long range pcr kit  (Qiagen)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    QIAGEN LongRange PCR Kit
    Description:
    For sensitive and accurate long range PCR Kit contents Qiagen LongRange PCR Kit 20 x 50L rxns Amplification of Extremely Long PCR Products up to 40 kb DNA Low Error Rates Ensured by High fidelity Enzyme Minimal PCR Optimization due to Unique Buffer System Amplification of Low copy Targets and GC rich Templates For Sensitive and Accurate Long range PCR Includes LongRange PCR Enzyme Mix 40U LongRange PCR Buffer 5x Q Solution RNase free Water 10mM dNTPs Benefits Amplification of extremely long PCR products up to 40 kb DNA Low error rates ensured by high fidelity enzyme Minimal PCR optimization due to unique buffer system Amplification of low copy targets and GC rich templates
    Catalog Number:
    206401
    Price:
    66.9
    Category:
    QIAGEN LongRange PCR Kit
    Buy from Supplier


    Structured Review

    Qiagen long range pcr kit
    QIAGEN LongRange PCR Kit
    For sensitive and accurate long range PCR Kit contents Qiagen LongRange PCR Kit 20 x 50L rxns Amplification of Extremely Long PCR Products up to 40 kb DNA Low Error Rates Ensured by High fidelity Enzyme Minimal PCR Optimization due to Unique Buffer System Amplification of Low copy Targets and GC rich Templates For Sensitive and Accurate Long range PCR Includes LongRange PCR Enzyme Mix 40U LongRange PCR Buffer 5x Q Solution RNase free Water 10mM dNTPs Benefits Amplification of extremely long PCR products up to 40 kb DNA Low error rates ensured by high fidelity enzyme Minimal PCR optimization due to unique buffer system Amplification of low copy targets and GC rich templates
    https://www.bioz.com/result/long range pcr kit/product/Qiagen
    Average 99 stars, based on 46 article reviews
    Price from $9.99 to $1999.99
    long range pcr kit - by Bioz Stars, 2020-08
    99/100 stars

    Images

    1) Product Images from "Validation of a novel Mho microarray for a comprehensive characterisation of the Mycoplasma hominis action in HeLa cell infection"

    Article Title: Validation of a novel Mho microarray for a comprehensive characterisation of the Mycoplasma hominis action in HeLa cell infection

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0181383

    RT-PCR analysis of the postulated ABC transporter genes 730–760. The positions of the different amplicons are shown below the scheme of the MHO_710–770 gene region. The primers used ( Table 1 ) and the lengths of the amplicons (A-G) are indicated. PCR products (A–G) for genomic DNA (g), mRNA (m) and cDNA (c) were separated on a 0.6% agarose gel and stained with ethidium bromide. M, Gene Ruler 1 kb DNA ladder (Fermentas).
    Figure Legend Snippet: RT-PCR analysis of the postulated ABC transporter genes 730–760. The positions of the different amplicons are shown below the scheme of the MHO_710–770 gene region. The primers used ( Table 1 ) and the lengths of the amplicons (A-G) are indicated. PCR products (A–G) for genomic DNA (g), mRNA (m) and cDNA (c) were separated on a 0.6% agarose gel and stained with ethidium bromide. M, Gene Ruler 1 kb DNA ladder (Fermentas).

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Staining

    2) Product Images from "Large Interruptions of GAA Repeat Expansion Mutations in Friedreich Ataxia Are Very Rare"

    Article Title: Large Interruptions of GAA Repeat Expansion Mutations in Friedreich Ataxia Are Very Rare

    Journal: Frontiers in Cellular Neuroscience

    doi: 10.3389/fncel.2018.00443

    Mbo II digest results. Agarose gel showing Mbo II digests of GAA PCR products of FRDA samples. The expected 170bp (5′) and 120bp (3′) undigested GAA-flanking fragments from normal pure GAA repeat expansion FRDA samples are shown in lanes 2, 3, and 4. These band sizes can be seen in between the 200 and 100bp fragments of the 1 Kb+ DNA ladder markers, which are loaded into lanes 1 and 11 of the gel. Lane 5 shows a large Mbo II band of approximately 600bp that was obtained from the positive interrupted GAA repeat sequence from the “NEP” BAC transgenic mouse that contains approximately 500 triplet repeats with the previously determined interrupted sequence of (GAA) 21 (GGAGAA) 5 (GGAGGAGAA) 70 (GAA) n ( Holloway et al., 2011 ). In addition for this positive sample, we also identified the expected 5′ flanking band of 170bp, together with a smaller band of less than 100bp that we sequenced and we showed to contain a 27bp deletion in the 3′ flanking region. Lane 6 shows an abnormal band of 200bp representing the 80bp duplication in the 3′ GAA flanking region. Lane 7 shows an abnormal band of approximately 100bp representing the 19bp deletion in the 3′ GAA flanking region. Lanes 8, 9, and 10 contain abnormal bands of approximately 300, 100, and 180bp, respectively, that are likely to contain a region of interrupted GAA repeat sequence within the body of one or other of the large FRDA GAA repeat expansions.
    Figure Legend Snippet: Mbo II digest results. Agarose gel showing Mbo II digests of GAA PCR products of FRDA samples. The expected 170bp (5′) and 120bp (3′) undigested GAA-flanking fragments from normal pure GAA repeat expansion FRDA samples are shown in lanes 2, 3, and 4. These band sizes can be seen in between the 200 and 100bp fragments of the 1 Kb+ DNA ladder markers, which are loaded into lanes 1 and 11 of the gel. Lane 5 shows a large Mbo II band of approximately 600bp that was obtained from the positive interrupted GAA repeat sequence from the “NEP” BAC transgenic mouse that contains approximately 500 triplet repeats with the previously determined interrupted sequence of (GAA) 21 (GGAGAA) 5 (GGAGGAGAA) 70 (GAA) n ( Holloway et al., 2011 ). In addition for this positive sample, we also identified the expected 5′ flanking band of 170bp, together with a smaller band of less than 100bp that we sequenced and we showed to contain a 27bp deletion in the 3′ flanking region. Lane 6 shows an abnormal band of 200bp representing the 80bp duplication in the 3′ GAA flanking region. Lane 7 shows an abnormal band of approximately 100bp representing the 19bp deletion in the 3′ GAA flanking region. Lanes 8, 9, and 10 contain abnormal bands of approximately 300, 100, and 180bp, respectively, that are likely to contain a region of interrupted GAA repeat sequence within the body of one or other of the large FRDA GAA repeat expansions.

    Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Sequencing, BAC Assay, Transgenic Assay

    Mbo II digests of GAA repeat expansions from human FRDA somatic tissues and mouse FRDA intergenerational and somatic tissues. Agarose gels showing Mbo II digests of GAA PCR products of (A) FRDA patient cerebellum tissue samples, (B) YG8sR mouse ear biopsy samples and human FRDA blood samples, and (C) four tissues from one YG8sR mouse. In each case, the expected 170 and 120bp undigested GAA-flanking fragments can be identified in between the 200 and 100bp fragments of the 1 Kb+ DNA ladder marker, which is loaded into the first lane of each gel. (A) Lanes 1–3 show the results from cerebellum tissue samples from three FRDA patients. (B) Lanes 1 and 2 are from FRDA patient blood samples; lanes 3–6 are from ear biopsy samples from 4 GAA repeat expansion-based YG8sR mice of four different generations, and lane 7 is from an ear biopsy sample from the Y47R mouse which has nine GAA repeats. (C) Lanes 1–4 are from brain, cerebellum, heart, and liver tissues of the YG8sR mouse, respectively.
    Figure Legend Snippet: Mbo II digests of GAA repeat expansions from human FRDA somatic tissues and mouse FRDA intergenerational and somatic tissues. Agarose gels showing Mbo II digests of GAA PCR products of (A) FRDA patient cerebellum tissue samples, (B) YG8sR mouse ear biopsy samples and human FRDA blood samples, and (C) four tissues from one YG8sR mouse. In each case, the expected 170 and 120bp undigested GAA-flanking fragments can be identified in between the 200 and 100bp fragments of the 1 Kb+ DNA ladder marker, which is loaded into the first lane of each gel. (A) Lanes 1–3 show the results from cerebellum tissue samples from three FRDA patients. (B) Lanes 1 and 2 are from FRDA patient blood samples; lanes 3–6 are from ear biopsy samples from 4 GAA repeat expansion-based YG8sR mice of four different generations, and lane 7 is from an ear biopsy sample from the Y47R mouse which has nine GAA repeats. (C) Lanes 1–4 are from brain, cerebellum, heart, and liver tissues of the YG8sR mouse, respectively.

    Techniques Used: Polymerase Chain Reaction, Marker, Mouse Assay

    3) Product Images from "Soluble vascular endothelial growth factor receptor 3 is essential for corneal alymphaticity"

    Article Title: Soluble vascular endothelial growth factor receptor 3 is essential for corneal alymphaticity

    Journal: Blood

    doi: 10.1182/blood-2012-08-453043

    sVEGFR-3 is expressed in corneal epithelium and antagonizes VEGF-C. (A) Reverse-transcriptase PCRs (RT-PCRs) with intron-tail–specific reverse primer and exon-exon junction forward primers showing sVEGFR-3 in mouse cornea. Membrane VEGFR-3 mRNA expression in sclera only. (B) Western blot of corneal and scleral lysate (n = 5) with anti–VEGFR-3 N-terminal antibody demonstrates sVEGFR-3 at 60 kDa in cornea and membrane VEGFR-3 at 170 kDa in sclera. (C) Western blot of corneal and scleral lysate (n = 5) with anti–VEGFR-3 C-terminal antibody demonstrates the expression of membrane VEGFR-3 at 170 kDa in sclera only (none in cornea). (D) Immunolocalization of sVEGFR-3 (brown) in human cornea via an intron-derived C-terminal tail, human sVEGFR-3 antibody (PA 4835; Thermo Scientific). Isotype-negative control rabbit IgG. (E) RT-PCR and western blot of mouse cornea shows VEGF-C mRNA and protein. (F) Western blot of corneal lysate (n = 5) with anti–VEGFR-3 N-terminal antibody, blotted with anti–VEGF-C antibody under reducing (1) and native conditions (2), reveals binding of sVEGFR-3 to VEGF-C. (G) Sandwich ELISA with anti–VEGF-C–coated antibodies in 96-well plates, followed by the addition of corneal lysate (n = 5, each group; corneas from 3 mice in each sample), and then anti–VEGF-C, anti–VEGFR-3 N-terminal, and anti–N-terminal VEGFR-2 antibodies. (H) Competitive ELISA with human recombinant VEGF-C coated on 96-well plates and equimolar human recombinant VEGFR-3 and VEGFR-2 with extracellular domains added, showing affinity and binding to VEGF-C (n = 5). GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IP, immunoprecipitation; M, marker; mVEGFR-3, membrane VEGFR-3; WB, western blot.
    Figure Legend Snippet: sVEGFR-3 is expressed in corneal epithelium and antagonizes VEGF-C. (A) Reverse-transcriptase PCRs (RT-PCRs) with intron-tail–specific reverse primer and exon-exon junction forward primers showing sVEGFR-3 in mouse cornea. Membrane VEGFR-3 mRNA expression in sclera only. (B) Western blot of corneal and scleral lysate (n = 5) with anti–VEGFR-3 N-terminal antibody demonstrates sVEGFR-3 at 60 kDa in cornea and membrane VEGFR-3 at 170 kDa in sclera. (C) Western blot of corneal and scleral lysate (n = 5) with anti–VEGFR-3 C-terminal antibody demonstrates the expression of membrane VEGFR-3 at 170 kDa in sclera only (none in cornea). (D) Immunolocalization of sVEGFR-3 (brown) in human cornea via an intron-derived C-terminal tail, human sVEGFR-3 antibody (PA 4835; Thermo Scientific). Isotype-negative control rabbit IgG. (E) RT-PCR and western blot of mouse cornea shows VEGF-C mRNA and protein. (F) Western blot of corneal lysate (n = 5) with anti–VEGFR-3 N-terminal antibody, blotted with anti–VEGF-C antibody under reducing (1) and native conditions (2), reveals binding of sVEGFR-3 to VEGF-C. (G) Sandwich ELISA with anti–VEGF-C–coated antibodies in 96-well plates, followed by the addition of corneal lysate (n = 5, each group; corneas from 3 mice in each sample), and then anti–VEGF-C, anti–VEGFR-3 N-terminal, and anti–N-terminal VEGFR-2 antibodies. (H) Competitive ELISA with human recombinant VEGF-C coated on 96-well plates and equimolar human recombinant VEGFR-3 and VEGFR-2 with extracellular domains added, showing affinity and binding to VEGF-C (n = 5). GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IP, immunoprecipitation; M, marker; mVEGFR-3, membrane VEGFR-3; WB, western blot.

    Techniques Used: Expressing, Western Blot, Derivative Assay, Negative Control, Reverse Transcription Polymerase Chain Reaction, Binding Assay, Sandwich ELISA, Mouse Assay, Competitive ELISA, Recombinant, Immunoprecipitation, Marker

    Corneal injury induces lymphangiogenesis, upregulation of VEGF-C, and membrane VEGFR-3 expression. (A) Immunostaining of normal and sutured cornea on day 3 reveals sVEGFR-3 and VEGF-C upregulation at the site of suture, indicating that sVEGFR-3 initially tends to capture VEGF-C and control VEGF-C surge. Negative controls are sections stained with isotype-control primary antibodies. (B) Real-time PCR of normal and sutured cornea on day 3 revealing mechanical trauma leads to instant increase in VEGF-C mRNA levels (n = 5). (C) Western blot of normal (1) and sutured cornea (2) on day 5 leads to expression of membrane VEGFR-3 (170 kDa) in sutured cornea that leads to signaling through VEGFR-3 and development of lymphatic vessels.
    Figure Legend Snippet: Corneal injury induces lymphangiogenesis, upregulation of VEGF-C, and membrane VEGFR-3 expression. (A) Immunostaining of normal and sutured cornea on day 3 reveals sVEGFR-3 and VEGF-C upregulation at the site of suture, indicating that sVEGFR-3 initially tends to capture VEGF-C and control VEGF-C surge. Negative controls are sections stained with isotype-control primary antibodies. (B) Real-time PCR of normal and sutured cornea on day 3 revealing mechanical trauma leads to instant increase in VEGF-C mRNA levels (n = 5). (C) Western blot of normal (1) and sutured cornea (2) on day 5 leads to expression of membrane VEGFR-3 (170 kDa) in sutured cornea that leads to signaling through VEGFR-3 and development of lymphatic vessels.

    Techniques Used: Expressing, Immunostaining, Staining, Real-time Polymerase Chain Reaction, Western Blot

    4) Product Images from "A Single Nucleotide Polymorphism Associated with Hepatitis C Virus Infections Located in the Distal Region of the IL28B Promoter Influences NF-?B-Mediated Gene Transcription"

    Article Title: A Single Nucleotide Polymorphism Associated with Hepatitis C Virus Infections Located in the Distal Region of the IL28B Promoter Influences NF-?B-Mediated Gene Transcription

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0075495

    rs28416813 is in LD with rs12979860. A) EtBr-stained gel of the PCR products that were amplified from the IL28A and IL28B promoters that included the SNP rs28416813 by the same set of primers because of high homology between the two genes at their 5′ ends [35] . The ∼2 kb fragment specific to IL28B was excised from gels purified and subject to DNA sequencing to genotype the SNP rs28416813. 1 and 2 are samples from two different patients. Ma-DNA Mol. Wt. marker. B) Pairwise LD plots for the three SNPs genotyped from a cohort of patients with chronic HCV infections in India (n = 20) (top) and LD plots for the SNPs from genotype data of a CEU population available from the 1000 genomes project database (bottom). The plots were generated using LDHeatmap [20] .
    Figure Legend Snippet: rs28416813 is in LD with rs12979860. A) EtBr-stained gel of the PCR products that were amplified from the IL28A and IL28B promoters that included the SNP rs28416813 by the same set of primers because of high homology between the two genes at their 5′ ends [35] . The ∼2 kb fragment specific to IL28B was excised from gels purified and subject to DNA sequencing to genotype the SNP rs28416813. 1 and 2 are samples from two different patients. Ma-DNA Mol. Wt. marker. B) Pairwise LD plots for the three SNPs genotyped from a cohort of patients with chronic HCV infections in India (n = 20) (top) and LD plots for the SNPs from genotype data of a CEU population available from the 1000 genomes project database (bottom). The plots were generated using LDHeatmap [20] .

    Techniques Used: Staining, Polymerase Chain Reaction, Amplification, Purification, DNA Sequencing, Marker, Generated

    5) Product Images from "Large Interruptions of GAA Repeat Expansion Mutations in Friedreich Ataxia Are Very Rare"

    Article Title: Large Interruptions of GAA Repeat Expansion Mutations in Friedreich Ataxia Are Very Rare

    Journal: Frontiers in Cellular Neuroscience

    doi: 10.3389/fncel.2018.00443

    Mbo II digest results. Agarose gel showing Mbo II digests of GAA PCR products of FRDA samples. The expected 170bp (5′) and 120bp (3′) undigested GAA-flanking fragments from normal pure GAA repeat expansion FRDA samples are shown in lanes 2, 3, and 4. These band sizes can be seen in between the 200 and 100bp fragments of the 1 Kb+ DNA ladder markers, which are loaded into lanes 1 and 11 of the gel. Lane 5 shows a large Mbo II band of approximately 600bp that was obtained from the positive interrupted GAA repeat sequence from the “NEP” BAC transgenic mouse that contains approximately 500 triplet repeats with the previously determined interrupted sequence of (GAA) 21 (GGAGAA) 5 (GGAGGAGAA) 70 (GAA) n ). In addition for this positive sample, we also identified the expected 5′ flanking band of 170bp, together with a smaller band of less than 100bp that we sequenced and we showed to contain a 27bp deletion in the 3′ flanking region. Lane 6 shows an abnormal band of 200bp representing the 80bp duplication in the 3′ GAA flanking region. Lane 7 shows an abnormal band of approximately 100bp representing the 19bp deletion in the 3′ GAA flanking region. Lanes 8, 9, and 10 contain abnormal bands of approximately 300, 100, and 180bp, respectively, that are likely to contain a region of interrupted GAA repeat sequence within the body of one or other of the large FRDA GAA repeat expansions.
    Figure Legend Snippet: Mbo II digest results. Agarose gel showing Mbo II digests of GAA PCR products of FRDA samples. The expected 170bp (5′) and 120bp (3′) undigested GAA-flanking fragments from normal pure GAA repeat expansion FRDA samples are shown in lanes 2, 3, and 4. These band sizes can be seen in between the 200 and 100bp fragments of the 1 Kb+ DNA ladder markers, which are loaded into lanes 1 and 11 of the gel. Lane 5 shows a large Mbo II band of approximately 600bp that was obtained from the positive interrupted GAA repeat sequence from the “NEP” BAC transgenic mouse that contains approximately 500 triplet repeats with the previously determined interrupted sequence of (GAA) 21 (GGAGAA) 5 (GGAGGAGAA) 70 (GAA) n ). In addition for this positive sample, we also identified the expected 5′ flanking band of 170bp, together with a smaller band of less than 100bp that we sequenced and we showed to contain a 27bp deletion in the 3′ flanking region. Lane 6 shows an abnormal band of 200bp representing the 80bp duplication in the 3′ GAA flanking region. Lane 7 shows an abnormal band of approximately 100bp representing the 19bp deletion in the 3′ GAA flanking region. Lanes 8, 9, and 10 contain abnormal bands of approximately 300, 100, and 180bp, respectively, that are likely to contain a region of interrupted GAA repeat sequence within the body of one or other of the large FRDA GAA repeat expansions.

    Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Sequencing, BAC Assay, Transgenic Assay

    Mbo II digests of GAA repeat expansions from human FRDA somatic tissues and mouse FRDA intergenerational and somatic tissues. Agarose gels showing Mbo II digests of GAA PCR products of (A) FRDA patient cerebellum tissue samples, (B) YG8sR mouse ear biopsy samples and human FRDA blood samples, and (C) four tissues from one YG8sR mouse. In each case, the expected 170 and 120bp undigested GAA-flanking fragments can be identified in between the 200 and 100bp fragments of the 1 Kb+ DNA ladder marker, which is loaded into the first lane of each gel. (A) Lanes 1–3 show the results from cerebellum tissue samples from three FRDA patients. (B) Lanes 1 and 2 are from FRDA patient blood samples; lanes 3–6 are from ear biopsy samples from 4 GAA repeat expansion-based YG8sR mice of four different generations, and lane 7 is from an ear biopsy sample from the Y47R mouse which has nine GAA repeats. (C) Lanes 1–4 are from brain, cerebellum, heart, and liver tissues of the YG8sR mouse, respectively.
    Figure Legend Snippet: Mbo II digests of GAA repeat expansions from human FRDA somatic tissues and mouse FRDA intergenerational and somatic tissues. Agarose gels showing Mbo II digests of GAA PCR products of (A) FRDA patient cerebellum tissue samples, (B) YG8sR mouse ear biopsy samples and human FRDA blood samples, and (C) four tissues from one YG8sR mouse. In each case, the expected 170 and 120bp undigested GAA-flanking fragments can be identified in between the 200 and 100bp fragments of the 1 Kb+ DNA ladder marker, which is loaded into the first lane of each gel. (A) Lanes 1–3 show the results from cerebellum tissue samples from three FRDA patients. (B) Lanes 1 and 2 are from FRDA patient blood samples; lanes 3–6 are from ear biopsy samples from 4 GAA repeat expansion-based YG8sR mice of four different generations, and lane 7 is from an ear biopsy sample from the Y47R mouse which has nine GAA repeats. (C) Lanes 1–4 are from brain, cerebellum, heart, and liver tissues of the YG8sR mouse, respectively.

    Techniques Used: Polymerase Chain Reaction, Marker, Mouse Assay

    6) Product Images from "An entire exon 3 germ-line rearrangement in the BRCA2 gene: pathogenic relevance of exon 3 deletion in breast cancer predisposition"

    Article Title: An entire exon 3 germ-line rearrangement in the BRCA2 gene: pathogenic relevance of exon 3 deletion in breast cancer predisposition

    Journal: BMC Medical Genetics

    doi: 10.1186/1471-2350-12-121

    Genomic analysis of the Δ3 BRCA2 large rearrangement . a: Dedicated BRCA2 CGH array . The gene is represented at the top, with vertical boxes that indicate exon positions and sizes. Black plots are considered to be within the diploidy range (the y axis gives the log2 intensity ratios). The green dots indicate signals that were below the threshold for deletion (-0.4 log2 ratio). b: Sequence analysis of the smaller PCR product obtained by long-range PCR of proband DNA with the exon 3 large rearrangement in BRCA2 (Hg18/build36, 2006). The sequence crosses the breakpoint that begins in intron 2 and ends in intron 3.
    Figure Legend Snippet: Genomic analysis of the Δ3 BRCA2 large rearrangement . a: Dedicated BRCA2 CGH array . The gene is represented at the top, with vertical boxes that indicate exon positions and sizes. Black plots are considered to be within the diploidy range (the y axis gives the log2 intensity ratios). The green dots indicate signals that were below the threshold for deletion (-0.4 log2 ratio). b: Sequence analysis of the smaller PCR product obtained by long-range PCR of proband DNA with the exon 3 large rearrangement in BRCA2 (Hg18/build36, 2006). The sequence crosses the breakpoint that begins in intron 2 and ends in intron 3.

    Techniques Used: Sequencing, Polymerase Chain Reaction

    7) Product Images from "MYST Family Lysine Acetyltransferase Facilitates Ataxia Telangiectasia Mutated (ATM) Kinase-mediated DNA Damage Response in Toxoplasma gondii *"

    Article Title: MYST Family Lysine Acetyltransferase Facilitates Ataxia Telangiectasia Mutated (ATM) Kinase-mediated DNA Damage Response in Toxoplasma gondii *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M109.066134

    A , relative gene expression of TgMYST-B, ATM kinase, and actin in WT, fMYST-B, or fMYST-B(E403G) tachyzoites as assayed by real-time PCR. B , ChIP followed by PCR analysis of four regions proximal to the ATM kinase start site. ChIP was performed on both
    Figure Legend Snippet: A , relative gene expression of TgMYST-B, ATM kinase, and actin in WT, fMYST-B, or fMYST-B(E403G) tachyzoites as assayed by real-time PCR. B , ChIP followed by PCR analysis of four regions proximal to the ATM kinase start site. ChIP was performed on both

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Chromatin Immunoprecipitation, Polymerase Chain Reaction

    8) Product Images from "Sequence Variation within the KIV-2 Copy Number Polymorphism of the Human LPA Gene in African, Asian, and European Populations"

    Article Title: Sequence Variation within the KIV-2 Copy Number Polymorphism of the Human LPA Gene in African, Asian, and European Populations

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0121582

    Positions of the PCR primers and regions amplified for cloning and batchwise screening. Below a stretch of KIV-2 domains showing the positions of the exons and the short and long introns in the KIV-2 CNV, the regions amplified by the different PCRs are depicted by horizontal lines with the names of the PCRs written above and the primers below. PCRs “421” and “422” are spanning the first and second exon of the KIV-2 respectively, and also contain the flanking intron sequences. These two PCRs were used in the batchwise screening and cloning. PCR “412to422” amplifies both exons and the long intron, while PCR “422to421” includes both exons and the short intron. The locations of the different primers used for sequencing are shown above the depicted stretch of KIV-2 CNV. The figure is drawn to scale (2.5 cm = 1 kb).
    Figure Legend Snippet: Positions of the PCR primers and regions amplified for cloning and batchwise screening. Below a stretch of KIV-2 domains showing the positions of the exons and the short and long introns in the KIV-2 CNV, the regions amplified by the different PCRs are depicted by horizontal lines with the names of the PCRs written above and the primers below. PCRs “421” and “422” are spanning the first and second exon of the KIV-2 respectively, and also contain the flanking intron sequences. These two PCRs were used in the batchwise screening and cloning. PCR “412to422” amplifies both exons and the long intron, while PCR “422to421” includes both exons and the short intron. The locations of the different primers used for sequencing are shown above the depicted stretch of KIV-2 CNV. The figure is drawn to scale (2.5 cm = 1 kb).

    Techniques Used: Polymerase Chain Reaction, Amplification, Clone Assay, Sequencing

    Related Articles

    Polymerase Chain Reaction:

    Article Title: An entire exon 3 germ-line rearrangement in the BRCA2 gene: pathogenic relevance of exon 3 deletion in breast cancer predisposition
    Article Snippet: .. DNA breakpoints analysis The breakpoints were characterized by long-range PCR of genomic DNA using the Qiagen Long-Range PCR kit (Qiagen, Germany). .. 150 ng of DNA was amplified with a primer pair that tightly flanks the respective breakpoint regions identified by the CGH-array in a reaction volume of 25 μl (Table ).

    Article Title: Preimplantation High-Resolution HLA Sequencing Using Next Generation Sequencing.
    Article Snippet: .. The kit provides the LongRange PCR Kit (Qiagen, Hilden, Germany) and multiple primers for the 5 HLA loci including HLA-A, -B, -C, -DRB1, and -DQB1. ..

    Article Title: Targeted next-generation sequencing of DNA regions proximal to a conserved GXGXXG signaling motif enables systematic discovery of tyrosine kinase fusions in cancer
    Article Snippet: .. Long-range PCR Long-range PCR was performed with the LongRange PCR Kit (QIAGEN), as per the manufacturer’s instructions. .. An FGFR1OP2 -F primer (AGATGATCCGGGTATAATAA) within exon 4 and an FGFR1 -R primer (AGAAGAACCCCAGAGTTCAT) within exon 10 were used to amplify the genomic fusion sequence.

    Article Title: Identification of Variants of Hepatitis C Virus (HCV) Entry Factors in Patients Highly Exposed to HCV but Remaining Uninfected: An ANRS Case-Control Study
    Article Snippet: .. To avoid amplification of the pseudogene for exons 6 to 9 of the OCLN gene, long-range (LR) PCR (Qiagen LongRange PCR Kit) was used as an intermediate step before PCR amplification of the exon. .. LR PCR amplification consisted of 10 min at 94°C followed by 30 cycles of 20 s at 94°C, 1 min at 68°C and 5 min at 72°C, and a final 10-min elongation step at 72°C.

    Article Title: Complete mitochondrial genome sequences from five Eimeria species (Apicomplexa; Coccidia; Eimeriidae) infecting domestic turkeys
    Article Snippet: .. PCR reactions using QIAGEN LongRange PCR kit (QIAGEN, Valencia, CA, USA) protocol according to the manufacturer’s instructions with the modification that an additional 1.5 mM MgCl2 was added to the PCR buffer provided by the manufacturer. .. For each Eimeria species, long PCR reactions consisted of ~200 ng genomic DNA template (when using the Inv_COI_461F/Inv_COI_262R primers), and 25 ng genomic DNA template (when using primers Cocci_MT-WG-F and Cocci_MT-WG-R), 1× LongRange PCR buffer, 4 mM MgCl2 , 500 μM of each dNTP, 2U LongRange PCR enzyme mix and 0.4 μM of each primer.

    Article Title: A Single Nucleotide Polymorphism Associated with Hepatitis C Virus Infections Located in the Distal Region of the IL28B Promoter Influences NF-?B-Mediated Gene Transcription
    Article Snippet: .. The SNP rs28416813 was amplified with the Long-range PCR kit from Qiagen by using: Forward primer 1.9kbrs813KpnIFor2 (5′GATATCGGTACCTGCATTGTACGACCCTCCAAC-3′) and reverse primer: 1.9kbil28b12aaHIIIREV1 (5′GATATCAAGCTTCAGCACTGCGGCCATCAG-3′). .. Due to high sequence homology between IL28A and IL28B the primers gave rise to two amplicons of sizes 2673 bp corresponding to promoter of IL28A and 1975 bp corresponding to that of IL28B .

    Article Title: Rare recombination events generate sequence diversity among balancer chromosomes in Drosophila melanogaster
    Article Snippet: .. Long-range PCR of the junction between the two duplicated B 1 regions was performed using the Qiagen LongRange PCR Kit (catalog no. 206402) using 250 ng of genomic DNA, with a 59 °C annealing temperature, and 9-min extension time. .. We visually screened 630 stocks from the Bloomington Drosophila Stock Center that were labeled as carrying FM7c for the presence or absence of the sn phenotype in B males.

    Article Title: AAV-Mediated CRISPR/Cas9 Gene Editing in Murine Phenylketonuria
    Article Snippet: .. On-Target PCR Amplicon Preparation The QIAGEN LongRange PCR Kit was used according to the manufacturer’s protocol on genomic liver DNA using a forward primer targeting genomic DNA 58 bp upstream of the 5′ end of the repair template sequence, 5′-AGTTACTGTCGTTTGCAATGCCGC-3′, and a reverse primer, 5′-GCACAGTAGCCACTAATTCTCTCCTTAG-3′, located 426 bp downstream of the C836T mutation within the repair template region. .. A secondary nested PCR was performed using the 5′-GGGTTGTAGTCTCTCTGGATTTACCA-3′ forward primer and 5′-GCACAGTAGCCACTAATTCTCTCCTTAG-3′ reverse primer with Invitrogen Platinum Taq DNA Polymerase according to the manufacturer’s recommendations.

    Modification:

    Article Title: Complete mitochondrial genome sequences from five Eimeria species (Apicomplexa; Coccidia; Eimeriidae) infecting domestic turkeys
    Article Snippet: .. PCR reactions using QIAGEN LongRange PCR kit (QIAGEN, Valencia, CA, USA) protocol according to the manufacturer’s instructions with the modification that an additional 1.5 mM MgCl2 was added to the PCR buffer provided by the manufacturer. .. For each Eimeria species, long PCR reactions consisted of ~200 ng genomic DNA template (when using the Inv_COI_461F/Inv_COI_262R primers), and 25 ng genomic DNA template (when using primers Cocci_MT-WG-F and Cocci_MT-WG-R), 1× LongRange PCR buffer, 4 mM MgCl2 , 500 μM of each dNTP, 2U LongRange PCR enzyme mix and 0.4 μM of each primer.

    Amplification:

    Article Title: Identification of Variants of Hepatitis C Virus (HCV) Entry Factors in Patients Highly Exposed to HCV but Remaining Uninfected: An ANRS Case-Control Study
    Article Snippet: .. To avoid amplification of the pseudogene for exons 6 to 9 of the OCLN gene, long-range (LR) PCR (Qiagen LongRange PCR Kit) was used as an intermediate step before PCR amplification of the exon. .. LR PCR amplification consisted of 10 min at 94°C followed by 30 cycles of 20 s at 94°C, 1 min at 68°C and 5 min at 72°C, and a final 10-min elongation step at 72°C.

    Article Title: A Single Nucleotide Polymorphism Associated with Hepatitis C Virus Infections Located in the Distal Region of the IL28B Promoter Influences NF-?B-Mediated Gene Transcription
    Article Snippet: .. The SNP rs28416813 was amplified with the Long-range PCR kit from Qiagen by using: Forward primer 1.9kbrs813KpnIFor2 (5′GATATCGGTACCTGCATTGTACGACCCTCCAAC-3′) and reverse primer: 1.9kbil28b12aaHIIIREV1 (5′GATATCAAGCTTCAGCACTGCGGCCATCAG-3′). .. Due to high sequence homology between IL28A and IL28B the primers gave rise to two amplicons of sizes 2673 bp corresponding to promoter of IL28A and 1975 bp corresponding to that of IL28B .

    Article Title: AAV-Mediated CRISPR/Cas9 Gene Editing in Murine Phenylketonuria
    Article Snippet: .. On-Target PCR Amplicon Preparation The QIAGEN LongRange PCR Kit was used according to the manufacturer’s protocol on genomic liver DNA using a forward primer targeting genomic DNA 58 bp upstream of the 5′ end of the repair template sequence, 5′-AGTTACTGTCGTTTGCAATGCCGC-3′, and a reverse primer, 5′-GCACAGTAGCCACTAATTCTCTCCTTAG-3′, located 426 bp downstream of the C836T mutation within the repair template region. .. A secondary nested PCR was performed using the 5′-GGGTTGTAGTCTCTCTGGATTTACCA-3′ forward primer and 5′-GCACAGTAGCCACTAATTCTCTCCTTAG-3′ reverse primer with Invitrogen Platinum Taq DNA Polymerase according to the manufacturer’s recommendations.

    Sequencing:

    Article Title: AAV-Mediated CRISPR/Cas9 Gene Editing in Murine Phenylketonuria
    Article Snippet: .. On-Target PCR Amplicon Preparation The QIAGEN LongRange PCR Kit was used according to the manufacturer’s protocol on genomic liver DNA using a forward primer targeting genomic DNA 58 bp upstream of the 5′ end of the repair template sequence, 5′-AGTTACTGTCGTTTGCAATGCCGC-3′, and a reverse primer, 5′-GCACAGTAGCCACTAATTCTCTCCTTAG-3′, located 426 bp downstream of the C836T mutation within the repair template region. .. A secondary nested PCR was performed using the 5′-GGGTTGTAGTCTCTCTGGATTTACCA-3′ forward primer and 5′-GCACAGTAGCCACTAATTCTCTCCTTAG-3′ reverse primer with Invitrogen Platinum Taq DNA Polymerase according to the manufacturer’s recommendations.

    Mutagenesis:

    Article Title: AAV-Mediated CRISPR/Cas9 Gene Editing in Murine Phenylketonuria
    Article Snippet: .. On-Target PCR Amplicon Preparation The QIAGEN LongRange PCR Kit was used according to the manufacturer’s protocol on genomic liver DNA using a forward primer targeting genomic DNA 58 bp upstream of the 5′ end of the repair template sequence, 5′-AGTTACTGTCGTTTGCAATGCCGC-3′, and a reverse primer, 5′-GCACAGTAGCCACTAATTCTCTCCTTAG-3′, located 426 bp downstream of the C836T mutation within the repair template region. .. A secondary nested PCR was performed using the 5′-GGGTTGTAGTCTCTCTGGATTTACCA-3′ forward primer and 5′-GCACAGTAGCCACTAATTCTCTCCTTAG-3′ reverse primer with Invitrogen Platinum Taq DNA Polymerase according to the manufacturer’s recommendations.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen long range rt pcr kit
    Characterization of ectopically expressed RNAs by long range <t>RT-PCR.</t> MDA-MB-231 parental cell line (231-parental), its pcDNA3-ERα stable transfectant (ERα-2), and its ERα-IRES stable transfectants (ERα-IRES-5 and ERα-IRES-3) were analyzed for expression of ERα–harboring transcript (1.8 kb), Hygromycin B resistance gene-containing transcript (1.0 kb), and ERα-IRES-Hygro R fused transcript (3.2 kb), by RT followed by long range PCR amplification. pERα-IRES DNA served as a PCR positive control for the ERα <t>cDNA</t> primers (1.8 kb), the Hygromycin B resistance gene ORF primers (1.0 kb), and the 5′ sense ERα primer plus 3′ antisense Hygro R fused ORFs primers (3.5 kb). A First four lanes from left contain the ERα cDNA primers; lanes 5–8 the 5′ sense ERα primer together with the 3′ antisense Hygro R gene primer. B. The 5′ sense ERα primer together with the 3′ antisense Hygro R gene primer. C. Lanes 1 and 2 from left, the ERα primers. Lanes 3 and 4 the Hygro R gene primers. Primer sequences are detailed in the “ Methods ” section.
    Long Range Rt Pcr Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 49 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/long range rt pcr kit/product/Qiagen
    Average 99 stars, based on 49 article reviews
    Price from $9.99 to $1999.99
    long range rt pcr kit - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    Image Search Results


    Characterization of ectopically expressed RNAs by long range RT-PCR. MDA-MB-231 parental cell line (231-parental), its pcDNA3-ERα stable transfectant (ERα-2), and its ERα-IRES stable transfectants (ERα-IRES-5 and ERα-IRES-3) were analyzed for expression of ERα–harboring transcript (1.8 kb), Hygromycin B resistance gene-containing transcript (1.0 kb), and ERα-IRES-Hygro R fused transcript (3.2 kb), by RT followed by long range PCR amplification. pERα-IRES DNA served as a PCR positive control for the ERα cDNA primers (1.8 kb), the Hygromycin B resistance gene ORF primers (1.0 kb), and the 5′ sense ERα primer plus 3′ antisense Hygro R fused ORFs primers (3.5 kb). A First four lanes from left contain the ERα cDNA primers; lanes 5–8 the 5′ sense ERα primer together with the 3′ antisense Hygro R gene primer. B. The 5′ sense ERα primer together with the 3′ antisense Hygro R gene primer. C. Lanes 1 and 2 from left, the ERα primers. Lanes 3 and 4 the Hygro R gene primers. Primer sequences are detailed in the “ Methods ” section.

    Journal: PLoS ONE

    Article Title: ER-Alpha-cDNA As Part of a Bicistronic Transcript Gives Rise to High Frequency, Long Term, Receptor Expressing Cell Clones

    doi: 10.1371/journal.pone.0031977

    Figure Lengend Snippet: Characterization of ectopically expressed RNAs by long range RT-PCR. MDA-MB-231 parental cell line (231-parental), its pcDNA3-ERα stable transfectant (ERα-2), and its ERα-IRES stable transfectants (ERα-IRES-5 and ERα-IRES-3) were analyzed for expression of ERα–harboring transcript (1.8 kb), Hygromycin B resistance gene-containing transcript (1.0 kb), and ERα-IRES-Hygro R fused transcript (3.2 kb), by RT followed by long range PCR amplification. pERα-IRES DNA served as a PCR positive control for the ERα cDNA primers (1.8 kb), the Hygromycin B resistance gene ORF primers (1.0 kb), and the 5′ sense ERα primer plus 3′ antisense Hygro R fused ORFs primers (3.5 kb). A First four lanes from left contain the ERα cDNA primers; lanes 5–8 the 5′ sense ERα primer together with the 3′ antisense Hygro R gene primer. B. The 5′ sense ERα primer together with the 3′ antisense Hygro R gene primer. C. Lanes 1 and 2 from left, the ERα primers. Lanes 3 and 4 the Hygro R gene primers. Primer sequences are detailed in the “ Methods ” section.

    Article Snippet: Two µg of total RNA extracted using EZ-RNA isolation kit (Biological Industries, Israel) were transcribed into first strand cDNA by hexamer priming, followed by PCR reactions as specified in the Long range RT-PCR kit (Qiagen).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Multiple Displacement Amplification, Transfection, Expressing, Polymerase Chain Reaction, Amplification, Positive Control

    RT-PCR analysis of the postulated ABC transporter genes 730–760. The positions of the different amplicons are shown below the scheme of the MHO_710–770 gene region. The primers used ( Table 1 ) and the lengths of the amplicons (A-G) are indicated. PCR products (A–G) for genomic DNA (g), mRNA (m) and cDNA (c) were separated on a 0.6% agarose gel and stained with ethidium bromide. M, Gene Ruler 1 kb DNA ladder (Fermentas).

    Journal: PLoS ONE

    Article Title: Validation of a novel Mho microarray for a comprehensive characterisation of the Mycoplasma hominis action in HeLa cell infection

    doi: 10.1371/journal.pone.0181383

    Figure Lengend Snippet: RT-PCR analysis of the postulated ABC transporter genes 730–760. The positions of the different amplicons are shown below the scheme of the MHO_710–770 gene region. The primers used ( Table 1 ) and the lengths of the amplicons (A-G) are indicated. PCR products (A–G) for genomic DNA (g), mRNA (m) and cDNA (c) were separated on a 0.6% agarose gel and stained with ethidium bromide. M, Gene Ruler 1 kb DNA ladder (Fermentas).

    Article Snippet: Overlapping regions of the MHO genes 720–770 were amplified using the Long Range PCR Kit (Qiagen, Hilden, Germany) by standard PCR conditions (initial cycle of 3 min at 93°C; 35 cycles of 15 s at 93°C, 30 s at 50°C, 10 min at 68°C).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Staining

    Mbo II digest results. Agarose gel showing Mbo II digests of GAA PCR products of FRDA samples. The expected 170bp (5′) and 120bp (3′) undigested GAA-flanking fragments from normal pure GAA repeat expansion FRDA samples are shown in lanes 2, 3, and 4. These band sizes can be seen in between the 200 and 100bp fragments of the 1 Kb+ DNA ladder markers, which are loaded into lanes 1 and 11 of the gel. Lane 5 shows a large Mbo II band of approximately 600bp that was obtained from the positive interrupted GAA repeat sequence from the “NEP” BAC transgenic mouse that contains approximately 500 triplet repeats with the previously determined interrupted sequence of (GAA) 21 (GGAGAA) 5 (GGAGGAGAA) 70 (GAA) n ( Holloway et al., 2011 ). In addition for this positive sample, we also identified the expected 5′ flanking band of 170bp, together with a smaller band of less than 100bp that we sequenced and we showed to contain a 27bp deletion in the 3′ flanking region. Lane 6 shows an abnormal band of 200bp representing the 80bp duplication in the 3′ GAA flanking region. Lane 7 shows an abnormal band of approximately 100bp representing the 19bp deletion in the 3′ GAA flanking region. Lanes 8, 9, and 10 contain abnormal bands of approximately 300, 100, and 180bp, respectively, that are likely to contain a region of interrupted GAA repeat sequence within the body of one or other of the large FRDA GAA repeat expansions.

    Journal: Frontiers in Cellular Neuroscience

    Article Title: Large Interruptions of GAA Repeat Expansion Mutations in Friedreich Ataxia Are Very Rare

    doi: 10.3389/fncel.2018.00443

    Figure Lengend Snippet: Mbo II digest results. Agarose gel showing Mbo II digests of GAA PCR products of FRDA samples. The expected 170bp (5′) and 120bp (3′) undigested GAA-flanking fragments from normal pure GAA repeat expansion FRDA samples are shown in lanes 2, 3, and 4. These band sizes can be seen in between the 200 and 100bp fragments of the 1 Kb+ DNA ladder markers, which are loaded into lanes 1 and 11 of the gel. Lane 5 shows a large Mbo II band of approximately 600bp that was obtained from the positive interrupted GAA repeat sequence from the “NEP” BAC transgenic mouse that contains approximately 500 triplet repeats with the previously determined interrupted sequence of (GAA) 21 (GGAGAA) 5 (GGAGGAGAA) 70 (GAA) n ( Holloway et al., 2011 ). In addition for this positive sample, we also identified the expected 5′ flanking band of 170bp, together with a smaller band of less than 100bp that we sequenced and we showed to contain a 27bp deletion in the 3′ flanking region. Lane 6 shows an abnormal band of 200bp representing the 80bp duplication in the 3′ GAA flanking region. Lane 7 shows an abnormal band of approximately 100bp representing the 19bp deletion in the 3′ GAA flanking region. Lanes 8, 9, and 10 contain abnormal bands of approximately 300, 100, and 180bp, respectively, that are likely to contain a region of interrupted GAA repeat sequence within the body of one or other of the large FRDA GAA repeat expansions.

    Article Snippet: We then performed long-range PCR of the samples (approximately 100 ng input DNA) using either the Expand High Fidelity PCR System, dNTPack (Roche), or the Long Range PCR Kit (Qiagen) together with GAA-B-F (5′-AATGGATTTCCTGGCAGGACGC-3′) and GAA-B-R (5′-GCATTGGGCGATCTTGGCTTAA-3′) primers as previously described ( ).

    Techniques: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Sequencing, BAC Assay, Transgenic Assay

    Mbo II digests of GAA repeat expansions from human FRDA somatic tissues and mouse FRDA intergenerational and somatic tissues. Agarose gels showing Mbo II digests of GAA PCR products of (A) FRDA patient cerebellum tissue samples, (B) YG8sR mouse ear biopsy samples and human FRDA blood samples, and (C) four tissues from one YG8sR mouse. In each case, the expected 170 and 120bp undigested GAA-flanking fragments can be identified in between the 200 and 100bp fragments of the 1 Kb+ DNA ladder marker, which is loaded into the first lane of each gel. (A) Lanes 1–3 show the results from cerebellum tissue samples from three FRDA patients. (B) Lanes 1 and 2 are from FRDA patient blood samples; lanes 3–6 are from ear biopsy samples from 4 GAA repeat expansion-based YG8sR mice of four different generations, and lane 7 is from an ear biopsy sample from the Y47R mouse which has nine GAA repeats. (C) Lanes 1–4 are from brain, cerebellum, heart, and liver tissues of the YG8sR mouse, respectively.

    Journal: Frontiers in Cellular Neuroscience

    Article Title: Large Interruptions of GAA Repeat Expansion Mutations in Friedreich Ataxia Are Very Rare

    doi: 10.3389/fncel.2018.00443

    Figure Lengend Snippet: Mbo II digests of GAA repeat expansions from human FRDA somatic tissues and mouse FRDA intergenerational and somatic tissues. Agarose gels showing Mbo II digests of GAA PCR products of (A) FRDA patient cerebellum tissue samples, (B) YG8sR mouse ear biopsy samples and human FRDA blood samples, and (C) four tissues from one YG8sR mouse. In each case, the expected 170 and 120bp undigested GAA-flanking fragments can be identified in between the 200 and 100bp fragments of the 1 Kb+ DNA ladder marker, which is loaded into the first lane of each gel. (A) Lanes 1–3 show the results from cerebellum tissue samples from three FRDA patients. (B) Lanes 1 and 2 are from FRDA patient blood samples; lanes 3–6 are from ear biopsy samples from 4 GAA repeat expansion-based YG8sR mice of four different generations, and lane 7 is from an ear biopsy sample from the Y47R mouse which has nine GAA repeats. (C) Lanes 1–4 are from brain, cerebellum, heart, and liver tissues of the YG8sR mouse, respectively.

    Article Snippet: We then performed long-range PCR of the samples (approximately 100 ng input DNA) using either the Expand High Fidelity PCR System, dNTPack (Roche), or the Long Range PCR Kit (Qiagen) together with GAA-B-F (5′-AATGGATTTCCTGGCAGGACGC-3′) and GAA-B-R (5′-GCATTGGGCGATCTTGGCTTAA-3′) primers as previously described ( ).

    Techniques: Polymerase Chain Reaction, Marker, Mouse Assay

    sVEGFR-3 is expressed in corneal epithelium and antagonizes VEGF-C. (A) Reverse-transcriptase PCRs (RT-PCRs) with intron-tail–specific reverse primer and exon-exon junction forward primers showing sVEGFR-3 in mouse cornea. Membrane VEGFR-3 mRNA expression in sclera only. (B) Western blot of corneal and scleral lysate (n = 5) with anti–VEGFR-3 N-terminal antibody demonstrates sVEGFR-3 at 60 kDa in cornea and membrane VEGFR-3 at 170 kDa in sclera. (C) Western blot of corneal and scleral lysate (n = 5) with anti–VEGFR-3 C-terminal antibody demonstrates the expression of membrane VEGFR-3 at 170 kDa in sclera only (none in cornea). (D) Immunolocalization of sVEGFR-3 (brown) in human cornea via an intron-derived C-terminal tail, human sVEGFR-3 antibody (PA 4835; Thermo Scientific). Isotype-negative control rabbit IgG. (E) RT-PCR and western blot of mouse cornea shows VEGF-C mRNA and protein. (F) Western blot of corneal lysate (n = 5) with anti–VEGFR-3 N-terminal antibody, blotted with anti–VEGF-C antibody under reducing (1) and native conditions (2), reveals binding of sVEGFR-3 to VEGF-C. (G) Sandwich ELISA with anti–VEGF-C–coated antibodies in 96-well plates, followed by the addition of corneal lysate (n = 5, each group; corneas from 3 mice in each sample), and then anti–VEGF-C, anti–VEGFR-3 N-terminal, and anti–N-terminal VEGFR-2 antibodies. (H) Competitive ELISA with human recombinant VEGF-C coated on 96-well plates and equimolar human recombinant VEGFR-3 and VEGFR-2 with extracellular domains added, showing affinity and binding to VEGF-C (n = 5). GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IP, immunoprecipitation; M, marker; mVEGFR-3, membrane VEGFR-3; WB, western blot.

    Journal: Blood

    Article Title: Soluble vascular endothelial growth factor receptor 3 is essential for corneal alymphaticity

    doi: 10.1182/blood-2012-08-453043

    Figure Lengend Snippet: sVEGFR-3 is expressed in corneal epithelium and antagonizes VEGF-C. (A) Reverse-transcriptase PCRs (RT-PCRs) with intron-tail–specific reverse primer and exon-exon junction forward primers showing sVEGFR-3 in mouse cornea. Membrane VEGFR-3 mRNA expression in sclera only. (B) Western blot of corneal and scleral lysate (n = 5) with anti–VEGFR-3 N-terminal antibody demonstrates sVEGFR-3 at 60 kDa in cornea and membrane VEGFR-3 at 170 kDa in sclera. (C) Western blot of corneal and scleral lysate (n = 5) with anti–VEGFR-3 C-terminal antibody demonstrates the expression of membrane VEGFR-3 at 170 kDa in sclera only (none in cornea). (D) Immunolocalization of sVEGFR-3 (brown) in human cornea via an intron-derived C-terminal tail, human sVEGFR-3 antibody (PA 4835; Thermo Scientific). Isotype-negative control rabbit IgG. (E) RT-PCR and western blot of mouse cornea shows VEGF-C mRNA and protein. (F) Western blot of corneal lysate (n = 5) with anti–VEGFR-3 N-terminal antibody, blotted with anti–VEGF-C antibody under reducing (1) and native conditions (2), reveals binding of sVEGFR-3 to VEGF-C. (G) Sandwich ELISA with anti–VEGF-C–coated antibodies in 96-well plates, followed by the addition of corneal lysate (n = 5, each group; corneas from 3 mice in each sample), and then anti–VEGF-C, anti–VEGFR-3 N-terminal, and anti–N-terminal VEGFR-2 antibodies. (H) Competitive ELISA with human recombinant VEGF-C coated on 96-well plates and equimolar human recombinant VEGFR-3 and VEGFR-2 with extracellular domains added, showing affinity and binding to VEGF-C (n = 5). GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IP, immunoprecipitation; M, marker; mVEGFR-3, membrane VEGFR-3; WB, western blot.

    Article Snippet: A total of 2 μg of RNA was reverse transcribed using complementary DNA (cDNA) cloning primer (QT) CCAGTGAGCAGAGTGACGAGGACTCGAGCTCAAGCTTTTTTTTTTTTTTTTT. cDNA was amplified using Q0-CCAGTGAGCAGAGTGACG and VEGFR-3 domain 4–specific forward primer ATCAACAAACCTGACACGCTCCTG using a Long Range PCR Kit (Qiagen), with the following polymerase chain reaction (PCR) conditions: 93°C for 3 minutes, 35 cycles of 93°C for 15 seconds, 55°C for 30 seconds, and 68°C for 5 minutes.

    Techniques: Expressing, Western Blot, Derivative Assay, Negative Control, Reverse Transcription Polymerase Chain Reaction, Binding Assay, Sandwich ELISA, Mouse Assay, Competitive ELISA, Recombinant, Immunoprecipitation, Marker

    Corneal injury induces lymphangiogenesis, upregulation of VEGF-C, and membrane VEGFR-3 expression. (A) Immunostaining of normal and sutured cornea on day 3 reveals sVEGFR-3 and VEGF-C upregulation at the site of suture, indicating that sVEGFR-3 initially tends to capture VEGF-C and control VEGF-C surge. Negative controls are sections stained with isotype-control primary antibodies. (B) Real-time PCR of normal and sutured cornea on day 3 revealing mechanical trauma leads to instant increase in VEGF-C mRNA levels (n = 5). (C) Western blot of normal (1) and sutured cornea (2) on day 5 leads to expression of membrane VEGFR-3 (170 kDa) in sutured cornea that leads to signaling through VEGFR-3 and development of lymphatic vessels.

    Journal: Blood

    Article Title: Soluble vascular endothelial growth factor receptor 3 is essential for corneal alymphaticity

    doi: 10.1182/blood-2012-08-453043

    Figure Lengend Snippet: Corneal injury induces lymphangiogenesis, upregulation of VEGF-C, and membrane VEGFR-3 expression. (A) Immunostaining of normal and sutured cornea on day 3 reveals sVEGFR-3 and VEGF-C upregulation at the site of suture, indicating that sVEGFR-3 initially tends to capture VEGF-C and control VEGF-C surge. Negative controls are sections stained with isotype-control primary antibodies. (B) Real-time PCR of normal and sutured cornea on day 3 revealing mechanical trauma leads to instant increase in VEGF-C mRNA levels (n = 5). (C) Western blot of normal (1) and sutured cornea (2) on day 5 leads to expression of membrane VEGFR-3 (170 kDa) in sutured cornea that leads to signaling through VEGFR-3 and development of lymphatic vessels.

    Article Snippet: A total of 2 μg of RNA was reverse transcribed using complementary DNA (cDNA) cloning primer (QT) CCAGTGAGCAGAGTGACGAGGACTCGAGCTCAAGCTTTTTTTTTTTTTTTTT. cDNA was amplified using Q0-CCAGTGAGCAGAGTGACG and VEGFR-3 domain 4–specific forward primer ATCAACAAACCTGACACGCTCCTG using a Long Range PCR Kit (Qiagen), with the following polymerase chain reaction (PCR) conditions: 93°C for 3 minutes, 35 cycles of 93°C for 15 seconds, 55°C for 30 seconds, and 68°C for 5 minutes.

    Techniques: Expressing, Immunostaining, Staining, Real-time Polymerase Chain Reaction, Western Blot