long range pcr polymerase  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96
    Name:
    Poly A Polymerase
    Description:

    Catalog Number:
    2180A
    Price:
    None
    Category:
    Molecular Biology
    Size:
    20 Units
    Buy from Supplier


    Structured Review

    TaKaRa long range pcr polymerase
    mtDNA deletions and mutations increase when endogenous Parkin is lost in striata of PD-mito- Pst I mice. A , Schematic representation of mouse mtDNA. Scissors indicate the Pst I cleavage sites. Red arrows represent encoded proteins. Gray arrows represent mt-tRNAs. Color-coded representation of the position of the amplicons used for the qPCRs is maintained in the graphs. B , mtDNA levels measured by qPCR of LCM-collected SN TH + neurons ( n = 5/group; T = p value after t test). C , D , Southern blot probing striatal <t>DNA</t> with mtDNA and nuclear DNA probes ( C ) and mtDNA content measured by qPCR ( D ) in 4-month-old animals. E , Quantification by qPCR of full-length mtDNA content in striata of 4-month-old animals. F , Recombination events detected by qPCR using primers flanking the Pst I sites in striatal samples. G , H , Long-range <t>PCR</t> amplification of a 10 kb and a 117 bp fragment from striatal DNA ( G ) and relative quantification of a 10 kb fragment normalized to the 117 bp fragment ( H ). Boxes in graphs B , D , and F represent one individual animal. * p

    https://www.bioz.com/result/long range pcr polymerase/product/TaKaRa
    Average 96 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    long range pcr polymerase - by Bioz Stars, 2021-09
    96/100 stars

    Images

    1) Product Images from "Lack of Parkin Anticipates the Phenotype and Affects Mitochondrial Morphology and mtDNA Levels in a Mouse Model of Parkinson's Disease"

    Article Title: Lack of Parkin Anticipates the Phenotype and Affects Mitochondrial Morphology and mtDNA Levels in a Mouse Model of Parkinson's Disease

    Journal: The Journal of Neuroscience

    doi: 10.1523/JNEUROSCI.1384-17.2017

    mtDNA deletions and mutations increase when endogenous Parkin is lost in striata of PD-mito- Pst I mice. A , Schematic representation of mouse mtDNA. Scissors indicate the Pst I cleavage sites. Red arrows represent encoded proteins. Gray arrows represent mt-tRNAs. Color-coded representation of the position of the amplicons used for the qPCRs is maintained in the graphs. B , mtDNA levels measured by qPCR of LCM-collected SN TH + neurons ( n = 5/group; T = p value after t test). C , D , Southern blot probing striatal DNA with mtDNA and nuclear DNA probes ( C ) and mtDNA content measured by qPCR ( D ) in 4-month-old animals. E , Quantification by qPCR of full-length mtDNA content in striata of 4-month-old animals. F , Recombination events detected by qPCR using primers flanking the Pst I sites in striatal samples. G , H , Long-range PCR amplification of a 10 kb and a 117 bp fragment from striatal DNA ( G ) and relative quantification of a 10 kb fragment normalized to the 117 bp fragment ( H ). Boxes in graphs B , D , and F represent one individual animal. * p
    Figure Legend Snippet: mtDNA deletions and mutations increase when endogenous Parkin is lost in striata of PD-mito- Pst I mice. A , Schematic representation of mouse mtDNA. Scissors indicate the Pst I cleavage sites. Red arrows represent encoded proteins. Gray arrows represent mt-tRNAs. Color-coded representation of the position of the amplicons used for the qPCRs is maintained in the graphs. B , mtDNA levels measured by qPCR of LCM-collected SN TH + neurons ( n = 5/group; T = p value after t test). C , D , Southern blot probing striatal DNA with mtDNA and nuclear DNA probes ( C ) and mtDNA content measured by qPCR ( D ) in 4-month-old animals. E , Quantification by qPCR of full-length mtDNA content in striata of 4-month-old animals. F , Recombination events detected by qPCR using primers flanking the Pst I sites in striatal samples. G , H , Long-range PCR amplification of a 10 kb and a 117 bp fragment from striatal DNA ( G ) and relative quantification of a 10 kb fragment normalized to the 117 bp fragment ( H ). Boxes in graphs B , D , and F represent one individual animal. * p

    Techniques Used: Mouse Assay, Real-time Polymerase Chain Reaction, Laser Capture Microdissection, Southern Blot, Polymerase Chain Reaction, Amplification

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Molecular Detection and Genetic Identification of Rickettsia Infection in Ixodes granulatus Ticks, an Incriminated Vector for Geographical Transmission in Taiwan
    Article Snippet: .. All PCR reagents and Taq polymerase were obtained and used as recommended by the supplier (Takara Shuzo Co., Ltd., Kyoto, Japan). ..

    Article Title: A New Type of Allodiploid Hybrids Derived From Female Megalobrama amblycephala × Male Gobiocypris rarus
    Article Snippet: .. The PCR reactions were performed in a volume of 25 μl with approximately 20 ng of genomic DNA, 1.5 mM MgCl2 , 250 μM of each dNTP, 0.4 μM of each primer, and 1.25 U of Taq polymerase (TaKaRa, Dalian, China). ..

    Article Title: MicroRNAs 21 and 199a-3p Regulate Axon Growth Potential through Modulation of Pten and mTor mRNAs
    Article Snippet: .. Using PCR primers with restriction enzyme sites (EcoRI and SalI), PTEN coding sequence was amplified with high fidelity polymerase (Primer Star HS, Takara) and inserted into pFLAG-CMV2 (Sigma) using EcoRI/SalI sites. ..

    Article Title: Assessment of 16S rRNA Gene-Based Phylogenetic Diversity of Archaeal Communities in Halite-Crystal Salts Processed from Natural Saharan Saline Systems of Southern Tunisia
    Article Snippet: .. PCR reactions were carried out in a final volume of 50 μL containing: 1X buffer (Takara), 1.5 mm MgCl2 , 0.25 mM of each deoxynucleoside triphosphate, 0.3 mM of each primer, and 1 U Taq polymerase (Takara). ..

    Article Title: A 14-Year Italian Experience in DM2 Genetic Testing: Frequency and Distribution of Normal and Premutated CNBP Alleles
    Article Snippet: .. Amplification was carried out in 30 μl volume, containing: 50 ng genomic DNA, PCR reaction buffer (5×), 25 mM MgCl2 , 1.25 mM dNTPs, 70 pmol of each primer, and 1 U of TaKaRa Taq polymerase (Takara Bio). ..

    Sequencing:

    Article Title: MicroRNAs 21 and 199a-3p Regulate Axon Growth Potential through Modulation of Pten and mTor mRNAs
    Article Snippet: .. Using PCR primers with restriction enzyme sites (EcoRI and SalI), PTEN coding sequence was amplified with high fidelity polymerase (Primer Star HS, Takara) and inserted into pFLAG-CMV2 (Sigma) using EcoRI/SalI sites. ..

    Amplification:

    Article Title: MicroRNAs 21 and 199a-3p Regulate Axon Growth Potential through Modulation of Pten and mTor mRNAs
    Article Snippet: .. Using PCR primers with restriction enzyme sites (EcoRI and SalI), PTEN coding sequence was amplified with high fidelity polymerase (Primer Star HS, Takara) and inserted into pFLAG-CMV2 (Sigma) using EcoRI/SalI sites. ..

    Article Title: A 14-Year Italian Experience in DM2 Genetic Testing: Frequency and Distribution of Normal and Premutated CNBP Alleles
    Article Snippet: .. Amplification was carried out in 30 μl volume, containing: 50 ng genomic DNA, PCR reaction buffer (5×), 25 mM MgCl2 , 1.25 mM dNTPs, 70 pmol of each primer, and 1 U of TaKaRa Taq polymerase (Takara Bio). ..

    Synthesized:

    Article Title: Novel Mycoviruses Discovered in the Mycovirome of a Necrotrophic Fungus
    Article Snippet: .. For the 3′ end, RNA was polyadenylated with PolyA polymerase (TaKaRa) and cDNA was synthesized with 3′ RACE adapter (5′- GCGAGCACAGAATTAATACGACTCACTATAGG T12VN-3′). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    TaKaRa range pcr
    Different radio-sensitivity of C . neoformans H99S vs H99 strains and their <t>DNA</t> damage progression after 1 kGy exposure. (A) H99S and H99 cells were cultured in YPD overnight, and then 10-fold serially diluted (10 2 to 10 5 ) in PBS and 3 μL of diluted solution was spotted onto the YPD plates. Cells were exposed to the indicated doses of γ-radiation and then further incubated at 30 ° C for 5 days. Image was from one representative experiment of three independent experiments. (B) (C) DNA damage progression of C . neoformans H99S and H99 cells after 1 kGy γ-radiation measured by mitochondrial DNA and nuclear DNA LR-QPCR, respectively. After radiation, cells were harvested at selected time points and DNA was extracted and <t>PCR</t> was performed using 1 ng DNA and 30 ng DNA for the long mitochondrial DNA fragment and long nuclear DNA fragment respectively. Results were from three independent experiments with triplicate samples in each experiment (3 samples/point/experiment x 3). Mean ± S.E.M. **, p
    Range Pcr, supplied by TaKaRa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/range pcr/product/TaKaRa
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    range pcr - by Bioz Stars, 2021-09
    86/100 stars
      Buy from Supplier

    96
    TaKaRa long range pcr polymerase
    mtDNA deletions and mutations increase when endogenous Parkin is lost in striata of PD-mito- Pst I mice. A , Schematic representation of mouse mtDNA. Scissors indicate the Pst I cleavage sites. Red arrows represent encoded proteins. Gray arrows represent mt-tRNAs. Color-coded representation of the position of the amplicons used for the qPCRs is maintained in the graphs. B , mtDNA levels measured by qPCR of LCM-collected SN TH + neurons ( n = 5/group; T = p value after t test). C , D , Southern blot probing striatal <t>DNA</t> with mtDNA and nuclear DNA probes ( C ) and mtDNA content measured by qPCR ( D ) in 4-month-old animals. E , Quantification by qPCR of full-length mtDNA content in striata of 4-month-old animals. F , Recombination events detected by qPCR using primers flanking the Pst I sites in striatal samples. G , H , Long-range <t>PCR</t> amplification of a 10 kb and a 117 bp fragment from striatal DNA ( G ) and relative quantification of a 10 kb fragment normalized to the 117 bp fragment ( H ). Boxes in graphs B , D , and F represent one individual animal. * p
    Long Range Pcr Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/long range pcr polymerase/product/TaKaRa
    Average 96 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    long range pcr polymerase - by Bioz Stars, 2021-09
    96/100 stars
      Buy from Supplier

    86
    TaKaRa long range pcr
    Structures of the pre- and post-Cre floxed mouse Zip5 gene and integration and genotyping screen designs. ( A ) The mouse Zip5 gene was captured using gap-repair and manipulated using galK recombineering. Exons ( 1–12 ) and the exon encoding transmembrane domain 1 ( TMD1 ) are indicated, as are the positions of LoxP sites (intron 4 and downstream of PGK Neo ), the PGK-neomycin ( PGK Neo ) cassette and the locations of primers used for genotyping. The LoxP site in intron 4 is flanked by an EcoRV restriction enzyme cleavage site. ( B ) The structure of the Zip5 gene after Cre recombination is shown. Recombination eliminates the transmembrane domain of ZIP5. ( C ) The floxed Zip5 gene was targeted into <t>E14</t> ES cells and properly targeted ES cells were identified by long range <t>PCR</t> using flanking and internal primers. PCR products from the wild-type ( Wt ) and floxed ( Fx ) alleles are indicated. EcoRV cleavage was used to differentiate between the floxed and wild-type alleles in the 5′ PCR screen whereas the 3′ PCR screen yielded the predicted larger product from the wild-type allele. Targeted ES cells were used to generate mice homozygous for the floxed Zip5 allele. ( D ) Mice were genotyped by PCR amplification of the intron 4 region containing the LoxP site. The PCR product from homozygous Zip5 floxed mice before Cre-induced recombination is shown in the left lane while that from control mice is shown in the center lane and that from Zip5 -knockout mice ( Ko ) is shown in the right lane . For the intestine- and pancreas-specific knockout mice, detection of Zip5 mRNA and/or protein was employed to monitor the efficacy of recombination.
    Long Range Pcr, supplied by TaKaRa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/long range pcr/product/TaKaRa
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    long range pcr - by Bioz Stars, 2021-09
    86/100 stars
      Buy from Supplier

    Image Search Results


    Different radio-sensitivity of C . neoformans H99S vs H99 strains and their DNA damage progression after 1 kGy exposure. (A) H99S and H99 cells were cultured in YPD overnight, and then 10-fold serially diluted (10 2 to 10 5 ) in PBS and 3 μL of diluted solution was spotted onto the YPD plates. Cells were exposed to the indicated doses of γ-radiation and then further incubated at 30 ° C for 5 days. Image was from one representative experiment of three independent experiments. (B) (C) DNA damage progression of C . neoformans H99S and H99 cells after 1 kGy γ-radiation measured by mitochondrial DNA and nuclear DNA LR-QPCR, respectively. After radiation, cells were harvested at selected time points and DNA was extracted and PCR was performed using 1 ng DNA and 30 ng DNA for the long mitochondrial DNA fragment and long nuclear DNA fragment respectively. Results were from three independent experiments with triplicate samples in each experiment (3 samples/point/experiment x 3). Mean ± S.E.M. **, p

    Journal: PLoS ONE

    Article Title: Measuring radiation-induced DNA damage in Cryptococcus neoformans and Saccharomyces cerevisiae using long range quantitative PCR

    doi: 10.1371/journal.pone.0207071

    Figure Lengend Snippet: Different radio-sensitivity of C . neoformans H99S vs H99 strains and their DNA damage progression after 1 kGy exposure. (A) H99S and H99 cells were cultured in YPD overnight, and then 10-fold serially diluted (10 2 to 10 5 ) in PBS and 3 μL of diluted solution was spotted onto the YPD plates. Cells were exposed to the indicated doses of γ-radiation and then further incubated at 30 ° C for 5 days. Image was from one representative experiment of three independent experiments. (B) (C) DNA damage progression of C . neoformans H99S and H99 cells after 1 kGy γ-radiation measured by mitochondrial DNA and nuclear DNA LR-QPCR, respectively. After radiation, cells were harvested at selected time points and DNA was extracted and PCR was performed using 1 ng DNA and 30 ng DNA for the long mitochondrial DNA fragment and long nuclear DNA fragment respectively. Results were from three independent experiments with triplicate samples in each experiment (3 samples/point/experiment x 3). Mean ± S.E.M. **, p

    Article Snippet: Quantitative amplification of mitochondrial and nuclear DNA fragments The long range PCR was performed using the TaKaRa PrimeSTAR GXL DNA polymerase since it was shown to amplify almost all amplicons with different sizes and Tm values under identical PCR conditions [ ].

    Techniques: Cell Culture, Incubation, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction

    Quantitative detection of DNA damage in C . neoformans H99 and S . cerevisiae BY4741 exposed to ionizing radiation using the long mitochondrial DNA and nuclear DNA fragments. H99 and BY4741 cells were exposed to ionizing radiation from doses of 500 Gy to 3000 Gy. Irradiated cells were immediately frozen at -80 ° C and DNA extraction was performed as described in the Material and Methods. PCR products were quantified using the PicoGreen assay. DNA lesions were calculated according to the formula (lesions/amplified fragment = -ln (A D /A C )). The solid lines are lines connecting each data point. The dotted lines are the linear regression lines. (A and D) long mitochondrial DNA fragment lesions, (B and E) long nuclear DNA fragment lesions, (C and F) short mitochondrial DNA fragment PCR yield. Results were from three independent experiments with triplicate samples in each experiment (3 samples/point/experiment x 3). Mean ± S.E.M. **, p

    Journal: PLoS ONE

    Article Title: Measuring radiation-induced DNA damage in Cryptococcus neoformans and Saccharomyces cerevisiae using long range quantitative PCR

    doi: 10.1371/journal.pone.0207071

    Figure Lengend Snippet: Quantitative detection of DNA damage in C . neoformans H99 and S . cerevisiae BY4741 exposed to ionizing radiation using the long mitochondrial DNA and nuclear DNA fragments. H99 and BY4741 cells were exposed to ionizing radiation from doses of 500 Gy to 3000 Gy. Irradiated cells were immediately frozen at -80 ° C and DNA extraction was performed as described in the Material and Methods. PCR products were quantified using the PicoGreen assay. DNA lesions were calculated according to the formula (lesions/amplified fragment = -ln (A D /A C )). The solid lines are lines connecting each data point. The dotted lines are the linear regression lines. (A and D) long mitochondrial DNA fragment lesions, (B and E) long nuclear DNA fragment lesions, (C and F) short mitochondrial DNA fragment PCR yield. Results were from three independent experiments with triplicate samples in each experiment (3 samples/point/experiment x 3). Mean ± S.E.M. **, p

    Article Snippet: Quantitative amplification of mitochondrial and nuclear DNA fragments The long range PCR was performed using the TaKaRa PrimeSTAR GXL DNA polymerase since it was shown to amplify almost all amplicons with different sizes and Tm values under identical PCR conditions [ ].

    Techniques: Irradiation, DNA Extraction, Polymerase Chain Reaction, Picogreen Assay, Amplification

    Quantitative amplification of target DNA fragments in LR-QPCR with respect to the amount of template DNA. DNA isolated from C . neoformans H99 and S . cerevisiae BY4741 were serially diluted with nuclease-free water for use in PCR. PCR of each sample was performed in triplicate for 26 cycles (long mitochondrial and nuclear DNA) and 20 cycles (short mitochondrial DNA), and the PCR products were quantified using the PicoGreen assay. (A and D) long mitochondrial DNA fragments from H99 and BY4741, (B and E) long nuclear DNA fragments from H99 and BY4741, (C and F) short mitochondrial DNA fragments from H99 and BY4741. The solid lines connect all of data points. The dotted lines are the linear regression lines. Results were from three independent experiments with triplicate samples in each experiment (3 samples/point/experiment x 3). Mean ± S.E.M.

    Journal: PLoS ONE

    Article Title: Measuring radiation-induced DNA damage in Cryptococcus neoformans and Saccharomyces cerevisiae using long range quantitative PCR

    doi: 10.1371/journal.pone.0207071

    Figure Lengend Snippet: Quantitative amplification of target DNA fragments in LR-QPCR with respect to the amount of template DNA. DNA isolated from C . neoformans H99 and S . cerevisiae BY4741 were serially diluted with nuclease-free water for use in PCR. PCR of each sample was performed in triplicate for 26 cycles (long mitochondrial and nuclear DNA) and 20 cycles (short mitochondrial DNA), and the PCR products were quantified using the PicoGreen assay. (A and D) long mitochondrial DNA fragments from H99 and BY4741, (B and E) long nuclear DNA fragments from H99 and BY4741, (C and F) short mitochondrial DNA fragments from H99 and BY4741. The solid lines connect all of data points. The dotted lines are the linear regression lines. Results were from three independent experiments with triplicate samples in each experiment (3 samples/point/experiment x 3). Mean ± S.E.M.

    Article Snippet: Quantitative amplification of mitochondrial and nuclear DNA fragments The long range PCR was performed using the TaKaRa PrimeSTAR GXL DNA polymerase since it was shown to amplify almost all amplicons with different sizes and Tm values under identical PCR conditions [ ].

    Techniques: Amplification, Real-time Polymerase Chain Reaction, Isolation, Polymerase Chain Reaction, Picogreen Assay

    Estimated CTX prophage region structure of V. cholerae strain M25, the representative of group ET‐8. Profiles of CTX prophage region‐specific RFLP and PCR of strain M25 are unique and it was categorized as an independent group, ET‐8. The best estimated model for CTX prophage region of strain M25 is “TLC–RS1–CTX‐1–RS1–RTX” on chromosome I and there are no CTX prophage‐associated genes on chromosome II.

    Journal: Microbiology and Immunology

    Article Title: Comparative analyses of CTX prophage region of Vibrio cholerae seventh pandemic wave 1 strains isolated in Asia

    doi: 10.1111/1348-0421.12648

    Figure Lengend Snippet: Estimated CTX prophage region structure of V. cholerae strain M25, the representative of group ET‐8. Profiles of CTX prophage region‐specific RFLP and PCR of strain M25 are unique and it was categorized as an independent group, ET‐8. The best estimated model for CTX prophage region of strain M25 is “TLC–RS1–CTX‐1–RS1–RTX” on chromosome I and there are no CTX prophage‐associated genes on chromosome II.

    Article Snippet: The CTX prophage region, which spans from the 3′‐end portion of the TLC gene cluster corresponding to a primer TLC3F sequence to the 5 ′‐end portion of the RTX gene cluster corresponding to a primer RTX5R sequence (Table ) , of each representative V. cholerae strain was amplified from the bacterial genome by long range PCR using Prime STAR Max DNA polymerase (Takara, Tokyo, Japan) in accordance with the manufacturer's instructions.

    Techniques: Polymerase Chain Reaction

    Estimated CTX prophage region structure of V. cholerae strain C7, the representative of group ET‐6. Profiles of CTX prophage region‐specific RFLP and PCR of strain C7 are unique and it was categorized as an independent group, ET‐6. The best estimated model for CTX prophage region of strain C7 is “TLC– + CTX‐1– # CTX‐1– + CTX‐1– + CTX‐1–RTX” on chromosome I; no CTX prophage‐associated genes are present on chromosome II. + CTX‐1, CTX‐1 harboring SNPs in rstA (G301A), rstB (T84C), and in ctxA (G622A); # CTX‐1, CTX‐1 harboring SNPs in rstB (T84C) and in ctxA (G622A).

    Journal: Microbiology and Immunology

    Article Title: Comparative analyses of CTX prophage region of Vibrio cholerae seventh pandemic wave 1 strains isolated in Asia

    doi: 10.1111/1348-0421.12648

    Figure Lengend Snippet: Estimated CTX prophage region structure of V. cholerae strain C7, the representative of group ET‐6. Profiles of CTX prophage region‐specific RFLP and PCR of strain C7 are unique and it was categorized as an independent group, ET‐6. The best estimated model for CTX prophage region of strain C7 is “TLC– + CTX‐1– # CTX‐1– + CTX‐1– + CTX‐1–RTX” on chromosome I; no CTX prophage‐associated genes are present on chromosome II. + CTX‐1, CTX‐1 harboring SNPs in rstA (G301A), rstB (T84C), and in ctxA (G622A); # CTX‐1, CTX‐1 harboring SNPs in rstB (T84C) and in ctxA (G622A).

    Article Snippet: The CTX prophage region, which spans from the 3′‐end portion of the TLC gene cluster corresponding to a primer TLC3F sequence to the 5 ′‐end portion of the RTX gene cluster corresponding to a primer RTX5R sequence (Table ) , of each representative V. cholerae strain was amplified from the bacterial genome by long range PCR using Prime STAR Max DNA polymerase (Takara, Tokyo, Japan) in accordance with the manufacturer's instructions.

    Techniques: Polymerase Chain Reaction

    Estimated CTX prophage region structure of V. cholerae strain P2, the representative of group ET‐5. Four V. cholerae wave 1 strains revealed similar profiles of CTX prophage region‐specific RFLP and PCR, and were categorized into a group designated as ET‐5. The strain P2 was chosen as a representative and sequenced. The best estimated model of CTX prophage region is “TLC–CTX‐1–CTX‐1–RTX” for chromosome I; no CTX prophage‐associated genes are present on chromosome II.

    Journal: Microbiology and Immunology

    Article Title: Comparative analyses of CTX prophage region of Vibrio cholerae seventh pandemic wave 1 strains isolated in Asia

    doi: 10.1111/1348-0421.12648

    Figure Lengend Snippet: Estimated CTX prophage region structure of V. cholerae strain P2, the representative of group ET‐5. Four V. cholerae wave 1 strains revealed similar profiles of CTX prophage region‐specific RFLP and PCR, and were categorized into a group designated as ET‐5. The strain P2 was chosen as a representative and sequenced. The best estimated model of CTX prophage region is “TLC–CTX‐1–CTX‐1–RTX” for chromosome I; no CTX prophage‐associated genes are present on chromosome II.

    Article Snippet: The CTX prophage region, which spans from the 3′‐end portion of the TLC gene cluster corresponding to a primer TLC3F sequence to the 5 ′‐end portion of the RTX gene cluster corresponding to a primer RTX5R sequence (Table ) , of each representative V. cholerae strain was amplified from the bacterial genome by long range PCR using Prime STAR Max DNA polymerase (Takara, Tokyo, Japan) in accordance with the manufacturer's instructions.

    Techniques: Polymerase Chain Reaction

    Estimated CTX prophage region structure of V. cholerae strain P16, the representative of group ET‐7. Two V. cholerae wave 1 strains revealed similar profiles of CTX prophage region‐specific RFLP and PCR, and were categorized into a group designated as ET‐7. The strain P16 was chosen as a representative and sequenced. The best estimated model for CTX prophage region of strain P16 is “TLC–CTX‐1–CTX‐1–VCET1_GI–VCET1_GI–RTX” on chromosome I and “VCET1_GI–VCET1_GI” on chromosome II.

    Journal: Microbiology and Immunology

    Article Title: Comparative analyses of CTX prophage region of Vibrio cholerae seventh pandemic wave 1 strains isolated in Asia

    doi: 10.1111/1348-0421.12648

    Figure Lengend Snippet: Estimated CTX prophage region structure of V. cholerae strain P16, the representative of group ET‐7. Two V. cholerae wave 1 strains revealed similar profiles of CTX prophage region‐specific RFLP and PCR, and were categorized into a group designated as ET‐7. The strain P16 was chosen as a representative and sequenced. The best estimated model for CTX prophage region of strain P16 is “TLC–CTX‐1–CTX‐1–VCET1_GI–VCET1_GI–RTX” on chromosome I and “VCET1_GI–VCET1_GI” on chromosome II.

    Article Snippet: The CTX prophage region, which spans from the 3′‐end portion of the TLC gene cluster corresponding to a primer TLC3F sequence to the 5 ′‐end portion of the RTX gene cluster corresponding to a primer RTX5R sequence (Table ) , of each representative V. cholerae strain was amplified from the bacterial genome by long range PCR using Prime STAR Max DNA polymerase (Takara, Tokyo, Japan) in accordance with the manufacturer's instructions.

    Techniques: Polymerase Chain Reaction

    Estimated CTX prophage region structure of V. cholerae strain C1, the representative of group ET‐3. Profiles of CTX prophage region‐specific RFLP and PCR of strain C1 are unique and it was categorized as an independent group, ET‐3. The best estimated model for CTX prophage region is “TLC–CTX‐1–*RS1–CTX‐1–*RS1–CTX‐1–RTX” for chromosome I; no CTX prophage‐associated genes are present on chromosome II.

    Journal: Microbiology and Immunology

    Article Title: Comparative analyses of CTX prophage region of Vibrio cholerae seventh pandemic wave 1 strains isolated in Asia

    doi: 10.1111/1348-0421.12648

    Figure Lengend Snippet: Estimated CTX prophage region structure of V. cholerae strain C1, the representative of group ET‐3. Profiles of CTX prophage region‐specific RFLP and PCR of strain C1 are unique and it was categorized as an independent group, ET‐3. The best estimated model for CTX prophage region is “TLC–CTX‐1–*RS1–CTX‐1–*RS1–CTX‐1–RTX” for chromosome I; no CTX prophage‐associated genes are present on chromosome II.

    Article Snippet: The CTX prophage region, which spans from the 3′‐end portion of the TLC gene cluster corresponding to a primer TLC3F sequence to the 5 ′‐end portion of the RTX gene cluster corresponding to a primer RTX5R sequence (Table ) , of each representative V. cholerae strain was amplified from the bacterial genome by long range PCR using Prime STAR Max DNA polymerase (Takara, Tokyo, Japan) in accordance with the manufacturer's instructions.

    Techniques: Polymerase Chain Reaction

    Estimated CTX prophage region structure of V. cholerae strain J6, the representative of group ET‐2. Two V. cholerae wave 1 strains revealed similar profiles of CTX prophage region‐specific RFLP and PCR and were categorized into a group designated as ET‐2. The strain J6 was chosen as a representative and sequenced. The best estimated model of CTX prophage region is “TLC–CTX‐1–*RS1–CTX‐1–RTX” for chromosome I; no CTX prophage‐associated genes are present on chromosome II.

    Journal: Microbiology and Immunology

    Article Title: Comparative analyses of CTX prophage region of Vibrio cholerae seventh pandemic wave 1 strains isolated in Asia

    doi: 10.1111/1348-0421.12648

    Figure Lengend Snippet: Estimated CTX prophage region structure of V. cholerae strain J6, the representative of group ET‐2. Two V. cholerae wave 1 strains revealed similar profiles of CTX prophage region‐specific RFLP and PCR and were categorized into a group designated as ET‐2. The strain J6 was chosen as a representative and sequenced. The best estimated model of CTX prophage region is “TLC–CTX‐1–*RS1–CTX‐1–RTX” for chromosome I; no CTX prophage‐associated genes are present on chromosome II.

    Article Snippet: The CTX prophage region, which spans from the 3′‐end portion of the TLC gene cluster corresponding to a primer TLC3F sequence to the 5 ′‐end portion of the RTX gene cluster corresponding to a primer RTX5R sequence (Table ) , of each representative V. cholerae strain was amplified from the bacterial genome by long range PCR using Prime STAR Max DNA polymerase (Takara, Tokyo, Japan) in accordance with the manufacturer's instructions.

    Techniques: Polymerase Chain Reaction

    Estimated CTX prophage region structure of V. cholerae strain C2, the representative of group ET‐4. Profiles of CTX prophage region‐specific RFLP and PCR of strain C2 are unique and it was categorized as an independent group, ET‐4. The best estimated model for CTX prophage region of strain C2 is “TLC–CTX‐1–RS1–CTX‐1–VCET1_GI–VCET1_GI–RTX” on chromosome I and a single “VCET1_GI” on chromosome II.

    Journal: Microbiology and Immunology

    Article Title: Comparative analyses of CTX prophage region of Vibrio cholerae seventh pandemic wave 1 strains isolated in Asia

    doi: 10.1111/1348-0421.12648

    Figure Lengend Snippet: Estimated CTX prophage region structure of V. cholerae strain C2, the representative of group ET‐4. Profiles of CTX prophage region‐specific RFLP and PCR of strain C2 are unique and it was categorized as an independent group, ET‐4. The best estimated model for CTX prophage region of strain C2 is “TLC–CTX‐1–RS1–CTX‐1–VCET1_GI–VCET1_GI–RTX” on chromosome I and a single “VCET1_GI” on chromosome II.

    Article Snippet: The CTX prophage region, which spans from the 3′‐end portion of the TLC gene cluster corresponding to a primer TLC3F sequence to the 5 ′‐end portion of the RTX gene cluster corresponding to a primer RTX5R sequence (Table ) , of each representative V. cholerae strain was amplified from the bacterial genome by long range PCR using Prime STAR Max DNA polymerase (Takara, Tokyo, Japan) in accordance with the manufacturer's instructions.

    Techniques: Polymerase Chain Reaction

    mtDNA deletions and mutations increase when endogenous Parkin is lost in striata of PD-mito- Pst I mice. A , Schematic representation of mouse mtDNA. Scissors indicate the Pst I cleavage sites. Red arrows represent encoded proteins. Gray arrows represent mt-tRNAs. Color-coded representation of the position of the amplicons used for the qPCRs is maintained in the graphs. B , mtDNA levels measured by qPCR of LCM-collected SN TH + neurons ( n = 5/group; T = p value after t test). C , D , Southern blot probing striatal DNA with mtDNA and nuclear DNA probes ( C ) and mtDNA content measured by qPCR ( D ) in 4-month-old animals. E , Quantification by qPCR of full-length mtDNA content in striata of 4-month-old animals. F , Recombination events detected by qPCR using primers flanking the Pst I sites in striatal samples. G , H , Long-range PCR amplification of a 10 kb and a 117 bp fragment from striatal DNA ( G ) and relative quantification of a 10 kb fragment normalized to the 117 bp fragment ( H ). Boxes in graphs B , D , and F represent one individual animal. * p

    Journal: The Journal of Neuroscience

    Article Title: Lack of Parkin Anticipates the Phenotype and Affects Mitochondrial Morphology and mtDNA Levels in a Mouse Model of Parkinson's Disease

    doi: 10.1523/JNEUROSCI.1384-17.2017

    Figure Lengend Snippet: mtDNA deletions and mutations increase when endogenous Parkin is lost in striata of PD-mito- Pst I mice. A , Schematic representation of mouse mtDNA. Scissors indicate the Pst I cleavage sites. Red arrows represent encoded proteins. Gray arrows represent mt-tRNAs. Color-coded representation of the position of the amplicons used for the qPCRs is maintained in the graphs. B , mtDNA levels measured by qPCR of LCM-collected SN TH + neurons ( n = 5/group; T = p value after t test). C , D , Southern blot probing striatal DNA with mtDNA and nuclear DNA probes ( C ) and mtDNA content measured by qPCR ( D ) in 4-month-old animals. E , Quantification by qPCR of full-length mtDNA content in striata of 4-month-old animals. F , Recombination events detected by qPCR using primers flanking the Pst I sites in striatal samples. G , H , Long-range PCR amplification of a 10 kb and a 117 bp fragment from striatal DNA ( G ) and relative quantification of a 10 kb fragment normalized to the 117 bp fragment ( H ). Boxes in graphs B , D , and F represent one individual animal. * p

    Article Snippet: Fifteen nanograms of DNA was amplified to generate a 10 kb fragment using a Long-Range PCR Polymerase (Takara).

    Techniques: Mouse Assay, Real-time Polymerase Chain Reaction, Laser Capture Microdissection, Southern Blot, Polymerase Chain Reaction, Amplification

    Structures of the pre- and post-Cre floxed mouse Zip5 gene and integration and genotyping screen designs. ( A ) The mouse Zip5 gene was captured using gap-repair and manipulated using galK recombineering. Exons ( 1–12 ) and the exon encoding transmembrane domain 1 ( TMD1 ) are indicated, as are the positions of LoxP sites (intron 4 and downstream of PGK Neo ), the PGK-neomycin ( PGK Neo ) cassette and the locations of primers used for genotyping. The LoxP site in intron 4 is flanked by an EcoRV restriction enzyme cleavage site. ( B ) The structure of the Zip5 gene after Cre recombination is shown. Recombination eliminates the transmembrane domain of ZIP5. ( C ) The floxed Zip5 gene was targeted into E14 ES cells and properly targeted ES cells were identified by long range PCR using flanking and internal primers. PCR products from the wild-type ( Wt ) and floxed ( Fx ) alleles are indicated. EcoRV cleavage was used to differentiate between the floxed and wild-type alleles in the 5′ PCR screen whereas the 3′ PCR screen yielded the predicted larger product from the wild-type allele. Targeted ES cells were used to generate mice homozygous for the floxed Zip5 allele. ( D ) Mice were genotyped by PCR amplification of the intron 4 region containing the LoxP site. The PCR product from homozygous Zip5 floxed mice before Cre-induced recombination is shown in the left lane while that from control mice is shown in the center lane and that from Zip5 -knockout mice ( Ko ) is shown in the right lane . For the intestine- and pancreas-specific knockout mice, detection of Zip5 mRNA and/or protein was employed to monitor the efficacy of recombination.

    Journal: PLoS ONE

    Article Title: The Zinc Transporter Zip5 (Slc39a5) Regulates Intestinal Zinc Excretion and Protects the Pancreas against Zinc Toxicity

    doi: 10.1371/journal.pone.0082149

    Figure Lengend Snippet: Structures of the pre- and post-Cre floxed mouse Zip5 gene and integration and genotyping screen designs. ( A ) The mouse Zip5 gene was captured using gap-repair and manipulated using galK recombineering. Exons ( 1–12 ) and the exon encoding transmembrane domain 1 ( TMD1 ) are indicated, as are the positions of LoxP sites (intron 4 and downstream of PGK Neo ), the PGK-neomycin ( PGK Neo ) cassette and the locations of primers used for genotyping. The LoxP site in intron 4 is flanked by an EcoRV restriction enzyme cleavage site. ( B ) The structure of the Zip5 gene after Cre recombination is shown. Recombination eliminates the transmembrane domain of ZIP5. ( C ) The floxed Zip5 gene was targeted into E14 ES cells and properly targeted ES cells were identified by long range PCR using flanking and internal primers. PCR products from the wild-type ( Wt ) and floxed ( Fx ) alleles are indicated. EcoRV cleavage was used to differentiate between the floxed and wild-type alleles in the 5′ PCR screen whereas the 3′ PCR screen yielded the predicted larger product from the wild-type allele. Targeted ES cells were used to generate mice homozygous for the floxed Zip5 allele. ( D ) Mice were genotyped by PCR amplification of the intron 4 region containing the LoxP site. The PCR product from homozygous Zip5 floxed mice before Cre-induced recombination is shown in the left lane while that from control mice is shown in the center lane and that from Zip5 -knockout mice ( Ko ) is shown in the right lane . For the intestine- and pancreas-specific knockout mice, detection of Zip5 mRNA and/or protein was employed to monitor the efficacy of recombination.

    Article Snippet: The Zip5 Fx targeting vector was electroporated into E14 embryonic stem (ES) cells and colonies were screened using long range PCR with LA-Taq (TaKaRa Bio, Inc.) and primers outside the captured Zip5 locus paired with primers within the Zip5 gene itself ( ).

    Techniques: Polymerase Chain Reaction, Mouse Assay, Amplification, Knock-Out