lipofectamine rnaimax  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher lipofectamine rnaimax
    microRNAs 146a, 146b, and 155 are down-regulated in statin-treated Mac. a microRNA array. Total RNA was isolated from macrophages differentiated in the absence or presence of statin (25 cm 2 flasks, 100,000 cells/cm 2 ) with the “RNeasy Plus Mini Kit”. Deep sequencing was performed by the “Core Unit DNA”, Universität Leipzig, using the “TruSeq™Small RNA sample prepkit v2” (illumina, San Diego, USA). The mean of the normalized data of macrophages pretreated without statin and macrophages pretreated with statin was calculated and data of samples with a mean > 100 counts (192 samples; compare Supplementary Table 2 ) were included into the analysis and blotted against each other. The orange line indicates unchanged expression. The red dots mark three selected miRs, which were down-regulated in statin-pretreated macrophages, as compared to Mac prepared in the absence of statin (compare Supplementary Table 2 ). A second array showed a similar result. b Blockade of miR-146a and miR-155 reverses the hypo-responsiveness in macrophages only to some degree. Macrophages were incubated as described in Fig. 1a (6-well plate; 100,000 cells/cm 2 ). The respective “miRCURY LNA™” anti-miR (Exiqon, Qiagen, Vedbaek, Denmark) were prepared in <t>“Lipofectamine</t> <t>RNAiMax”</t> and 250 µl of this solution was added to 2750 µl of culture medium in the absence (−) or presence (+) of statin. After 24 h LPS was added. After further 24 h, the supernatants were harvested and analyzed in ELISA. Four experiments with similar results were performed. Data analysis and color code as in Fig. 1c (“Ctrl” vs. “anti-miR”).
    Lipofectamine Rnaimax, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 786 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lipofectamine rnaimax/product/Thermo Fisher
    Average 99 stars, based on 786 article reviews
    Price from $9.99 to $1999.99
    lipofectamine rnaimax - by Bioz Stars, 2020-02
    99/100 stars

    Images

    1) Product Images from "The differential statin effect on cytokine production of monocytes or macrophages is mediated by differential geranylgeranylation-dependent Rac1 activation"

    Article Title: The differential statin effect on cytokine production of monocytes or macrophages is mediated by differential geranylgeranylation-dependent Rac1 activation

    Journal: Cell Death & Disease

    doi: 10.1038/s41419-019-2109-9

    microRNAs 146a, 146b, and 155 are down-regulated in statin-treated Mac. a microRNA array. Total RNA was isolated from macrophages differentiated in the absence or presence of statin (25 cm 2 flasks, 100,000 cells/cm 2 ) with the “RNeasy Plus Mini Kit”. Deep sequencing was performed by the “Core Unit DNA”, Universität Leipzig, using the “TruSeq™Small RNA sample prepkit v2” (illumina, San Diego, USA). The mean of the normalized data of macrophages pretreated without statin and macrophages pretreated with statin was calculated and data of samples with a mean > 100 counts (192 samples; compare Supplementary Table 2 ) were included into the analysis and blotted against each other. The orange line indicates unchanged expression. The red dots mark three selected miRs, which were down-regulated in statin-pretreated macrophages, as compared to Mac prepared in the absence of statin (compare Supplementary Table 2 ). A second array showed a similar result. b Blockade of miR-146a and miR-155 reverses the hypo-responsiveness in macrophages only to some degree. Macrophages were incubated as described in Fig. 1a (6-well plate; 100,000 cells/cm 2 ). The respective “miRCURY LNA™” anti-miR (Exiqon, Qiagen, Vedbaek, Denmark) were prepared in “Lipofectamine RNAiMax” and 250 µl of this solution was added to 2750 µl of culture medium in the absence (−) or presence (+) of statin. After 24 h LPS was added. After further 24 h, the supernatants were harvested and analyzed in ELISA. Four experiments with similar results were performed. Data analysis and color code as in Fig. 1c (“Ctrl” vs. “anti-miR”).
    Figure Legend Snippet: microRNAs 146a, 146b, and 155 are down-regulated in statin-treated Mac. a microRNA array. Total RNA was isolated from macrophages differentiated in the absence or presence of statin (25 cm 2 flasks, 100,000 cells/cm 2 ) with the “RNeasy Plus Mini Kit”. Deep sequencing was performed by the “Core Unit DNA”, Universität Leipzig, using the “TruSeq™Small RNA sample prepkit v2” (illumina, San Diego, USA). The mean of the normalized data of macrophages pretreated without statin and macrophages pretreated with statin was calculated and data of samples with a mean > 100 counts (192 samples; compare Supplementary Table 2 ) were included into the analysis and blotted against each other. The orange line indicates unchanged expression. The red dots mark three selected miRs, which were down-regulated in statin-pretreated macrophages, as compared to Mac prepared in the absence of statin (compare Supplementary Table 2 ). A second array showed a similar result. b Blockade of miR-146a and miR-155 reverses the hypo-responsiveness in macrophages only to some degree. Macrophages were incubated as described in Fig. 1a (6-well plate; 100,000 cells/cm 2 ). The respective “miRCURY LNA™” anti-miR (Exiqon, Qiagen, Vedbaek, Denmark) were prepared in “Lipofectamine RNAiMax” and 250 µl of this solution was added to 2750 µl of culture medium in the absence (−) or presence (+) of statin. After 24 h LPS was added. After further 24 h, the supernatants were harvested and analyzed in ELISA. Four experiments with similar results were performed. Data analysis and color code as in Fig. 1c (“Ctrl” vs. “anti-miR”).

    Techniques Used: Isolation, Sequencing, Expressing, Incubation, Enzyme-linked Immunosorbent Assay

    2) Product Images from "Use of small interfering ribonucleic acids to inhibit the adipogenic effect of alcohol on human bone marrow-derived mesenchymal cells"

    Article Title: Use of small interfering ribonucleic acids to inhibit the adipogenic effect of alcohol on human bone marrow-derived mesenchymal cells

    Journal:

    doi: 10.1007/s00264-009-0914-y

    Alizarin red staining identification of mineralisation in cell cultures for 28 days. a Cell control. b Osteogenic control. c Adipogenic control. d Lipofectamine™ RNAiMAX control. e Negative siRNA control. f PPARγ-siRNA (magnification
    Figure Legend Snippet: Alizarin red staining identification of mineralisation in cell cultures for 28 days. a Cell control. b Osteogenic control. c Adipogenic control. d Lipofectamine™ RNAiMAX control. e Negative siRNA control. f PPARγ-siRNA (magnification

    Techniques Used: Staining

    Oil red O staining of hBMSCs transfected with PPRAγ-siRNA or controls followed by treatment for 24 days. a Cell control. b Osteogenic control. c Adipogenic control. d Lipofectamine™ RNAiMAX control. e Negative siRNA control. f
    Figure Legend Snippet: Oil red O staining of hBMSCs transfected with PPRAγ-siRNA or controls followed by treatment for 24 days. a Cell control. b Osteogenic control. c Adipogenic control. d Lipofectamine™ RNAiMAX control. e Negative siRNA control. f

    Techniques Used: Staining, Transfection

    Related Articles

    Clone Assay:

    Article Title: Mitochondrial fission factor is a novel Myc-dependent regulator of mitochondrial permeability in cancer
    Article Snippet: 2.2 Plasmids and gene silencing cDNA clones encoding human MFF1, MFF5 or control vector were purchased from GeneCopoeia (Cat. n. EX-Z4766, EX-Z0675). .. Cells were transfected with the various siRNA (30–60 nM) in the presence of Lipofectamine RNAiMAX (Invitrogen) at a 1:1 ratio (vol siRNA 20 μM:vol Lipofectamine RNAiMAX) and processed as described [ ].

    Stable Transfection:

    Article Title: Mitochondrial fission factor is a novel Myc-dependent regulator of mitochondrial permeability in cancer
    Article Snippet: Cells were transfected with the various siRNA (30–60 nM) in the presence of Lipofectamine RNAiMAX (Invitrogen) at a 1:1 ratio (vol siRNA 20 μM:vol Lipofectamine RNAiMAX) and processed as described [ ]. .. Individual clones of PC3 and DU145 cells stably expressing MFF-directed shRNA sequences were generated by infection with lentiviral particles, followed by a 2-week selection in the presence of puromycin at 2 μg/ml.

    Synthesized:

    Article Title: Mitochondrial fission factor is a novel Myc-dependent regulator of mitochondrial permeability in cancer
    Article Snippet: An additional siRNA sequence targeting MFF (SantaCruz #SC-94736-A: 5′-GAACAAAGAACGUGCUAAAUUUU-3′) was synthesized by Dharmacon. .. Cells were transfected with the various siRNA (30–60 nM) in the presence of Lipofectamine RNAiMAX (Invitrogen) at a 1:1 ratio (vol siRNA 20 μM:vol Lipofectamine RNAiMAX) and processed as described [ ].

    Construct:

    Article Title: Enhancer-mediated enrichment of interacting JMJD3–DDX21 to ENPP2 locus prevents R-loop formation and promotes transcription
    Article Snippet: For siRNA treatment, cells were transfected by use of Lipofectamine RNAiMax (Invitrogen Thermofisher, Canada). siRNAs targeting JMJD3 (siJMJD3#1 cat no. #SI03181136 and siJMJ3#2 cat no.#SI04133836), DDX21 (siDDX21#1 cat no. #SI04311412 and siDDX21#2 cat no.#SI04155781), UTX (siUTX#1 cat no#SI04306743 and siUTX#2 cat no. #SI04314303), and EZH2 (cat no. #SI02665166) were purchased from QIAGEN (ON, Canada). .. For rescue experiments, HEK293T cells were transfected with siRNA targeting the 3′untranslated region (UTR) of intended mRNA target, followed by expression of siRNA-resistant wild-type or mutants constructs for DDX21 and JMJD3.

    Enzyme-linked Immunosorbent Assay:

    Article Title: The differential statin effect on cytokine production of monocytes or macrophages is mediated by differential geranylgeranylation-dependent Rac1 activation
    Article Snippet: Subsequently, 250 µl of the mix was added to 2250 µl cell suspension in 6-well plates (Nunc) for 24 h. LPS (100 ng/ml) was then added for further 24 h. The supernatants were analyzed in ELISA and the cell lysates in Western blot. .. “Lipofectamine® RNAiMAX” (9 µl; ambion™) was added to 150 µl of “OptiMEM®” and 3 µl of the anti-miR (10 µM) was added to another volume of 150 µl “Optimem®”.

    Incubation:

    Article Title: The differential statin effect on cytokine production of monocytes or macrophages is mediated by differential geranylgeranylation-dependent Rac1 activation
    Article Snippet: “Lipofectamine® RNAiMAX” (9 µl; ambion™) was added to 150 µl of “OptiMEM®” and 3 µl of the anti-miR (10 µM) was added to another volume of 150 µl “Optimem®”. .. Subsequently, both preparations were mixed and incubated for 5 min, applied to the cultures (250 µl mix plus 2750 µl culture; 6-well plate), incubated for 24 h, LPS was added, and the cells were cultured for additional 24 h.

    Article Title: Activation of type I interferon antiviral response in human neural stem cells
    Article Snippet: Lipofectamine 2000 RNAiMAX (Thermo-Fisher Scientific, MA, USA) was used for transfecting siRNAs. .. The prepared mixtures were then added to the cells and incubated at 37 °C, 5% CO2 for 6 h. The old medium was decanted, and fresh expansion medium was added for incubation.

    Cell Culture:

    Article Title: The differential statin effect on cytokine production of monocytes or macrophages is mediated by differential geranylgeranylation-dependent Rac1 activation
    Article Snippet: “Lipofectamine® RNAiMAX” (9 µl; ambion™) was added to 150 µl of “OptiMEM®” and 3 µl of the anti-miR (10 µM) was added to another volume of 150 µl “Optimem®”. .. Subsequently, both preparations were mixed and incubated for 5 min, applied to the cultures (250 µl mix plus 2750 µl culture; 6-well plate), incubated for 24 h, LPS was added, and the cells were cultured for additional 24 h.

    Article Title: RNA components of the spliceosome regulate tissue- and cancer-specific alternative splicing
    Article Snippet: Paragraph title: Cell culture and snRNA KD ... Transfection was performed in six-well plates using Lipofectamine RNAiMAX (Invitrogen) following the manufacturer's cell line–specific protocols (MCF-7 reverse transfection; HeLa forward transfection), with 200 pmol ASO and 10 µL RNAiMAX reagent per well in a six-well plate.

    Expressing:

    Article Title: RCC2 promotes breast cancer progression through regulation of Wnt signaling and inducing EMT
    Article Snippet: Lentivirus production and oligonucleotide transfection Lentiviruses were produced by transfecting 293T cells with expression plasmids and packaging plasmids (psPAX2 and pMD2.G, Addgene_12260 and Addgene_12259); the supernatants were collected 48 hrs later, filtered through 0.45 mm filters (Millipore, CA, USA) and then concentrated via Amicon Ultra centrifugal filters (100KD MWCO, Millipore). .. Two days after infection, puromycin (1-μg/ mL) was added for 48-72 hrs to eliminate uninfected cells. siRNAs (GeneChem, Suzhou, China) were transfected using Lipofectamine RNAiMAX (Invitrogen).

    Article Title: AKAP12 deficiency impairs VEGF‐induced endothelial cell migration and sprouting, et al. AKAP12 deficiency impairs VEGF‐induced endothelial cell migration and sprouting
    Article Snippet: To silence VASP expression, Hs_VASP_4 and VASP_9 Flexi Tube siRNA were purchased from Qiagen (Hilden, Germany). .. VASP and control transfections were performed using Lipofectamine RNAiMAX (Thermo Fisher Scientific, Dreieich, Germany) according to the manufacturer's protocol.

    Article Title: A High-Throughput Screen Identifies DYRK1A Inhibitor ID-8 that Stimulates Human Kidney Tubular Epithelial Cell Proliferation
    Article Snippet: Transfection complexes were prepared in Opti-MEM medium using Lipofectamine RNAiMax (Thermo Scientific) and human DYRK1A siRNA (10 nM final concentration, #s4401, Silencer Select; Thermo Scientific), following the manufacturer’s protocol. .. Transfection efficiency was measured by DYRK1A protein expression, and knockdown effects on proliferation were on the basis of the percentage of EdU-labeled cells across tested groups.

    Article Title: Mitochondrial fission factor is a novel Myc-dependent regulator of mitochondrial permeability in cancer
    Article Snippet: Cells were transfected with the various siRNA (30–60 nM) in the presence of Lipofectamine RNAiMAX (Invitrogen) at a 1:1 ratio (vol siRNA 20 μM:vol Lipofectamine RNAiMAX) and processed as described [ ]. .. Individual clones of PC3 and DU145 cells stably expressing MFF-directed shRNA sequences were generated by infection with lentiviral particles, followed by a 2-week selection in the presence of puromycin at 2 μg/ml.

    Article Title: Enhancer-mediated enrichment of interacting JMJD3–DDX21 to ENPP2 locus prevents R-loop formation and promotes transcription
    Article Snippet: For siRNA treatment, cells were transfected by use of Lipofectamine RNAiMax (Invitrogen Thermofisher, Canada). siRNAs targeting JMJD3 (siJMJD3#1 cat no. #SI03181136 and siJMJ3#2 cat no.#SI04133836), DDX21 (siDDX21#1 cat no. #SI04311412 and siDDX21#2 cat no.#SI04155781), UTX (siUTX#1 cat no#SI04306743 and siUTX#2 cat no. #SI04314303), and EZH2 (cat no. #SI02665166) were purchased from QIAGEN (ON, Canada). .. For rescue experiments, HEK293T cells were transfected with siRNA targeting the 3′untranslated region (UTR) of intended mRNA target, followed by expression of siRNA-resistant wild-type or mutants constructs for DDX21 and JMJD3.

    Western Blot:

    Article Title: The differential statin effect on cytokine production of monocytes or macrophages is mediated by differential geranylgeranylation-dependent Rac1 activation
    Article Snippet: Subsequently, 250 µl of the mix was added to 2250 µl cell suspension in 6-well plates (Nunc) for 24 h. LPS (100 ng/ml) was then added for further 24 h. The supernatants were analyzed in ELISA and the cell lysates in Western blot. .. “Lipofectamine® RNAiMAX” (9 µl; ambion™) was added to 150 µl of “OptiMEM®” and 3 µl of the anti-miR (10 µM) was added to another volume of 150 µl “Optimem®”.

    Allele-specific Oligonucleotide:

    Article Title: RNA components of the spliceosome regulate tissue- and cancer-specific alternative splicing
    Article Snippet: .. Transfection was performed in six-well plates using Lipofectamine RNAiMAX (Invitrogen) following the manufacturer's cell line–specific protocols (MCF-7 reverse transfection; HeLa forward transfection), with 200 pmol ASO and 10 µL RNAiMAX reagent per well in a six-well plate. .. Cells were harvested after 48 h. Total RNA was extracted using NucleoSpin miRNA (Macherey-Nagel) to collect the small and large RNA fractions combined.

    Transfection:

    Article Title: RCC2 promotes breast cancer progression through regulation of Wnt signaling and inducing EMT
    Article Snippet: .. Two days after infection, puromycin (1-μg/ mL) was added for 48-72 hrs to eliminate uninfected cells. siRNAs (GeneChem, Suzhou, China) were transfected using Lipofectamine RNAiMAX (Invitrogen). ..

    Article Title: AKAP12 deficiency impairs VEGF‐induced endothelial cell migration and sprouting, et al. AKAP12 deficiency impairs VEGF‐induced endothelial cell migration and sprouting
    Article Snippet: .. VASP and control transfections were performed using Lipofectamine RNAiMAX (Thermo Fisher Scientific, Dreieich, Germany) according to the manufacturer's protocol. .. 4.5 Cell migration (scratch wound assay) Endothelial cells were seeded on 96‐well plates (Ibidi, Martinsried, Germany) coated with fibronectin.

    Article Title: The aryl hydrocarbon receptor–cytochrome P450 1A1 pathway controls lipid accumulation and enhances the permissiveness for hepatitis C virus assembly
    Article Snippet: .. Huh-7 cells were transfected with 30 n m siRNAs consisting of randomized siRNA (si-control) or siRNAs targeting AhR (si-AhR), APOE (si-ApoE), or CYP1A1 and CYP1B1 (ABI) using Lipofectamine RNAiMAX (Invitrogen); transfection was performed twice at a 2-day interval, according to the manufacturer's protocol. .. The sizes of each LD and the number of LDs were quantified with MetaMorph software (Molecular Devices) ( ).

    Article Title: Vitamin D Regulation of the Uridine Phosphorylase 1 Gene and Uridine-Induced DNA Damage in Colon in African Americans and European Americans
    Article Snippet: .. YAMC cells were transfected with UPP1 small interfering RNA (siRNA) using lipofectamine RNAimax (Thermo Fisher Scientific) ( ). .. UPP1 silencing was confirmed by quantitative reverse-transcription PCR ( ).

    Article Title: The differential statin effect on cytokine production of monocytes or macrophages is mediated by differential geranylgeranylation-dependent Rac1 activation
    Article Snippet: Paragraph title: Transfection experiments ... “Lipofectamine® RNAiMAX” (9 µl; ambion™) was added to 150 µl of “OptiMEM®” and 3 µl of the anti-miR (10 µM) was added to another volume of 150 µl “Optimem®”.

    Article Title: BK Polyomavirus Activates the DNA Damage Response To Prolong S Phase
    Article Snippet: .. Reverse transfection into RPTE cells was performed using 10.8 μl/ml Lipofectamine RNAiMax (ThermoFisher) and 10 nM siRNA using a protocol adapted from Jiang et al. ( ). ..

    Article Title: A High-Throughput Screen Identifies DYRK1A Inhibitor ID-8 that Stimulates Human Kidney Tubular Epithelial Cell Proliferation
    Article Snippet: .. Transfection complexes were prepared in Opti-MEM medium using Lipofectamine RNAiMax (Thermo Scientific) and human DYRK1A siRNA (10 nM final concentration, #s4401, Silencer Select; Thermo Scientific), following the manufacturer’s protocol. .. After damage, cells were treated for 24 hours with either DYRK1A siRNA, ID-8 (1 µ M), DYRK1A siRNA+ID-8 (1 µ M), or siRNA negative control (short hairpin RNA).

    Article Title: Mitochondrial fission factor is a novel Myc-dependent regulator of mitochondrial permeability in cancer
    Article Snippet: .. Cells were transfected with the various siRNA (30–60 nM) in the presence of Lipofectamine RNAiMAX (Invitrogen) at a 1:1 ratio (vol siRNA 20 μM:vol Lipofectamine RNAiMAX) and processed as described [ ]. .. Two independent shRNA sequences were also used for targeting human MFF: TRCN0000167581 and TRCN0000343573 (Sigma Aldrich).

    Article Title: The H3K9 Methylation Writer SETDB1 and Its Reader MPP8 Cooperate to Silence Satellite DNA Repeats in Mouse Embryonic Stem Cells
    Article Snippet: .. 2.2. siRNA Transfection HM1 ESCs were seeded in ESCs media to achieve 70–80% confluence and 24 h later were transfected with siRNAs (SETDB1, MPP8 and non-targeting scrambled control) to achieve a final siRNA concentration of 25 pM using the Lipofectamine RNAiMax reagent and OPTIMEM (Life technologies; Waltham, Massachusetts, USA). .. A second round of transfection was performed 24 h later using the same siRNA concentration.

    Article Title: RNA components of the spliceosome regulate tissue- and cancer-specific alternative splicing
    Article Snippet: .. Transfection was performed in six-well plates using Lipofectamine RNAiMAX (Invitrogen) following the manufacturer's cell line–specific protocols (MCF-7 reverse transfection; HeLa forward transfection), with 200 pmol ASO and 10 µL RNAiMAX reagent per well in a six-well plate. .. Cells were harvested after 48 h. Total RNA was extracted using NucleoSpin miRNA (Macherey-Nagel) to collect the small and large RNA fractions combined.

    Article Title: Enhancer-mediated enrichment of interacting JMJD3–DDX21 to ENPP2 locus prevents R-loop formation and promotes transcription
    Article Snippet: .. For siRNA treatment, cells were transfected by use of Lipofectamine RNAiMax (Invitrogen Thermofisher, Canada). siRNAs targeting JMJD3 (siJMJD3#1 cat no. #SI03181136 and siJMJ3#2 cat no.#SI04133836), DDX21 (siDDX21#1 cat no. #SI04311412 and siDDX21#2 cat no.#SI04155781), UTX (siUTX#1 cat no#SI04306743 and siUTX#2 cat no. #SI04314303), and EZH2 (cat no. #SI02665166) were purchased from QIAGEN (ON, Canada). .. For rescue experiments, HEK293T cells were transfected with siRNA targeting the 3′untranslated region (UTR) of intended mRNA target, followed by expression of siRNA-resistant wild-type or mutants constructs for DDX21 and JMJD3.

    Article Title: Activation of type I interferon antiviral response in human neural stem cells
    Article Snippet: Lipofectamine 2000 RNAiMAX (Thermo-Fisher Scientific, MA, USA) was used for transfecting siRNAs. .. The knockdown efficiencies were examined after 72 h of transfection by immunoblot analysis.

    Infection:

    Article Title: RCC2 promotes breast cancer progression through regulation of Wnt signaling and inducing EMT
    Article Snippet: .. Two days after infection, puromycin (1-μg/ mL) was added for 48-72 hrs to eliminate uninfected cells. siRNAs (GeneChem, Suzhou, China) were transfected using Lipofectamine RNAiMAX (Invitrogen). ..

    Article Title: Mitochondrial fission factor is a novel Myc-dependent regulator of mitochondrial permeability in cancer
    Article Snippet: Cells were transfected with the various siRNA (30–60 nM) in the presence of Lipofectamine RNAiMAX (Invitrogen) at a 1:1 ratio (vol siRNA 20 μM:vol Lipofectamine RNAiMAX) and processed as described [ ]. .. Individual clones of PC3 and DU145 cells stably expressing MFF-directed shRNA sequences were generated by infection with lentiviral particles, followed by a 2-week selection in the presence of puromycin at 2 μg/ml.

    Generated:

    Article Title: Mitochondrial fission factor is a novel Myc-dependent regulator of mitochondrial permeability in cancer
    Article Snippet: Cells were transfected with the various siRNA (30–60 nM) in the presence of Lipofectamine RNAiMAX (Invitrogen) at a 1:1 ratio (vol siRNA 20 μM:vol Lipofectamine RNAiMAX) and processed as described [ ]. .. Individual clones of PC3 and DU145 cells stably expressing MFF-directed shRNA sequences were generated by infection with lentiviral particles, followed by a 2-week selection in the presence of puromycin at 2 μg/ml.

    Sequencing:

    Article Title: RCC2 promotes breast cancer progression through regulation of Wnt signaling and inducing EMT
    Article Snippet: Two days after infection, puromycin (1-μg/ mL) was added for 48-72 hrs to eliminate uninfected cells. siRNAs (GeneChem, Suzhou, China) were transfected using Lipofectamine RNAiMAX (Invitrogen). .. The sequence of siRCC2-2 was 5′- AAGGGGCAGCTGGGACATGGT -3′.

    Article Title: Mitochondrial fission factor is a novel Myc-dependent regulator of mitochondrial permeability in cancer
    Article Snippet: An additional siRNA sequence targeting MFF (SantaCruz #SC-94736-A: 5′-GAACAAAGAACGUGCUAAAUUUU-3′) was synthesized by Dharmacon. .. Cells were transfected with the various siRNA (30–60 nM) in the presence of Lipofectamine RNAiMAX (Invitrogen) at a 1:1 ratio (vol siRNA 20 μM:vol Lipofectamine RNAiMAX) and processed as described [ ].

    MTT Assay:

    Article Title: Macrophage migration inhibitory factor regulates mitochondrial dynamics and cell growth of human cancer cell lines through CD74–NF-κB signaling
    Article Snippet: MTT, phosphatase inhibitor mixture, and paraformaldehyde were obtained from Sigma. .. Fetal bovine serum, MitoTracker Red, JC-1, Alexa Fluor 647, Alexa Fluor 488, and Oregon green 488–tagged antibodies, an ATP determination kit, Opti-MEM, and Lipofectamine RNAiMAX were procured from Life Technologies.

    Mutagenesis:

    Article Title: Enhancer-mediated enrichment of interacting JMJD3–DDX21 to ENPP2 locus prevents R-loop formation and promotes transcription
    Article Snippet: Mutant DDX21 S375L/A376E ( , ) was created by site-directed mutagenesis (Civic Bioscience Ltee, QC, Canada). .. For siRNA treatment, cells were transfected by use of Lipofectamine RNAiMax (Invitrogen Thermofisher, Canada). siRNAs targeting JMJD3 (siJMJD3#1 cat no. #SI03181136 and siJMJ3#2 cat no.#SI04133836), DDX21 (siDDX21#1 cat no. #SI04311412 and siDDX21#2 cat no.#SI04155781), UTX (siUTX#1 cat no#SI04306743 and siUTX#2 cat no. #SI04314303), and EZH2 (cat no. #SI02665166) were purchased from QIAGEN (ON, Canada).

    Polymerase Chain Reaction:

    Article Title: Vitamin D Regulation of the Uridine Phosphorylase 1 Gene and Uridine-Induced DNA Damage in Colon in African Americans and European Americans
    Article Snippet: YAMC cells were transfected with UPP1 small interfering RNA (siRNA) using lipofectamine RNAimax (Thermo Fisher Scientific) ( ). .. UPP1 silencing was confirmed by quantitative reverse-transcription PCR ( ).

    Small Interfering RNA:

    Article Title: AKAP12 deficiency impairs VEGF‐induced endothelial cell migration and sprouting, et al. AKAP12 deficiency impairs VEGF‐induced endothelial cell migration and sprouting
    Article Snippet: Paragraph title: Small interfering RNA (siRNA) ... VASP and control transfections were performed using Lipofectamine RNAiMAX (Thermo Fisher Scientific, Dreieich, Germany) according to the manufacturer's protocol.

    Article Title: Vitamin D Regulation of the Uridine Phosphorylase 1 Gene and Uridine-Induced DNA Damage in Colon in African Americans and European Americans
    Article Snippet: .. YAMC cells were transfected with UPP1 small interfering RNA (siRNA) using lipofectamine RNAimax (Thermo Fisher Scientific) ( ). .. UPP1 silencing was confirmed by quantitative reverse-transcription PCR ( ).

    Article Title: A High-Throughput Screen Identifies DYRK1A Inhibitor ID-8 that Stimulates Human Kidney Tubular Epithelial Cell Proliferation
    Article Snippet: Paragraph title: Small Interfering RNA Transfection ... Transfection complexes were prepared in Opti-MEM medium using Lipofectamine RNAiMax (Thermo Scientific) and human DYRK1A siRNA (10 nM final concentration, #s4401, Silencer Select; Thermo Scientific), following the manufacturer’s protocol.

    Article Title: Mitochondrial fission factor is a novel Myc-dependent regulator of mitochondrial permeability in cancer
    Article Snippet: Transfection of plasmid DNA (1 μg) was carried out using 2 μl X-Treme gene HP (Roche) for 24 h. For gene knockdown experiments, tumour cells were transfected with control, non-targeting small interfering RNA (siRNA) pool (D-001810, Dharmacon) or specific siRNA pools targeting MFF (Santa Cruz#sc-94736) or individual MFF-directed siRNA sequences (Santa Cruz #Sc-94,36-A and C). .. Cells were transfected with the various siRNA (30–60 nM) in the presence of Lipofectamine RNAiMAX (Invitrogen) at a 1:1 ratio (vol siRNA 20 μM:vol Lipofectamine RNAiMAX) and processed as described [ ].

    shRNA:

    Article Title: A High-Throughput Screen Identifies DYRK1A Inhibitor ID-8 that Stimulates Human Kidney Tubular Epithelial Cell Proliferation
    Article Snippet: Transfection complexes were prepared in Opti-MEM medium using Lipofectamine RNAiMax (Thermo Scientific) and human DYRK1A siRNA (10 nM final concentration, #s4401, Silencer Select; Thermo Scientific), following the manufacturer’s protocol. .. After damage, cells were treated for 24 hours with either DYRK1A siRNA, ID-8 (1 µ M), DYRK1A siRNA+ID-8 (1 µ M), or siRNA negative control (short hairpin RNA).

    Article Title: Mitochondrial fission factor is a novel Myc-dependent regulator of mitochondrial permeability in cancer
    Article Snippet: Cells were transfected with the various siRNA (30–60 nM) in the presence of Lipofectamine RNAiMAX (Invitrogen) at a 1:1 ratio (vol siRNA 20 μM:vol Lipofectamine RNAiMAX) and processed as described [ ]. .. Two independent shRNA sequences were also used for targeting human MFF: TRCN0000167581 and TRCN0000343573 (Sigma Aldrich).

    Plasmid Preparation:

    Article Title: Mitochondrial fission factor is a novel Myc-dependent regulator of mitochondrial permeability in cancer
    Article Snippet: Transfection of plasmid DNA (1 μg) was carried out using 2 μl X-Treme gene HP (Roche) for 24 h. For gene knockdown experiments, tumour cells were transfected with control, non-targeting small interfering RNA (siRNA) pool (D-001810, Dharmacon) or specific siRNA pools targeting MFF (Santa Cruz#sc-94736) or individual MFF-directed siRNA sequences (Santa Cruz #Sc-94,36-A and C). .. Cells were transfected with the various siRNA (30–60 nM) in the presence of Lipofectamine RNAiMAX (Invitrogen) at a 1:1 ratio (vol siRNA 20 μM:vol Lipofectamine RNAiMAX) and processed as described [ ].

    Article Title: Enhancer-mediated enrichment of interacting JMJD3–DDX21 to ENPP2 locus prevents R-loop formation and promotes transcription
    Article Snippet: The vector RnaseH (#108699) and the plasmid encoding for HA-JMJD3 (#24167) used for analysis of the interactome of JMJD3 were obtained from Addgene (MA, USA). .. For siRNA treatment, cells were transfected by use of Lipofectamine RNAiMax (Invitrogen Thermofisher, Canada). siRNAs targeting JMJD3 (siJMJD3#1 cat no. #SI03181136 and siJMJ3#2 cat no.#SI04133836), DDX21 (siDDX21#1 cat no. #SI04311412 and siDDX21#2 cat no.#SI04155781), UTX (siUTX#1 cat no#SI04306743 and siUTX#2 cat no. #SI04314303), and EZH2 (cat no. #SI02665166) were purchased from QIAGEN (ON, Canada).

    Negative Control:

    Article Title: BK Polyomavirus Activates the DNA Damage Response To Prolong S Phase
    Article Snippet: Silencer Select siRNAs for Wee1 (s21) and Cdk1 (s464) and a nontargeting siRNA (Silencer Select negative control no. 1) were purchased from Ambion (ThermoFisher). .. Reverse transfection into RPTE cells was performed using 10.8 μl/ml Lipofectamine RNAiMax (ThermoFisher) and 10 nM siRNA using a protocol adapted from Jiang et al. ( ).

    Article Title: A High-Throughput Screen Identifies DYRK1A Inhibitor ID-8 that Stimulates Human Kidney Tubular Epithelial Cell Proliferation
    Article Snippet: Transfection complexes were prepared in Opti-MEM medium using Lipofectamine RNAiMax (Thermo Scientific) and human DYRK1A siRNA (10 nM final concentration, #s4401, Silencer Select; Thermo Scientific), following the manufacturer’s protocol. .. After damage, cells were treated for 24 hours with either DYRK1A siRNA, ID-8 (1 µ M), DYRK1A siRNA+ID-8 (1 µ M), or siRNA negative control (short hairpin RNA).

    Selection:

    Article Title: Mitochondrial fission factor is a novel Myc-dependent regulator of mitochondrial permeability in cancer
    Article Snippet: Cells were transfected with the various siRNA (30–60 nM) in the presence of Lipofectamine RNAiMAX (Invitrogen) at a 1:1 ratio (vol siRNA 20 μM:vol Lipofectamine RNAiMAX) and processed as described [ ]. .. Individual clones of PC3 and DU145 cells stably expressing MFF-directed shRNA sequences were generated by infection with lentiviral particles, followed by a 2-week selection in the presence of puromycin at 2 μg/ml.

    In Vitro:

    Article Title: A High-Throughput Screen Identifies DYRK1A Inhibitor ID-8 that Stimulates Human Kidney Tubular Epithelial Cell Proliferation
    Article Snippet: Small interfering RNA (siRNA) transfections were done in 384-well plates following the same experimental design described in the in vitro damage models section. .. Transfection complexes were prepared in Opti-MEM medium using Lipofectamine RNAiMax (Thermo Scientific) and human DYRK1A siRNA (10 nM final concentration, #s4401, Silencer Select; Thermo Scientific), following the manufacturer’s protocol.

    Produced:

    Article Title: RCC2 promotes breast cancer progression through regulation of Wnt signaling and inducing EMT
    Article Snippet: Lentivirus production and oligonucleotide transfection Lentiviruses were produced by transfecting 293T cells with expression plasmids and packaging plasmids (psPAX2 and pMD2.G, Addgene_12260 and Addgene_12259); the supernatants were collected 48 hrs later, filtered through 0.45 mm filters (Millipore, CA, USA) and then concentrated via Amicon Ultra centrifugal filters (100KD MWCO, Millipore). .. Two days after infection, puromycin (1-μg/ mL) was added for 48-72 hrs to eliminate uninfected cells. siRNAs (GeneChem, Suzhou, China) were transfected using Lipofectamine RNAiMAX (Invitrogen).

    Concentration Assay:

    Article Title: A High-Throughput Screen Identifies DYRK1A Inhibitor ID-8 that Stimulates Human Kidney Tubular Epithelial Cell Proliferation
    Article Snippet: .. Transfection complexes were prepared in Opti-MEM medium using Lipofectamine RNAiMax (Thermo Scientific) and human DYRK1A siRNA (10 nM final concentration, #s4401, Silencer Select; Thermo Scientific), following the manufacturer’s protocol. .. After damage, cells were treated for 24 hours with either DYRK1A siRNA, ID-8 (1 µ M), DYRK1A siRNA+ID-8 (1 µ M), or siRNA negative control (short hairpin RNA).

    Article Title: The H3K9 Methylation Writer SETDB1 and Its Reader MPP8 Cooperate to Silence Satellite DNA Repeats in Mouse Embryonic Stem Cells
    Article Snippet: .. 2.2. siRNA Transfection HM1 ESCs were seeded in ESCs media to achieve 70–80% confluence and 24 h later were transfected with siRNAs (SETDB1, MPP8 and non-targeting scrambled control) to achieve a final siRNA concentration of 25 pM using the Lipofectamine RNAiMax reagent and OPTIMEM (Life technologies; Waltham, Massachusetts, USA). .. A second round of transfection was performed 24 h later using the same siRNA concentration.

    Article Title: Activation of type I interferon antiviral response in human neural stem cells
    Article Snippet: Knockdown assay Specific siRNAs (Sigma-Aldrich, MO, USA) were prepared with a concentration of 100 μM using RNase-free distilled water. .. Lipofectamine 2000 RNAiMAX (Thermo-Fisher Scientific, MA, USA) was used for transfecting siRNAs.

    Staining:

    Article Title: Use of small interfering ribonucleic acids to inhibit the adipogenic effect of alcohol on human bone marrow-derived mesenchymal cells
    Article Snippet: Opti-MEM I Reduced Serum Medium and Lipofectamine™ RNAiMAX were purchased from Invitrogen Life Technologies (UK). .. Staining solutions and all other biochemical reagents were obtained from Sigma-Aldrich (UK) unless otherwise stated.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher lipofectamine rnaimax transfection reagent
    Functional validation of gene editing in HEK293-Cas9 cells: HEK293-Cas9 cells were treated with positive control (PC) consisting of a validated Alt-R ® CRISPR-Cas9 crRNA and tracrRNA or nucleic acid constructs delivered into these cells using <t>RNAiMAX</t> reagent. An “untreated cells only” (CO) control was included. A full description of all nucleic acid constructs is provided in Table 1 . Genomic DNA was isolated 48 h <t>post-transfection</t> and assayed for editing at the HPRT locus as described in the Materials and Methods. (A) HPRT site 38087. (B) HPRT site 38285. All samples were tested in triplicate. Shown are the mean and standard deviation (n=3) from all samples.
    Lipofectamine Rnaimax Transfection Reagent, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 90 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lipofectamine rnaimax transfection reagent/product/Thermo Fisher
    Average 90 stars, based on 90 article reviews
    Price from $9.99 to $1999.99
    lipofectamine rnaimax transfection reagent - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    99
    Thermo Fisher mock transfected
    Mitochondria activity, mitochondrial respiratory enzyme, and ATP level of <t>transfected</t> SCs. Chicken SCs were transfected with miR-7450 agomir and antagomir, and miR-7450 agomir-transfected group treated with 22.0 kV of plasma for 120 s. ( A ) Mitochondrial staining in SCs. Scale bar: 50 μm. ( B ) Relative fluorescence intensity for mitochondrial staining. ( C ) NADH level. Activities of ( D ) cytochrome c oxidase and ( E ) ATPase synthase in the mitochondria of SCs. ( F ) ATP level in SCs. ( G ) ATP5A1 mRNA relative level. Data are represented as the mean ± SD (n = 3 per group). * p
    Mock Transfected, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 36 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mock transfected/product/Thermo Fisher
    Average 99 stars, based on 36 article reviews
    Price from $9.99 to $1999.99
    mock transfected - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    Image Search Results


    Functional validation of gene editing in HEK293-Cas9 cells: HEK293-Cas9 cells were treated with positive control (PC) consisting of a validated Alt-R ® CRISPR-Cas9 crRNA and tracrRNA or nucleic acid constructs delivered into these cells using RNAiMAX reagent. An “untreated cells only” (CO) control was included. A full description of all nucleic acid constructs is provided in Table 1 . Genomic DNA was isolated 48 h post-transfection and assayed for editing at the HPRT locus as described in the Materials and Methods. (A) HPRT site 38087. (B) HPRT site 38285. All samples were tested in triplicate. Shown are the mean and standard deviation (n=3) from all samples.

    Journal: Journal of cytokine biology

    Article Title: Chemical Modification of CRISPR gRNAs Eliminate type I Interferon Responses in Human Peripheral Blood Mononuclear Cells

    doi: 10.4172/2576-3881.1000121

    Figure Lengend Snippet: Functional validation of gene editing in HEK293-Cas9 cells: HEK293-Cas9 cells were treated with positive control (PC) consisting of a validated Alt-R ® CRISPR-Cas9 crRNA and tracrRNA or nucleic acid constructs delivered into these cells using RNAiMAX reagent. An “untreated cells only” (CO) control was included. A full description of all nucleic acid constructs is provided in Table 1 . Genomic DNA was isolated 48 h post-transfection and assayed for editing at the HPRT locus as described in the Materials and Methods. (A) HPRT site 38087. (B) HPRT site 38285. All samples were tested in triplicate. Shown are the mean and standard deviation (n=3) from all samples.

    Article Snippet: RPMI, fetal bovine serum (FBS), penicillin-streptomycin, Dulbecco’s phosphate-buffered saline (DPBS; Ca2+ /Mg2+ -free), Hank’s balanced salt solution (HBSS), MEGAclear™ Transcription Clean-Up Kit, Geneticin, Opti-MEM® , and Lipofectamine® RNAiMAX transfection reagent were purchased from Thermo Fisher Scientific (Waltham, MA).

    Techniques: Functional Assay, Positive Control, CRISPR, Construct, Isolation, Transfection, Standard Deviation

    JMJD2A silencing. hiPSCs-derived cardiomyocytes were transfected by means of Lipofectamine ® RNAiMAX with oligonucleotides synthesized by Invitrogen. JMJD2A expression was analyzed by RT-PCR and Western blot. ∗ Means with the same letter are statistically equal under the LSD test with p = 0.05. (A) We observed a reduction in mRNA of JMJD2A after siRNA-JMJD2A. (B) Protein expression of JMJD2A is reduced after siRNA-JMJD2A. The reduction is more intense with siRNA-JMJD2A (2).

    Journal: Frontiers in Genetics

    Article Title: The Histone Demethylase JMJD2A Modulates the Induction of Hypertrophy Markers in iPSC-Derived Cardiomyocytes

    doi: 10.3389/fgene.2018.00014

    Figure Lengend Snippet: JMJD2A silencing. hiPSCs-derived cardiomyocytes were transfected by means of Lipofectamine ® RNAiMAX with oligonucleotides synthesized by Invitrogen. JMJD2A expression was analyzed by RT-PCR and Western blot. ∗ Means with the same letter are statistically equal under the LSD test with p = 0.05. (A) We observed a reduction in mRNA of JMJD2A after siRNA-JMJD2A. (B) Protein expression of JMJD2A is reduced after siRNA-JMJD2A. The reduction is more intense with siRNA-JMJD2A (2).

    Article Snippet: The transfection mixture was prepared in 300 μL of Opti-MEM® medium using 9 μL of Lipofectamine® RNAiMAX (Thermo Fisher 13778100, Waltham, MA, United States), with 100 μM siRNA per well.

    Techniques: Derivative Assay, Transfection, Synthesized, Expressing, Reverse Transcription Polymerase Chain Reaction, Western Blot

    Effect of JMJD2A silencing on BNP expression. hiPSCs-derived cardiomyocytes were transfected by means of Lipofectamine ® RNAiMAX. ET-1 was used to induce hypertrophy in the cells, and BNP expression was analyzed by RT-PCR and Western blot. ∗ Means with the same letter are statistically equal under the LSD test with p = 0.05. (A) We observed a reduction of BNP mRNA after the transfection of siRNA-JMJD2A (2). BNP mRNA expression is partially recover by ET-1. (B) BNP protein expression is reduced after the transfection of siRNA-JMJD2A (2).

    Journal: Frontiers in Genetics

    Article Title: The Histone Demethylase JMJD2A Modulates the Induction of Hypertrophy Markers in iPSC-Derived Cardiomyocytes

    doi: 10.3389/fgene.2018.00014

    Figure Lengend Snippet: Effect of JMJD2A silencing on BNP expression. hiPSCs-derived cardiomyocytes were transfected by means of Lipofectamine ® RNAiMAX. ET-1 was used to induce hypertrophy in the cells, and BNP expression was analyzed by RT-PCR and Western blot. ∗ Means with the same letter are statistically equal under the LSD test with p = 0.05. (A) We observed a reduction of BNP mRNA after the transfection of siRNA-JMJD2A (2). BNP mRNA expression is partially recover by ET-1. (B) BNP protein expression is reduced after the transfection of siRNA-JMJD2A (2).

    Article Snippet: The transfection mixture was prepared in 300 μL of Opti-MEM® medium using 9 μL of Lipofectamine® RNAiMAX (Thermo Fisher 13778100, Waltham, MA, United States), with 100 μM siRNA per well.

    Techniques: Expressing, Derivative Assay, Transfection, Reverse Transcription Polymerase Chain Reaction, Western Blot

    Effect of JMJD2A silencing on BNP expression. hiPSCs-derived cardiomyocytes were transfected by means of Lipofectamine ® RNAiMAX. ET-1 was used to induce hypertrophy in the cells, and BNP expression was analyzed by RT-PCR and Western blot. ∗ Means with the same letter are statistically equal under the LSD test with p = 0.05. (A) We observed a reduction of BNP mRNA after the transfection of siRNA-JMJD2A (2). BNP mRNA expression is partially recover by ET-1. (B) BNP protein expression is reduced after the transfection of siRNA-JMJD2A (2).

    Journal: Frontiers in Genetics

    Article Title: The Histone Demethylase JMJD2A Modulates the Induction of Hypertrophy Markers in iPSC-Derived Cardiomyocytes

    doi: 10.3389/fgene.2018.00014

    Figure Lengend Snippet: Effect of JMJD2A silencing on BNP expression. hiPSCs-derived cardiomyocytes were transfected by means of Lipofectamine ® RNAiMAX. ET-1 was used to induce hypertrophy in the cells, and BNP expression was analyzed by RT-PCR and Western blot. ∗ Means with the same letter are statistically equal under the LSD test with p = 0.05. (A) We observed a reduction of BNP mRNA after the transfection of siRNA-JMJD2A (2). BNP mRNA expression is partially recover by ET-1. (B) BNP protein expression is reduced after the transfection of siRNA-JMJD2A (2).

    Article Snippet: The transfection mixture was prepared in 300 μL of Opti-MEM® medium using 9 μL of Lipofectamine® RNAiMAX (Thermo Fisher 13778100, Waltham, MA, United States), with 100 μM siRNA per well.

    Techniques: Expressing, Derivative Assay, Transfection, Reverse Transcription Polymerase Chain Reaction, Western Blot

    JMJD2A silencing. hiPSCs-derived cardiomyocytes were transfected by means of Lipofectamine ® RNAiMAX with oligonucleotides synthesized by Invitrogen. JMJD2A expression was analyzed by RT-PCR and Western blot. ∗ Means with the same letter are statistically equal under the LSD test with p = 0.05. (A) We observed a reduction in mRNA of JMJD2A after siRNA-JMJD2A. (B) Protein expression of JMJD2A is reduced after siRNA-JMJD2A. The reduction is more intense with siRNA-JMJD2A (2).

    Journal: Frontiers in Genetics

    Article Title: The Histone Demethylase JMJD2A Modulates the Induction of Hypertrophy Markers in iPSC-Derived Cardiomyocytes

    doi: 10.3389/fgene.2018.00014

    Figure Lengend Snippet: JMJD2A silencing. hiPSCs-derived cardiomyocytes were transfected by means of Lipofectamine ® RNAiMAX with oligonucleotides synthesized by Invitrogen. JMJD2A expression was analyzed by RT-PCR and Western blot. ∗ Means with the same letter are statistically equal under the LSD test with p = 0.05. (A) We observed a reduction in mRNA of JMJD2A after siRNA-JMJD2A. (B) Protein expression of JMJD2A is reduced after siRNA-JMJD2A. The reduction is more intense with siRNA-JMJD2A (2).

    Article Snippet: The transfection mixture was prepared in 300 μL of Opti-MEM® medium using 9 μL of Lipofectamine® RNAiMAX (Thermo Fisher 13778100, Waltham, MA, United States), with 100 μM siRNA per well.

    Techniques: Derivative Assay, Transfection, Synthesized, Expressing, Reverse Transcription Polymerase Chain Reaction, Western Blot

    Mitochondria activity, mitochondrial respiratory enzyme, and ATP level of transfected SCs. Chicken SCs were transfected with miR-7450 agomir and antagomir, and miR-7450 agomir-transfected group treated with 22.0 kV of plasma for 120 s. ( A ) Mitochondrial staining in SCs. Scale bar: 50 μm. ( B ) Relative fluorescence intensity for mitochondrial staining. ( C ) NADH level. Activities of ( D ) cytochrome c oxidase and ( E ) ATPase synthase in the mitochondria of SCs. ( F ) ATP level in SCs. ( G ) ATP5A1 mRNA relative level. Data are represented as the mean ± SD (n = 3 per group). * p

    Journal: Scientific Reports

    Article Title: MicroRNA-7450 regulates non-thermal plasma-induced chicken Sertoli cell apoptosis via adenosine monophosphate-activated protein kinase activation

    doi: 10.1038/s41598-018-27123-8

    Figure Lengend Snippet: Mitochondria activity, mitochondrial respiratory enzyme, and ATP level of transfected SCs. Chicken SCs were transfected with miR-7450 agomir and antagomir, and miR-7450 agomir-transfected group treated with 22.0 kV of plasma for 120 s. ( A ) Mitochondrial staining in SCs. Scale bar: 50 μm. ( B ) Relative fluorescence intensity for mitochondrial staining. ( C ) NADH level. Activities of ( D ) cytochrome c oxidase and ( E ) ATPase synthase in the mitochondria of SCs. ( F ) ATP level in SCs. ( G ) ATP5A1 mRNA relative level. Data are represented as the mean ± SD (n = 3 per group). * p

    Article Snippet: At 60–80% confluence, SCs were mock-transfected (Lipofectamine® RNAiMAX Regent only; Thermo Fisher Scientific) or transfected with complexes of Lipofectamine® RNAiMAX, miR-7450 agomir negative control (NC; 50 nM), miR-7450 antagomir NC (100 nM), miR-7450 agomir (chemically-modified double-stranded miRNA mimic; 50 nM) in the presence or absence of non-thermal plasma treatment at 22.0 kV for 120 s, and miR-7450 antagomir (chemically-modified single-stranded miRNA inhibitor; 100 nM) from GenePharma Co., Ltd. (Shanghai, China), according to the manufacturer’s protocol.

    Techniques: Activity Assay, Transfection, Staining, Fluorescence

    Chicken SC protein expression. ( A ) Representative western blot analysis of protein bands in SCs exposed to 22.0 kV of plasma for 120 s. Uncropped immunoblot scans are presented in Supplementary Figure S5 . Relative protein levels of ( B ) NRF2, KEAP1, PRDX4, ( C ) ATP5A, ( D ) p-AMPKα/AMPKα, and ( E ) p-mTOR/mTOR in SCs exposed to plasma. ( F ) Representative western blot analysis of protein bands in SCs trasfected with miR-7450 agomir and antagomir, and miR-7450 agomir-transfected group treated with 22.0 kV of plasma for 120 s. Uncropped immunoblot scans are presented in Supplementary Figure S6 . Relative protein levels of ( G ) ATP5A, ( H ) p-AMPKα/AMPKα, and ( I ) p-mTOR/mTOR in transfected SCs. One independent replicate on western blot analysis of protein bands in SCs is presented in Supplementary Figure S7 . Data are represented as the mean ± SD (n = 3 per group). * p

    Journal: Scientific Reports

    Article Title: MicroRNA-7450 regulates non-thermal plasma-induced chicken Sertoli cell apoptosis via adenosine monophosphate-activated protein kinase activation

    doi: 10.1038/s41598-018-27123-8

    Figure Lengend Snippet: Chicken SC protein expression. ( A ) Representative western blot analysis of protein bands in SCs exposed to 22.0 kV of plasma for 120 s. Uncropped immunoblot scans are presented in Supplementary Figure S5 . Relative protein levels of ( B ) NRF2, KEAP1, PRDX4, ( C ) ATP5A, ( D ) p-AMPKα/AMPKα, and ( E ) p-mTOR/mTOR in SCs exposed to plasma. ( F ) Representative western blot analysis of protein bands in SCs trasfected with miR-7450 agomir and antagomir, and miR-7450 agomir-transfected group treated with 22.0 kV of plasma for 120 s. Uncropped immunoblot scans are presented in Supplementary Figure S6 . Relative protein levels of ( G ) ATP5A, ( H ) p-AMPKα/AMPKα, and ( I ) p-mTOR/mTOR in transfected SCs. One independent replicate on western blot analysis of protein bands in SCs is presented in Supplementary Figure S7 . Data are represented as the mean ± SD (n = 3 per group). * p

    Article Snippet: At 60–80% confluence, SCs were mock-transfected (Lipofectamine® RNAiMAX Regent only; Thermo Fisher Scientific) or transfected with complexes of Lipofectamine® RNAiMAX, miR-7450 agomir negative control (NC; 50 nM), miR-7450 antagomir NC (100 nM), miR-7450 agomir (chemically-modified double-stranded miRNA mimic; 50 nM) in the presence or absence of non-thermal plasma treatment at 22.0 kV for 120 s, and miR-7450 antagomir (chemically-modified single-stranded miRNA inhibitor; 100 nM) from GenePharma Co., Ltd. (Shanghai, China), according to the manufacturer’s protocol.

    Techniques: Expressing, Western Blot, Transfection

    Expression of miR-7450 and mRNA levels of AMPKα and mTOR in SCs. ( A ) miR-7450 relative level and ( B ) relative mRNA levels of AMPKα and mTOR in SCs exposed to 22.0 kV of plasma for 120 s. ( C ) miR-7450 relative level and ( D ) relative mRNA levels of AMPKα and mTOR in SCs transfected with miR-7450 agomir and antagomir, and miR-7450 agomir-transfected group treated with 22.0 kV of plasma for 120 s. RT-PCR analysis of a non-target gene ( POU1F1 ) and an unrelated target gene ( PDE10A ) of miR-7450 in transfected SCs is presented in Supplementary Figure S4 . Data are represented as the mean ± SD (n = 3 per group). * p

    Journal: Scientific Reports

    Article Title: MicroRNA-7450 regulates non-thermal plasma-induced chicken Sertoli cell apoptosis via adenosine monophosphate-activated protein kinase activation

    doi: 10.1038/s41598-018-27123-8

    Figure Lengend Snippet: Expression of miR-7450 and mRNA levels of AMPKα and mTOR in SCs. ( A ) miR-7450 relative level and ( B ) relative mRNA levels of AMPKα and mTOR in SCs exposed to 22.0 kV of plasma for 120 s. ( C ) miR-7450 relative level and ( D ) relative mRNA levels of AMPKα and mTOR in SCs transfected with miR-7450 agomir and antagomir, and miR-7450 agomir-transfected group treated with 22.0 kV of plasma for 120 s. RT-PCR analysis of a non-target gene ( POU1F1 ) and an unrelated target gene ( PDE10A ) of miR-7450 in transfected SCs is presented in Supplementary Figure S4 . Data are represented as the mean ± SD (n = 3 per group). * p

    Article Snippet: At 60–80% confluence, SCs were mock-transfected (Lipofectamine® RNAiMAX Regent only; Thermo Fisher Scientific) or transfected with complexes of Lipofectamine® RNAiMAX, miR-7450 agomir negative control (NC; 50 nM), miR-7450 antagomir NC (100 nM), miR-7450 agomir (chemically-modified double-stranded miRNA mimic; 50 nM) in the presence or absence of non-thermal plasma treatment at 22.0 kV for 120 s, and miR-7450 antagomir (chemically-modified single-stranded miRNA inhibitor; 100 nM) from GenePharma Co., Ltd. (Shanghai, China), according to the manufacturer’s protocol.

    Techniques: Expressing, Transfection, Reverse Transcription Polymerase Chain Reaction

    SC viability and apoptosis after miRNA transfection. Chicken SCs were transfected with miR-7450 agomir and antagomir, and miR-7450 agomir-transfected group treated with 22.0 kV of plasma for 120 s. ( A ) Relative viability of SCs. ( B ) Flow cytometric analysis of SC cell apoptosis. ( C ) JC-1 staining of SCs. Scale bar: 50 μm. ( D ) Relative green/red fluorescence intensity for JC-1 staining. Data are represented as the mean ± SD (n = 3 per group). * p

    Journal: Scientific Reports

    Article Title: MicroRNA-7450 regulates non-thermal plasma-induced chicken Sertoli cell apoptosis via adenosine monophosphate-activated protein kinase activation

    doi: 10.1038/s41598-018-27123-8

    Figure Lengend Snippet: SC viability and apoptosis after miRNA transfection. Chicken SCs were transfected with miR-7450 agomir and antagomir, and miR-7450 agomir-transfected group treated with 22.0 kV of plasma for 120 s. ( A ) Relative viability of SCs. ( B ) Flow cytometric analysis of SC cell apoptosis. ( C ) JC-1 staining of SCs. Scale bar: 50 μm. ( D ) Relative green/red fluorescence intensity for JC-1 staining. Data are represented as the mean ± SD (n = 3 per group). * p

    Article Snippet: At 60–80% confluence, SCs were mock-transfected (Lipofectamine® RNAiMAX Regent only; Thermo Fisher Scientific) or transfected with complexes of Lipofectamine® RNAiMAX, miR-7450 agomir negative control (NC; 50 nM), miR-7450 antagomir NC (100 nM), miR-7450 agomir (chemically-modified double-stranded miRNA mimic; 50 nM) in the presence or absence of non-thermal plasma treatment at 22.0 kV for 120 s, and miR-7450 antagomir (chemically-modified single-stranded miRNA inhibitor; 100 nM) from GenePharma Co., Ltd. (Shanghai, China), according to the manufacturer’s protocol.

    Techniques: Transfection, Flow Cytometry, Staining, Fluorescence