. Primers were designed according to five annotated eIF4E transcripts identified in the draft cassava genomic sequence (Manihot esculenta v4.1) published in Phytozome ( http://phytozome.jgi.doe.gov ) in 2013, prior to the availability of the current cassava genome V6.1 ( ).

    Article Title: Fast and Reliable PCR Amplification from Aspergillus fumigatus Spore Suspension Without Traditional DNA Extraction). Fast and reliable PCR amplification from Aspergillus fumigatus spore suspension without traditional DNA extraction
    Article Snippet: .. Successful PCR amplification has also been obtained with a Phusion High‐Fidelity DNA polymerase (New England Biolabs; M0530; see Fig. A). .. This polymerase was tested in the following PCR conditions for PCR products of ∼1.2 kb: 1 cycle at 98°C for 30 s followed by 35 cycles of 98°C for 10 s, 58°C for 20 s, 72°C for 45 s, and finally 1 cycle of 72°C for 5 min. 8 Following the PCR, mix 5 µl of the PCR reaction with 1 µl of 6× DNA loading dye and load the reactions on an agarose gel (Voytas, ).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    New England Biolabs long range pcr
    A DOCK2 mutation is detected in IRF5 −/− mice backcrossed 11 generations to C57BL/6 ( IRF5 −/− 11G) mice but not in IRF5 −/− mice backcrossed 15 generations to C57BL/6 ( IRF5 −/− 15G). (A) <t>RT–PCR</t> to detect the DOCK2 mutation (DOCK2mu). RNA was purified from splenic B cells of wild-type C57BL/6 mice from The Jackson Laboratory (Jackson wild-type), IRF5 +/+ and IRF5 −/− 15G littermates and IRF5 −/− ). Primers used in the left-hand gel give a 577-bp product for the DOCK2 mutation and a 383-bp product for wild-type DOCK2. Primers used in the right-hand gel give a 158-bp product for the DOCK2 mutation and do not amplify wild-type DOCK2. (B) The diagram shows the hypothesized differences in genomic DOCK2 <t>DNA</t> between wild-type and DOCK2 mutant IRF5 −/− mice. In the DOCK2 mutant mice, the duplicated exon 28 and 29 together with some flanking DNA is inserted into the intron between exons 27 and 28. The gel shows a PCR performed using a forward primer, which recognizes exon 29 (Ex29F2) and 27 reverse primers (R1-R26 or Ex28R2), which detect the region in the intron between exons 27 and 28 that is closest to exon 28. PCR products were obtained with the R23–R25 primers. IRF5 −/− 11G genomic DNA containing the DOCK2 mutation was used as the template. (C) PCR was performed using the R23 reverse primer and 10 forward primers, which recognize either exon 29 (Ex29F2) or the intron between exons 29 and 30 (In\.1F to In29.9F). (D) DNA sequence of the 3′-end of DOCK2 mutation. The shaded region is the duplicated intronic sequence between exons 29 and 30, and the unshaded region is the non-duplicated intron between exons 27 and 28. (E) Diagram of the DOCK2 mutation. The duplicated segment of the DOCK2 gene present in the DOCK2 mutation ends at 3991bp after exon 29. This duplicated segment is inserted into intron 27–28 at 17 306bp before exon 28. (F) PCR to detect the DOCK2 mutation. Genomic DNA from IRF5 −/− 11G mice gave a PCR product for the DOCK2 mutation (305bp), whereas DNA from IRF5 +/+ and IRF5 −/− 15G littermates did not. CD19 PCR was used as an internal control to verify the adequacy of DNA preparation in each sample.
    Long Range Pcr, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 92/100, based on 44 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/long range pcr/product/New England Biolabs
    Average 92 stars, based on 44 article reviews
    Price from $9.99 to $1999.99
    long range pcr - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    89
    New England Biolabs long range pcr amplification
    Developing a fluorescent reporter for the FGF/ERK target <t>Spry4</t> in mouse ESCs. A. Schematic diagram of ESC treatment regime for identifying FGF/ERK signaling targets. ESCs were grown for 3 days in serum/LIF medium with the MEK inhibitor PD0325901 (MEKi) and then released into inhibitor-free medium. Samples were collected 0, 2, 4, 6 and 8 hours after MEKi removal (indicated by red arrows) for <t>qRT-PCR</t> analysis. B. qRT-PCR data showing mRNA levels of FGF/ERK target genes in ESCs after treatment described in (A). Graph shows mean +/− SD of relative mRNA levels normalized to Ppia housekeeping gene expression from 2 ( Spry2 , Dusp6 )or 3 (all other genes) independent experiments. C. Schematic representation of the Spry4 H2B-Venus targeting strategy. A reporter cassette encoding the H2B-Venus fluorophore preceded by an Engrailed 2 ( En2 ) intron and followed by a neomycin resistance cassette (NEO) was targeted immediately upstream of the second, ATG-containing exon of the Spry4 locus. Boxes denote exons (Ex1 and Ex2) with non-coding UTR shown as white boxes and open reading frame coding sequence as black boxes, triangles denote loxP sites (black) and Rox site (gray) that enable removal of coding exon and NEO, respectively. Open triangle indicates position of an FRT site from the original EUCOMM vector design. ATG, start codon; TAG, stop codon; pA, single polyadenylation sequences. Red bars and arrows indicate PCR amplicons and primers used to identify correctly targeted alleles. Distances within the diagram are not drawn to scale. D. Representative image of the Spry4 H2B-Venus reporter imaged live in ESCs. Nuclei were stained with SiR-Hoechst (Spirochrome). E. Venus expression and POU5F1 (OCT3/4) and NANOG immunofluorescence staining of reporter-bearing ESCs grown in serum/LIF. Note the heterogeneous expression of NANOG and the Venus reporter, in contrast to the homogeneously expressed POU5F1. Scale bars, 20 μm.
    Long Range Pcr Amplification, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 89/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/long range pcr amplification/product/New England Biolabs
    Average 89 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    long range pcr amplification - by Bioz Stars, 2020-08
    89/100 stars
      Buy from Supplier

    Image Search Results


    A DOCK2 mutation is detected in IRF5 −/− mice backcrossed 11 generations to C57BL/6 ( IRF5 −/− 11G) mice but not in IRF5 −/− mice backcrossed 15 generations to C57BL/6 ( IRF5 −/− 15G). (A) RT–PCR to detect the DOCK2 mutation (DOCK2mu). RNA was purified from splenic B cells of wild-type C57BL/6 mice from The Jackson Laboratory (Jackson wild-type), IRF5 +/+ and IRF5 −/− 15G littermates and IRF5 −/− ). Primers used in the left-hand gel give a 577-bp product for the DOCK2 mutation and a 383-bp product for wild-type DOCK2. Primers used in the right-hand gel give a 158-bp product for the DOCK2 mutation and do not amplify wild-type DOCK2. (B) The diagram shows the hypothesized differences in genomic DOCK2 DNA between wild-type and DOCK2 mutant IRF5 −/− mice. In the DOCK2 mutant mice, the duplicated exon 28 and 29 together with some flanking DNA is inserted into the intron between exons 27 and 28. The gel shows a PCR performed using a forward primer, which recognizes exon 29 (Ex29F2) and 27 reverse primers (R1-R26 or Ex28R2), which detect the region in the intron between exons 27 and 28 that is closest to exon 28. PCR products were obtained with the R23–R25 primers. IRF5 −/− 11G genomic DNA containing the DOCK2 mutation was used as the template. (C) PCR was performed using the R23 reverse primer and 10 forward primers, which recognize either exon 29 (Ex29F2) or the intron between exons 29 and 30 (In\.1F to In29.9F). (D) DNA sequence of the 3′-end of DOCK2 mutation. The shaded region is the duplicated intronic sequence between exons 29 and 30, and the unshaded region is the non-duplicated intron between exons 27 and 28. (E) Diagram of the DOCK2 mutation. The duplicated segment of the DOCK2 gene present in the DOCK2 mutation ends at 3991bp after exon 29. This duplicated segment is inserted into intron 27–28 at 17 306bp before exon 28. (F) PCR to detect the DOCK2 mutation. Genomic DNA from IRF5 −/− 11G mice gave a PCR product for the DOCK2 mutation (305bp), whereas DNA from IRF5 +/+ and IRF5 −/− 15G littermates did not. CD19 PCR was used as an internal control to verify the adequacy of DNA preparation in each sample.

    Journal: International Immunology

    Article Title: Phenotype and function of B cells and dendritic cells from interferon regulatory factor 5-deficient mice with and without a mutation in DOCK2

    doi: 10.1093/intimm/dxs114

    Figure Lengend Snippet: A DOCK2 mutation is detected in IRF5 −/− mice backcrossed 11 generations to C57BL/6 ( IRF5 −/− 11G) mice but not in IRF5 −/− mice backcrossed 15 generations to C57BL/6 ( IRF5 −/− 15G). (A) RT–PCR to detect the DOCK2 mutation (DOCK2mu). RNA was purified from splenic B cells of wild-type C57BL/6 mice from The Jackson Laboratory (Jackson wild-type), IRF5 +/+ and IRF5 −/− 15G littermates and IRF5 −/− ). Primers used in the left-hand gel give a 577-bp product for the DOCK2 mutation and a 383-bp product for wild-type DOCK2. Primers used in the right-hand gel give a 158-bp product for the DOCK2 mutation and do not amplify wild-type DOCK2. (B) The diagram shows the hypothesized differences in genomic DOCK2 DNA between wild-type and DOCK2 mutant IRF5 −/− mice. In the DOCK2 mutant mice, the duplicated exon 28 and 29 together with some flanking DNA is inserted into the intron between exons 27 and 28. The gel shows a PCR performed using a forward primer, which recognizes exon 29 (Ex29F2) and 27 reverse primers (R1-R26 or Ex28R2), which detect the region in the intron between exons 27 and 28 that is closest to exon 28. PCR products were obtained with the R23–R25 primers. IRF5 −/− 11G genomic DNA containing the DOCK2 mutation was used as the template. (C) PCR was performed using the R23 reverse primer and 10 forward primers, which recognize either exon 29 (Ex29F2) or the intron between exons 29 and 30 (In\.1F to In29.9F). (D) DNA sequence of the 3′-end of DOCK2 mutation. The shaded region is the duplicated intronic sequence between exons 29 and 30, and the unshaded region is the non-duplicated intron between exons 27 and 28. (E) Diagram of the DOCK2 mutation. The duplicated segment of the DOCK2 gene present in the DOCK2 mutation ends at 3991bp after exon 29. This duplicated segment is inserted into intron 27–28 at 17 306bp before exon 28. (F) PCR to detect the DOCK2 mutation. Genomic DNA from IRF5 −/− 11G mice gave a PCR product for the DOCK2 mutation (305bp), whereas DNA from IRF5 +/+ and IRF5 −/− 15G littermates did not. CD19 PCR was used as an internal control to verify the adequacy of DNA preparation in each sample.

    Article Snippet: Long-range PCR was performed using LongAmp Taq DNA polymerase (New England BioLabs, Ipswich, MA, USA), which can amplify up to 30kb.

    Techniques: Mutagenesis, Mouse Assay, Reverse Transcription Polymerase Chain Reaction, Purification, Polymerase Chain Reaction, Sequencing

    Additional studies of the genomic segment that includes SBDS supports the presence of an insertion of unknown origin within the paternal allele. a . Agarose gel analysis of a 13.1 kb long-range PCR product spanning SBDS and flanking region, the region targeted by the Southern blotting studies (Figures 2 and 3 ). DNA from patient (BAB3762), parents (BAB3763- mother, BAB3764-father) and a normal controls (CTL1 and CTL2) were amplified using primers DelFb + KpnR, and then digested with either Kpn I or Sac I. Kpn I did not digest the 13.1 kb PCR product, consistent with lack of amplification of the paternal allele. Consistently, Sac I digestion of the 13.1 kb PCR product showed an identical pattern in samples and controls. b . Sanger sequencing of intron 2 amplified along with exon 2 using short range PCR revealed inconsistent segregation of a paternal genotype for two polymorphic SNPs in the patient (BAB3762). *Non-digested PCR product.

    Journal: BMC Medical Genetics

    Article Title: Structural variation and missense mutation in SBDS associated with Shwachman-Diamond syndrome

    doi: 10.1186/1471-2350-15-64

    Figure Lengend Snippet: Additional studies of the genomic segment that includes SBDS supports the presence of an insertion of unknown origin within the paternal allele. a . Agarose gel analysis of a 13.1 kb long-range PCR product spanning SBDS and flanking region, the region targeted by the Southern blotting studies (Figures 2 and 3 ). DNA from patient (BAB3762), parents (BAB3763- mother, BAB3764-father) and a normal controls (CTL1 and CTL2) were amplified using primers DelFb + KpnR, and then digested with either Kpn I or Sac I. Kpn I did not digest the 13.1 kb PCR product, consistent with lack of amplification of the paternal allele. Consistently, Sac I digestion of the 13.1 kb PCR product showed an identical pattern in samples and controls. b . Sanger sequencing of intron 2 amplified along with exon 2 using short range PCR revealed inconsistent segregation of a paternal genotype for two polymorphic SNPs in the patient (BAB3762). *Non-digested PCR product.

    Article Snippet: Long-range PCR products were digested using restriction enzymes Kpn I and Sac I (New England BioLabs, Ipswich, MA) for 2 hours at 37°C, followed by separation on a 1% agarose gel in 0.5X Tris–Borate–EDTA buffer.

    Techniques: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Southern Blot, Amplification, Sequencing

    Developing a fluorescent reporter for the FGF/ERK target Spry4 in mouse ESCs. A. Schematic diagram of ESC treatment regime for identifying FGF/ERK signaling targets. ESCs were grown for 3 days in serum/LIF medium with the MEK inhibitor PD0325901 (MEKi) and then released into inhibitor-free medium. Samples were collected 0, 2, 4, 6 and 8 hours after MEKi removal (indicated by red arrows) for qRT-PCR analysis. B. qRT-PCR data showing mRNA levels of FGF/ERK target genes in ESCs after treatment described in (A). Graph shows mean +/− SD of relative mRNA levels normalized to Ppia housekeeping gene expression from 2 ( Spry2 , Dusp6 )or 3 (all other genes) independent experiments. C. Schematic representation of the Spry4 H2B-Venus targeting strategy. A reporter cassette encoding the H2B-Venus fluorophore preceded by an Engrailed 2 ( En2 ) intron and followed by a neomycin resistance cassette (NEO) was targeted immediately upstream of the second, ATG-containing exon of the Spry4 locus. Boxes denote exons (Ex1 and Ex2) with non-coding UTR shown as white boxes and open reading frame coding sequence as black boxes, triangles denote loxP sites (black) and Rox site (gray) that enable removal of coding exon and NEO, respectively. Open triangle indicates position of an FRT site from the original EUCOMM vector design. ATG, start codon; TAG, stop codon; pA, single polyadenylation sequences. Red bars and arrows indicate PCR amplicons and primers used to identify correctly targeted alleles. Distances within the diagram are not drawn to scale. D. Representative image of the Spry4 H2B-Venus reporter imaged live in ESCs. Nuclei were stained with SiR-Hoechst (Spirochrome). E. Venus expression and POU5F1 (OCT3/4) and NANOG immunofluorescence staining of reporter-bearing ESCs grown in serum/LIF. Note the heterogeneous expression of NANOG and the Venus reporter, in contrast to the homogeneously expressed POU5F1. Scale bars, 20 μm.

    Journal: Developmental biology

    Article Title: A Sprouty4 reporter to monitor FGF/ERK signaling activity in ESCs and mice

    doi: 10.1016/j.ydbio.2018.06.017

    Figure Lengend Snippet: Developing a fluorescent reporter for the FGF/ERK target Spry4 in mouse ESCs. A. Schematic diagram of ESC treatment regime for identifying FGF/ERK signaling targets. ESCs were grown for 3 days in serum/LIF medium with the MEK inhibitor PD0325901 (MEKi) and then released into inhibitor-free medium. Samples were collected 0, 2, 4, 6 and 8 hours after MEKi removal (indicated by red arrows) for qRT-PCR analysis. B. qRT-PCR data showing mRNA levels of FGF/ERK target genes in ESCs after treatment described in (A). Graph shows mean +/− SD of relative mRNA levels normalized to Ppia housekeeping gene expression from 2 ( Spry2 , Dusp6 )or 3 (all other genes) independent experiments. C. Schematic representation of the Spry4 H2B-Venus targeting strategy. A reporter cassette encoding the H2B-Venus fluorophore preceded by an Engrailed 2 ( En2 ) intron and followed by a neomycin resistance cassette (NEO) was targeted immediately upstream of the second, ATG-containing exon of the Spry4 locus. Boxes denote exons (Ex1 and Ex2) with non-coding UTR shown as white boxes and open reading frame coding sequence as black boxes, triangles denote loxP sites (black) and Rox site (gray) that enable removal of coding exon and NEO, respectively. Open triangle indicates position of an FRT site from the original EUCOMM vector design. ATG, start codon; TAG, stop codon; pA, single polyadenylation sequences. Red bars and arrows indicate PCR amplicons and primers used to identify correctly targeted alleles. Distances within the diagram are not drawn to scale. D. Representative image of the Spry4 H2B-Venus reporter imaged live in ESCs. Nuclei were stained with SiR-Hoechst (Spirochrome). E. Venus expression and POU5F1 (OCT3/4) and NANOG immunofluorescence staining of reporter-bearing ESCs grown in serum/LIF. Note the heterogeneous expression of NANOG and the Venus reporter, in contrast to the homogeneously expressed POU5F1. Scale bars, 20 μm.

    Article Snippet: The targeting construct was introduced into cells by electroporation, and correct targeting to the Spry4 locus was determined by long-range PCR amplification of the 5’ and 3’ arm junctions using the LongAmp Taq PCR Kit (NEB, #e5200) and the following primers: Spry4_GF3 (GACATGCTCACCTTCAACTTGGA) with R1RN_rev (TGATATCGTGGTATCGTTATGCGCCT) to detect the 5’ arm junction (correctly targeted: 6.7kb product); Spry4_GR3 (CTCCTGCTTAATGCGTCCAGATG) with LRPCR_neoR_fwd (GGGATCTCATGCTGGAGTTC) to detect the 3’ arm junction (correctly targeted: 7.5 kb product).

    Techniques: Quantitative RT-PCR, Expressing, Sequencing, Plasmid Preparation, Polymerase Chain Reaction, Staining, Immunofluorescence

    Long-range PCR of muscle DNA. ( a ) Lane 1, patient 4 presenting with Kearns-Sayre/Pearson-like syndrome; lane 2, a positive control for mtDNA deletions. Intact 16.6 kb mtDNA is marked with a black arrow . ( b ) Lanes 1 and 8, 5-year-old healthy control; lanes 2–5, patient samples with unspecific deletion bands; lane 6, Patient 5 presenting with a single large-scale deletion with no intact 16.6 kb mtDNA band. In addition, smaller deletion bands are visible signifying multiple mtDNA deletions; lane 7, a patient sample with unspecific 0.5 kb band

    Journal: JIMD Reports

    Article Title: Mitochondrial DNA Depletion and Deletions in Paediatric Patients with Neuromuscular Diseases: Novel Phenotypes

    doi: 10.1007/8904_2015_438

    Figure Lengend Snippet: Long-range PCR of muscle DNA. ( a ) Lane 1, patient 4 presenting with Kearns-Sayre/Pearson-like syndrome; lane 2, a positive control for mtDNA deletions. Intact 16.6 kb mtDNA is marked with a black arrow . ( b ) Lanes 1 and 8, 5-year-old healthy control; lanes 2–5, patient samples with unspecific deletion bands; lane 6, Patient 5 presenting with a single large-scale deletion with no intact 16.6 kb mtDNA band. In addition, smaller deletion bands are visible signifying multiple mtDNA deletions; lane 7, a patient sample with unspecific 0.5 kb band

    Article Snippet: Deletions of mitochondrial DNA were detected by long-range PCR (XL-PCR) amplification of mtDNA using Phusion DNA polymerase (New England Biolabs, Ipswich, MA, USA).

    Techniques: Polymerase Chain Reaction, Positive Control