long range dntpack  (Roche)

Bioz Verified Symbol Roche is a verified supplier
Bioz Manufacturer Symbol Roche manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Roche long range dntpack
    Long Range Dntpack, supplied by Roche, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/long range dntpack/product/Roche
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    long range dntpack - by Bioz Stars, 2021-06
    86/100 stars


    Related Articles

    Polymerase Chain Reaction:

    Article Title: Effect of Leflunomide, Cidofovir and Ciprofloxacin on Replication of BKPyV in a Salivary Gland In Vitro Culture System
    Article Snippet: .. BKPyV VP1 gene forward (BKPVWGF; 5’-GCGGGATCCAGATGAAAACCTTAGG-3’) and reverse primers (BKPyVWGR; 5’-GCGGGATCCCCCATTTCTGG-3’) including the naturally occurring BamH1 restriction fragment recognition sites were used to amplify the whole genome (wg) of BKPyV via PCR from throat wash of HIVSGD patients, and the urine of a lung transplant patient using the Expand Long Range dNTPack (Roche) as described by manufacturer. .. Amplified wg BKPyV products were purified by QIAquick PCR Purification Kit (QIAGEN) as described by manufacturer.

    Article Title: An RNA-targeted therapy for dystrophic epidermolysis bullosa
    Article Snippet: PCR analysis of genomic DNA Genomic DNA of transduced keratinocytes was isolated using the DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol. .. For detection of full-length LV-RTM-S6m, PCR analysis using a polyA signal specific forward primer (5′CCTCCCCCTGAACCTGAAACATAAAATGAATGC3′), a COL7A1 exon 65 specific reverse primer (5′GATTCAGGCGCCTCTGGGAGAGAAG3′) as well as the Long Range dNTPack (Roche, Vienna, Austria) was performed according to the manufacturer's protocol. ..

    Article Title: Large Interruptions of GAA Repeat Expansion Mutations in Friedreich Ataxia Are Very Rare
    Article Snippet: We also obtained genomic DNA samples from cerebellum autopsy tissues from three FRDA patients (tissues were registered with the HTA under Brunel University Licensing number 12543) and five ear biopsies from previously described GAA repeat expansion-based Y47R and YG8sR FRDA mouse models ( ) (animal procedures were carried out in accordance with the UK Home Office “Animals (Scientific Procedures) Act 1986” and with approval from the Brunel University London Animal Welfare and Ethical Review Board). .. We then performed long-range PCR of the samples (approximately 100 ng input DNA) using either the Expand High Fidelity PCR System, dNTPack (Roche), or the Long Range PCR Kit (Qiagen) together with GAA-B-F (5′-AATGGATTTCCTGGCAGGACGC-3′) and GAA-B-R (5′-GCATTGGGCGATCTTGGCTTAA-3′) primers as previously described ( ). .. The thermocycling conditions used were (i) Roche Kit: 94°C for 2 min; 10 cycles of 94°C for 10 s, 60°C for 30 s, 68°C for 45 s; 20 cycles of 94°C for 10 s, 60°C for 30 s, 68°C for 1 min with 20 s increments; and a final cycle of 68°C for 10 mins, or (ii) Qiagen Kit: 93°C for 3 min; 35 cycles of 93°C for 15 s, 62°C for 30 s, 68°C for 5 min, and a final cycle of 68°C for 10 min.

    Article Title: Expansion of a novel endogenous retrovirus throughout the pericentromeres of modern humans
    Article Snippet: .. Mapping full-length K222 A full-length proviral genome of K222 was amplified from human H9 and HUT78 cell lines and some human DNA samples, in which the centromeric K111 5′ end was not detected using the Expand Long Range dNTPack PCR kit (Roche Applied Science). .. PCR reactions contained 50 ng genomic DNA, 2.5 mM MgCl2 , 500 μM dNTPs, 300 nM of each primer, and 3.5 units of Expand Long Range Enzyme Mix.

    Article Title: DNA Ligase III is critical for mtDNA integrity but not Xrcc1-mediated nuclear DNA repair
    Article Snippet: Mitochondria were isolated from brain tissue using the Qproteome™ Mitochondria Isolation Kit, (QIAGEN) according to the manufacturer’s directions, and mtDNA was isolated using the Mitochondrial DNA Isolation Kit (BioVision) according to the manufacturer’s directions. .. PCR of mtDNA was done using the Expand Long Range, dNTPack (Roche) with the following conditions: Initial denaturation at 92°C for 30sec followed by annealing at 56°C for 30sec and elongation at 68°C (at 60s/kb) for 39 cycles, with a final 68oC elongation for 10mins. .. Primers used: ‘Set A’, forward, 5’-CCT TCA TCC TTC TCT CCC TAT GAG GA, reverse 5’-GGT TGT TTG ATC CTG TTT CGT GGA and ‘Set B’, forward, 5’-CCC AGC TAC TAC CAT CAT TCA AGT, reverse 5’-CAG TAT GCT TAC CTT GTT ACG ACT.

    Article Title: Correction of the auditory phenotype in C57BL/6N mice via CRISPR/Cas9-mediated homology directed repair
    Article Snippet: Analysis of the sgRNA predicted off-target sites Genomic DNA from F1 animals was extracted from ear clips using a DNA Extract All Reagents Kit (Applied Biosystems). .. Potential off-target sites predicted by the WTSI Genome Editing (WGE) webtool for sgRNA_U1 and sgRNA_D1 (design 1), and containing ≤3 mismatches (Additional file : Table S2) were PCR amplified using High fidelity Expand Long Range dNTPack (Roche) and the corresponding genotyping primers (Additional file : Table S3). .. PCR amplicons were gel-purified (QIAGEN) and analysed by Sanger sequencing.


    Article Title: Expansion of a novel endogenous retrovirus throughout the pericentromeres of modern humans
    Article Snippet: .. Mapping full-length K222 A full-length proviral genome of K222 was amplified from human H9 and HUT78 cell lines and some human DNA samples, in which the centromeric K111 5′ end was not detected using the Expand Long Range dNTPack PCR kit (Roche Applied Science). .. PCR reactions contained 50 ng genomic DNA, 2.5 mM MgCl2 , 500 μM dNTPs, 300 nM of each primer, and 3.5 units of Expand Long Range Enzyme Mix.

    Article Title: CACN-1/Cactin interacts genetically with MIG-2 GTPase signaling to control distal tip cell migration in C. elegans
    Article Snippet: Extrachromosomal arrays were generated by germline transformation of N2 animals with cacn-1 ::GFP DNA (50 μg/ml) and stable chromosomal integration was induced by treatment with UV. .. The rescued line UN0938 was generated by micro-injecting the UN0705 strain with the cacn-1 genomic region amplified from genomic DNA using Expand Long-range dNTPack (Roche). ..

    Article Title: Correction of the auditory phenotype in C57BL/6N mice via CRISPR/Cas9-mediated homology directed repair
    Article Snippet: Analysis of the sgRNA predicted off-target sites Genomic DNA from F1 animals was extracted from ear clips using a DNA Extract All Reagents Kit (Applied Biosystems). .. Potential off-target sites predicted by the WTSI Genome Editing (WGE) webtool for sgRNA_U1 and sgRNA_D1 (design 1), and containing ≤3 mismatches (Additional file : Table S2) were PCR amplified using High fidelity Expand Long Range dNTPack (Roche) and the corresponding genotyping primers (Additional file : Table S3). .. PCR amplicons were gel-purified (QIAGEN) and analysed by Sanger sequencing.


    Article Title: CACN-1/Cactin interacts genetically with MIG-2 GTPase signaling to control distal tip cell migration in C. elegans
    Article Snippet: Extrachromosomal arrays were generated by germline transformation of N2 animals with cacn-1 ::GFP DNA (50 μg/ml) and stable chromosomal integration was induced by treatment with UV. .. The rescued line UN0938 was generated by micro-injecting the UN0705 strain with the cacn-1 genomic region amplified from genomic DNA using Expand Long-range dNTPack (Roche). ..


    Article Title: Receptor determinants of zoonotic transmission of New World hemorrhagic fever arenaviruses
    Article Snippet: All chimeras were cloned into the pcDNA 3.1(+) expression vector (Invitrogen) with a C-terminal FLAG tag. .. Site-directed mutagenesis of mTfR1 and hTfR1 was performed by using Expand Long-Range dNTPack (Roche). .. Plasmids encoding the MACV Carvallo strain GP1Δ deletion variant (residues 79–248) fused to the Fc region of human IgG1 (GP1Δ-Fc), as well as MACV, JUNV (MC2), and GTOV (INH-95551) GPC, have been described previously ( ).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Roche expand long template pcr system kit
    Agar gel electrophoretic analysis of the <t>PCR</t> <t>POLH</t> gDNA of exon 10 and its intronic boundaries showed difference in the size between affected individuals (XPV17B-1 and XPV91) compared to healthy parents (XPV(P)) and a healthy control. (Marker: 1 kb DNA ladder molecular size marker (GeneRuler).)
    Expand Long Template Pcr System Kit, supplied by Roche, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand long template pcr system kit/product/Roche
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    expand long template pcr system kit - by Bioz Stars, 2021-06
    86/100 stars
      Buy from Supplier

    Roche expand long range dntpack kit
    Agar gel electrophoretic analysis of the <t>PCR</t> <t>POLH</t> gDNA of exon 10 and its intronic boundaries showed difference in the size between affected individuals (XPV17B-1 and XPV91) compared to healthy parents (XPV(P)) and a healthy control. (Marker: 1 kb DNA ladder molecular size marker (GeneRuler).)
    Expand Long Range Dntpack Kit, supplied by Roche, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand long range dntpack kit/product/Roche
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    expand long range dntpack kit - by Bioz Stars, 2021-06
    86/100 stars
      Buy from Supplier

    Roche expand long range dntpack
    Agar gel electrophoretic analysis of the <t>PCR</t> <t>POLH</t> gDNA of exon 10 and its intronic boundaries showed difference in the size between affected individuals (XPV17B-1 and XPV91) compared to healthy parents (XPV(P)) and a healthy control. (Marker: 1 kb DNA ladder molecular size marker (GeneRuler).)
    Expand Long Range Dntpack, supplied by Roche, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand long range dntpack/product/Roche
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    expand long range dntpack - by Bioz Stars, 2021-06
    86/100 stars
      Buy from Supplier

    Image Search Results

    Agar gel electrophoretic analysis of the PCR POLH gDNA of exon 10 and its intronic boundaries showed difference in the size between affected individuals (XPV17B-1 and XPV91) compared to healthy parents (XPV(P)) and a healthy control. (Marker: 1 kb DNA ladder molecular size marker (GeneRuler).)

    Journal: BioMed Research International

    Article Title: A Founder Large Deletion Mutation in Xeroderma Pigmentosum-Variant Form in Tunisia: Implication for Molecular Diagnosis and Therapy

    doi: 10.1155/2014/256245

    Figure Lengend Snippet: Agar gel electrophoretic analysis of the PCR POLH gDNA of exon 10 and its intronic boundaries showed difference in the size between affected individuals (XPV17B-1 and XPV91) compared to healthy parents (XPV(P)) and a healthy control. (Marker: 1 kb DNA ladder molecular size marker (GeneRuler).)

    Article Snippet: PCR Long-Range On absence of amplification of POLH exon 10, long PCR was performed using the Expand Long Template PCR System Kit (Expand Long Range dNTPack 700 units/μ L Roche).

    Techniques: Polymerase Chain Reaction, Marker