Structured Review

TaKaRa long range pcr enzyme
Long Range Pcr Enzyme, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/long range pcr enzyme/product/TaKaRa
Average 93 stars, based on 2 article reviews
Price from $9.99 to $1999.99
long range pcr enzyme - by Bioz Stars, 2020-07
93/100 stars

Images

Related Articles

Polymerase Chain Reaction:

Article Title: Identification of candidates for driver oncogenes in scirrhous‐type gastric cancer cell lines, et al. Identification of candidates for driver oncogenes in scirrhous‐type gastric cancer cell lines
Article Snippet: .. The genomic rearrangement for the BORCS5‐ETV6 fusion in OCUM‐9 was PCR‐amplified with a long‐range PCR enzyme (Takara LA Taq, Takara Bio) from the genomic DNA with the following primers: 5′‐GACCCAACGATCTGAACTCCTCAG‐3′ and 5′‐TTTTCAGCCCACTTGAGCCACTGG‐3′. .. Genomic PCR or RT‐PCR for the BORCS5‐ETV6 fusion point was conducted with the genomic primers (5′‐AAGTCACCATCTGTCCTGGCCTC‐3′ and 5′‐GAGGGAGCTAAAGCTGGCACAAC‐3′) or the cDNA primers (5′‐ACGCGTCAGCCCCACACATTAG‐3′ and 5′‐TTTTCAGCCCACTTGAGCCACTGG‐3′), respectively.

Article Title: Increased nonHDL cholesterol levels cause muscle wasting and ambulatory dysfunction in the mouse model of LGMD2B [S]
Article Snippet: .. Disruption of the Dysf gene was confirmed in Dysf−/− mice via the original PCR protocol developed by and obtained directly from the Campbell laboratory (University of Iowa) using a long range PCR enzyme (Takara, catalog #RR0002M). .. ApoE−/− mice were obtained from the Jackson Laboratory (B6.129P2-Apoetm1Unc/J , stock #002052) and disruption of the ApoE gene was confirmed via PCR protocol suggested by the Jackson Laboratory.

Mouse Assay:

Article Title: Increased nonHDL cholesterol levels cause muscle wasting and ambulatory dysfunction in the mouse model of LGMD2B [S]
Article Snippet: .. Disruption of the Dysf gene was confirmed in Dysf−/− mice via the original PCR protocol developed by and obtained directly from the Campbell laboratory (University of Iowa) using a long range PCR enzyme (Takara, catalog #RR0002M). .. ApoE−/− mice were obtained from the Jackson Laboratory (B6.129P2-Apoetm1Unc/J , stock #002052) and disruption of the ApoE gene was confirmed via PCR protocol suggested by the Jackson Laboratory.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    TaKaRa la taq dna polymerase
    ( A ) Gel electrophoresis of near full-length genome PCR products produced from four long amplifying <t>DNA</t> polymerases; KlenTaq LA (discontinued), AccuTaq LA, PrimeSTAR GXL and Takara LA <t>Taq</t> (separate gel) per manufacturer’s instructions for samples with high GC/secondary structures. M, HyperLadder 1 kb; 1, CVB3 Nancy; 2, CVB5 Faulkner; 3, H 2 O control. ( B ) Gel electrophoresis of near full-length genome PCR products produced from Takara LA Taq DNA polymerase. M, HyperLadder 1 kb; 1–4, known EV positives from NSW Health Pathology East virology diagnostic lab; 5, CVB3 Nancy; 6, H 2 O control. Full-length gels are presented in Supplementary Fig. 1 .
    La Taq Dna Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 657 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/la taq dna polymerase/product/TaKaRa
    Average 99 stars, based on 657 article reviews
    Price from $9.99 to $1999.99
    la taq dna polymerase - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    Image Search Results


    ( A ) Gel electrophoresis of near full-length genome PCR products produced from four long amplifying DNA polymerases; KlenTaq LA (discontinued), AccuTaq LA, PrimeSTAR GXL and Takara LA Taq (separate gel) per manufacturer’s instructions for samples with high GC/secondary structures. M, HyperLadder 1 kb; 1, CVB3 Nancy; 2, CVB5 Faulkner; 3, H 2 O control. ( B ) Gel electrophoresis of near full-length genome PCR products produced from Takara LA Taq DNA polymerase. M, HyperLadder 1 kb; 1–4, known EV positives from NSW Health Pathology East virology diagnostic lab; 5, CVB3 Nancy; 6, H 2 O control. Full-length gels are presented in Supplementary Fig. 1 .

    Journal: Scientific Reports

    Article Title: Amplification and next generation sequencing of near full-length human enteroviruses for identification and characterisation from clinical samples

    doi: 10.1038/s41598-018-30322-y

    Figure Lengend Snippet: ( A ) Gel electrophoresis of near full-length genome PCR products produced from four long amplifying DNA polymerases; KlenTaq LA (discontinued), AccuTaq LA, PrimeSTAR GXL and Takara LA Taq (separate gel) per manufacturer’s instructions for samples with high GC/secondary structures. M, HyperLadder 1 kb; 1, CVB3 Nancy; 2, CVB5 Faulkner; 3, H 2 O control. ( B ) Gel electrophoresis of near full-length genome PCR products produced from Takara LA Taq DNA polymerase. M, HyperLadder 1 kb; 1–4, known EV positives from NSW Health Pathology East virology diagnostic lab; 5, CVB3 Nancy; 6, H 2 O control. Full-length gels are presented in Supplementary Fig. 1 .

    Article Snippet: The following enzymes were tested: Takara LA Taq DNA Polymerase (Clontech), AccuTaq LA DNA Polymerase (Sigma) and PrimeSTAR GXL DNA Polymerase (Clontech).

    Techniques: Nucleic Acid Electrophoresis, Polymerase Chain Reaction, Produced, Diagnostic Assay

    ( A ) Gel electrophoresis of near full-length genome PCR products produced from four long amplifying DNA polymerases; KlenTaq LA (discontinued), AccuTaq LA, PrimeSTAR GXL and Takara LA Taq (separate gel) per manufacturer’s instructions for samples with high GC/secondary structures. M, HyperLadder 1 kb; 1, CVB3 Nancy; 2, CVB5 Faulkner; 3, H 2 O control. ( B ) Gel electrophoresis of near full-length genome PCR products produced from Takara LA Taq DNA polymerase. M, HyperLadder 1 kb; 1–4, known EV positives from NSW Health Pathology East virology diagnostic lab; 5, CVB3 Nancy; 6, H 2 .

    Journal: Scientific Reports

    Article Title: Amplification and next generation sequencing of near full-length human enteroviruses for identification and characterisation from clinical samples

    doi: 10.1038/s41598-018-30322-y

    Figure Lengend Snippet: ( A ) Gel electrophoresis of near full-length genome PCR products produced from four long amplifying DNA polymerases; KlenTaq LA (discontinued), AccuTaq LA, PrimeSTAR GXL and Takara LA Taq (separate gel) per manufacturer’s instructions for samples with high GC/secondary structures. M, HyperLadder 1 kb; 1, CVB3 Nancy; 2, CVB5 Faulkner; 3, H 2 O control. ( B ) Gel electrophoresis of near full-length genome PCR products produced from Takara LA Taq DNA polymerase. M, HyperLadder 1 kb; 1–4, known EV positives from NSW Health Pathology East virology diagnostic lab; 5, CVB3 Nancy; 6, H 2 .

    Article Snippet: The following enzymes were tested: Takara LA Taq DNA Polymerase (Clontech), AccuTaq LA DNA Polymerase (Sigma) and PrimeSTAR GXL DNA Polymerase (Clontech).

    Techniques: Nucleic Acid Electrophoresis, Polymerase Chain Reaction, Produced, Diagnostic Assay