long range pcr kit  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Qiagen long range pcr kit
    Long Range Pcr Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 30 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/long range pcr kit/product/Qiagen
    Average 99 stars, based on 30 article reviews
    Price from $9.99 to $1999.99
    long range pcr kit - by Bioz Stars, 2020-03
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: A Stretch of 17 Amino Acids in the Prosaposin C Terminus Is Critical for Its Binding to Sortilin and Targeting to Lysosomes
    Article Snippet: StrataClone Ultra PCR cloning kit, QuikChange II site-directed mutagenesis kit, and QuikChange Lightning site-directed mutagenesis kit were from Stratagene (La Jolla, CA). .. Long Range PCR kit, Taq PCR kit, QIAquick gel extraction kit, QIAprep Spin mini-prep kit, Hispeed Plasmid mini-kit, and PolyFect transfection reagent were all from Qiagen (Mississauga, ON, Canada).

    Transfection:

    Article Title: A Stretch of 17 Amino Acids in the Prosaposin C Terminus Is Critical for Its Binding to Sortilin and Targeting to Lysosomes
    Article Snippet: .. Long Range PCR kit, Taq PCR kit, QIAquick gel extraction kit, QIAprep Spin mini-prep kit, Hispeed Plasmid mini-kit, and PolyFect transfection reagent were all from Qiagen (Mississauga, ON, Canada). .. Protein A Sepharose 4 Fast Flow, ECL Plus Western blotting detection reagents, and Amersham Hyperfilm MP autoradiography films were from GE Healthcare (Piscataway, NJ).

    Mutagenesis:

    Article Title: A Stretch of 17 Amino Acids in the Prosaposin C Terminus Is Critical for Its Binding to Sortilin and Targeting to Lysosomes
    Article Snippet: StrataClone Ultra PCR cloning kit, QuikChange II site-directed mutagenesis kit, and QuikChange Lightning site-directed mutagenesis kit were from Stratagene (La Jolla, CA). .. Long Range PCR kit, Taq PCR kit, QIAquick gel extraction kit, QIAprep Spin mini-prep kit, Hispeed Plasmid mini-kit, and PolyFect transfection reagent were all from Qiagen (Mississauga, ON, Canada).

    Protease Inhibitor:

    Article Title: A Stretch of 17 Amino Acids in the Prosaposin C Terminus Is Critical for Its Binding to Sortilin and Targeting to Lysosomes
    Article Snippet: Protease inhibitor cocktail was from Roche. .. Long Range PCR kit, Taq PCR kit, QIAquick gel extraction kit, QIAprep Spin mini-prep kit, Hispeed Plasmid mini-kit, and PolyFect transfection reagent were all from Qiagen (Mississauga, ON, Canada).

    Autoradiography:

    Article Title: A Stretch of 17 Amino Acids in the Prosaposin C Terminus Is Critical for Its Binding to Sortilin and Targeting to Lysosomes
    Article Snippet: Long Range PCR kit, Taq PCR kit, QIAquick gel extraction kit, QIAprep Spin mini-prep kit, Hispeed Plasmid mini-kit, and PolyFect transfection reagent were all from Qiagen (Mississauga, ON, Canada). .. Protein A Sepharose 4 Fast Flow, ECL Plus Western blotting detection reagents, and Amersham Hyperfilm MP autoradiography films were from GE Healthcare (Piscataway, NJ).

    Flow Cytometry:

    Article Title: A Stretch of 17 Amino Acids in the Prosaposin C Terminus Is Critical for Its Binding to Sortilin and Targeting to Lysosomes
    Article Snippet: Long Range PCR kit, Taq PCR kit, QIAquick gel extraction kit, QIAprep Spin mini-prep kit, Hispeed Plasmid mini-kit, and PolyFect transfection reagent were all from Qiagen (Mississauga, ON, Canada). .. Protein A Sepharose 4 Fast Flow, ECL Plus Western blotting detection reagents, and Amersham Hyperfilm MP autoradiography films were from GE Healthcare (Piscataway, NJ).

    Construct:

    Article Title: A Stretch of 17 Amino Acids in the Prosaposin C Terminus Is Critical for Its Binding to Sortilin and Targeting to Lysosomes
    Article Snippet: Paragraph title: Reagents and Constructs ... Long Range PCR kit, Taq PCR kit, QIAquick gel extraction kit, QIAprep Spin mini-prep kit, Hispeed Plasmid mini-kit, and PolyFect transfection reagent were all from Qiagen (Mississauga, ON, Canada).

    Gel Extraction:

    Article Title: A Stretch of 17 Amino Acids in the Prosaposin C Terminus Is Critical for Its Binding to Sortilin and Targeting to Lysosomes
    Article Snippet: .. Long Range PCR kit, Taq PCR kit, QIAquick gel extraction kit, QIAprep Spin mini-prep kit, Hispeed Plasmid mini-kit, and PolyFect transfection reagent were all from Qiagen (Mississauga, ON, Canada). .. Protein A Sepharose 4 Fast Flow, ECL Plus Western blotting detection reagents, and Amersham Hyperfilm MP autoradiography films were from GE Healthcare (Piscataway, NJ).

    Staining:

    Article Title: A Stretch of 17 Amino Acids in the Prosaposin C Terminus Is Critical for Its Binding to Sortilin and Targeting to Lysosomes
    Article Snippet: ProLong Gold antifade reagent, 4′,6-diamidino-2-phenylindole (DAPI), and Hoechst 33342 stain were from Invitrogen. .. Long Range PCR kit, Taq PCR kit, QIAquick gel extraction kit, QIAprep Spin mini-prep kit, Hispeed Plasmid mini-kit, and PolyFect transfection reagent were all from Qiagen (Mississauga, ON, Canada).

    Polymerase Chain Reaction:

    Article Title: A Stretch of 17 Amino Acids in the Prosaposin C Terminus Is Critical for Its Binding to Sortilin and Targeting to Lysosomes
    Article Snippet: .. Long Range PCR kit, Taq PCR kit, QIAquick gel extraction kit, QIAprep Spin mini-prep kit, Hispeed Plasmid mini-kit, and PolyFect transfection reagent were all from Qiagen (Mississauga, ON, Canada). .. Protein A Sepharose 4 Fast Flow, ECL Plus Western blotting detection reagents, and Amersham Hyperfilm MP autoradiography films were from GE Healthcare (Piscataway, NJ).

    Western Blot:

    Article Title: A Stretch of 17 Amino Acids in the Prosaposin C Terminus Is Critical for Its Binding to Sortilin and Targeting to Lysosomes
    Article Snippet: Long Range PCR kit, Taq PCR kit, QIAquick gel extraction kit, QIAprep Spin mini-prep kit, Hispeed Plasmid mini-kit, and PolyFect transfection reagent were all from Qiagen (Mississauga, ON, Canada). .. Protein A Sepharose 4 Fast Flow, ECL Plus Western blotting detection reagents, and Amersham Hyperfilm MP autoradiography films were from GE Healthcare (Piscataway, NJ).

    Plasmid Preparation:

    Article Title: A Stretch of 17 Amino Acids in the Prosaposin C Terminus Is Critical for Its Binding to Sortilin and Targeting to Lysosomes
    Article Snippet: .. Long Range PCR kit, Taq PCR kit, QIAquick gel extraction kit, QIAprep Spin mini-prep kit, Hispeed Plasmid mini-kit, and PolyFect transfection reagent were all from Qiagen (Mississauga, ON, Canada). .. Protein A Sepharose 4 Fast Flow, ECL Plus Western blotting detection reagents, and Amersham Hyperfilm MP autoradiography films were from GE Healthcare (Piscataway, NJ).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Qiagen long range rt pcr kit
    Characterization of ectopically expressed RNAs by long range <t>RT-PCR.</t> MDA-MB-231 parental cell line (231-parental), its pcDNA3-ERα stable transfectant (ERα-2), and its ERα-IRES stable transfectants (ERα-IRES-5 and ERα-IRES-3) were analyzed for expression of ERα–harboring transcript (1.8 kb), Hygromycin B resistance gene-containing transcript (1.0 kb), and ERα-IRES-Hygro R fused transcript (3.2 kb), by RT followed by long range PCR amplification. pERα-IRES DNA served as a PCR positive control for the ERα <t>cDNA</t> primers (1.8 kb), the Hygromycin B resistance gene ORF primers (1.0 kb), and the 5′ sense ERα primer plus 3′ antisense Hygro R fused ORFs primers (3.5 kb). A First four lanes from left contain the ERα cDNA primers; lanes 5–8 the 5′ sense ERα primer together with the 3′ antisense Hygro R gene primer. B. The 5′ sense ERα primer together with the 3′ antisense Hygro R gene primer. C. Lanes 1 and 2 from left, the ERα primers. Lanes 3 and 4 the Hygro R gene primers. Primer sequences are detailed in the “ Methods ” section.
    Long Range Rt Pcr Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 31 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/long range rt pcr kit/product/Qiagen
    Average 90 stars, based on 31 article reviews
    Price from $9.99 to $1999.99
    long range rt pcr kit - by Bioz Stars, 2020-03
    90/100 stars
      Buy from Supplier

    Image Search Results


    Characterization of ectopically expressed RNAs by long range RT-PCR. MDA-MB-231 parental cell line (231-parental), its pcDNA3-ERα stable transfectant (ERα-2), and its ERα-IRES stable transfectants (ERα-IRES-5 and ERα-IRES-3) were analyzed for expression of ERα–harboring transcript (1.8 kb), Hygromycin B resistance gene-containing transcript (1.0 kb), and ERα-IRES-Hygro R fused transcript (3.2 kb), by RT followed by long range PCR amplification. pERα-IRES DNA served as a PCR positive control for the ERα cDNA primers (1.8 kb), the Hygromycin B resistance gene ORF primers (1.0 kb), and the 5′ sense ERα primer plus 3′ antisense Hygro R fused ORFs primers (3.5 kb). A First four lanes from left contain the ERα cDNA primers; lanes 5–8 the 5′ sense ERα primer together with the 3′ antisense Hygro R gene primer. B. The 5′ sense ERα primer together with the 3′ antisense Hygro R gene primer. C. Lanes 1 and 2 from left, the ERα primers. Lanes 3 and 4 the Hygro R gene primers. Primer sequences are detailed in the “ Methods ” section.

    Journal: PLoS ONE

    Article Title: ER-Alpha-cDNA As Part of a Bicistronic Transcript Gives Rise to High Frequency, Long Term, Receptor Expressing Cell Clones

    doi: 10.1371/journal.pone.0031977

    Figure Lengend Snippet: Characterization of ectopically expressed RNAs by long range RT-PCR. MDA-MB-231 parental cell line (231-parental), its pcDNA3-ERα stable transfectant (ERα-2), and its ERα-IRES stable transfectants (ERα-IRES-5 and ERα-IRES-3) were analyzed for expression of ERα–harboring transcript (1.8 kb), Hygromycin B resistance gene-containing transcript (1.0 kb), and ERα-IRES-Hygro R fused transcript (3.2 kb), by RT followed by long range PCR amplification. pERα-IRES DNA served as a PCR positive control for the ERα cDNA primers (1.8 kb), the Hygromycin B resistance gene ORF primers (1.0 kb), and the 5′ sense ERα primer plus 3′ antisense Hygro R fused ORFs primers (3.5 kb). A First four lanes from left contain the ERα cDNA primers; lanes 5–8 the 5′ sense ERα primer together with the 3′ antisense Hygro R gene primer. B. The 5′ sense ERα primer together with the 3′ antisense Hygro R gene primer. C. Lanes 1 and 2 from left, the ERα primers. Lanes 3 and 4 the Hygro R gene primers. Primer sequences are detailed in the “ Methods ” section.

    Article Snippet: Two µg of total RNA extracted using EZ-RNA isolation kit (Biological Industries, Israel) were transcribed into first strand cDNA by hexamer priming, followed by PCR reactions as specified in the Long range RT-PCR kit (Qiagen).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Multiple Displacement Amplification, Transfection, Expressing, Polymerase Chain Reaction, Amplification, Positive Control

    RT-PCR analysis of the postulated ABC transporter genes 730–760. The positions of the different amplicons are shown below the scheme of the MHO_710–770 gene region. The primers used ( Table 1 ) and the lengths of the amplicons (A-G) are indicated. PCR products (A–G) for genomic DNA (g), mRNA (m) and cDNA (c) were separated on a 0.6% agarose gel and stained with ethidium bromide. M, Gene Ruler 1 kb DNA ladder (Fermentas).

    Journal: PLoS ONE

    Article Title: Validation of a novel Mho microarray for a comprehensive characterisation of the Mycoplasma hominis action in HeLa cell infection

    doi: 10.1371/journal.pone.0181383

    Figure Lengend Snippet: RT-PCR analysis of the postulated ABC transporter genes 730–760. The positions of the different amplicons are shown below the scheme of the MHO_710–770 gene region. The primers used ( Table 1 ) and the lengths of the amplicons (A-G) are indicated. PCR products (A–G) for genomic DNA (g), mRNA (m) and cDNA (c) were separated on a 0.6% agarose gel and stained with ethidium bromide. M, Gene Ruler 1 kb DNA ladder (Fermentas).

    Article Snippet: Overlapping regions of the MHO genes 720–770 were amplified using the Long Range PCR Kit (Qiagen, Hilden, Germany) by standard PCR conditions (initial cycle of 3 min at 93°C; 35 cycles of 15 s at 93°C, 30 s at 50°C, 10 min at 68°C).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Staining

    sVEGFR-3 is expressed in corneal epithelium and antagonizes VEGF-C. (A) Reverse-transcriptase PCRs (RT-PCRs) with intron-tail–specific reverse primer and exon-exon junction forward primers showing sVEGFR-3 in mouse cornea. Membrane VEGFR-3 mRNA expression in sclera only. (B) Western blot of corneal and scleral lysate (n = 5) with anti–VEGFR-3 N-terminal antibody demonstrates sVEGFR-3 at 60 kDa in cornea and membrane VEGFR-3 at 170 kDa in sclera. (C) Western blot of corneal and scleral lysate (n = 5) with anti–VEGFR-3 C-terminal antibody demonstrates the expression of membrane VEGFR-3 at 170 kDa in sclera only (none in cornea). (D) Immunolocalization of sVEGFR-3 (brown) in human cornea via an intron-derived C-terminal tail, human sVEGFR-3 antibody (PA 4835; Thermo Scientific). Isotype-negative control rabbit IgG. (E) RT-PCR and western blot of mouse cornea shows VEGF-C mRNA and protein. (F) Western blot of corneal lysate (n = 5) with anti–VEGFR-3 N-terminal antibody, blotted with anti–VEGF-C antibody under reducing (1) and native conditions (2), reveals binding of sVEGFR-3 to VEGF-C. (G) Sandwich ELISA with anti–VEGF-C–coated antibodies in 96-well plates, followed by the addition of corneal lysate (n = 5, each group; corneas from 3 mice in each sample), and then anti–VEGF-C, anti–VEGFR-3 N-terminal, and anti–N-terminal VEGFR-2 antibodies. (H) Competitive ELISA with human recombinant VEGF-C coated on 96-well plates and equimolar human recombinant VEGFR-3 and VEGFR-2 with extracellular domains added, showing affinity and binding to VEGF-C (n = 5). GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IP, immunoprecipitation; M, marker; mVEGFR-3, membrane VEGFR-3; WB, western blot.

    Journal: Blood

    Article Title: Soluble vascular endothelial growth factor receptor 3 is essential for corneal alymphaticity

    doi: 10.1182/blood-2012-08-453043

    Figure Lengend Snippet: sVEGFR-3 is expressed in corneal epithelium and antagonizes VEGF-C. (A) Reverse-transcriptase PCRs (RT-PCRs) with intron-tail–specific reverse primer and exon-exon junction forward primers showing sVEGFR-3 in mouse cornea. Membrane VEGFR-3 mRNA expression in sclera only. (B) Western blot of corneal and scleral lysate (n = 5) with anti–VEGFR-3 N-terminal antibody demonstrates sVEGFR-3 at 60 kDa in cornea and membrane VEGFR-3 at 170 kDa in sclera. (C) Western blot of corneal and scleral lysate (n = 5) with anti–VEGFR-3 C-terminal antibody demonstrates the expression of membrane VEGFR-3 at 170 kDa in sclera only (none in cornea). (D) Immunolocalization of sVEGFR-3 (brown) in human cornea via an intron-derived C-terminal tail, human sVEGFR-3 antibody (PA 4835; Thermo Scientific). Isotype-negative control rabbit IgG. (E) RT-PCR and western blot of mouse cornea shows VEGF-C mRNA and protein. (F) Western blot of corneal lysate (n = 5) with anti–VEGFR-3 N-terminal antibody, blotted with anti–VEGF-C antibody under reducing (1) and native conditions (2), reveals binding of sVEGFR-3 to VEGF-C. (G) Sandwich ELISA with anti–VEGF-C–coated antibodies in 96-well plates, followed by the addition of corneal lysate (n = 5, each group; corneas from 3 mice in each sample), and then anti–VEGF-C, anti–VEGFR-3 N-terminal, and anti–N-terminal VEGFR-2 antibodies. (H) Competitive ELISA with human recombinant VEGF-C coated on 96-well plates and equimolar human recombinant VEGFR-3 and VEGFR-2 with extracellular domains added, showing affinity and binding to VEGF-C (n = 5). GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IP, immunoprecipitation; M, marker; mVEGFR-3, membrane VEGFR-3; WB, western blot.

    Article Snippet: A total of 2 μg of RNA was reverse transcribed using complementary DNA (cDNA) cloning primer (QT) CCAGTGAGCAGAGTGACGAGGACTCGAGCTCAAGCTTTTTTTTTTTTTTTTT. cDNA was amplified using Q0-CCAGTGAGCAGAGTGACG and VEGFR-3 domain 4–specific forward primer ATCAACAAACCTGACACGCTCCTG using a Long Range PCR Kit (Qiagen), with the following polymerase chain reaction (PCR) conditions: 93°C for 3 minutes, 35 cycles of 93°C for 15 seconds, 55°C for 30 seconds, and 68°C for 5 minutes.

    Techniques: Expressing, Western Blot, Derivative Assay, Negative Control, Reverse Transcription Polymerase Chain Reaction, Binding Assay, Sandwich ELISA, Mouse Assay, Competitive ELISA, Recombinant, Immunoprecipitation, Marker

    Corneal injury induces lymphangiogenesis, upregulation of VEGF-C, and membrane VEGFR-3 expression. (A) Immunostaining of normal and sutured cornea on day 3 reveals sVEGFR-3 and VEGF-C upregulation at the site of suture, indicating that sVEGFR-3 initially tends to capture VEGF-C and control VEGF-C surge. Negative controls are sections stained with isotype-control primary antibodies. (B) Real-time PCR of normal and sutured cornea on day 3 revealing mechanical trauma leads to instant increase in VEGF-C mRNA levels (n = 5). (C) Western blot of normal (1) and sutured cornea (2) on day 5 leads to expression of membrane VEGFR-3 (170 kDa) in sutured cornea that leads to signaling through VEGFR-3 and development of lymphatic vessels.

    Journal: Blood

    Article Title: Soluble vascular endothelial growth factor receptor 3 is essential for corneal alymphaticity

    doi: 10.1182/blood-2012-08-453043

    Figure Lengend Snippet: Corneal injury induces lymphangiogenesis, upregulation of VEGF-C, and membrane VEGFR-3 expression. (A) Immunostaining of normal and sutured cornea on day 3 reveals sVEGFR-3 and VEGF-C upregulation at the site of suture, indicating that sVEGFR-3 initially tends to capture VEGF-C and control VEGF-C surge. Negative controls are sections stained with isotype-control primary antibodies. (B) Real-time PCR of normal and sutured cornea on day 3 revealing mechanical trauma leads to instant increase in VEGF-C mRNA levels (n = 5). (C) Western blot of normal (1) and sutured cornea (2) on day 5 leads to expression of membrane VEGFR-3 (170 kDa) in sutured cornea that leads to signaling through VEGFR-3 and development of lymphatic vessels.

    Article Snippet: A total of 2 μg of RNA was reverse transcribed using complementary DNA (cDNA) cloning primer (QT) CCAGTGAGCAGAGTGACGAGGACTCGAGCTCAAGCTTTTTTTTTTTTTTTTT. cDNA was amplified using Q0-CCAGTGAGCAGAGTGACG and VEGFR-3 domain 4–specific forward primer ATCAACAAACCTGACACGCTCCTG using a Long Range PCR Kit (Qiagen), with the following polymerase chain reaction (PCR) conditions: 93°C for 3 minutes, 35 cycles of 93°C for 15 seconds, 55°C for 30 seconds, and 68°C for 5 minutes.

    Techniques: Expressing, Immunostaining, Staining, Real-time Polymerase Chain Reaction, Western Blot

    Mbo II digest results. Agarose gel showing Mbo II digests of GAA PCR products of FRDA samples. The expected 170bp (5′) and 120bp (3′) undigested GAA-flanking fragments from normal pure GAA repeat expansion FRDA samples are shown in lanes 2, 3, and 4. These band sizes can be seen in between the 200 and 100bp fragments of the 1 Kb+ DNA ladder markers, which are loaded into lanes 1 and 11 of the gel. Lane 5 shows a large Mbo II band of approximately 600bp that was obtained from the positive interrupted GAA repeat sequence from the “NEP” BAC transgenic mouse that contains approximately 500 triplet repeats with the previously determined interrupted sequence of (GAA) 21 (GGAGAA) 5 (GGAGGAGAA) 70 (GAA) n ( Holloway et al., 2011 ). In addition for this positive sample, we also identified the expected 5′ flanking band of 170bp, together with a smaller band of less than 100bp that we sequenced and we showed to contain a 27bp deletion in the 3′ flanking region. Lane 6 shows an abnormal band of 200bp representing the 80bp duplication in the 3′ GAA flanking region. Lane 7 shows an abnormal band of approximately 100bp representing the 19bp deletion in the 3′ GAA flanking region. Lanes 8, 9, and 10 contain abnormal bands of approximately 300, 100, and 180bp, respectively, that are likely to contain a region of interrupted GAA repeat sequence within the body of one or other of the large FRDA GAA repeat expansions.

    Journal: Frontiers in Cellular Neuroscience

    Article Title: Large Interruptions of GAA Repeat Expansion Mutations in Friedreich Ataxia Are Very Rare

    doi: 10.3389/fncel.2018.00443

    Figure Lengend Snippet: Mbo II digest results. Agarose gel showing Mbo II digests of GAA PCR products of FRDA samples. The expected 170bp (5′) and 120bp (3′) undigested GAA-flanking fragments from normal pure GAA repeat expansion FRDA samples are shown in lanes 2, 3, and 4. These band sizes can be seen in between the 200 and 100bp fragments of the 1 Kb+ DNA ladder markers, which are loaded into lanes 1 and 11 of the gel. Lane 5 shows a large Mbo II band of approximately 600bp that was obtained from the positive interrupted GAA repeat sequence from the “NEP” BAC transgenic mouse that contains approximately 500 triplet repeats with the previously determined interrupted sequence of (GAA) 21 (GGAGAA) 5 (GGAGGAGAA) 70 (GAA) n ( Holloway et al., 2011 ). In addition for this positive sample, we also identified the expected 5′ flanking band of 170bp, together with a smaller band of less than 100bp that we sequenced and we showed to contain a 27bp deletion in the 3′ flanking region. Lane 6 shows an abnormal band of 200bp representing the 80bp duplication in the 3′ GAA flanking region. Lane 7 shows an abnormal band of approximately 100bp representing the 19bp deletion in the 3′ GAA flanking region. Lanes 8, 9, and 10 contain abnormal bands of approximately 300, 100, and 180bp, respectively, that are likely to contain a region of interrupted GAA repeat sequence within the body of one or other of the large FRDA GAA repeat expansions.

    Article Snippet: We then performed long-range PCR of the samples (approximately 100 ng input DNA) using either the Expand High Fidelity PCR System, dNTPack (Roche), or the Long Range PCR Kit (Qiagen) together with GAA-B-F (5′-AATGGATTTCCTGGCAGGACGC-3′) and GAA-B-R (5′-GCATTGGGCGATCTTGGCTTAA-3′) primers as previously described ( ).

    Techniques: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Sequencing, BAC Assay, Transgenic Assay

    Mbo II digests of GAA repeat expansions from human FRDA somatic tissues and mouse FRDA intergenerational and somatic tissues. Agarose gels showing Mbo II digests of GAA PCR products of (A) FRDA patient cerebellum tissue samples, (B) YG8sR mouse ear biopsy samples and human FRDA blood samples, and (C) four tissues from one YG8sR mouse. In each case, the expected 170 and 120bp undigested GAA-flanking fragments can be identified in between the 200 and 100bp fragments of the 1 Kb+ DNA ladder marker, which is loaded into the first lane of each gel. (A) Lanes 1–3 show the results from cerebellum tissue samples from three FRDA patients. (B) Lanes 1 and 2 are from FRDA patient blood samples; lanes 3–6 are from ear biopsy samples from 4 GAA repeat expansion-based YG8sR mice of four different generations, and lane 7 is from an ear biopsy sample from the Y47R mouse which has nine GAA repeats. (C) Lanes 1–4 are from brain, cerebellum, heart, and liver tissues of the YG8sR mouse, respectively.

    Journal: Frontiers in Cellular Neuroscience

    Article Title: Large Interruptions of GAA Repeat Expansion Mutations in Friedreich Ataxia Are Very Rare

    doi: 10.3389/fncel.2018.00443

    Figure Lengend Snippet: Mbo II digests of GAA repeat expansions from human FRDA somatic tissues and mouse FRDA intergenerational and somatic tissues. Agarose gels showing Mbo II digests of GAA PCR products of (A) FRDA patient cerebellum tissue samples, (B) YG8sR mouse ear biopsy samples and human FRDA blood samples, and (C) four tissues from one YG8sR mouse. In each case, the expected 170 and 120bp undigested GAA-flanking fragments can be identified in between the 200 and 100bp fragments of the 1 Kb+ DNA ladder marker, which is loaded into the first lane of each gel. (A) Lanes 1–3 show the results from cerebellum tissue samples from three FRDA patients. (B) Lanes 1 and 2 are from FRDA patient blood samples; lanes 3–6 are from ear biopsy samples from 4 GAA repeat expansion-based YG8sR mice of four different generations, and lane 7 is from an ear biopsy sample from the Y47R mouse which has nine GAA repeats. (C) Lanes 1–4 are from brain, cerebellum, heart, and liver tissues of the YG8sR mouse, respectively.

    Article Snippet: We then performed long-range PCR of the samples (approximately 100 ng input DNA) using either the Expand High Fidelity PCR System, dNTPack (Roche), or the Long Range PCR Kit (Qiagen) together with GAA-B-F (5′-AATGGATTTCCTGGCAGGACGC-3′) and GAA-B-R (5′-GCATTGGGCGATCTTGGCTTAA-3′) primers as previously described ( ).

    Techniques: Polymerase Chain Reaction, Marker, Mouse Assay