Structured Review

Boehringer Mannheim long range pcr kit
Long Range Pcr Kit, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/long range pcr kit/product/Boehringer Mannheim
Average 86 stars, based on 1 article reviews
Price from $9.99 to $1999.99
long range pcr kit - by Bioz Stars, 2021-07
86/100 stars

Images

Related Articles

Amplification:

Article Title: Multi-exon deletions of the FBN1 gene in Marfan syndrome
Article Snippet: Fragments migrating abnormally in agarose gel electrophoresis were excised, purified with the QIAquick Gel Extraction Kit (QIAGEN) and directly sequenced with fluorescent terminators on an ABI Prism 377 DNA sequencer (Perkin-Elmer). .. To define the deletion endpoints, we amplified genomic DNA with the ExpandTM PCR System (Boehringer Mannheim). .. The thermal profile for long-range PCR was as follows: denaturation for 2 min at 94°C, then 35 cycles of denaturation (10 s at 94°C), annealing (30 s at 60°C), and extension (8 min at 68°C), followed by a final extension step of 7 min at 68°C.

Article Title: Antagonism between Go? and Gq? in Caenorhabditis elegans: the RGS protein EAT-16 is necessary for Go? signaling and regulates Gq? activity
Article Snippet: Subclone pYH5 was injected at a concentration of 30 ng/μl, and pWJC5 was injected at a concentration of 25 ng/μl. .. A 3-kb genomic DNA fragment was amplified ( ) from ad702 mutant animals in three independent reactions and from sy438 animals in 10 independent reactions using the Expand long-range PCR kit (Boehringer Mannheim) with the following primers (from 5′ to 3′): AGACAGCTTCGTCGTATGTCTCAC (“P1”) and GCAGTGTTGGGTGGTTCGAGATTG (“P2”); the products from each strain were gel-purified (Qiagen) and pooled. .. The ad702 fragment was amplified a second time with P2 and the nested primer TGTCGAGCTGATTGAGACACGCTG (‘S1’) in 10 independent reactions; the products were purified as above and pooled.

Polymerase Chain Reaction:

Article Title: Multi-exon deletions of the FBN1 gene in Marfan syndrome
Article Snippet: Fragments migrating abnormally in agarose gel electrophoresis were excised, purified with the QIAquick Gel Extraction Kit (QIAGEN) and directly sequenced with fluorescent terminators on an ABI Prism 377 DNA sequencer (Perkin-Elmer). .. To define the deletion endpoints, we amplified genomic DNA with the ExpandTM PCR System (Boehringer Mannheim). .. The thermal profile for long-range PCR was as follows: denaturation for 2 min at 94°C, then 35 cycles of denaturation (10 s at 94°C), annealing (30 s at 60°C), and extension (8 min at 68°C), followed by a final extension step of 7 min at 68°C.

Article Title: Antagonism between Go? and Gq? in Caenorhabditis elegans: the RGS protein EAT-16 is necessary for Go? signaling and regulates Gq? activity
Article Snippet: Subclone pYH5 was injected at a concentration of 30 ng/μl, and pWJC5 was injected at a concentration of 25 ng/μl. .. A 3-kb genomic DNA fragment was amplified ( ) from ad702 mutant animals in three independent reactions and from sy438 animals in 10 independent reactions using the Expand long-range PCR kit (Boehringer Mannheim) with the following primers (from 5′ to 3′): AGACAGCTTCGTCGTATGTCTCAC (“P1”) and GCAGTGTTGGGTGGTTCGAGATTG (“P2”); the products from each strain were gel-purified (Qiagen) and pooled. .. The ad702 fragment was amplified a second time with P2 and the nested primer TGTCGAGCTGATTGAGACACGCTG (‘S1’) in 10 independent reactions; the products were purified as above and pooled.

Article Title: Biological functions of the ISWI chromatin remodeling complex NURF
Article Snippet: .. EMS-induced nucleotide changes were determined by amplifying overlapping DNA fragments covering nurf301 using nurf301 -specific primers and an Expand Long Range PCR kit (Boehringer, Mannheim) and DNA isolated from homozygous mutant animals as template. .. DNAs were sequenced and compared with similarly isolated w1118 sequence.

Article Title: Immunological Development and Cardiovascular Function Are Normal in Annexin VI Null Mutant Mice
Article Snippet: Consistent with this, stable expression of annexin VI in A431 cells restrains both their growth in culture and their ability to form tumors in vivo ( , ). .. The mouse annexin VI targeting construct was generated by a novel long-range genomic fusion PCR technique with the Expand Long Template or the Expand High Fidelity PCR kit (Boehringer Mannheim). ..

Article Title: Loss-of-Function Mutations in a Human Gene Related toChlamydomonas reinhardtii Dynein IC78 Result in Primary Ciliary Dyskinesia
Article Snippet: The full-length coding sequence of DNAI1 was subsequently amplified on total trachea and testis RNAs, by means of RT-PCR with primers P4 (forward) and P5 (reverse). .. To characterize the intron-exon organization of the DNAI1 gene, long-range PCRs were performed on human genomic DNA, by use of the Expand Long Template PCR System kit (Boehringer Mannheim) and various sets of exonic primers designed in the human DNAI1 cDNA, according to the manufacturer's instructions. .. PCR products were purified with the use of the PCR purification kit (Boehringer Mannheim) prior to sequencing.

Mutagenesis:

Article Title: Antagonism between Go? and Gq? in Caenorhabditis elegans: the RGS protein EAT-16 is necessary for Go? signaling and regulates Gq? activity
Article Snippet: Subclone pYH5 was injected at a concentration of 30 ng/μl, and pWJC5 was injected at a concentration of 25 ng/μl. .. A 3-kb genomic DNA fragment was amplified ( ) from ad702 mutant animals in three independent reactions and from sy438 animals in 10 independent reactions using the Expand long-range PCR kit (Boehringer Mannheim) with the following primers (from 5′ to 3′): AGACAGCTTCGTCGTATGTCTCAC (“P1”) and GCAGTGTTGGGTGGTTCGAGATTG (“P2”); the products from each strain were gel-purified (Qiagen) and pooled. .. The ad702 fragment was amplified a second time with P2 and the nested primer TGTCGAGCTGATTGAGACACGCTG (‘S1’) in 10 independent reactions; the products were purified as above and pooled.

Article Title: Biological functions of the ISWI chromatin remodeling complex NURF
Article Snippet: .. EMS-induced nucleotide changes were determined by amplifying overlapping DNA fragments covering nurf301 using nurf301 -specific primers and an Expand Long Range PCR kit (Boehringer, Mannheim) and DNA isolated from homozygous mutant animals as template. .. DNAs were sequenced and compared with similarly isolated w1118 sequence.

Isolation:

Article Title: Biological functions of the ISWI chromatin remodeling complex NURF
Article Snippet: .. EMS-induced nucleotide changes were determined by amplifying overlapping DNA fragments covering nurf301 using nurf301 -specific primers and an Expand Long Range PCR kit (Boehringer, Mannheim) and DNA isolated from homozygous mutant animals as template. .. DNAs were sequenced and compared with similarly isolated w1118 sequence.

Construct:

Article Title: Immunological Development and Cardiovascular Function Are Normal in Annexin VI Null Mutant Mice
Article Snippet: Consistent with this, stable expression of annexin VI in A431 cells restrains both their growth in culture and their ability to form tumors in vivo ( , ). .. The mouse annexin VI targeting construct was generated by a novel long-range genomic fusion PCR technique with the Expand Long Template or the Expand High Fidelity PCR kit (Boehringer Mannheim). ..

Generated:

Article Title: Immunological Development and Cardiovascular Function Are Normal in Annexin VI Null Mutant Mice
Article Snippet: Consistent with this, stable expression of annexin VI in A431 cells restrains both their growth in culture and their ability to form tumors in vivo ( , ). .. The mouse annexin VI targeting construct was generated by a novel long-range genomic fusion PCR technique with the Expand Long Template or the Expand High Fidelity PCR kit (Boehringer Mannheim). ..

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Boehringer Mannheim expand long range pcr kit
    <t>nurf301</t> is required for homeotic gene expression. ( A,B ) UBX protein in imaginal discs of the third thoracic segment (brown staining) is undetectable in nurf301 1 homozygotes. ( C,D ) Antibody staining shows that EN protein (revealed in green), which normally can be detected in the posterior compartment of all imaginal discs, is lost in nurf301 2 mutant larvae. ( E ) Semiquantitative <t>RT–PCR</t> analysis confirms that Ubx and en transcript abundance is reduced between 5- and 25-fold in total RNA isolated from nurf301 mutant animals. Lanes represent fivefold serial dilutions of mutant and wild-type total RNA (lane 1 , 200 ng; lane 2 , 40 ng; lane 3 , 8 ng; and lane 4 , 1.6 ng).
    Expand Long Range Pcr Kit, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand long range pcr kit/product/Boehringer Mannheim
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    expand long range pcr kit - by Bioz Stars, 2021-07
    86/100 stars
      Buy from Supplier

    86
    Boehringer Mannheim long range pcr kit
    <t>nurf301</t> is required for homeotic gene expression. ( A,B ) UBX protein in imaginal discs of the third thoracic segment (brown staining) is undetectable in nurf301 1 homozygotes. ( C,D ) Antibody staining shows that EN protein (revealed in green), which normally can be detected in the posterior compartment of all imaginal discs, is lost in nurf301 2 mutant larvae. ( E ) Semiquantitative <t>RT–PCR</t> analysis confirms that Ubx and en transcript abundance is reduced between 5- and 25-fold in total RNA isolated from nurf301 mutant animals. Lanes represent fivefold serial dilutions of mutant and wild-type total RNA (lane 1 , 200 ng; lane 2 , 40 ng; lane 3 , 8 ng; and lane 4 , 1.6 ng).
    Long Range Pcr Kit, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/long range pcr kit/product/Boehringer Mannheim
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    long range pcr kit - by Bioz Stars, 2021-07
    86/100 stars
      Buy from Supplier

    Image Search Results


    nurf301 is required for homeotic gene expression. ( A,B ) UBX protein in imaginal discs of the third thoracic segment (brown staining) is undetectable in nurf301 1 homozygotes. ( C,D ) Antibody staining shows that EN protein (revealed in green), which normally can be detected in the posterior compartment of all imaginal discs, is lost in nurf301 2 mutant larvae. ( E ) Semiquantitative RT–PCR analysis confirms that Ubx and en transcript abundance is reduced between 5- and 25-fold in total RNA isolated from nurf301 mutant animals. Lanes represent fivefold serial dilutions of mutant and wild-type total RNA (lane 1 , 200 ng; lane 2 , 40 ng; lane 3 , 8 ng; and lane 4 , 1.6 ng).

    Journal: Genes & Development

    Article Title: Biological functions of the ISWI chromatin remodeling complex NURF

    doi: 10.1101/gad.1032202

    Figure Lengend Snippet: nurf301 is required for homeotic gene expression. ( A,B ) UBX protein in imaginal discs of the third thoracic segment (brown staining) is undetectable in nurf301 1 homozygotes. ( C,D ) Antibody staining shows that EN protein (revealed in green), which normally can be detected in the posterior compartment of all imaginal discs, is lost in nurf301 2 mutant larvae. ( E ) Semiquantitative RT–PCR analysis confirms that Ubx and en transcript abundance is reduced between 5- and 25-fold in total RNA isolated from nurf301 mutant animals. Lanes represent fivefold serial dilutions of mutant and wild-type total RNA (lane 1 , 200 ng; lane 2 , 40 ng; lane 3 , 8 ng; and lane 4 , 1.6 ng).

    Article Snippet: EMS-induced nucleotide changes were determined by amplifying overlapping DNA fragments covering nurf301 using nurf301 -specific primers and an Expand Long Range PCR kit (Boehringer, Mannheim) and DNA isolated from homozygous mutant animals as template.

    Techniques: Expressing, Staining, Mutagenesis, Reverse Transcription Polymerase Chain Reaction, Isolation