Structured Review

Roche long range dntpack
Long Range Dntpack, supplied by Roche, used in various techniques. Bioz Stars score: 85/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/long range dntpack/product/Roche
Average 85 stars, based on 4 article reviews
Price from $9.99 to $1999.99
long range dntpack - by Bioz Stars, 2020-07
85/100 stars

Images

Related Articles

Polymerase Chain Reaction:

Article Title: Screening of the DNA mismatch repair genes MLH1, MSH2 and MSH6 in a Greek cohort of Lynch syndrome suspected families
Article Snippet: .. Long range polymerase chain reaction and breakpoint analysis 150 ng of genomic DNA was amplified in a 50 μl reaction volume using 1,5 mM Mg+2 , 300 μM of each dNTP, 0.5 U of "Expand Long Range dNTPack" (Roche Diagnostics). ..

Article Title: An RNA-targeted therapy for dystrophic epidermolysis bullosa
Article Snippet: .. For detection of full-length LV-RTM-S6m, PCR analysis using a polyA signal specific forward primer (5′CCTCCCCCTGAACCTGAAACATAAAATGAATGC3′), a COL7A1 exon 65 specific reverse primer (5′GATTCAGGCGCCTCTGGGAGAGAAG3′) as well as the Long Range dNTPack (Roche, Vienna, Austria) was performed according to the manufacturer's protocol. ..

Article Title: Mitogenomics of the Old World monkey tribe Papionini
Article Snippet: .. To minimize the chance of amplifying nuclear mitochondrial-like sequences (numts) [ ], two overlapping long-range PCR fragments were generated (8 kb and 10 kb) using primers specifically designed for macaque species groups on the basis of available sequence data in GenBank and the Long Range dNTPack from Roche. .. Conditions for the long-range PCR amplification comprised a pre-denaturation step at 94°C for 2 min, followed by 40 cycles at 94°C for 1 min, annealing at 60°C for 1 min and extension at 68°C for 20 min. At the end a final extension step at 68°C for 30 min was added.

Sequencing:

Article Title: Mitogenomics of the Old World monkey tribe Papionini
Article Snippet: .. To minimize the chance of amplifying nuclear mitochondrial-like sequences (numts) [ ], two overlapping long-range PCR fragments were generated (8 kb and 10 kb) using primers specifically designed for macaque species groups on the basis of available sequence data in GenBank and the Long Range dNTPack from Roche. .. Conditions for the long-range PCR amplification comprised a pre-denaturation step at 94°C for 2 min, followed by 40 cycles at 94°C for 1 min, annealing at 60°C for 1 min and extension at 68°C for 20 min. At the end a final extension step at 68°C for 30 min was added.

Generated:

Article Title: Mitogenomics of the Old World monkey tribe Papionini
Article Snippet: .. To minimize the chance of amplifying nuclear mitochondrial-like sequences (numts) [ ], two overlapping long-range PCR fragments were generated (8 kb and 10 kb) using primers specifically designed for macaque species groups on the basis of available sequence data in GenBank and the Long Range dNTPack from Roche. .. Conditions for the long-range PCR amplification comprised a pre-denaturation step at 94°C for 2 min, followed by 40 cycles at 94°C for 1 min, annealing at 60°C for 1 min and extension at 68°C for 20 min. At the end a final extension step at 68°C for 30 min was added.

Amplification:

Article Title: Screening of the DNA mismatch repair genes MLH1, MSH2 and MSH6 in a Greek cohort of Lynch syndrome suspected families
Article Snippet: .. Long range polymerase chain reaction and breakpoint analysis 150 ng of genomic DNA was amplified in a 50 μl reaction volume using 1,5 mM Mg+2 , 300 μM of each dNTP, 0.5 U of "Expand Long Range dNTPack" (Roche Diagnostics). ..

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 88
    Roche expand long template pcr system kit
    Agar gel electrophoretic analysis of the <t>PCR</t> <t>POLH</t> gDNA of exon 10 and its intronic boundaries showed difference in the size between affected individuals (XPV17B-1 and XPV91) compared to healthy parents (XPV(P)) and a healthy control. (Marker: 1 kb DNA ladder molecular size marker (GeneRuler).)
    Expand Long Template Pcr System Kit, supplied by Roche, used in various techniques. Bioz Stars score: 88/100, based on 25 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand long template pcr system kit/product/Roche
    Average 88 stars, based on 25 article reviews
    Price from $9.99 to $1999.99
    expand long template pcr system kit - by Bioz Stars, 2020-07
    88/100 stars
      Buy from Supplier

    85
    Roche two step nested long range pcr protocol
    Alpha-synuclein overexpression results in oxidative DNA damage, alterations in respiratory chain complex I and mitochondrial DNA deletions in transgenic mice brains. (A) Immuno-histochemical detection of 8-OHdG suggesting increased oxidative DNA damage in α-Syn tg mice brains. (B) 8-OHdG levels were quantified on whole brain in α-Syn tg and non-transgenic control mice by ELISA. Scale bar represents 25 µm. (C) Long extension <t>PCR</t> showing large-scale <t>mtDNA</t> deletions in α-Syn tg mice. (D) Quantitative determination of mtDNA deletions by real-time PCR showing increased mtDNA deletion levels in the brain of α-Syn tg mice compared to control animals. (E) Immunostaining for α-Syn (green signal) and NeuN (red signal; arrow marks the identical neuron in double labeling) used for Laser Capture Microdissection (LCM). Scale bar represents 250 µm in the upper panel and 25 µm in the close-up lower panel. (F) Quantification of mtDNA deletion levels by real-time PCR on individual neurons with either intense or negative α-Syn immunoreactivity after LCM. (G) Western blot analysis of mitochondrial OXPHOS in brain homogenates from α-Syn tg and wt mice. Lane 1 shows mitochondrial proteins standard marker. (H) Densitometric analysis of the levels of Complexes I, II, III and IV. *p
    Two Step Nested Long Range Pcr Protocol, supplied by Roche, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/two step nested long range pcr protocol/product/Roche
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    two step nested long range pcr protocol - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    85
    Roche long range dntpack
    Alpha-synuclein overexpression results in oxidative DNA damage, alterations in respiratory chain complex I and mitochondrial DNA deletions in transgenic mice brains. (A) Immuno-histochemical detection of 8-OHdG suggesting increased oxidative DNA damage in α-Syn tg mice brains. (B) 8-OHdG levels were quantified on whole brain in α-Syn tg and non-transgenic control mice by ELISA. Scale bar represents 25 µm. (C) Long extension <t>PCR</t> showing large-scale <t>mtDNA</t> deletions in α-Syn tg mice. (D) Quantitative determination of mtDNA deletions by real-time PCR showing increased mtDNA deletion levels in the brain of α-Syn tg mice compared to control animals. (E) Immunostaining for α-Syn (green signal) and NeuN (red signal; arrow marks the identical neuron in double labeling) used for Laser Capture Microdissection (LCM). Scale bar represents 250 µm in the upper panel and 25 µm in the close-up lower panel. (F) Quantification of mtDNA deletion levels by real-time PCR on individual neurons with either intense or negative α-Syn immunoreactivity after LCM. (G) Western blot analysis of mitochondrial OXPHOS in brain homogenates from α-Syn tg and wt mice. Lane 1 shows mitochondrial proteins standard marker. (H) Densitometric analysis of the levels of Complexes I, II, III and IV. *p
    Long Range Dntpack, supplied by Roche, used in various techniques. Bioz Stars score: 85/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/long range dntpack/product/Roche
    Average 85 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    long range dntpack - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    89
    Roche expand long range dntpack kit
    Alpha-synuclein overexpression results in oxidative DNA damage, alterations in respiratory chain complex I and mitochondrial DNA deletions in transgenic mice brains. (A) Immuno-histochemical detection of 8-OHdG suggesting increased oxidative DNA damage in α-Syn tg mice brains. (B) 8-OHdG levels were quantified on whole brain in α-Syn tg and non-transgenic control mice by ELISA. Scale bar represents 25 µm. (C) Long extension <t>PCR</t> showing large-scale <t>mtDNA</t> deletions in α-Syn tg mice. (D) Quantitative determination of mtDNA deletions by real-time PCR showing increased mtDNA deletion levels in the brain of α-Syn tg mice compared to control animals. (E) Immunostaining for α-Syn (green signal) and NeuN (red signal; arrow marks the identical neuron in double labeling) used for Laser Capture Microdissection (LCM). Scale bar represents 250 µm in the upper panel and 25 µm in the close-up lower panel. (F) Quantification of mtDNA deletion levels by real-time PCR on individual neurons with either intense or negative α-Syn immunoreactivity after LCM. (G) Western blot analysis of mitochondrial OXPHOS in brain homogenates from α-Syn tg and wt mice. Lane 1 shows mitochondrial proteins standard marker. (H) Densitometric analysis of the levels of Complexes I, II, III and IV. *p
    Expand Long Range Dntpack Kit, supplied by Roche, used in various techniques. Bioz Stars score: 89/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand long range dntpack kit/product/Roche
    Average 89 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    expand long range dntpack kit - by Bioz Stars, 2020-07
    89/100 stars
      Buy from Supplier

    Image Search Results


    Agar gel electrophoretic analysis of the PCR POLH gDNA of exon 10 and its intronic boundaries showed difference in the size between affected individuals (XPV17B-1 and XPV91) compared to healthy parents (XPV(P)) and a healthy control. (Marker: 1 kb DNA ladder molecular size marker (GeneRuler).)

    Journal: BioMed Research International

    Article Title: A Founder Large Deletion Mutation in Xeroderma Pigmentosum-Variant Form in Tunisia: Implication for Molecular Diagnosis and Therapy

    doi: 10.1155/2014/256245

    Figure Lengend Snippet: Agar gel electrophoretic analysis of the PCR POLH gDNA of exon 10 and its intronic boundaries showed difference in the size between affected individuals (XPV17B-1 and XPV91) compared to healthy parents (XPV(P)) and a healthy control. (Marker: 1 kb DNA ladder molecular size marker (GeneRuler).)

    Article Snippet: PCR Long-Range On absence of amplification of POLH exon 10, long PCR was performed using the Expand Long Template PCR System Kit (Expand Long Range dNTPack 700 units/μ L Roche).

    Techniques: Polymerase Chain Reaction, Marker

    Alpha-synuclein overexpression results in oxidative DNA damage, alterations in respiratory chain complex I and mitochondrial DNA deletions in transgenic mice brains. (A) Immuno-histochemical detection of 8-OHdG suggesting increased oxidative DNA damage in α-Syn tg mice brains. (B) 8-OHdG levels were quantified on whole brain in α-Syn tg and non-transgenic control mice by ELISA. Scale bar represents 25 µm. (C) Long extension PCR showing large-scale mtDNA deletions in α-Syn tg mice. (D) Quantitative determination of mtDNA deletions by real-time PCR showing increased mtDNA deletion levels in the brain of α-Syn tg mice compared to control animals. (E) Immunostaining for α-Syn (green signal) and NeuN (red signal; arrow marks the identical neuron in double labeling) used for Laser Capture Microdissection (LCM). Scale bar represents 250 µm in the upper panel and 25 µm in the close-up lower panel. (F) Quantification of mtDNA deletion levels by real-time PCR on individual neurons with either intense or negative α-Syn immunoreactivity after LCM. (G) Western blot analysis of mitochondrial OXPHOS in brain homogenates from α-Syn tg and wt mice. Lane 1 shows mitochondrial proteins standard marker. (H) Densitometric analysis of the levels of Complexes I, II, III and IV. *p

    Journal: PLoS ONE

    Article Title: TOM40 Mediates Mitochondrial Dysfunction Induced by ?-Synuclein Accumulation in Parkinson's Disease

    doi: 10.1371/journal.pone.0062277

    Figure Lengend Snippet: Alpha-synuclein overexpression results in oxidative DNA damage, alterations in respiratory chain complex I and mitochondrial DNA deletions in transgenic mice brains. (A) Immuno-histochemical detection of 8-OHdG suggesting increased oxidative DNA damage in α-Syn tg mice brains. (B) 8-OHdG levels were quantified on whole brain in α-Syn tg and non-transgenic control mice by ELISA. Scale bar represents 25 µm. (C) Long extension PCR showing large-scale mtDNA deletions in α-Syn tg mice. (D) Quantitative determination of mtDNA deletions by real-time PCR showing increased mtDNA deletion levels in the brain of α-Syn tg mice compared to control animals. (E) Immunostaining for α-Syn (green signal) and NeuN (red signal; arrow marks the identical neuron in double labeling) used for Laser Capture Microdissection (LCM). Scale bar represents 250 µm in the upper panel and 25 µm in the close-up lower panel. (F) Quantification of mtDNA deletion levels by real-time PCR on individual neurons with either intense or negative α-Syn immunoreactivity after LCM. (G) Western blot analysis of mitochondrial OXPHOS in brain homogenates from α-Syn tg and wt mice. Lane 1 shows mitochondrial proteins standard marker. (H) Densitometric analysis of the levels of Complexes I, II, III and IV. *p

    Article Snippet: Low-abundance mtDNA deletions were detected by a two-step nested long-range PCR protocol (Expand Long Range dNTPack®, Roche, Mannheim, Germany) to amplify a final ∼10 kb fragment of the deletion-prone “major arc” of the mitochondrial genome as we previously reported , .

    Techniques: Over Expression, Transgenic Assay, Mouse Assay, Enzyme-linked Immunosorbent Assay, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Immunostaining, Labeling, Laser Capture Microdissection, Western Blot, Marker